Caesalpinia Mimosoides Leaf Extract Promotes Neurite Outgrowth and Inhibits BACE1 Activity in Mutant APP-Overexpressing Neuronal Neuro2a Cells

pharmaceuticals

Article Caesalpinia mimosoides Leaf Extract Promotes Neurite Outgrowth and Inhibits BACE1 Activity in Mutant APP-Overexpressing Neuronal Neuro2a Cells

Panthakarn Rangsinth 1 , Chatrawee Duangjan 1, Chanin Sillapachaiyaporn 1 , Ciro Isidoro 2 , Anchalee Prasansuklab 3,4,* and Tewin Tencomnao 3,5,*

1 Graduate Program in Clinical Biochemistry and Molecular Medicine, Department of Clinical Chemistry, Faculty of Allied Health Sciences, Chulalongkorn University, Bangkok 10330, Thailand; [email protected] (P.R.); [email protected] (C.D.); [email protected] (C.S.) 2 Department of Health Sciences, Università del Piemonte Orientale “A. Avogadro”, Via Solaroli 17, 28100 Novara, Italy; [email protected] 3 Natural Products for Neuroprotection and Anti-Ageing Research Unit, Chulalongkorn University, Bangkok 10330, Thailand 4 College of Public Health Sciences, Chulalongkorn University, Bangkok 10330, Thailand 5 Department of Clinical Chemistry, Faculty of Allied Health Sciences, Chulalongkorn University, Bangkok 10330, Thailand * Correspondence: [email protected] (A.P.); [email protected] (T.T.); Tel.: +66-2218-8048 (A.P.); +66-2218-1533 (T.T.)

Citation: Rangsinth, P.; Duangjan, C.; Sillapachaiyaporn, C.; Isidoro, C.; Abstract: Alzheimer’s disease (AD) is implicated in the imbalance of several proteins, including Prasansuklab, A.; Tencomnao, T. Amyloid-β (Aβ), amyloid precursor protein (APP), and BACE1. APP overexpression interferes with Caesalpinia mimosoides Leaf Extract neurite outgrowth, while BACE1 plays a role in Aβ generation. Medicinal herbs with effects on Promotes Neurite Outgrowth and neurite outgrowth stimulation and BACE1 inhibition may beneﬁt AD. This study aimed to investigate Inhibits BACE1 Activity in Mutant the neurite outgrowth stimulatory effect, along with BACE1 inhibition of Caesalpinia mimosoides APP-Overexpressing Neuronal (CM), using wild-type (Neuro2a) and APP (Swedish mutant)-overexpressing (Neuro2a/APPSwe) Pharmaceuticals Neuro2a Cells. 2021, neurons. The methanol extract of CM leaves stimulated neurite outgrowth in wild-type and APP- 14, 901. https://doi.org/10.3390/ overexpressing cells. After exposure to the extract, the mRNA expression of the neurite outgrowth ph14090901 activation genes growth-associated protein-43 (GAP-43) and teneurin-4 (Ten-4) was increased in both

Academic Editors: Simona Sestito, Neuro2a and Neuro2a/APPSwe cells, while the mRNA expression of neurite outgrowth negative Simona Rapposelli and regulators Nogo receptor (NgR) and Lingo-1 was reduced. Additionally, the extract suppressed 0 Massimiliano Runfola BACE1 activity in the APP-overexpressing neurons. Virtual screening demonstrated that quercetin-3 - glucuronide, quercetin-3-O-glucoside, clausarinol, and theogallin were possible inhibitors of BACE1. Received: 9 August 2021 ADMET was analyzed to predict drug-likeness properties of CM-constituents. These results suggest Accepted: 31 August 2021 that CM extract promotes neurite outgrowth and inhibits BACE1 activity in APP-overexpressing Published: 4 September 2021 neurons. Thus, CM may serve as a source of drugs for AD treatment. Additional studies for full identification of bioactive constituents and to confirm the neuritogenesis in vivo are needed for Publisher’s Note: MDPI stays neutral translation into clinic of the present findings. with regard to jurisdictional claims in published maps and institutional affil- Keywords: Alzheimer’s disease; neurodegenerative diseases; Neuro2a/APPSwe; neuritogenesis; iations. amyloid precursor protein; BACE1; molecular docking; ADMET analysis

Copyright: © 2021 by the authors. 1. Introduction Licensee MDPI, Basel, Switzerland. Alzheimer’s disease (AD) is a progressive neurodegenerative disease and the most This article is an open access article common form of dementia among elder people; it seriously affects a person’s memory and distributed under the terms and ability to carry out daily activities. An effective treatment for AD is still not available. AD is conditions of the Creative Commons Attribution (CC BY) license (https:// characterized by loss of neurons and synapses in the brain, particularly in the hippocampus creativecommons.org/licenses/by/ area. The cause of this disease is not fully understood. It is believed that the disease process 4.0/). is associated with the accumulation of amyloid-β (Aβ) peptide generated by the cleavage

Pharmaceuticals 2021, 14, 901. https://doi.org/10.3390/ph14090901 https://www.mdpi.com/journal/pharmaceuticals Pharmaceuticals 2021, 14, 901 2 of 24

of amyloid precursor protein (APP) by beta-secretase (BACE-1) in the amyloidogenic pathway [1,2]. The disease process is associated with hyperphosphorylated tau protein, a microtubule assembly protein accumulating intracellularly as neurofibrillary tangles (NFTs) and Aβ peptide deposited in diffuse and neuritic plaques in the brain [3]. Both tangles and plaques are found in the brains of individuals afflicted by AD [4,5]. It is still unclear what are the causes leading to abnormal hyperphosphorylation of tau and whether Aβ accumulation occurs due to its overproduction or a defect in the clearance [6–8]. Aβ, a hallmark protein found in patients with AD, arises from a protein called amyloid precursor protein (APP) that is processed via β- and γ-secretase cleavage [9]. The mutation in APP gene also influences Aβ level in the brain. The well-known Swedish mutation in APP has been reported to increase Aβ production and secretion [10,11]. More- over, overexpression of APP has been reported to inhibit cell differentiation and neurite outgrowth in cultured Neuro2a cells [12]. Therefore, the therapeutic intervention of AD by inducing neuroregeneration or neurite outgrowth should also consider the condition of APP overexpression. The reconstruction of the neuronal and synaptic networks for the recovery of brain functions is a potential therapeutic strategy for AD. One of the neuro-regeneration processes is neuritogenesis or neurite outgrowth, which is a branching of neurites followed by elongation of axons and dendrites in maturing neuron [13]. This process is an important step to construct the functional networks of neurons and is considered a hallmark of neuronal differentiation [14]. Previous findings have shown that overexpression and mutation of APP have an inhibitory influence on neurite outgrowth [12,15]. Moreover, recent study showed that overexpressing APP with the Swedish mutation results in a physical interaction between APP and the negative neurite outgrowth regulator Lingo-1 [16]. Leucine rich repeat and immunoglobin-like domain-containing protein 1 (Lingo-1) is a transmembrane protein highly expressed in the brain. Lingo-1 has been implicated in several neurodegenerative diseases, including AD [17,18]. Its action remarkably relates to the Nogo receptor (NgR) as part of a co-receptor complex leading to activation of rho- associated coiled coil-containing protein kinase (RhoA/ROCK) signaling pathway, which subsequently suppresses the development of growth cones and axon [19,20]. Typically, neurite outgrowth can be induced by several neurotrophic factors, including nerve growth factor (NGF) and brain-derived neurotrophic factor (BDNF) [21,22]. Unfortunately, NGF level is found to decrease during aging [23–25]. Moreover, NGF is a large polypeptide that cannot pass the blood–brain barrier [26,27], so the treatment using NGF must be given directly to the brain [28]. Hence, searching for novel small molecules with neurite outgrowth promoting activity may constitute an alternative therapy for AD. Importantly, these molecules should also exert the effect even in neurons with APP overexpression, the condition mimicking AD pathology. In recent years, medicinal plant-derived natural compounds have received exten- sive attention as major sources of new therapeutic agents for treating neurodegenerative diseases and neurological disorders. Many of them have been shown to exert their neurotrophic effects by promoting neurite outgrowth [29–31]. Caesalpinia mimosoides Lam., a small spiny and woody climbing tropical trees be- longing to Fabaceae family and Caesalpinioideae subfamily, is native to Southeast Asia and to Northern and Northeastern parts of Thailand. Young twigs and leaves are edible and are traditionally used as an anti-flatulent and a remedy against fainting and dizzi- ness [32]. The plant has been reported to exhibit antioxidant [32,33], anti-inflammatory [34], anti-cancer [35], and anti-aging activities [33]. Moreover, C. mimosoides contains several bioactive compounds, including gallic acid [35] and quercetin [36], that have been previously reported to have neurite outgrowth activity [37–39]. Recently, quercetin isolated from C. mimosoides was shown to possess neurite outgrowth and neuroprotective properties against acetylcholinesterase (AChE) in cultured P19-derived neurons [36]. However, the Pharmaceuticals 2021, 14, 901 3 of 24

Pharmaceuticals 2021, 14, 901 3 of 24

against acetylcholinesterase (AChE) in cultured P19-derived neurons [36]. However, the neurite outgrowth stimulatory and BACE1 inhibitory effect of this plant on neuronal cells overexpressingneurite outgrowth APP stimulatoryhas not been and investigated. BACE1 inhibitory effect of this plant on neuronal cells overexpressing APP has not been investigated. In this study, the effect of APP overexpression on neurite outgrowth was investi- In this study, the effect of APP overexpression on neurite outgrowth was investigated, gated, along with the reversing effect of C. mimosoided (CM) extract against APP-overex- along with the reversing effect of C. mimosoided (CM) extract against APP-overexpressing pressing neuronal cells. Swedish mutant APP-overexpressing Neuro2a neuronal cells. Swedish mutant APP-overexpressing Neuro2a (Neuro2a/APPSwe) cells (Neuro2a/APPSwe) cells were employed for comparison with Neuro2a cells expressing were employed for comparison with Neuro2a cells expressing wild-type APP [40,41]. wild-type APP [40,41]. The mechanisms underlying the activity of CM extract were exam- The mechanisms underlying the activity of CM extract were examined by studying the ined by studying the expression of several signaling molecules involved in neurite out- expression of several signaling molecules involved in neurite outgrowth. Moreover, the growth. Moreover, the effect of CM extract on BACE1 inhibition was investigated in the effect of CM extract on BACE1 inhibition was investigated in the cells along with in cells along with in silico approaches. Furthermore, drug-likeliness, bioavailability, and silico approaches. Furthermore, drug-likeliness, bioavailability, and toxicity of the CM- toxicity of the CM-constituents were predicted using ADMET analysis. constituents were predicted using ADMET analysis.

2.2. Results Results 2.1.2.1. Quantification Quantification of ofGallic Gallic Acid Acid and and Quercetin Quercetin Previously,Previously, we we have have reported reported the the phytochemical phytochemical profiling profiling by by LC LC-MS-MS of of CM CM methanol methanol extractextract used used in inthe the current current study study [33]. [ 33The]. major The major compounds compounds in the inextract the extractincluded included gallic acidgallic and acid quercetin, and quercetin, which which were were shown shown to possess to possess neurite neurite outgrowth outgrowth activity activity [36 [36–39–39]. ]. Hence,Hence, the the amount amount of of these these compounds compounds was was quantified. quantified. The The HPLC HPLC chromatogram chromatogram of of CM CM methanolmethanol extract extract showed showed peaks representing representing gallic gallic acid acid and and quercetin quercetin at the at the retention retention time timeof 11.56 of 11.56 and and 41.73 41.73 min, min, respectively respectively (Figure (Figure1). 1 Based). Based on on the the calculations calculations of of the the external exter- nalstandard, standard, the the methanol methanol extract extract contained contained gallic gallic acid acid and and quercetin quercetin at 7815.17at 7815.17± 25.09 ± 25.09 mg mgand and 36.33 36.33± ±0.51 0.51 mg mg of of compounds compounds per per 100 100 g g crude crude extract, extract, respectively. respectively.

