DOCSLIB.ORG

Supplementary Data

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplementary Data A Suppl. Figure 1 A 1.0 p = 0.0192 0.8 0.6 0.4 Proportion Surviving 0.2 Gain Normal 0.0 0122436486072 Months After Esophagectomy B p = 0.034 Below Median Proportion Surviving Above Median Months After Esophagectomy Suppl. Figure 2 Suppl. Figure 3 Suppl. Figure 4 Suppl. Figure 5 A Score 0 Score 1 Score 2 Score 3 N=25, (22.5% of patients) N=53, (47.7% of patients) N=23, (20.7% of patients) N=10, (9.0% of patients) B 60 50 40 30 % of Patients 20 10 0 1 23 Score SUPPLEMENTARY MATERIAL Supplementary methods: Real-time PCR analysis. Real-time PCR analysis for CDK4 expression was performed in 108 tumors using Assays-on-Demand (AOD, Life technologies Corp, Carlsbad, CA). 88ng of cDNA (RNA equivalents) template was used in each qPCR reaction and assays were performed in triplicate. Quantification of CDK4 expression was measured relative to the geometric mean of five endogenous control genes (HMBS, POLRA, TBP, PGK, UCBH). Network-based analysis. Genes that were differently expressed between CDK6-positive and CDK6- negative samples with a p-value < 0.05 and fold-change >0.5 were identified using limma package from bioconductor (1). Network-based analysis was performed using the functional interaction (FI) network (2). Briefly, this consists of 10956 proteins and more than 200,000 curated functional interactions. We calculated pairwise shortest paths among genes of interest in the FI network, hierarchically clustered them based on the average linkage method, and then selected a cluster containing more than 80% altered genes. To calculate a p-value for average shortest path we performed 1000-fold permutation test by randomly selecting the same number of genes from the biggest connected network component. A minimum spanning tree algorithm was used to find linkers and connected all genes of interest in one subnetwork (3). For network clustering we used Markov Cluster Algorithm (MCL) (4) with inflation 1.8. Only clusters with 10 or more genes were taken into account. We used the hypergeometric test to evaluate whether up (or down)-regulated genes were represented more than expected by chance within each cluster. All network diagrams were drawn with Cytoscape (5). The functional enrichment analysis for pathways was based on binominal test. False discovery rate was calculated based on 1000 permutations on all genes in the FI network. siRNA sequences: CDK6, si1: Sense - GUUUGUAACAGAUAUCGAUtt, Antisense - AUCGAUAUCUGUUACAAACtt CDK6, si2: Sense - GCAGAAAUGUUUCGUAGAAtt, Antisense - UUCUACGAAACAUUUCUGCaa CDK4, si1: Sense – UGCUGACUUUUAACCCACAtt, Antisense - UGUGGGUUAAAAGUCAGCAtt CDK4, si2: Sense – CACCCGUGGUUGUUACACUtt, Antisense - AGUGUAACAACCACGGGUGta Construction of Tissue Microarray (TMA): TMAs, containing 38 cases of Barrett’s esophagus (BE), 81 cases of columnar cell metaplasia (CCM), 86 cases of squamous epithelium (SE), 18 cases of low grade dysplasia (LGD), 15 cases of high grade dysplasia (HGD), and 116 cases of EAC, were constructed from the representative areas of formalin-fixed specimens collected between 1997-2005 in the Department of Pathology and Laboratory Medicine, University of Rochester Medical Center/Strong Memorial Hospital, Rochester, New York. Five-micron sections were cut from tissue microarrays and were stained with H&E to confirm the presence of the expected tissue histology within each tissue core. Additional sections were cut for IHC analysis. Patients for Tissue Microarrays: All the 116 patients with esophageal adenocarcinoma used for the tissue microarray construction were treated with esophagectomy in Strong Memorial Hospital/University of Rochester between 1997-2005. These patients included 104 males (89.6%) and 12 females (10.4%). The patient age ranged from 34 to 85 years