FigureFigure 1. 1. HPLCHPLC chromatogram. chromatogram. Gallic Gallic acid acid and and quercetin quercetin in in CM CM methanol methanol extract extract were were quantified quantiﬁed using using HPLC HPLC analysis. analysis. TheThe peaks peaks at at the the retention retention time time of of 11.56 11.56 and and 41.73 41.73 min min represented represented as as gallic gallic acid acid and and quercetin, quercetin, respectively. respectively.

2.2.2.2. Selection Selection of ofCM CM Extract Extract Concentration Concentration ToTo select select the the optimal optimal concentration concentration of CM of CM methanol methanol extract, extract, an MTT an MTTassay assaywas em- was ployedemployed to assess to assess cellular cellular toxicity toxicity of the ofextract the extract at a series at a of series different of different concentration. concentration. After treatmentAfter treatment of Neuro2a of Neuro2a and Neuro2a/APPSwe and Neuro2a/APPSwe cells with cells the with various the variousconcentrations concentrations (1, 10, 25,(1, 50, 10, and 25, 100 50, andµg/mL) 100 ofµg/mL) CM extract of CM for extract 48 h, a for concentration 48 h, a concentration-dependent-dependent toxicity effect toxicity in botheffect neuronal in both cell neuronal lines with cell linesmore with than more 50% thanreduction 50% reductionof viable cells of viable at the cells high at concen- the high traconcentrationstions tested (25, tested 50 and (25, 100 50 andµg/mL) 100 µwasg/mL) observed was observed.. The maximum The maximum concentration concentration of the extractof the that extract produced that produced acceptable acceptable toxicity toxicitywith a minimum with a minimum cell viability cell viability of 90% ofin 90%both in Neuro2aboth Neuro2a and Neuro2a/APPSwe and Neuro2a/APPSwe cells was cells found was at found 10 µg at/mL 10 µ(94.08g/mL ± (94.084.98% ±and4.98% 93.78 and ± 5.5693.78%, respectively)± 5.56%, respectively) (Figure 2A, (FigureB). According2A,B). According to these results, to these 10 results, µg/mL 10of CMµg/mL methanol of CM extractmethanol was, extract therefore was,, selected therefore, for selectedsubsequent for subsequentexperiments. experiments.

PharmaceuticaPharmaceuticalsls 2021,, 14,, 901 901 44 of of 24 24

FigureFigure 2. 2. MTTMTT assay. assay. Cell Cell viability viability of of(A ()A Neuro2a) Neuro2a and and (B) (Neuro2a/APPSweB) Neuro2a/APPSwe cells cells after after treatment treatment with withthe various the various con- centrationsconcentrations of CM of CMextract extract for 48 for h. 48 The h. The extract extract concentration concentration of 10 of µg 10/mLµg/mL with with more more than than 90% 90% cell cellsurvival survival was was chosen chosen as theasthe test test concentration concentration for forsubsequent subsequent experiments. experiments.

2.3.2.3. Effects Effects of of CM CM Extract Extract on on Neurite Neurite Out Outgrowthgrowth Activity Activity SSerumerum deprivation isis aa condition condition for for inducing inducing neurite neurite outgrowth outgrowth in Neuro2ain Neuro2a cells cells [42]. [42].Therefore, Therefore, we investigated we investigated neurite outgrowth neurite activity outgrowth of Neuro2a activity and of Neuro2a/APPSwe Neuro2a and Neuro2a/APPSwecells after treatment cells in 1%after FBS treatment differentiation in 1% FBS medium differentiation (with or medium without CM(with extract). or witho Theut CMcomplete extract). medium The complete containing medium 10% containing FBS was used 10% asFBS an was undifferentiated used as an undifferentiated control. Neu- control.ronal morphology Neuronal morphology after treatment after withtreatment the different with the conditions different conditions for 48 h is for shown 48 h inis Figure3A,B. We first investigated the effect of APP overexpression on neurite outgrowth shown in Figure 3A,B. We first investigated the effect of APP overexpression on neurite activity. Neuro2a and Neuro2a/APPSwe cells were cultured in differentiation medium outgrowth activity. Neuro2a and Neuro2a/APPSwe cells were cultured in differentiation containing 1% FBS or complete medium containing 10% FBS (control) for 48 h. After cultur- medium containing 1% FBS or complete medium containing 10% FBS (control) for 48 h. ing the cells in 1% FBS medium, the neurite outgrowth of Neuro2a and Neuro2a/APPSwe After culturing the cells in 1% FBS medium, the neurite outgrowth of Neuro2a and cells was increased in both cell types as percent of neurite-bearing cells (23.62 ± 3.27% and Neuro2a/APPSwe cells was increased in both cell types as percent of neurite-bearing cells 16.56 ± 1.87%, respectively) and as the mean of the longest neurite length (17.01 ± 0.92 µm (23.62 ± 3.27% and 16.56 ± 1.87%, respectively) and as the mean of the longest neurite and 13.73 ± 1.97 µm, respectively) compared to the cells cultured in 10% FBS medium. length (17.01 ± 0.92 µm and 13.73 ± 1.97 µm, respectively) compared to the cells cultured When the comparison was done between cell lines, both percent of neurite-bearing cells and in 10% FBS medium. When the comparison was done between cell lines, both percent of the mean of longest neurite length after treatment of differentiation medium were found to neurite-bearing cells and the mean of longest neurite length after treatment of differenti- be significantly lower in Neuro2a/APPSwe cells than in Neuro2a cells (p-value = 0.03 and ation0.02, respectively) medium were (Figure found3C,D). to be significantly lower in Neuro2a/APPSwe cells than in Neuro2aTo investigate cells (p-value the = ability 0.03 and to potentiate 0.02, respectively) neurite outgrowth (Figure 3C of,D CM). extract, the cells were treatedTo investigate with the extract the ability at a to concentration potentiate neurite of 10 outgrowthµg/mL CM of extractCM extract, diluted the incells 1% were FBS treatedmedium with for the 48 h,extract while at cells a concentration receiving 10% of FBS10 µg or/mL 1% FBSCM mediumextract diluted treatment in 1% were FBS usedme- diumas undifferentiated for 48 h, while and cells differentiated receiving 10% controls, FBS or 1% respectively. FBS medium The treatment result showed were thatused CM as undifferentiatedextract, when compared and differentiated with 1% FBS controls, medium respectively. control, significantly The result increasedshowed that the CM percent extract,of neurite-bearing when compared cells with (43.52 1%± FBS6.00% medium vs. 23.62 control,± 3.27%, significantlyp-value = increased 0.0025) and the slightly percent (but of neuritenot significantly)-bearing cells increased (43.52 ± the 6.00% mean vs. neurite 23.62 ± length 3.27%, (21.59 p-value± 3.76= 0.0025)µm vs. and17.01 slightly± 0.9 (butµm, notp-value significantly) = 0.12) in increased Neuro2a the cells. mean Meanwhile, neurite length Neuro2a/APPSwe (21.59 ± 3.76 µm cells vs. 17.01 treated ± 0.9 with µm, CM p- valueextract = showed0.12) in Neuro2a a significant cells. increase Meanwhile, in both Neuro2a/APPSwe percent of neurite-bearing cells treated cells with (39.19 CM± extract3.87% showedvs. 16.56 a significant± 1.87%, pincrease-value =in 0.0025) both percent and the of meanneurite neurite-bearing length cells (39.19 (20.47 ±± 3.87%3.56 µvs.m 16.56vs. 13.73 ± 1.87%,± 1.97 p-valueµm, p=-value 0.0025) = and 0.045) the whenmean neurite compared length with (20.47 1% FBS± 3.56 medium µm vs. 13.73 control ± 1.97(Figure µm,3 E,F).p-value = 0.045) when compared with 1% FBS medium control (Figure 3E,F).

PharmaceuticaPharmaceuticalsls 20212021, 14, 14, 901, 901 5 5of of 24 24

FigureFigure 3. 3. NeuriteNeurite outgrowth outgrowth determination. determination. The The neuronal neuronal morphology morphology of of (A (A) )Neuro2a Neuro2a cells. cells. (B (B) )Neuro2a/APPSwe Neuro2a/APPSwe cells. cells. Neuro2a/APPSweNeuro2a/APPSwe cells cells exhibited exhibited number number of of (C ()C neurite) neurite-bearing-bearing cells cells and and (D (D) ) neurit neuritee length length significantly signiﬁcantly lower lower than than Neuro2aNeuro2a cells cells after after induced induced differentiation differentiation by by1% 1% FBS FBS medium medium for 48 for h. 48 When h. When treated treated with with10 µg/m 10 µLg/mL CM extract CM extract for 48 h, for Neuro2a48 h, Neuro2a and Neuro2a/APPSwe and Neuro2a/APPSwe cells significantly cells signiﬁcantly increased increased both number both number of (E) neurite of (E)- neurite-bearingbearing cells and cells (F) neurite and (F) length neurite when compared with 1% FBS treatment. The white arrow indicates neurite. Values are mean ± SD of at least three inde- length when compared with 1% FBS treatment. The white arrow indicates neurite. Values are mean ± SD of at least three pendent experiments. * p-value < 0.05, *** p-value < 0.001. independent experiments. * p-value < 0.05, *** p-value < 0.001.

2.4. APP Expression in Neuro2a and Neuro2a/APPSwe Cells Compared to Neuro2a cells, NeuroAPPSwe cells express higher levels of APP-bearing the Swedish mutation. Western blot analysis was used to determine APP level using antibodies speciﬁc to both wild-type and Swedish mutant APP. The protein bands showed that the level of APP was clearly different between wild-type cells and APP-overexpressing

Pharmaceuticals 2021, 14, 901 6 of 24

2.4. APP Expression in Neuro2a and Neuro2a/APPSwe Cells Compared to Neuro2a cells, NeuroAPPSwe cells express higher levels of APP-bear- Pharmaceuticals 2021, 14, 901 6 of 24 ing the Swedish mutation. Western blot analysis was used to determine APP level using antibodies specific to both wild-type and Swedish mutant APP. The protein bands showed that the level of APP was clearly different between wild-type cells and APP-over- expressingNeuro2a cellsNeuro2a (Figure cells4A,B). (Figure However, 4A,B). However, APP level APP was level not altered was not after altered treatment after treat- with ment10 µ g/mLwith 10 CM µg extract/mL CM for extract 48 h in for both 48 h cells in both (Figure cells4C). (Figure 4C).

Figure 4. APP expression level. (A) Western blot analysis revealed that APP expression in Neuro2a/APPSwe cells was Figure 4. APP expression level. (A) Western blot analysis revealed that APP expression in Neuro2a/APPSwe cells was higher than higher than that in Neuro2a cells. (B) In 1% FBS medium, APP was signiﬁcantly different between wild-type cells and that in Neuro2a cells. (B) In 1% FBS medium, APP was significantly different between wild-type cells and APPSwe-overexpressing APPSwe-overexpressing Neuro2a cells (C) The APP levels between treatment groups of Neuro2a and Neuro2a/APPSwe Neuro2a cells (C) The APP levels between treatment groups of Neuro2a and Neuro2a/APPSwe cells were normalized vs. the 10% cells were normalized vs. the 10% FBS group for each cell type. The analysis showed that Neuro2a/APPSwe cells exhibited FBS group for each cell type. The analysis showed that Neuro2a/APPSwe cells exhibited higher levels of APP than Neuro2a cells. higher levels of APP than Neuro2a cells. APP level in both cells did not differ in 10% FBS, 1% FBS, and 10 µg/mL CM APP level in both cells did not differ in 10% FBS, 1% FBS, and 10 µg/mL CM extract in 1% FBS treatment. Values are mean ± SD of at extract in 1% FBS treatment. Values are mean ± SD of at least three independent experiments. *** p-value < 0.001. least three independent experiments. *** p-value < 0.001.

2.5.2.5. Effects Effects of ofCM CM Extract Extract on on GAP GAP-43-43 Gene Gene Expression Expression ToTo further further examine examine the the mechanism mechanism underlying underlying neurite neurite outgrowth outgrowth activity activity of of CM CM methanol extract, gene expression of the neurite outgrowth marker, GAP-43, was investi- methanol extract, gene expression of the neurite outgrowth marker, GAP-43, was investigated using quantitative real-time RT-PCR. By comparing both cell lines cultured in 1% FBS gated using quantitative real-time RT-PCR. By comparing both cell lines cultured in 1% for 48 h, we found that the level of GAP-43 mRNA expression was signiﬁcantly lower in FBS for 48 h, we found that the level of GAP-43 mRNA expression was significantly lower the APP Swedish-mutant (Neuro2a/APPSwe) cells than in Neuro2a cells (p-value = 0.0002) in the APP Swedish-mutant (Neuro2a/APPSwe) cells than in Neuro2a cells (p-value = (Figure5A). After inducing cell differentiation in 1% FBS medium, GAP-43 mRNA level 0.0002) (Figure 5A). After inducing cell differentiation in 1% FBS medium, GAP-43 mRNA was increased in both Neuro2a and Neuro2a/APPSwe cells when compared with 10% level was increased in both Neuro2a and Neuro2a/APPSwe cells when compared with FBS control. Worthy of note, in the presence of 10 µg/mL CM extract, both Neuro2a and 10% FBS control. Worthy of note, in the presence of 10 µg/mL CM extract, both Neuro2a Neuro2a/APPSwe cells showed a signiﬁcant increase of GAP-43 expression level when and Neuro2a/APPSwe cells showed a significant increase of GAP-43 expression level compared to the cells in 1% FBS medium control (p-value = 0.046 and 0.0008, respectively) (Figure5B).

Pharmaceuticals 2021, 14, 901 7 of 24

Pharmaceuticals 2021, 14, 901 7 of 24 when compared to the cells in 1% FBS medium control (p-value = 0.046 and 0.0008, respectively) (Figure 5B).

FigureFigure 5. 5. GAPGAP-43-43 mRNA mRNA expression expression level. level. (A (A) )Neuro2a/APPSwe Neuro2a/APPSwe cells cells showed showed significant signiﬁcant lower lower GAP GAP-43-43 gene gene expression expression thanthan Neuro2a Neuro2a cells cells after after induced induced differentiation differentiation by 1% by 1%FBS FBS medium medium for 48 for h. 48 (B h.) The (B )GAP The-43 GAP-43 mRNA mRNA levels between levels between treat- menttreatment groups groups of Neuro2a of Neuro2a and Neuro2a/APPSwe and Neuro2a/APPSwe cells were cells normalized were normalized vs. 10% vs. FBS 10% group FBS group for each for cell each type. cell Neuro2a type. Neuro2a and Neuro2a/APPSweand Neuro2a/APPSwe cells significantly cells signiﬁcantly increased increased the expression the expression of GAP-43 of gene GAP-43 when gene treated when with treated 10 µg/mL with of 10 CMµg/mL extract of forCM 48 extracth compared for 48 to h 1% compared FBS treatment. to 1% FBS Values treatment. are mean Values ± SD of are at mean least three± SD independent of at least three experiments. independent * p-value experiments. < 0.05, **** p p-value-value << 0.05,0.001. *** p-value < 0.001.

2.6.2.6. Effects Effects of of and and CM CM Extract Extract on on Ten Ten-4-4 Gene Gene Expression Expression TheThe neuritogenesis neuritogenesis signaling signaling pathway pathway of of neurit neuritee outgrowth outgrowth activity activity affected affected by by APP APP overexpressionoverexpression and and CM CM extract extract treatment treatment was was further further examined. examined. We We evaluated evaluated the the mRNA mRNA expressionexpression level level of of Teneurin Teneurin-4-4 (Ten (Ten-4),-4), which which plays plays a akey key role role in in neuronal neuronal development development andand neurite neurite outgrowth outgrowth [43]. [43]. Following Following treatment treatment of of the the cells cells with with 1% 1% FBS FBS medium medium control control forfor 48 48 h, h, Ten Ten-4-4 mRNA mRNA expression expression was was significantly significantly lower lower in APP-overexpressing in APP-overexpressing cells cells than thanin normal in normal Neuro2a Neuro2a cells cells (p-value (p-value < 0.0001) < 0.0001) (Figure (Figure6A). 6A Treating). Treating the cellsthe cells with with 1% FBS1% FBSmedium medium control control along along with with 10 µ10g/mL µg/mL CM CM extract extract significantly significantly increased increased the the expression expres- sionlevel level of Ten-4 of Ten mRNA-4 mRNA in Neuro2a/APPSwein Neuro2a/APPSwe cells cells as as compared compared to to 1% 1% FBS FBS medium medium control control(p-value (p-value = 0.007).= 0.007). In In Neuro2a Neuro2a cells cells treated treated withwith 1%1% FBS medium plus plus CM CM extract, extract, the the mRNAmRNA level level of of Ten Ten-4-4 also also tended tended to to increase increase when when compared compared to to 1% 1% FBS FBS medium medium control control alonealone (p (-pvalue-value = =0.58) 0.58) (Figure (Figure 6B6B).). However, However, in in comparison comparison to to 10% 10% FBS FBS medium medium control, control, TenTen-4-4 mRNA mRNA expression expression level level after after the the extract extract treatment treatment was was significantly significantly higher higher in in both both Neuro2aNeuro2a cells cells (by (by 1.86 1.86-fold)-fold) and and Neuro2a/A Neuro2a/APPSwePPSwe cells cells (by (by 2.3 2.3-fold).-fold). Notably, Notably, there there was was a aslight slight increase increase of ofexpression expression level level for forTen Ten-4-4 in APP in APP overexpressing overexpressing cells cells treated treated with with1% FBS1% medium FBS medium control control compared compared to 10% to 10%FBS medium FBS medium control. control. 2.7. Effects of CM Extract on Lingo-1 Gene Expression Lingo-1, also known as leucine rich repeat and immunoglobin-like domain-containing protein 1, is a transmembrane signaling protein that negatively regulates neurite outgrowth [20] and is shown to physically interact with APP [16]. By comparing mRNA expression level of Lingo-1 under differentiated condition induced by 1% FBS medium control, Swedish mutant APP-overexpressing neurons exhibited a significant higher gene expression than the wild-type neurons by 2.02-fold (p-value = 0.0002) (Figure7A). The Lingo-1 mRNA level showed no significant difference between Neuro2a and Neuro2a/APPSwe cells when treated with 10% FBS or 1% FBS medium controls, but it significantly decreased in both cell lines after 48 h exposure to 1% FBS medium control along with 10 µg/mL CM extract when compared to 1% FBS medium control alone (p-value = 0.0372 and 0.0086, respectively) (Figure7B).

Pharmaceuticals 2021, 14, 901 8 of 24

Pharmaceuticals 2021, 14, 901 8 of 24 Pharmaceuticals 2021, 14, 901 8 of 24

Figure 6. Ten-4 mRNA expression level. (A) Neuro2a/APPSwe cells showed significant lower Ten-4 gene expression than Neuro2a cells in 1% FBS medium after 48 h treatment. (B) The relative Ten-4 mRNA levels between treatment groups of Neuro2a and Neuro2a/APPSwe cell groups were normalized by 10% FBS group from each cell type. Ten-4 gene expression significantly increased in both Neuro2a and Neuro2a/APPSwe cells when treated with 10 µg/mL of CM extract for 48 h compared to 1% FBS treatment in each cell. Values are mean ± SD of at least three independent experiments. ** p-value < 0.01, *** p-value < 0.001.

2.7. Effects of CM Extract on Lingo-1 Gene Expression Lingo-1, also known as leucine rich repeat and immunoglobin-like domain-containing protein 1, is a transmembrane signaling protein that negatively regulates neurite outgrowth [20] and is shown to physically interact with APP [16]. By comparing mRNA expression level of Lingo-1 under differentiated condition induced by 1% FBS medium control, Swedish mutant APP-overexpressing neurons exhibited a significant higher gene ex- Figure 6. 6. TenTen-4-4 mRNA mRNA expression expressionpression level. level. than (A ()A theNeuro2a/APPSwe) Neuro2a/APPSwe wild-type neurons cells cells showed by showed 2.02 significant-fold signiﬁcant (p lower-value lower Ten = - 0.0002)4 Ten-4 gene geneexpression (Figure expression 7Athan). The Neuro2athan Neuro2a cells in cells 1% inFBS 1% mediumLingo FBS medium -after1 mRNA 48 after h treatment. 48 level h treatment. ( showedB) The relative (B) no The significantTen relative-4 mRNA Ten-4 differencelevel mRNAs between levels between treatment between Neuro2a groups treatment of and Neuro2agroups of and Neuro2a Neuro2a/APPSwe and Neuro2a/APPSweNeuro2a/APPSwe cell groups cellwere groups cells normalized when were normalized bytreated 10% FBS with by group 10%10% from FBS FBS groupeach or cel1% froml type.FBS each Tenmedium cell-4 type.gene controls, expression Ten-4 gene but it significantlyexpression signiﬁcantly increased in increased bothsignificantly Neuro2a in both and Neuro2ade creasedNeuro2a/APPSwe and in Neuro2a/APPSwe both cell cells lines when after cells treat when48ed hwith exposure treated 10 µg with/mL to 10 1%ofµ g/mLCM FBS extract ofmedium CM for extract 48 control h compared to 1% FBS treatment in each cell. Values are mean ± SD of at least three independent experiments. ** p-value < for 48 h compared to 1% FBSalong treatment with 10 in µg each/mL cell. CM Values extract are when mean ±comparedSD of at leastto 1% three FBS independent medium control experiments. alone (p- 0.01, *** p-value < 0.001. ** p-value < 0.01, *** p-valuevalue < 0.001. = 0.0372 and 0.0086, respectively) (Figure 7B). 2.7. Effects of CM Extract on Lingo-1 Gene Expression Lingo-1, also known as leucine rich repeat and immunoglobin-like domain-containing protein 1, is a transmembrane signaling protein that negatively regulates neurite outgrowth [20] and is shown to physically interact with APP [16]. By comparing mRNA expression level of Lingo-1 under differentiated condition induced by 1% FBS medium control, Swedish mutant APP-overexpressing neurons exhibited a significant higher gene expression than the wild-type neurons by 2.02-fold (p-value = 0.0002) (Figure 7A). The Lingo-1 mRNA level showed no significant difference between Neuro2a and Neuro2a/APPSwe cells when treated with 10% FBS or 1% FBS medium controls, but it significantly decreased in both cell lines after 48 h exposure to 1% FBS medium control along with 10 µg/mL CM extract when compared to 1% FBS medium control alone (p- value = 0.0372 and 0.0086, respectively) (Figure 7B).