with a mean of 65 years. Immunohistochemistry. Tissue sections were deparaffinized, rehydrated and incubated with anti-CDK6 antibody (Santa Cruz Biotechnology, Santa Cruz, CA). Sections were then incubated with the secondary antibody (Flex mouse-link, Dako North America, Inc., Carpinteria, CA) followed by Flex-HRP then Flex DAB chromogen and counterstained with hematoxylin. The intensity of the CDK6 immunostaining was scored as follows: score 0, no stain, score 1, weak stain in cytoplasm and/or nucleus (>30% of cells), score 2, moderate stain in cytoplasm and/or nucleus (>30% of cells) and score 3, strong stain in cytoplasm and/or nucleus (>30% of cells). Anchorage-independent growth assay. For anchorage-independence, two layer agarose-containg media were plated in 24-well plates. The first layer (300μl) was McCoy growth medium (Invitrogen) containing 0.8% sea plaque agarose (a gift from Dr. Andrew Bateman, McGill University, Montreal, Canada) and 5% FBS.The second layer contained 3000 cells in McCoy medium containing 0.4% agarose and 7.5% FBS. Colonies were left to grow in 5% CO2 at 37ºC in a humidified incubator for about three weeks. Colonies were counted using an inverted microscope at 4X amplification. Supplementary Table 1: Clinical characteristics of esophageal adenocarcinoma patients. No. of Variable patients Sex Male 95 Female 21 N-Stage N0 48 N1 65 NX 3 Stage T1 36 T2 17 T3 59 T4 2 TX 2 Overall Stage I 28 II 31 III 49 IV 7 Unknown 1 Follow Up (months) Median 26.8 Range 2.3-76.5 Supplementary Table 2: Pathway annotation for two major network clusters identified by MCL algorithm. P-values in the table are calculated based on binominal test and FDR values based on 1000 permutation tests. Only outputs with p-value < 0.05 and FDR<0.05 are listed. In the brackets after pathways we marked the data resource where the pathway was curated: “R” for Reactome, “K” for KEGG, “B” for BioCarta, “P” for Panther, and “N” for NCI-Nature. Cluster Pathway P-Value FDR IDs [HLA-DQB1, ITK, HLA-DRB1, HLA-DMA, <1.000e- 2 TCR signaling (R) 3.42E-14 HLA-DQA1, TRAC, HLA-DPA1, INPP5D, 03 HLA-DRA] [HLA-DQB1, HLA-DRB1, CTSS, HLA- Antigen processing and <5.000e- 2 1.07E-09 DQA1, HLA-DRB4, HLA-DPA1, HLA- presentation (K) 04 DRA] Cell adhesion molecules [HLA-DQB1, HLA-DRB1, HLA-DQA1, 2 8.17E-07 3.33E-04 (K) HLA-DRB4, HLA-DPA1, HLA-DRA] LCK and FYN tyrosine 2 kinases in initiation of 6.43E-06 2.50E-04 [HLA-DRB1, TRAC, HLA-DRA] TCR activation (B) [TRA@, HLA-DMA, HLA-DQA1, HLA- 2 T cell activation (P) 9.14E-06 2.00E-04 DPA1, HLA-DRA] 2 IL 4 signaling pathway (B) 1.25E-05 1.67E-04 [HLA-DRB1, IL2RG, HLA-DRA] IL12-mediated signaling [HLA-DRB1, TRAC, IL2RG, JAK2, HLA- 2 1.58E-05 2.86E-04 events (N) DRA] The co-stimulatory signal 2 3.39E-05 3.75E-04 [HLA-DRB1, TRAC, HLA-DRA] during T-cell activation(B) TCR signaling in naive [ITK, HLA-DRB1, TRAC, INPP5D, HLA- 2 3.58E-05 3.33E-04 CD4+ T cells (N) DRA] Role of mef2d in T-cell 2 6.37E-05 6.00E-04 [HLA-DRB1, TRAC, HLA-DRA] apoptosis (B) Activation of csk by camp- dependent protein kinase 2 2.61E-04 2.82E-03 [HLA-DRB1, TRAC, HLA-DRA] inhibits signaling through the T cell receptor (B) T cell receptor signaling 2 4.59E-04 5.50E-03 [HLA-DRB1, TRAC, HLA-DRA] pathway (B) IL4-mediated signaling 2 7.71E-04 1.05E-02 [IL2RG, JAK2, INPP5D] events (N) Jak-STAT signaling 2 3.07E-03 3.50E-02 [IL7R, IL2RG, JAK2] pathway (K) IL12 signaling mediated 2 3.66E-03 3.66E-02 [HLA-DRB1, HLA-DRA] by STAT4 (N) EPO signaling pathway 2 4.40E-03 3.81E-02 [JAK2, INPP5D] (N) Receptor-ligand <1.000e- [GNGT1, ADRB1, CCR6, GNB2, CXCL9, 3 complexes bind G 3.67E-08 03 CXCL11] proteins(R) Class A/1 (Rhodopsin-like 3 1.23E-04 9.50E-03 [ADRB1, CCR6, CXCL9, CXCL11] receptors)(R) Cytokine-cytokine 3 3.55E-04 1.80E-02 [CCR6, CXCL13, CXCL9, CXCL11] receptor interaction(K) Heterotrimeric G-protein signaling