FigureFigure 7. 7. LingoLingo-1-1 mRNA mRNA expression expression level. level. ( (AA)) Neur Neuro2a/APPSweo2a/APPSwe cells cells showed showed significant signiﬁcant higher higher Lingo Lingo-1-1 gene gene expression expression levellevel than than Neuro2a Neuro2a cells cells in in 1% 1% FBS FBS medium medium after after 48 48 h h treatment. treatment. ( (BB)) Lingo Lingo-1-1 mRNA mRNA level level between between treatment treatment groups groups of of Neuro2a and Neuro2a/APPSwe cells was normalized vs. 10% FBS group for each cell type. Lingo-1 gene expression level Neuro2a and Neuro2a/APPSwe cells was normalized vs. 10% FBS group for each cell type. Lingo-1 gene expression was significantly increased in both Neuro2a and Neuro2a/APPSwe cells when treated with 10 µg/mL of CM extract for 48 level was signiﬁcantly increased in both Neuro2a and Neuro2a/APPSwe cells when treated with 10 µg/mL of CM extract h compared to 1% FBS treatment in each cell. Values are mean ± SD of at least three independent experiments. * p-value < ± 0.05,for 48 ** hp- comparedvalue < 0.01, to *** 1% p- FBSvalue treatment < 0.001. in each cell. Values are mean SD of at least three independent experiments. * p-value < 0.05, ** p-value < 0.01, *** p-value < 0.001.

2.8. Effects of CM Extract on NgR Gene Expression The gene expression of Nogo receptor (NgR), a downstream signaling protein of Lingo-1, was further investigated. Under a differentiated condition induced by 1% FBS medium control, the APP-overexpressing Neuro2a cells exhibited a signiﬁcant higher NgR mRNA expression (2.46-fold) than wild-type Neuro2a cells (p-value = 0.0029) (Figure 8A). As observed for Lingo-1 gene expression, the NgR mRNA expression was not different Figure 7. Lingo-1 mRNA expression level. (A) Neuro2a/APPSwe cells showed significant higher Lingo-1 gene expression between Neuro2a and Neuro2a/APPSwe cells treated with 10% FBS or 1% FBS medium level than Neuro2a cells in 1% FBS medium after 48 h treatment. (B) Lingo-1 mRNA level between treatment groups of controls, whereas it signiﬁcantly decreased in both cell lines (p-value = 0.0392 and 0.0028, re- Neuro2a and Neuro2a/APPSwe cells was normalized vs. 10% FBS group for each cell type. Lingo-1 gene expression level µ was significantly increased inspectively) both Neuro2a after and exposure Neuro2a/APPSwe to 1% FBS cells medium when plus treat 10ed withg/mL 10 µg CM/mL extract of CM for extract 48 h for compared 48 h compared to 1% FBS treatmentto 1% in FBS each medium cell. Values control are mean alone ± SD (Figure of at 8leastB). three independent experiments. * p-value < 0.05, ** p-value < 0.01, *** p-value < 0.001.

Pharmaceuticals 2021, 14, 901 9 of 24

FigureFigure 8. 8.NgRNgR mRNA mRNA expression expression level. level. (A (A) Neuro2a/APPSwe) Neuro2a/APPSwe cells cells showed showed significant significant higher higher NgR NgR gene gene expression expression level level than Neuro2a cells after 48 h of treatment in 1% FBS medium. (B) NgR mRNA level between treatment groups of Neuro2a than Neuro2a cells after 48 h of treatment in 1% FBS medium. (B) NgR mRNA level between treatment groups of Neuro2a and Neuro2a/APPSwe cells was normalized vs. 10% FBS group for each cell type. NgR gene expression level in both and Neuro2a/APPSwe cells was normalized vs. 10% FBS group for each cell type. NgR gene expression level in both Neuro2a and Neuro2a/APPSwe cells significantly decreased upon treatment with 10 µg/mL of CM extract for 48 h com- µ paredNeuro2a to 1% and FBS Neuro2a/APPSwe treatment in each cells cell significantlytype. Values decreased are mean upon ± SD treatmentof at least with three 10 independentg/mL of CM experiments. extract for 48 * hp- comparedvalue < 0.05,to 1%** p FBS-value treatment < 0.01. in each cell type. Values are mean ± SD of at least three independent experiments. * p-value < 0.05, ** p-value < 0.01. 2.9. Effects of CM Extract on BACE1 Gene Expression 2.9. Effects of CM Extract on BACE1 Gene Expression When comparing BACE1 gene expression between Neuro2a and Neuro2a/APPSwe When comparing BACE1 gene expression between Neuro2a and Neuro2a/APPSwe cells after incubation in 1% FBS for 48 h, BACE1 mRNA level in Neuro2a/APPSwe cells cells after incubation in 1% FBS for 48 h, BACE1 mRNA level in Neuro2a/APPSwe cells was significantly higher than in the wild-type counterpart by 1.54 fold (p-value = 0.0002) was significantly higher than in the wild-type counterpart by 1.54 fold (p-value = 0.0002) (Figure 9A). Ten percent FBS and 1% FBS treatments elicited no changes in BACE1 gene (Figure9A). Ten percent FBS and 1% FBS treatments elicited no changes in BACE1 gene expression in both Neuro2a and Neuro2a/APPSwe cells after incubation for 48 h. Interest- expression in both Neuro2a and Neuro2a/APPSwe cells after incubation for 48 h. Inter- ingly, BACE1 mRNA was not influenced by the CM extract at in both wild-type and APP- Pharmaceuticals 2021, 14, 901 estingly, BACE1 mRNA was not influenced by the CM extract at in both wild-type10 of and 24 overexpressing cells (Figure 9B). APP-overexpressing cells (Figure9B).

FigureFigure 9. 9. BACE1BACE1 mRNA mRNA expression expression level. level. ( (AA)) Neuro2a/APPSwe Neuro2a/APPSwe cells cells showed showed significantly signiﬁcantly higher higher level level of of BACE1 BACE1 gene gene

expressionexpression than than Neuro2a Neuro2a cells cells after after 48 48 h h of of treatment treatment in in 1% 1% FBS FBS medium. medium. (B (B) )BACE1 BACE1 mRNA mRNA level level between between treatment treatment groupsgroups of of Neuro2a Neuro2a and and Neuro2a/APPSwe Neuro2a/APPSwe cells cells was was normalized normalized vs. 10% vs. FBS 10% group FBS groupfor each for cell each type. cell BACE1 type. gene BACE1 expres- gene sionexpression level in level both in Neuro2a both Neuro2a and Neuro2a/APPSwe and Neuro2a/APPSwe cells was cells not was altered not altered whenwhen treatment treatment with with10 µg 10/mLµg/mL of CM of extract CM extract for 48 h compared to 1% FBS treatment in each cell. Values are mean ± SD of at least three independent experiments. *** p- for 48 h compared to 1% FBS treatment in each cell. Values are mean ± SD of at least three independent experiments. value < 0.001. *** p-value < 0.001. 2.10. Effects of CM Extract on BACE1 Activity BACE1 was assayed according to the kit instructions and the activity was expressed as the fluorescence intensity unit per 30 µg of protein sample. Neuro2a/APPSwe cells showed a significantly higher level of BACE1 activity than Neuro2a cells after 48 h of treatment in 1% FBS medium (Figure 10A). Neuronal cells were treated with CM extract along with quercetin (1 µM), a well-known BACE1 inhibitor, for 48 h. Quercetin treatment significantly decreased the enzyme activity when compared to 1% FBS treatment in each cell type. BACE1 activity in Neuro2a/APPSwe cells was significantly decreased upon treatment with 10 µg/mL of CM extract for 48 h compared to 1% FBS treatment, and it slightly decreased (though not significantly) in Neuro2a cells (Figure 10B).

Figure 10. BACE1 activity expressed as fluorescence intensity unit per 30 µg of protein sample. (A) Neuro2a/APPSwe cells showed significantly higher level of BACE1 activity than Neuro2a cells after 48 h of treatment in 1% FBS medium. The enzyme activity correlated with the enzyme concentration. (B) Quercetin (1 µM), a well-known BACE1 inhibitor, significantly decreased the enzyme activity in both cells. BACE1 activity in Neuro2a/APPSwe cells significantly decreased upon treatment with 10 µg/mL of CM extract for 48 h compared to 1% FBS treatment, and it slightly decreased in Neuro2a cells. Values are mean ± SD of at least three independent experiments. * p-value < 0.05, ** p-value < 0.01.

Pharmaceuticals 2021, 14, 901 10 of 24

Figure 9. BACE1 mRNA expression level. (A) Neuro2a/APPSwe cells showed significantly higher level of BACE1 gene expression than Neuro2a cells after 48 h of treatment in 1% FBS medium. (B) BACE1 mRNA level between treatment groups of Neuro2a and Neuro2a/APPSwe cells was normalized vs. 10% FBS group for each cell type. BACE1 gene expres- Pharmaceuticalssion level2021 in, both14, 901 Neuro2a and Neuro2a/APPSwe cells was not altered when treatment with 10 µg/mL of CM extract for10 of 24 48 h compared to 1% FBS treatment in each cell. Values are mean ± SD of at least three independent experiments. *** p- value < 0.001.

2.10. Effects of CM Extract on BACE1 Activity BACE1 was assayed according to thethe kitkit instructionsinstructions andand thethe activityactivity waswas expressedexpressed µ as the the fluorescence fluorescence intensity intensity unit unit per per 30 30 µgg of of protein protein sample. sample. Neuro2a/APPSwe Neuro2a/APPSwe cells cells showed a significantly higher level of BACE1 activity than Neuro2a cells after 48 h of showed a significantly higher level of BACE1 activity than Neuro2a cells after 48 h of treatment in 1% FBS medium (Figure 10A). Neuronal cells were treated with CM extract treatment in 1% FBS medium (Figure 10A). Neuronal cells were treated with CM extract along with quercetin (1 µM), a well-known BACE1 inhibitor, for 48 h. Quercetin treatment along with quercetin (1 µM), a well-known BACE1 inhibitor, for 48 h. Quercetin treatment significantly decreased the enzyme activity when compared to 1% FBS treatment in each significantly decreased the enzyme activity when compared to 1% FBS treatment in each cell type. BACE1 activity in Neuro2a/APPSwe cells was significantly decreased upon cell type. BACE1 activity in Neuro2a/APPSwe cells was significantly decreased upon treatment with 10 µg/mL of CM extract for 48 h compared to 1% FBS treatment, and it treatment with 10 µg/mL of CM extract for 48 h compared to 1% FBS treatment, and it slightly decreased (though not significantly) in Neuro2a cells (Figure 10B). slightly decreased (though not significantly) in Neuro2a cells (Figure 10B).