pathway-Gq 3 8.50E-04 2.68E-02 [GNGT1, GNB2, RGS5] alpha and Go alpha mediated pathway (P) 5HT2 type receptor 3 mediated signaling 9.32E-04 2.30E-02 [GNGT1, GNB2] pathway (P) Heterotrimeric G-protein signaling pathway-Gi 3 1.95E-03 3.33E-02 [GNGT1, ADRB1, RGS5] alpha and Gs alpha mediated pathway (P) Supplementary results: Network-analysis of CDK6 amplified versus non-amplified tumors. While the association of amplification and overexpression of CDK6 with poor outcome in patients seems to be readily explained by its important role in regulating the cell cycle, a network-based analysis of genes that are differentially expressed between CDK6 amplified and non-amplified tumors raises another intriguing possibility. It is well known that solid human tumors are often infiltrated by lymphocytes (tumor- infiltrating lymphocytes [TILs]) and T cells have been shown to be mediators of anti-tumor immunity (6). The presence of TILs in esophageal carcinoma is often correlated with improved patient survival (7). In our analysis we found one cluster of genes associated with T-cell signaling and another cluster associated with chemokines and chemokine receptors, several of which are involved in attraction of T and B lymphocytes. Thus it is possible that tumors with increased CDK6 copy number produce less T-cell chemo-attractants, have fewer TIL’s and subsequently, these patients have worse survival. The nature of this observation and correlation with CDK6 amplification is not clear and needs to be experimentally verified. Although there is some evidence that chemokine signaling can influence CDK6 activity via pRB (8), we are not aware of any data suggesting that CDK6 activity can influence chemokine expression. We identified 213 genes (including CDK6) that were differently expressed between CDK6-amplified and CDK6-non-amplified tumor samples. Of these, 111 (52.11%) were in the FI network and hierarchical clustering reduced this to a set of 88 of the most interconnected candidates.
Load more

Recommended publications
  • Genetic Variation Across the Human Olfactory Receptor Repertoire Alters Odor Perception
    bioRxiv preprint doi: https://doi.org/10.1101/212431; this version posted November 1, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Genetic variation across the human olfactory receptor repertoire alters odor perception Casey Trimmer1,*, Andreas Keller2, Nicolle R. Murphy1, Lindsey L. Snyder1, Jason R. Willer3, Maira Nagai4,5, Nicholas Katsanis3, Leslie B. Vosshall2,6,7, Hiroaki Matsunami4,8, and Joel D. Mainland1,9 1Monell Chemical Senses Center, Philadelphia, Pennsylvania, USA 2Laboratory of Neurogenetics and Behavior, The Rockefeller University, New York, New York, USA 3Center for Human Disease Modeling, Duke University Medical Center, Durham, North Carolina, USA 4Department of Molecular Genetics and Microbiology, Duke University Medical Center, Durham, North Carolina, USA 5Department of Biochemistry, University of Sao Paulo, Sao Paulo, Brazil 6Howard Hughes Medical Institute, New York, New York, USA 7Kavli Neural Systems Institute, New York, New York, USA 8Department of Neurobiology and Duke Institute for Brain Sciences, Duke University Medical Center, Durham, North Carolina, USA 9Department of Neuroscience, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania, USA *[email protected] ABSTRACT The human olfactory receptor repertoire is characterized by an abundance of genetic variation that affects receptor response, but the perceptual effects of this variation are unclear. To address this issue, we sequenced the OR repertoire in 332 individuals and examined the relationship between genetic variation and 276 olfactory phenotypes, including the perceived intensity and pleasantness of 68 odorants at two concentrations, detection thresholds of three odorants, and general olfactory acuity.
    [Show full text]
  • Supplemental Data
    1 Supplementary Figure 1. Immunohistochemical distribution of urothelial cells, renal tubular cells, and interstitial cells stained 2 by uroplakin III, kidney specific protein, and vimentin, respectively. Magnification, ×100 (inset x400). Representative 3 micrographs were obtained from normal papillary tissues of CaOx stone formers. 1 Supplementary Table 1. Top 100 upregulated genes in papillary tissue of both Randall’s Plaque and normal mucosa with calcium oxalate stone formers compared to those with control patients. Fold Agilent ID Gene Symbol Description change A_23_P128868 OR11H12 Homo sapiens olfactory receptor, family 11, subfamily H, member 12 (OR11H12), mRNA [NM_001013354] 26.613 Homo sapiens killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 2 (KIR2DS2), mRNA A_23_P130815 KIR2DS2 26.224 [NM_012312] A_24_P402855 PROL1 Homo sapiens proline rich, lacrimal 1 (PROL1), mRNA [NM_021225] 23.733 A_24_P917306 ZNF385D zinc finger protein 385D [Source:HGNC Symbol;Acc:26191] [ENST00000494108] 23.050 A_33_P3260667 OR2T34 Homo sapiens olfactory receptor, family 2, subfamily T, member 34 (OR2T34), mRNA [NM_001001821] 20.948 A_33_P3259440 GOLGA6A Homo sapiens golgin A6 family, member A (GOLGA6A), mRNA [NM_001038640] 20.628 A_33_P3417281 MUC4 Homo sapiens mucin 4, cell surface associated (MUC4), transcript variant 1, mRNA [NM_018406] 20.610 A_24_P239176 MUC4 Homo sapiens mucin 4, cell surface associated (MUC4), transcript variant 1, mRNA [NM_018406] 19.965 A_21_P0006968 SFTA1P Homo sapiens surfactant associated 1, pseudogene
    [Show full text]
  • G Protein-Coupled Receptors
    G PROTEIN-COUPLED RECEPTORS Overview:- The completion of the Human Genome Project allowed the identification of a large family of proteins with a common motif of seven groups of 20-24 hydrophobic amino acids arranged as α-helices. Approximately 800 of these seven transmembrane (7TM) receptors have been identified of which over 300 are non-olfactory receptors (see Frederikson et al., 2003; Lagerstrom and Schioth, 2008). Subdivision on the basis of sequence homology allows the definition of rhodopsin, secretin, adhesion, glutamate and Frizzled receptor families. NC-IUPHAR recognizes Classes A, B, and C, which equate to the rhodopsin, secretin, and glutamate receptor families. The nomenclature of 7TM receptors is commonly used interchangeably with G protein-coupled receptors (GPCR), although the former nomenclature recognises signalling of 7TM receptors through pathways not involving G proteins. For example, adiponectin and membrane progestin receptors have some sequence homology to 7TM receptors but signal independently of G-proteins and appear to reside in membranes in an inverted fashion compared to conventional GPCR. Additionally, the NPR-C natriuretic peptide receptor has a single transmembrane domain structure, but appears to couple to G proteins to generate cellular responses. The 300+ non-olfactory GPCR are the targets for the majority of drugs in clinical usage (Overington et al., 2006), although only a minority of these receptors are exploited therapeutically. Signalling through GPCR is enacted by the activation of heterotrimeric GTP-binding proteins (G proteins), made up of α, β and γ subunits, where the α and βγ subunits are responsible for signalling. The α subunit (tabulated below) allows definition of one series of signalling cascades and allows grouping of GPCRs to suggest common cellular, tissue and behavioural responses.