FigureFigure 10.10. BACE1 activity activity expressed expressed as as fluorescence fluorescence intensity intensity unit unit per per 30 30µgµ ofg ofprotein protein sample. sample. (A) (Neuro2a/APPSweA) Neuro2a/APPSwe cells cellsshowed showed significantly significantly higher higher level levelof BACE1 of BACE1 activity activity than thanNeuro2a Neuro2a cells cellsafter after48 h 48of htreatment of treatment in 1% in FBS 1% FBSmedium. medium. The Theenzyme enzyme activity activity correlated correlated with withthe enzyme the enzyme concentration. concentration. (B) Quercetin (B) Quercetin (1 µM), (1 a µwellM),- aknown well-known BACE1 BACE1inhibitor, inhibitor, significantly decreased the enzyme activity in both cells. BACE1 activity in Neuro2a/APPSwe cells significantly decreased upon significantly decreased the enzyme activity in both cells. BACE1 activity in Neuro2a/APPSwe cells significantly decreased treatment with 10 µg/mL of CM extract for 48 h compared to 1% FBS treatment, and it slightly decreased in Neuro2a cells. upon treatment with 10 µg/mL of CM extract for 48 h compared to 1% FBS treatment, and it slightly decreased in Neuro2a Values are mean ± SD of at least three independent experiments. * p-value < 0.05, ** p-value < 0.01. cells. Values are mean ± SD of at least three independent experiments. * p-value < 0.05, ** p-value < 0.01.

2.11. In Silico Virtual Screening of Binding Afﬁnity between CM-Phytochemical Compounds and BACE1 The current study employed the same batch of the CM methanol extract used in our previous work, where its chemical composition analyzed by LC-MS was reported [33]. Ten

most represented CM-phytochemical compounds were tested for their potential to inhibit BACE1 by in silico molecular docking approach (Table1). For the method validation, 5HA, a reported inhibitor of BACE1 crystal structure, was removed and re-docked into the original active cavity of BACE1 for three runs. The results showed that 5HA was capably re-docked into a similar location and orientation of the original crystal structure with RMSD 1.03, 0.73, and 0.79 Å (less than 2 Å is considered the accuracy for docking [44,45]). Moreover, the predicted binding energies from three analyses were −13.32, −13.06, and −13.19 kcal/mol, demonstrating the acceptable reproducibility of analysis. Protein–ligand interactions exhibited that re-docking conformation of 5HA interacted with key amino acids found in the co-crystallized structure. For example, re-docking run #3, which provided the lowest binding energy, showed that 5HA formed hydrogen bonds with 8 out of 10 amino acids found in co-crystallized complex, including GLY34, SER35, THR72, GLN73, ASP228, GLY230, THR232, and ASN233. Furthermore, it shared amino acid interaction with 6 out of 9 amino acids: LEU30, TYR71, TRP115, THR231, THR232, and ALA335 by hydrophobic bonding (Table1 and Figure S1). Therefore, these results indicated that the protocol used in this study was reliable and could be applied for further predictions. Pharmaceuticals 2021, 14, 901 11 of 24

2.11. In Silico Virtual Screening of Binding Affinity between CM-Phytochemical Compounds and BACE1 The current study employed the same batch of the CM methanol extract used in our previous work, where its chemical composition analyzed by LC-MS was reported [33]. Ten most represented CM-phytochemical compounds were tested for their potential to inhibit BACE1 by in silico molecular docking approach (Table 1). For the method validation, 5HA, a reported inhibitor of BACE1 crystal structure, was removed and re-docked into the original active cavity of BACE1 for three runs. The results showed that 5HA was capably re-docked into a similar location and orientation of the original crystal structure with RMSD 1.03, 0.73, and 0.79 Å (less than 2 Å is considered the accuracy for docking [44,45]). Moreover, the predicted binding energies from three analyses were −13.32, −13.06, and −13.19 kcal/mol, demonstrating the acceptable reproducibility of analysis. Pro- tein–ligand interactions exhibited that re-docking conformation of 5HA interacted with key amino acids found in the co-crystallized structure. For example, re-docking run #3, which provided the lowest binding energy, showed that 5HA formed hydrogen bonds with 8 out of 10 amino acids found in co-crystallized complex, including GLY34, SER35, THR72, GLN73, ASP228, GLY230, THR232, and ASN233. Furthermore, it shared amino acid interaction with 6 out of 9 amino acids: LEU30, TYR71, TRP115, THR231, THR232, and ALA335 by hydrophobic bonding (Table 1 and Figure S1). Therefore, these results Pharmaceuticals 2021, 14, 901 indicated that the protocol used in this study was reliable and could be applied for further11 of 24 predictions.

Table 1. The results of method validation between co-crystalized ligand (5HA) at the original active site of BACE1 (PDB TableID: 3TPP). 1. The results of method validation between co-crystalized ligand (5HA) at the original active site of BACE1 (PDB ID: 3TPP). Ligand Binding Amino Acid Interaction Ligand Amino Acid Interaction RMSD (Å) BindingEnergy Energy Hydrophobic Electrostatic RMSD (Å) Hydrogen Bond (kcal/mol)(kcal/mol) Hydrogen BondHydrophobic BondElectrostatic ASP32Bond Bond Bond LEU30 ASP32 5HA5HA (crystal(crystal structure) structure) GLY34 LEU30 GLY34 TYR71 SER35 TYR71 SER35 ILE110 THR72 (2) ILE110 THR72 (2) TRP115TRP115 (2) (2) Not Not GLN73GLN73 (2) (2) Not determined Not determined TYR198TYR198 - - determined determined ASP228ASP228 ILE226 GLY230 (2) ILE226 GLY230 (2) THR231 (2) THR231 THR231 (2) THR231 THR232 (2) THR232 (2) THR232 (2) THR232 (2) ALA335 ASN233 ALA335 ASN233 ASP32 ASP32THR72 (3) GLN12 GLY13 THR72GLN73 (3) (2) TYR71 GLN12 GLY13 5HA (re-docking run #1) 1.03 −13.32 GLN73ASP228 (2) THR231 - GLY230 TYR71THR232 5HA (re-docking run #1) 1.03 −13.32 ASP228 - THR231 THR231ALA335 THR232 GLY230 THR232 ALA335 THR231 ASP32 LEU30 THR232GLY34 TYR71 ASP32THR72 (2) LEU30TRP115 GLY34GLN73 (2) TYR71TYR198 − 5HA (re-docking run #2) 0.73 13.60 THR72GLY230 (2) TRP115ILE226 - THR232 THR231 GLN73 (2) TYR198 5HA (re-docking run #2) 0.73 −13.60 ASN233 (2) THR232 - GLY230SER325 ILE226VAL332 THR232 THR231ALA335 THR232 ASN233GLY34 (2) VAL332 SER35 SER325 ALA335LEU30 THR72 TYR71 GLN73 (2) PHE108 ASP228 5HA (re-docking run #3) 0.79 −13.94 TRP115 (2) - GLY230 (2) THR231 (2) THR232 THR232 ASN233 ALA335 ARG235 SER325

The molecular docking results of all candidate compounds with BACE1 inhibitory potential were tabulated in Table2. Quercetin, a natural compound possessing BACE1 inhibitory activity in silico, in vitro, and in vivo [46–48], was found in the CM extract (based on HPLC), and it was docked as a reference inhibitor. The binding energy of quercetin with BACE1 was calculated at −8.78 kcal/mol, and this value was set as a reference value for evaluating the ability of inhibitor candidate compounds. Four compounds, including quercetin-30-glucuronide (−10.74 kcal/mol), quercetin-3-O-glucoside (−10.43 kcal/mol), clausarinol (−9.96 kcal/mol), and theogallin (−8.97 kcal/mol), showed binding energies lower than that of the reference control. These results suggest that quercetin-30-glucuronide, quercetin-3-O-glucoside, clausarinol, and theogallin have the potential to inhibit BACE1. Diagrams of protein–ligand interactions of these compounds and BACE1 were represented in Figure 11. Schematics of amino acid interactions of BACE1 and CM-phytochemical compounds are shown in Table S1. Pharmaceuticals 2021, 14, 901 12 of 24 Pharmaceuticals 2021, 14, 901 12 of 24 PharmaceuticaPharmaceutica lsls 20212021,, 1414,, 901901 1212 ofof 2424

GLY34GLY34 GLY34GLY34 SER35SER35 SER35SER35 LEU30LEU30 THR72THR72 LEU30LEU30 THR72THR72 TYR71TYR71 GLN73GLN73 (2) (2) TYR71TYR71 GLN73GLN73 (2)(2) PHE108PHE108 ASP228ASP228 PHE108PHE108 5HA5HA (re(re--dockingdocking run run #3)#3) 0.790.79 −−13.9413.94 ASP228ASP228 TRP115TRP115 (2) (2) -- 5HA5HA (re(re--dockingdocking runrun #3)#3) 0.790.79 −−13.9413.94 GLY230GLY230 (2) (2) TRP115TRP115 (2)(2) -- GLY230GLY230 (2)(2) THR231THR231 (2) (2) THR232THR232 THR231THR231 (2)(2) THR232THR232 THR232THR232 ASN233ASN233 THR232THR232 ASN233ASN233 ALA335ALA335 ARG235ARG235 ALA335ALA335 ARG235ARG235 SER325SER325 SER325SER325 TheThe molecularmolecular dockingdocking resultsresults ofof allall candidatecandidate compoundscompounds withwith BACE1BACE1 inhibitoryinhibitory The molecular docking results of all candidate compounds with BACE1 inhibitory potentialpotentialThe weremolecularwere tabulatedtabulated docking inin Table Tableresults 2.2. of QuercetinQuercetin all candidate, , aa naturalnatural compounds compoundcompound with possessing possessingBACE1 inhibitory BACE1BACE1 potential were tabulated in Table 2. Quercetin, a natural compound possessing BACE1 inhibitoryinhibitorypotential were activityactivity tabulated inin silicosilico in, , inTablein vitro,vitro, 2. andQuercetinand inin vivo vivo, a [46[46natural––4848],], compoundwaswas foundfound possessinginin the the CMCM extractBACE1 extract inhibitory activity in silico, in vitro, and in vivo [46–48], was found in the CM extract (based(basedinhibitory on on HPLC), HPLC),activity and and in silicoit it was was, docked indocked vitro, as asand a a reference reference in vivo inhibitor.[46 inhibitor.–48], was The The found binding binding in energy energy the CM of of extract quer- quer- (based on HPLC), and it was docked as a reference inhibitor. The binding energy of quer- cetincetin(based withwith on BACE1HPLC),BACE1 wasandwas calculateditcalculated was docked atat − −as8.788.78 a reference kcal/mol,kcal/mol, inhibitor. andand thisthis valueThevalue binding waswas setset energy asas aa referencereference of quercetin with BACE1 was calculated at −8.78 kcal/mol, and this value was set as a reference valuevaluecetin with forfor evaluatingevaluating BACE1 was thethe calculated abilityability ofof inhibitoratinhibitor −8.78 kcal/mol, candidatecandidate and compounds.compounds. this value FourwasFour set compoundscompounds as a reference, , in-in- value for evaluating the ability of inhibitor candidate compounds. Four compounds, in- cludingcludingvalue for quercetin quercetinevaluating--3′3′ -the-glucuronideglucuronide ability of inhibitor ( (−−10.7410.74 kcal/mol),candidate kcal/mol), compounds. quercetin quercetin--33- -OFourO--glucosideglucoside compounds ( (−−10.4310.43, including quercetin-3′-glucuronide (−10.74 kcal/mol), quercetin-3-O-glucoside (−10.43 kcal/mol),kcal/mol),cluding quercetin clausarinolclausarinol-3′ - (glucuronide(−−9.969.96 kcal/mol)kcal/mol) (−10.74, , andand theogallintheogallin kcal/mol), ((−− quercetin8.978.97 kcal/mol)kcal/mol)-3-O-,glucoside , showedshowed bindingbinding (−10.43 kcal/mol), clausarinol (−9.96 kcal/mol), and theogallin (−8.97 kcal/mol), showed binding energiesenergieskcal/mol), lowerlower clausarinol thanthan thatthat (− 9.96 ofof thethe kcal/mol) referencereference, and control.control. theogallin TheseThese ( results−results8.97 kcal/mol) suggestsuggest that,that showed quercetinquercetin binding--3′3′-- energies lower than that of the reference control. These results suggest that quercetin-3′- glucuronide,glucuronide,energies lower quercetin quercetin than that--33- -OofO- -glucoside,theglucoside, reference clausarinol, clausarinol, control. Theseand and theogallin theogallin results suggest have have the the that potential potential quercetin to to in- -in-3′- glucuronide, quercetin-3-O-glucoside, clausarinol, and theogallin have the potential to in- Pharmaceuticals 2021, 14, 901 hibithibitglucuronide, BACE1.BACE1. quercetinDiagramsDiagrams- 3 of-ofO protein-proteinglucoside,––ligandligand clausarinol, interactionsinteractions and theogallinofof thesethese compoundscompounds have the potential andand BACE112BACE1 ofto 24 inhibit BACE1. Diagrams of protein–ligand interactions of these compounds and BACE1 werewerehibit representedBACE1.represented Diagrams inin FigureFigure of 11.protein11. SchematicsSchematics–ligand ofofinteractions aminoamino acidacid of interactionsinteractions these compounds of of BACE1BACE1 and andand BACE1 CMCM-- were represented in Figure 11. Schematics of amino acid interactions of BACE1 and CM- phytochemicalphytochemicalwere represented compounds compounds in Figure are11.are shownSchematicsshown in in TableTable of amino S1 S1. . acid interactions of BACE1 and CM- phytochemicalphytochemical compoundscompounds areare shownshown inin TableTable S1S1.. Table 2. The results of molecular docking between the active site of BACE1 (PDB ID: 2WJO) and candidate ligands. TableTable 2. 2. The The results results of of molecular molecular docking docking between between the the active active site site of of BACE1 BACE1 (PDB (PDB ID: ID: 2WJO) 2WJO) and and candidate candidate ligands ligands. . TableTable 2.2. TheThe resultsresults ofof molecularmolecular dockingdocking betweenbetween thethe activeactive sitesite ofof BACE1BACE1 (PDB(PDB ID:ID: 2WJO)2WJO) andand candidatecandidate ligandsligands.. Binding Energy Inhibition Ligand BindingBinding Energy Energy Inhibition Inhibition Amino Acid Interaction LigandLigand (kcal/mol)Binding EnergyConstant Inhibition AminoAmino Acid Acid Interaction Interaction Ligand (kcal/mol)(kcal/mol)Binding Energy Constant ConstantInhibition Amino Acid Interaction Ligand (kcal/mol) Constant Amino Acid Interaction (kcal/mol) Constant Hydrogen HydrophobicHydrophobic ElectrostaticElectrostatic Hydrogen Bond Hydrophobic Electrostatic BondHydrogen BondBond BondHydrophobicHydrophobic BondBondElectrostaticElectrostatic HydrogenHydrogen BondBond Bond Bond BondBond BondBond QuercetinQuercetin (reference (reference inhibitor)inhibitor) QuercetinQuercetin (reference(reference inhibitor)inhibitor) VAL31VAL31VAL31 VAL31 LEU30LEU30 (2) (2) −8.78−8.78 365.72365.72µM µM GLN73GLN73VAL31 (2) (2) LEU30 (2) -- −8.78 365.72 µM GLN73 (2) TRP115TRP115LEU30LEU30 (2)(2) - −−8.788.78 365.72365.72 µMµM PHE108PHE108GLN73GLN73 (2) (2)(2) TRP115 -- PHE108 (2) TRP115TRP115 PHE108PHE108 (2)(2)

33-O-Methylgallate3--OO--MethylgallateMethylgallate 3-O-Methylgallate THR72 3-O-Methylgallate THR72THR72 GLN73THR72THR72 (3) GLN73GLN73 (3) (3) −5.20−−5.205.20 154.27154.27154.27µM µM µM GLN73 (3) PHE108PHE108PHE108 --- −5.20 154.27 µM PHE108PHE108PHE108GLN73 (3) PHE108 - −5.20 154.27 µM PHE108 PHE108 - THR232THR232THR232PHE108 (2) (2)(2) THR232 (2) THR232 (2)

44--AminomethylindoleAminomethylindole 4-Aminomethylindole44--AminomethylindoleAminomethylindole TYR71TYR71 (2) (2) TYR71TYR71 (2) (2) −−6.496.49 17.6317.63 µM µM -- GLY230GLY230TYR71 (2) -- −6.49−6.49 17.6317.63µM- µM - GLY230GLY230 -- −6.49 17.63 µM - THR231THR231GLY230 - THR231THR231THR231

BergeninBergenin BergeninBergenin TYR71TYR71 TYR71 TYR71THR72THR72TYR71 −−8.528.52 572.8572.8 nM nM THR72 -- -- −8.52 572.8 nM THR72GLN73THR72 - - −8.52−8.52 572.8572.8 nM nM GLN73 --- - GLN73THR232GLN73GLN73 PharmaceuticaPharmaceuticaPharmaceuticalslsls 2021 20212021,, , 14 1414,, , 901 901901 THR232 131313 of ofof 24 2424 THR232THR232THR232

ClausarinolClausarinolClausarinol

THR72THR72THR72THR72 (2) (2) (2)(2) LEU30LEU30LEU30LEU30 GLN73GLN73GLN73GLN73 (2) (2) (2)(2) PHE108PHE108PHE108PHE108 (2) (2) (2)(2) −9.96−9−9−9.96.96.96 50.2750.2750.2750.27 nM nM nMnM ---- THR232THR232THR232THR232 (2) (2) (2)(2) ILE118ILE118ILE118ILE118 ASN233ASN233ASN233ASN233 ARG235ARG235ARG235ARG235

EmmotinEmmotinEmmotin A AA

THR72THR72THR72THR72 (3) (3) (3)(3) TYR71TYR71TYR71TYR71 −7.90−7−7−7.90.90.90 1.62 µ1.621.621.62M µM µMµM THR232THR232THR232THR232 PHE108PHE108PHE108PHE108 ---- THR231THR231THR231THR231 ILE118ILE118ILE118ILE118

GallicGallic acidacid GallicGallic acid acid THR72THR72 THR72THR72 −5.09−−−555.09.09.09 186.3186.3186.3186.3µM µM µMµM GLN73GLN73GLN73GLN73 (2) (2) (2)(2) ------THR232THR232THR232THR232 (2) (2) (2)(2)

NNN---DDD---GlucosylarylamineGlucosylarylamineGlucosylarylamine GLN73GLN73GLN73 (2) (2)(2) PHE108PHE108PHE108 −−−777.10.10.10 6.296.296.29 µM µMµM GLY230GLY230GLY230 --- ASP228ASP228ASP228 THR231THR231THR231 (2) (2)(2) THR232THR232THR232 (2) (2)(2)

QuercetinQuercetinQuercetin---3′3′3′---glucuronideglucuronideglucuronide TYR71TYR71TYR71 THR72THR72THR72 LEU30LEU30LEU30 (2) (2)(2) −1−1−10.740.740.74 13.4513.4513.45 n nnMMM GLN73GLN73GLN73 (3) (3)(3) --- ALA335ALA335ALA335 ASP228ASP228ASP228 ARG235ARG235ARG235 (2) (2)(2)

QuercetinQuercetinQuercetin---333---OOO---glucosideglucosideglucoside

GLY34GLY34GLY34 GLN73GLN73GLN73 −1−1−10.430.430.43 22.5422.5422.54 nM nMnM PHE108PHE108PHE108 (2) (2)(2) ASP228ASP228ASP228 TYR71TYR71TYR71 THR232THR232THR232 (3) (3)(3) ARG235ARG235ARG235

TheogallinTheogallinTheogallin THR72THR72THR72 (3) (3)(3) GLN73GLN73GLN73 (3) (3)(3) ASP32ASP32ASP32 TYR71TYR71TYR71 −−−888.97.97.97 266.1266.1266.1 nM nMnM SER35SER35SER35 --- PHE108PHE108PHE108 LYS107LYS107LYS107 PHE108PHE108PHE108 (2) (2)(2) THR231THR231 THR231

Pharmaceuticals 2021, 14, 901 13 of 24 Pharmaceutica ls 2021, 14, 901 13 of 24 Pharmaceuticals 2021, 14, 901 13 of 24

Clausarinol Clausarinol Clausarinol THR72 (2) LEU30 THR72 (2) LEU30 GLN73THR72 (2) PHE108LEU30 (2) −9.96 50.27 nM GLN73 (2) PHE108 (2) - −9.96 50.27 nM THR232GLN73 (2) (2) ILE118PHE108 (2) - −9.96 50.27 nM THR232 (2) ILE118 - ASN233THR232 (2) ARG235ILE118 ASN233 ARG235 ASN233 ARG235

Emmotin A Emmotin A Emmotin A THR72 (3) TYR71 THR72 (3) TYR71 Pharmaceuticals 2021, 14, 901 −7.90 1.62 µM THR232THR72 (3) PHE108TYR71 - 13 of 24 −7.90 1.62 µM THR232 PHE108 - −7.90 1.62 µM THR231THR232 ILE118PHE108 - THR231 ILE118 THR231 ILE118

Table 2. Cont. Gallic acid Gallic acid Gallic acid Gallic acid Binding Energy Inhibition THR72 Ligand THR72 Amino Acid Interaction (kcal/mol)−5.09 Constant186.3 µM GLN73THR72 (2) - - −5.09 186.3 µM GLN73 (2) - - −5.09 186.3 µM THR232GLN73 (2) (2) - - HydrogenTHR232 (2) Hydrophobic Electrostatic BondTHR232 (2) Bond Bond

N-D-Glucosylarylamine NN-D-Glucosylarylamine-D-Glucosylarylamine N-D-Glucosylarylamine N-D-Glucosylarylamine GLN73 (2) GLN73GLN73 (2) (2) PHE108GLN73 (2) PHE108PHE108 −7.10 µ6.29 µM GLY230PHE108 - ASP228 −7.10−7.10 6.29 6.29M µM GLY230GLY230 -- ASP228 −7.10 6.29 µM THR231THR231GLY230 (2) (2) - ASP228 THR231 (2) THR232THR232THR231 (2) (2)(2) THR232 (2) THR232 (2)

Quercetin-3′0-glucuronide QuercetinQuercetin-3-3′--glucuronideglucuronide Quercetin-3′-glucuronide Quercetin-3′-glucuronide TYR71 TYR71TYR71 THR72TYR71 THR72THR72 LEU30 (2) −10.74 13.45 nM GLN73THR72 (3) LEU30LEU30 (2) (2) - −10.74−10.74 13.4513.45 nM nM GLN73GLN73 (3) (3) ALA335LEU30 (2) -- −10.74 13.45 nM ASP228GLN73 (3) ALA335ALA335 - ASP228ASP228 ALA335 ARG235ASP228 (2) ARG235ARG235 (2) (2) ARG235 (2)

Quercetin-3-O-glucoside Quercetin-3-O-glucoside Quercetin-3-O-glucosideQuercetin-3-O-glucoside GLY34 GLY34 GLY34GLN73GLY34 GLN73 −10.43 22.54 nM GLN73PHE108GLN73 (2) ASP228 TYR71 −10.43 22.54 nM PHE108 (2) ASP228 TYR71 −10.43−10.43 22.5422.54 nM nM PHE108THR232PHE108 (2) (3)(2) ASP228ASP228 TYR71TYR71 THR232THR232 (3) (3) ARG235THR232 (3) ARG235ARG235 ARG235