    [Show full text]
  • Whole Exome Sequencing in Families at High Risk for Hodgkin Lymphoma: Identification of a Predisposing Mutation in the KDR Gene
    Hodgkin Lymphoma SUPPLEMENTARY APPENDIX Whole exome sequencing in families at high risk for Hodgkin lymphoma: identification of a predisposing mutation in the KDR gene Melissa Rotunno, 1 Mary L. McMaster, 1 Joseph Boland, 2 Sara Bass, 2 Xijun Zhang, 2 Laurie Burdett, 2 Belynda Hicks, 2 Sarangan Ravichandran, 3 Brian T. Luke, 3 Meredith Yeager, 2 Laura Fontaine, 4 Paula L. Hyland, 1 Alisa M. Goldstein, 1 NCI DCEG Cancer Sequencing Working Group, NCI DCEG Cancer Genomics Research Laboratory, Stephen J. Chanock, 5 Neil E. Caporaso, 1 Margaret A. Tucker, 6 and Lynn R. Goldin 1 1Genetic Epidemiology Branch, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 2Cancer Genomics Research Laboratory, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 3Ad - vanced Biomedical Computing Center, Leidos Biomedical Research Inc.; Frederick National Laboratory for Cancer Research, Frederick, MD; 4Westat, Inc., Rockville MD; 5Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; and 6Human Genetics Program, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD, USA ©2016 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol.2015.135475 Received: August 19, 2015. Accepted: January 7, 2016. Pre-published: June 13, 2016. Correspondence: [email protected] Supplemental Author Information: NCI DCEG Cancer Sequencing Working Group: Mark H. Greene, Allan Hildesheim, Nan Hu, Maria Theresa Landi, Jennifer Loud, Phuong Mai, Lisa Mirabello, Lindsay Morton, Dilys Parry, Anand Pathak, Douglas R. Stewart, Philip R. Taylor, Geoffrey S. Tobias, Xiaohong R. Yang, Guoqin Yu NCI DCEG Cancer Genomics Research Laboratory: Salma Chowdhury, Michael Cullen, Casey Dagnall, Herbert Higson, Amy A.
    [Show full text]
  • Multi-Functionality of Proteins Involved in GPCR and G Protein Signaling: Making Sense of Structure–Function Continuum with In
    Cellular and Molecular Life Sciences (2019) 76:4461–4492 https://doi.org/10.1007/s00018-019-03276-1 Cellular andMolecular Life Sciences REVIEW Multi‑functionality of proteins involved in GPCR and G protein signaling: making sense of structure–function continuum with intrinsic disorder‑based proteoforms Alexander V. Fonin1 · April L. Darling2 · Irina M. Kuznetsova1 · Konstantin K. Turoverov1,3 · Vladimir N. Uversky2,4 Received: 5 August 2019 / Revised: 5 August 2019 / Accepted: 12 August 2019 / Published online: 19 August 2019 © Springer Nature Switzerland AG 2019 Abstract GPCR–G protein signaling system recognizes a multitude of extracellular ligands and triggers a variety of intracellular signal- ing cascades in response. In humans, this system includes more than 800 various GPCRs and a large set of heterotrimeric G proteins. Complexity of this system goes far beyond a multitude of pair-wise ligand–GPCR and GPCR–G protein interactions. In fact, one GPCR can recognize more than one extracellular signal and interact with more than one G protein. Furthermore, one ligand can activate more than one GPCR, and multiple GPCRs can couple to the same G protein. This defnes an intricate multifunctionality of this important signaling system. Here, we show that the multifunctionality of GPCR–G protein system represents an illustrative example of the protein structure–function continuum, where structures of the involved proteins represent a complex mosaic of diferently folded regions (foldons, non-foldons, unfoldons, semi-foldons, and inducible foldons). The functionality of resulting highly dynamic conformational ensembles is fne-tuned by various post-translational modifcations and alternative splicing, and such ensembles can undergo dramatic changes at interaction with their specifc partners.