Theogallin THR72 (3) Theogallin THR72 (3) Theogallin GLN73THR72 (3) THR72GLN73 (3) (3) ASP32GLN73 (3) GLN73ASP32 (3) TYR71 −8.97 266.1 nM ASP32SER35ASP32 TYR71 - −8.97 266.1 nM SER35 TYR71PHE108TYR71 - −8.97−8.97 266.1266.1 nM nM SER35LYS107SER35 PHE108 -- LYS107 PHE108PHE108 LYS107PHE108LYS107 (2) PHE108 (2) PHE108THR231PHE108 (2) (2) THR231 THR231THR231 THR231

2.12. ADMET Properties of CM-Phytochemical Compounds To evaluate the pharmacokinetic and drug-likeness properties, CM-constituent compounds were predicted via pkCSM database [49]. Drug-likeness was indicated by Lipinski’s rule of ﬁve and had no more than one violation of the following criteria: molecular weight ≤500, the number of hydrogen bond acceptor ≤10, the number of hydrogen bond donor ≤5, and the Log P ≤ 5 [50]. As shown in Table3, the predictions found that most o/w compounds passed Lipinski’s rule of ﬁve except quercetin-30-glucuronide and quercetin-

3-O-glucoside. Absorption, distribution, metabolism, excretion, and toxicity (ADMET) properties of the compounds are reported in Table4. Overall, all the CM-phytoconstituents predicted no AMES toxicity. However, bioavailability of these compounds has to be conﬁrmed using in vitro or in vivo models in future experiments. Pharmaceuticals 2021, 14, 901 14 of 24 Pharmaceuticals 2021, 14, 901 14 of 24

Quercetin

B C

Quercetin-3'-glucuronide Quercetin-3-O-glucoside

D E

Clausarinol Theogallin 1 Figure 11. DiagramsFigure 11. representDiagrams protein represent–ligand protein–ligand interactions. Schematics interactions. of amino Schematics acid interactions of amino acid of BACE1 interactions and candidate ligands: (A) of quercetin, BACE1 and (B) candidatequercetin-3′ ligands:-glucuronide (A) quercetin,, (C) quercetin (B) quercetin-3-3-O-glucoside,0-glucuronide, (D) clausarinol, (C) quercetin-3-O- and (E) theogallin. Green dashesglucoside, indicate (hydrogenD) clausarinol, bonds. and Pink (E) dashes theogallin. indicate Green hydrophobic dashes indicate bonds. hydrogen Orange bonds. dash indicatesPink dashes electrostatic bond. indicate hydrophobic bonds. Orange dash indicates electrostatic bond.

Table 3. The physiochemical properties2.12. ADMET of CM-phytoconstituents Properties of CM-Phytochemical based on Lipinski’s Compounds rule of ﬁve. To evaluate the pharmacokinetic and drug-likeness properties, CM-constituent com- MW (g/mol) Num. H-Bond Num. H-Bond Log P Violation Compound o/w (≤500 g/mol)pounds wereAcceptors predicted (≤10) viaDonors pkCSM (≤ 5) database(≤ [49].5) Drug-likeness(≤1) was indicated by Lipinski’s rule of five and had no more than one violation of the following criteria: molec- 3-O-Methylgallate 183.139ular weigh 4t ≤500, the number 2 of hydrogen bond 0.1726 acceptor ≤10, the 0 number of hydrogen 4-Aminomethylindole 146.193 1 2 1.6266 0 Bergenin 328.273bond donor 9 ≤5, and the Log P 5o/w ≤ 5 [50]. As shown−1.2006 in Table 3, the 0 predictions found that Clausarinol 414.498most compounds 6 passed Lipinski 3’s rule of five except 3.9911 quercetin-3′ 0-glucuronide and quer- Emmotin A 278.348cetin-3-O- 4glucoside. Absorption, 2 distribution, metabolism,1.62822 excretion, 0 and toxicity (AD- Gallic acid 170.120MET) properties 4 of the compounds 4 are reported 0.5016 in Table 4. Overall, 0 all the CM-phytocon- N-D-Glucosylarylamine 255.270stituents predicted 6 no AMES5 toxicity. However,− 1.1016bioavailability of 0 these compounds has Quercetin 302.238 7 5 1.988 0 to be confirmed using in vitro or in vivo models in future experiments. Quercetin-30-glucuronide 478.362 12 8 −0.4466 2 Quercetin-3-O-glucoside 464.379 12 8 −0.5389 2 Theogallin 344.272 9 7 −1.3399 1

Pharmaceuticals 2021, 14, 901 15 of 24

Table 4. ADMET analysis of CM-phytoconstituents. (log PS) (log BB) Compound in Human (log mol/L) (% Absorbed) (log mg/kg/day) Total Clearance AMES Toxicity (log mL/min/kg) Water Solubility BBB Permeability CYP2D6 Inhibitor CNS Permeability CYP2D6 Substrate Max. Tolerated Dose Intestinal Absorption

3-O-Methylgallate −2.094 73.513 −0.198 −2.807 No No 0.694 No 1.169 4-Aminomethylindole −1.847 91.463 0.352 −2.091 No No 0.991 No −0.323 Bergenin −1.853 63.774 −1.091 −3.903 No No 0.427 No −0.013 Clausarinol −3.641 79.297 −0.982 −2.136 No No 0.394 No −0.151 Emmotin A −2.886 95.021 −0.113 −2.903 No No 1.051 No 0.536 Gallic acid −2.560 43.374 −1.102 −1.102 No No 0.518 No 0.700 N-D-Glucosylarylamine −1.628 42.217 −0.671 −3.486 No No 0.217 No 0.788 Quercetin −2.925 77.207 −1.098 −3.065 No No 0.407 No 0.499 Quercetin-30-glucuronide −2.894 0.999 −1.656 −4.117 No No 0.429 No 0.432 Quercetin-3-O-glucoside −2.925 47.999 −1.688 −4.093 No No 0.394 No 0.569 Theogallin −2.589 22.529 −1.679 −4.166 No No 0.594 No 0.246 BBB: blood–brain barrier, BB: brain:blood drug concentration ratio, CNS: central nervous system, PS: permeability–surface area.

3. Discussion Several plants and natural products have been studied for use as herbal therapeutics in complementary and alternative medicine [51]. A number of plants and their isolated compounds possessing neurite outgrowth activity have been proposed for the treatment of neurodegenerative diseases. Here, we established an alternative strategy for the discovery of phytochemicals with a potential curative effect in Alzheimer’s disease (AD). Since APP overexpression negatively affects neurite outgrowth activity [12], here, we employed wild-type Neuro2A and APPSwe-overexpressing Neuro2A as an in vitro model to test the neurite outgrowth potential of C. mimosoides (CM) extract. Our previous LC-MS analysis showed that the methanol extract of CM contains the neurite outgrowth stimulatory compounds gallic acid and quercetin [33]. In the present study, HPLC results showed that CM methanol extract exhibited high gallic acid content of 7.8% of the crude extract. On the other hand, only 0.04% quercetin was found. According to our previous report, LC-MS results of CM methanol extract showed a high content of quercetin glycosides, including quercetin-30-glucuronide and quercetin-3-O-glucoside [33]. It is possible that CM methanol extract mainly contains quercetin glycosides rather than quercetin. Consistent with the literature [12], we found that neurite outgrowth was inhibited in Swedish mutation APP-overexpressing Neuro2a (Neuro2a/APPSwe) cells when compared to wild-type Neuro2a (Neuro2a/WT) cells after treatment with 1%FBS differentiation medium. Notably, neurite outgrowth activity in both Neuro2a/WT and Neuro2a/APPSwe cells was increased after treatment with CM methanol extract. This study is the ﬁrst report of neurite outgrowth inducing activity in APP-overexpressing neurons upon treating the cells with CM extract. To give a mechanistic support to this activity, the expression of neurite outgrowth regulating gene was investigated. The mRNA expression of GAP-43 and Ten-4, two neurite outgrowth positive regulators, was up-regulated in both wild-type and APP-overexpressing neurons after treatment with the CM extract. GAP-43 plays a key role in neurite outgrowth, which is expressed in neuronal growth cones during development [52,53]. It has been reported that the upregulation of GAP-43 by natural products potentiates the neurite outgrowth [54–56]. Another neurite outgrowth regulator is Teneurin-4 (Ten-4), a transmembrane protein of the Teneurin family. Ten-4 positively regulates the formation of ﬁlopodia-like protrusion and neurite outgrowth [43]. In Neuro2a cells, Ten-4 triggered neurite outgrowth by activation of focal adhesion kinase (FAK) and Rho-family small GTPases, Cdc42 and Rac1, key molecules for Pharmaceuticals 2021, 14, 901 16 of 24

the membranous protrusion formation downstream of FAK [39]. Recently, herbal extracts such as Mucuna pruriens, Anacardium occidentale L., Glochidion zeylanicum, Vitis vinifera, and Camellia sinensis (oolong tea) were also reported to increase neurite outgrowth dependent on Ten-4 expression [31,57–60]. Lingo-1, or leucine-rich repeat neuronal protein 1, is a transmembrane protein that is highly expressed in the brain, and it is implicated in several neurodegenerative diseases [17,18]. It has been shown that Lingo-1 is capable of directly binding to APP, promoting its proteolytic process via inducing BACE1 cleavage in amyloidogenic pathway and, thus, increasing the production of Aβ fragments [16,18,61]. Its action, resulting in suppression of growth cones and further axonal growth [19], involves the Nogo receptor (NgR) as a part of a co-receptor complex leading to activation of the rho-associated coiled coil-containing protein kinase (RhoA/ROCK) signaling pathway. Several natural products have shown the potential to counteract NgR. For instance, green tea and a variety of Chinese herbal medicines could inhibit the expression of NgR and, consequently, promote neurite outgrowth [62–64]. Additionally, the flavonoid isoquercitrin was found to promote neurite elongation via reducing RhoA activity, which is down-stream to the NgR pathway [65]. Here, we show that, compared to the wild-type counterpart, Swedish mutant APP overexpressing neurons exhibit an upregulation of Lingo-1, NgR, and BACE1 gene expression levels, as well as increased BACE1 activity. Remarkably, gene expression levels of Lingo-1 and NgR were suppressed, and neurite outgrowth was induced by CM extract treatment. On the other hand, no alteration was found in the BACE1 gene expression level. BACE1 activity was then assayed and found decreased in CM extract-treated Neuro2a/ APPSwe cells. One micromole per liter of Quercetin, a known BACE1 inhibitor, was employed for reference. Based on the quantification by HPLC, the content of quercetin in 10 µg/mL CM extract used for treatment was 1.2 × 10−2 µM. It could be possible that the BACE1 inhibitory effect was due to the mixtures of several bioactive compounds present in the CM extract apart from quercetin. Supporting this notion, the compounds in CM extract with a potential to inhibit BACE1 activity were determined via molecular docking study. Ten CM-phytochemical compounds were docked against the active site of BACE1, and the results found that quercetin-30-glucuronide, quercetin-3-O-glucoside, clausarinol, and theogallin exhibited more potent activity against BACE1 compared to quercetin, here used as a reference control. Notably, quercetin-3-O-glucoside was previously reported to have a BACE1 inhibitory effect using in vitro non-cell assay by having a half inhibitory concentration (IC50) at 41.23 ± 2.31 µM[66]. However, this knowledge about these compounds should be further proven by using higher model systems. Several plants and natural compounds were reported to possess inhibitory effects against BACE1 activity in APP-overexpressing neuronal cells, among these Gentiana delavayi flower extract [67], centipedegrass extract [68], theasaponin E1 from green tea seed [69], and ginsenoside [70]. According to our results, under the CM treatment, APP level and BACE1 gene expression were not decreased, but the activity of this enzyme was decreased. This finding is in agreement with a previous report showing that a quercetin-rich diet in early stages of AD was able to decrease BACE1 activity but did not affect APP and BACE1 mRNA level in APP/PS1 mice model [48,71]. The phytochemicals in CM extract involved in the amyloidogenesis APP cleavage need to be further investigated. Our ADMET analysis indicates that most of the CM-phytochemical compounds can be absorbed, distributed, metabolized, and excreted well in the human body, along with low toxicity. Therefore, CM extract and its constituent may be suitable as a basis for developing drugs. However, further studies to confirm the oral bioavailability rate and blood–brain barrier penetration of these compounds should be performed. Taken together, CM extract could counteract (Swe mutant) APP overexpression to stimulate neurite outgrowth through upregulation of GAP-43 and Ten-4 gene expression, along with downregulation of Lingo-1 and NgR gene expression. At least two known neurite outgrowth-inducing compounds, namely, gallic acid and quercetin [36–39], were found in the CM extract. However, it is likely that other bioactive compounds, yet to be Pharmaceuticals 2021, 14, 901 17 of 24