    [Show full text]
  • Misexpression of Cancer/Testis (Ct) Genes in Tumor Cells and the Potential Role of Dream Complex and the Retinoblastoma Protein Rb in Soma-To-Germline Transformation
    Michigan Technological University Digital Commons @ Michigan Tech Dissertations, Master's Theses and Master's Reports 2019 MISEXPRESSION OF CANCER/TESTIS (CT) GENES IN TUMOR CELLS AND THE POTENTIAL ROLE OF DREAM COMPLEX AND THE RETINOBLASTOMA PROTEIN RB IN SOMA-TO-GERMLINE TRANSFORMATION SABHA M. ALHEWAT Michigan Technological University, [email protected] Copyright 2019 SABHA M. ALHEWAT Recommended Citation ALHEWAT, SABHA M., "MISEXPRESSION OF CANCER/TESTIS (CT) GENES IN TUMOR CELLS AND THE POTENTIAL ROLE OF DREAM COMPLEX AND THE RETINOBLASTOMA PROTEIN RB IN SOMA-TO- GERMLINE TRANSFORMATION", Open Access Master's Thesis, Michigan Technological University, 2019. https://doi.org/10.37099/mtu.dc.etdr/933 Follow this and additional works at: https://digitalcommons.mtu.edu/etdr Part of the Cancer Biology Commons, and the Cell Biology Commons MISEXPRESSION OF CANCER/TESTIS (CT) GENES IN TUMOR CELLS AND THE POTENTIAL ROLE OF DREAM COMPLEX AND THE RETINOBLASTOMA PROTEIN RB IN SOMA-TO-GERMLINE TRANSFORMATION By Sabha Salem Alhewati A THESIS Submitted in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE In Biological Sciences MICHIGAN TECHNOLOGICAL UNIVERSITY 2019 © 2019 Sabha Alhewati This thesis has been approved in partial fulfillment of the requirements for the Degree of MASTER OF SCIENCE in Biological Sciences. Department of Biological Sciences Thesis Advisor: Paul Goetsch. Committee Member: Ebenezer Tumban. Committee Member: Zhiying Shan. Department Chair: Chandrashekhar Joshi. Table of Contents List of figures .......................................................................................................................v
    [Show full text]
  • GNB2 Rabbit Polyclonal Antibody – TA590202 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TA590202 GNB2 Rabbit Polyclonal Antibody Product data: Product Type: Primary Antibodies Applications: ELISA, IHC, WB Recommended Dilution: WB 1:20000, IHC 1:150,ELISA 1:100-1:2000 Reactivity: Human Host: Rabbit Isotype: IgG Clonality: Polyclonal Immunogen: DNA immunization. This antibody is specific for the N Terminus Region of the target protein. Formulation: 20 mM Potassium Phosphate, 150 mM Sodium Chloride, pH 7.0 Concentration: 0.99197 mg/ml Purification: Purified from mouse ascites fluids or tissue culture supernatant by affinity chromatography (protein A/G) Conjugation: Unconjugated Storage: Store at -20°C as received. Stability: Stable for 12 months from date of receipt. Gene Name: G protein subunit beta 2 Database Link: NP_005264 Entrez Gene 2783 Human P62879 Background: Heterotrimeric guanine nucleotide-binding proteins (G proteins), which integrate signals between receptors and effector proteins, are composed of an alpha, a beta, and a gamma subunit. These subunits are encoded by families of related genes. This gene encodes a beta subunit. Beta subunits are important regulators of alpha subunits, as well as of certain signal transduction receptors and effectors. This gene contains a trinucleotide (CCG) repeat length polymorphism in its 5' UTR. Synonyms: beta-2 subunit; G(S); G(T) beta subunit 2; G protein; guanine nucleotide-binding protein; guanine nucleotide-binding protein G(I); OTTHUMP00000174601; OTTHUMP00000174602; signal-transducing guanine nucleotide-binding regulatory protein beta This product is to be used for laboratory only.
    [Show full text]
  • WO 2019/068007 Al Figure 2
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization I International Bureau (10) International Publication Number (43) International Publication Date WO 2019/068007 Al 04 April 2019 (04.04.2019) W 1P O PCT (51) International Patent Classification: (72) Inventors; and C12N 15/10 (2006.01) C07K 16/28 (2006.01) (71) Applicants: GROSS, Gideon [EVIL]; IE-1-5 Address C12N 5/10 (2006.0 1) C12Q 1/6809 (20 18.0 1) M.P. Korazim, 1292200 Moshav Almagor (IL). GIBSON, C07K 14/705 (2006.01) A61P 35/00 (2006.01) Will [US/US]; c/o ImmPACT-Bio Ltd., 2 Ilian Ramon St., C07K 14/725 (2006.01) P.O. Box 4044, 7403635 Ness Ziona (TL). DAHARY, Dvir [EilL]; c/o ImmPACT-Bio Ltd., 2 Ilian Ramon St., P.O. (21) International Application Number: Box 4044, 7403635 Ness Ziona (IL). BEIMAN, Merav PCT/US2018/053583 [EilL]; c/o ImmPACT-Bio Ltd., 2 Ilian Ramon St., P.O. (22) International Filing Date: Box 4044, 7403635 Ness Ziona (E.). 28 September 2018 (28.09.2018) (74) Agent: MACDOUGALL, Christina, A. et al; Morgan, (25) Filing Language: English Lewis & Bockius LLP, One Market, Spear Tower, SanFran- cisco, CA 94105 (US). (26) Publication Language: English (81) Designated States (unless otherwise indicated, for every (30) Priority Data: kind of national protection available): AE, AG, AL, AM, 62/564,454 28 September 2017 (28.09.2017) US AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, BZ, 62/649,429 28 March 2018 (28.03.2018) US CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, (71) Applicant: IMMP ACT-BIO LTD.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name olfactory receptor, family 6, subfamily C, member 2 Gene Symbol OR6C2 Organism Human Gene Summary Olfactory receptors interact with odorant molecules in the nose to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. Gene Aliases OR6C67 RefSeq Accession No. NC_000012.11, NT_029419.12 UniGene ID Hs.524483 Ensembl Gene ID ENSG00000179695 Entrez Gene ID 341416 Assay Information Unique Assay ID qHsaCED0047379 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000322678 Amplicon Context Sequence TGGGGGACAATACCATTACCTACAATGCTTGTGCCAGTCAAATATTCTTTGTTATT CTCTTTGGAGCAACAGAATTTTTTCTCTTGGCAGCCATGTCCTA Amplicon Length (bp) 70 Chromosome Location 12:55846251-55846350 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 95 R2 0.9997 cDNA Cq 32.98 Page 1/5 PrimePCR™Assay Validation Report cDNA Tm (Celsius) 76.5 gDNA Cq 24.34 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this
    [Show full text]
  • Supplementary Table 2
    Supplementary Table S2. List of Analyzed Candidate Genes GI sequence putative gene symbol gene name number analysis function Akap3 A kinase (PRKA) anchor protein 3 6753025 ORF signaling Tmem16b transmembrane protein 16B 23956389 whole mRNA unknown Atp6v1e1 ATPase, H+ transporting, V1 subunit E isoform 1 45504358 ORF ion transporter Adipor2 Adiponectin receptor 2 39841015 whole mRNA metabolism Bcap37 B-cell receptor-associated protein 37 6671621 ORF signaling Cacna1c calcium channel, voltage-dependent, L type, alpha 1C 6753227 ORF signal transduction LOC245882 similar to voltage-gated calcium channel alpha(2)delta-4 28544679 whole mRNA signal transduction 5730412N02Rik similar to voltage-gated calcium channel alpha(2)delta-4 28544677 whole mRNA signal transduction Cacna2d4 similar to voltage-gated calcium channel alpha(2)delta-4 55832799 whole gene signal transduction AB114826 beta 1,4-N-acetylgalactosaminyltransferase-transferase-III 38566699 whole mRNA adhesion Clecs8 carbohydrate recognition domain lectin, superfamily member 8 4159800 ORF adhesion Clecsf9 carbohydrate recognition domain lectin, superfamily member 9 13096843 ORF adhesion Cops7a COP9 constitutive photomorphogenic 7242141 ORF adhesion Cs3 Calsynthenin -3 32822766 ORF adhesion Edr1 early development regulator1 6681270 ORF transcription factor Eno2 Enolase2 55494 ORF transcription factor Fhx Mus musculus fork head transcription factor 11118639 ORF transcription factor Fbxl14 F-box and leucine-rich repeat protein 14 19527157 whole mRNA ubiquitin cycle Gabt2 solute carrier
    [Show full text]
  • NIH Public Access Author Manuscript Alcohol
    NIH Public Access Author Manuscript Alcohol. Author manuscript; available in PMC 2014 November 01. NIH-PA Author ManuscriptPublished NIH-PA Author Manuscript in final edited NIH-PA Author Manuscript form as: Alcohol. 2013 November ; 47(7): . doi:10.1016/j.alcohol.2013.07.002. Stress-response pathways are altered in the hippocampus of chronic alcoholics Jeanette N. McClinticka, Xiaoling Xueia, Jay A. Tischfieldb, Alison Goatec, Tatiana Foroudd, Leah Wetherilld,e, Marissa A. Ehringerf,g, and Howard J. Edenberga,d,* aDepartment of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, IN 46202, USA bDepartment of Genetics, Rutgers University, Piscataway, NJ 08854, USA cDepartment of Psychiatry, School of Medicine, Washington University in St. Louis, St. Louis, MO 63110, USA dDepartment of Medical and Molecular Genetics, Indiana University School of Medicine, Indianapolis, IN 46202, USA eDepartment of Psychology, IUPUI School of Science, Indianapolis, IN 46202, USA fInstitute for Behavioral Genetics, University of Colorado, Boulder, CO 80309, USA gDepartment of Integrative Physiology, University of Colorado, Boulder, CO 80309, USA Abstract The chronic high-level alcohol consumption seen in alcoholism leads to dramatic effects on the hippocampus, including decreased white matter, loss of oligodendrocytes and other glial cells, and inhibition of neurogenesis. Examining gene expression in post mortem hippocampal tissue from 20 alcoholics and 19 controls allowed us to detect differentially expressed genes that may play a role in the risk for alcoholism or whose expression is modified by chronic consumption of alcohol. We identified 639 named genes whose expression significantly differed between alcoholics and controls at a False Discovery Rate (FDR) ≤ 0.20; 52% of these genes differed by at least 1.2-fold.
    [Show full text]
  • Chr CNV Start CNV Stop Gene Gene Feature 1 37261312 37269719
    chr CNV start CNV stop Gene Gene feature 1 37261312 37269719 Tmem131 closest upstream gene 1 37261312 37269719 Cnga3 closest downstream gene 1 41160869 41180390 Tmem182 closest upstream gene 1 41160869 41180390 2610017I09Rik closest downstream gene 1 66835123 66839616 1110028C15Rik in region 2 88714200 88719211 Olfr1206 closest upstream gene 2 88714200 88719211 Olfr1208 closest downstream gene 2 154840037 154846228 a in region 3 30065831 30417157 Mecom closest upstream gene 3 30065831 30417157 Arpm1 closest downstream gene 3 35476875 35495913 Sox2ot closest upstream gene 3 35476875 35495913 Atp11b closest downstream gene 3 39563408 39598697 Fat4 closest upstream gene 3 39563408 39598697 Intu closest downstream gene 3 94246481 94410611 Celf3 in region 3 94246481 94410611 Mrpl9 in region 3 94246481 94410611 Riiad1 in region 3 94246481 94410611 Snx27 in region 3 104311901 104319916 Lrig2 in region 3 144613709 144619149 Clca6 in region 3 144613709 144619149 Clca6 in region 4 108673 137301 Vmn1r2 closest downstream gene 4 3353037 5882883 6330407A03Rik in region 4 3353037 5882883 Chchd7 in region 4 3353037 5882883 Fam110b in region 4 3353037 5882883 Impad1 in region 4 3353037 5882883 Lyn in region 4 3353037 5882883 Mos in region 4 3353037 5882883 Penk in region 4 3353037 5882883 Plag1 in region 4 3353037 5882883 Rps20 in region 4 3353037 5882883 Sdr16c5 in region 4 3353037 5882883 Sdr16c6 in region 4 3353037 5882883 Tgs1 in region 4 3353037 5882883 Tmem68 in region 4 5919294 6304249 Cyp7a1 in region 4 5919294 6304249 Sdcbp in region 4 5919294
    [Show full text]