identiﬁed, which mainly affect these activities, should be explored, as well as contribute in a synergistic manner to the neurite outgrowth inducing effect of the CM extract. Moreover, we show that the extract is able to inhibit BACE1 activity, possibly due to the presence of quercetin-30-glucuronide, quercetin-3-O-glucoside, clausarinol, and theogallin.

4. Materials and Methods 4.1. Materials and Reagents Gallic acid, quercetin, dimethyl sulfoxide (DMSO), Dulbecco’s modiﬁed Eagle’s medium (DMEM), Ham’s F12 medium, and fetal bovine serum (FBS) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Geneticin (G418) was purchased from Invitrogen (San Diego, CA, USA). 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazoliumbromide (MTT) was purchased from Bio Basic (Markham, Ontario, Canada). Trizol reagent was purchased from Invitrogen (Carlsbad, CA, USA). Phosphate buffer saline (PBS) was HyCloneTM and purchased from GE Healthcare Bio-Sciences, USA. EmbryoMax® non-essential amino acids (NEAA) solution was purchased from Millipore® (Burlington, MA, USA). Peni- cillin/Streptomycin solution was purchased from Gibco (Waltham, MA, USA). Cell lysis buffer (10X), anti-APP, anti-β-actin, and horseradish peroxidase-coupled secondary anti- body were purchased from Cell Signaling Technology (Danvers, MA, USA). Methanol was purchased from Merck (Darmstadt, Germany).

4.2. Cell Culture Mouse neuroblastoma cells used in this study include wild-type APP expressing Neuro2a (Neuro2a) cells and Swedish mutant APP-overexpressing Neuro2a (Neuro2a/ APPSwe) cells. Neuro2a cells were obtained from the Health Science Research Resources Bank (Osaka, Japan). Neuro2a/APPSwe cells were kindly provided by Professor Ciro Isidoro [40,41]. Both cell lines were maintained in DMEM and Ham’s F12 medium (ratio 1:1) supplemented with 10% FBS, 1% NEAA, and 1% penicillin/streptomycin. A low concentration of G418 (0.4%) was added to the culture medium for Neuro2a/APPSwe cells to maintain transgene expression. The cells were grown in a humidiﬁed incubator with 5% ◦ CO2 at 37 C.

4.3. Plant Extract Preparation The CM methanol extract was from the same batch of extract that was used in our previous study [33]. In brief, twigs and leaves of C. mimosoides (CM) were collected from the local market in Chiang Rai Province, Thailand. The plant was authenticated and deposited with voucher specimen number A014170 (BCU) at the herbarium of Kasin Suvatabhandhu (Department of Botany, Faculty of Science, Chulalongkorn University, Bangkok, Thai- land). The twigs and leaves were dried and crushed into a powder. Then, approximately 40 g of the dried powder was constantly packed into a thimble and extracted in a Soxhlet apparatus with 400 mL of methanol for 24 h. The appearing supernatant was collected, ﬁltrated, and evaporated to dryness under vacuum. The yield of CM methanol extract was 29.82% (w/w). To stabilize the chemical composition in the extract, the stock of dried crude extract was kept at −20 ◦C and protected from light exposure. Finally, the extract was prepared as a stock solution of 100 mg/mL in DMSO, sterilized through a 0.2 µm pore size syringe ﬁlter, stored at −20 ◦C, and protected from light until further use.

4.4. HPLC Analysis The amount of gallic acid and quercetin were quantiﬁed using high-performance liquid chromatography (HPLC) analysis. The assay was performed at RSU Science and Technology Research Equipment Center (Rangsit University, Pathum Thani, Thailand). Gallic acid and quercetin reference compounds were accurately weighed and freshly prepared in 0.05 M perchloric acid containing 0.1 mM Na2EDTA on ice and stored at −20 ◦C prior to use. SHIMADZU LC-10 HPLC, equipped with an analytical C18 reversed- phase column (ODS3 C18, 4.6 × 250 mm i.d., 5-micrometer particle size), and UV detector Pharmaceuticals 2021, 14, 901 18 of 24

were used. The mobile phase consisted of 0.02 M sodium acetate, buffered to a pH of 4 with 0.0125 M citric acid, containing 0.042 M methanesulfonic acid and 0.1 mM EDTA, and the ﬂow rate was 1 mL/min. The calibration curves were prepared by injecting a series of gallic acid and quercetin standard dilutions. Gallic acid and quercetin in CM methanol extract were quantiﬁed by means of calibration curves obtained from the standards.

4.5. MTT Assay The cells were cultured in a 96-well plate at a density of 5000 cells per well and incubated for 24 h. Then, the cells were treated with different concentrations (1, 5, 10, 25, 50, and 100 µg/mL) of CM extract. After 48 h of incubation, the medium was removed and MTT solution was added to the cells at a ﬁnal concentration of 0.5 mg/mL. After an additional incubation for 3 h, the solution was carefully removed, and the formazan crystal was solubilized in 150 µL DMSO. The optical density (OD) was measured using an EnSpire® Multimode Plate Reader (Perkin-Elmer, Waltham, MA, USA) at 550 nm.

4.6. Neurite Outgrowth Assay The cells were seeded in a 6-well plate at an initial density of 5000 cells per well in 2 mL 10% FBS medium and incubated for 24 h. Then, the medium was carefully removed, and the cells were washed by PBS prior to treating with differentiation medium (1% FBS medium) with the CM extract for another 48 h. The extract was prepared by diluting the stock solution in 1% FBS medium at the selected optimum concentration that showed cell viability by more than 90%. Tests with the cells cultured in 10% FBS and 1% FBS medium were also conducted in parallel as negative controls. After completion of incubation period, the cells were visualized under 10× magnification using the differential interphase contrast (DIC) microscope (Axio Observer A1, Carl Zeiss, Köln, Germany) at 10× magnification, photographed using a Canon EOS50D camera, and processed with ImageJ Software (National Institutes of Health, Bethesda, MD, USA). For identification of neurite-bearing cells, a cell was scored positive if it bore a thin neurite extension that was double or more the length of the cell body diameter. For neurite length determination, the longest length of neurite of the cell was measured from cell membrane of cell body to the end of growth cone. At least 100 cells per well in 10–20 random microscopic fields were examined to calculate the percentage of neurite-bearing cells and the average length of neurite per cell.

4.7. RNA Extraction and Reverse Transcription-Polymerase Chain Reaction (RT-PCR) The cells were seeded in a 6-well plate at an initial density of 10,000 cells per well in 2 mL of 10% FBS medium and incubated for 24 h. After carefully removing the medium, the cells were washed with PBS and subsequently treated with differentiation medium (1% FBS medium) with the selected optimal concentration of CM extract for another 48 h. Experiments with the cells cultured in 10% FBS and 1% FBS medium were also conducted in parallel as negative controls. Total RNA was extracted from the cells using Trizol reagent following the manufacturer’s instructions. The amount of RNA was measured by absorbance at 260 nm using NanoDrop™ 1000 Spectrophotometer (Thermo Fisher Scientiﬁc, Fitchburg, WI, USA). One microgram of total RNA was used for cDNA synthesis using AccuPower RT PreMix (Bioneer Co., Daejeon, Korea) and Oligo(dT) 17 primer.

4.8. Quantitative Real-Time PCR Analysis Real-time PCR analysis was used to determine the mRNA expression level. The reaction was performed in the ExicyclerTM version 3.0 (Bioneer Co., Daejeon, Korea). The ampliﬁcation was done using GreenstarTM qPCR Premix (Bioneer Co., Daejeon, Korea) and the primers listed in Table5. The thermal cycling condition was composed of an initial denaturation step at 95 ◦C for 10 min, followed by 40 cycles of 95 ◦C for 15 s, appropriate annealing temperature for 15 s, and 72 ◦C for 30 s. The relative change in gene expression −∆∆Ct was analyzed using the 2 method, where the data of cycle threshold (Ct) values Pharmaceuticals 2021, 14, 901 19 of 24

of each target gene were normalized to that of β-actin for controlling the variability in expression levels. Each treatment was run in at least triplicate.

Table 5. Primer sequences, product sizes, and annealing temperatures used for quantitative real-time PCR.

Sequence Product Size Primer Annealing Temperature (◦C) (Forward and Reverse) (bp) 50- AGCCTAAACAAGCCGATGTG -30 GAP-43 157 62 50- GGTTTGGCTTCGTCTACAGC -30 50- GTGGACAAGTTTGGGCTCATTTA -30 Ten-4 [43] 185 62 50- GGGTTGATGGCTAAGTCTGTGG -30 50- TCTATCACGCACTGCAACCTGAC -30 Lingo-1 [72] 116 56 50- AGCATGGAGCCCTCGATTGTA -30 50- CCTGCAGAGGTCCTAATGCC -30 NgR 180 60 50- GAGGCGCTTAAGATCACGGT -30 50- CCAGGGCTACTATGTGGAGATGA -30 BACE1 66 58 50- GTGTCCACCAGGATGTTGAGC -30 50- GGCTGTATTCCCCTCCATCG -30 β-actin 154 62 50- CCAGTTGGTAACAATGCCATGT -30

4.9. Western Blot Analysis The cells were seeded overnight in a 6-well plate at an initial density of 10,000 cells per well in 10% FBS medium and incubated for 24 h. The medium was removed, and the cells were washed by PBS and subsequently treated with differentiation medium (1% FBS medium) with the selected optimal concentration of CM extract for another 48 h. Tests on the cells cultured in 10% FBS and 1% FBS medium were also conducted in parallel as negative controls. After completion of incubation period, cell lysates were prepared in 1× cell lysis buffer and quantified for total protein concentrations using Bradford assay. An equal amount of protein (15 µg) from each treatment was first denatured by heating in Laemmli loading buffer at 95 ◦C for 10 min and then separated on 10% SDS polyacrylamide gel prior transfer to PVDF membrane. Following blocking for 1 h with 5% skim milk in TBS-T (Tris-buffered saline with 0.1% Tween 20), the membranes were allowed to incubate overnight at 4 ◦C with primary antibodies specific for APP (1:5000) or β-actin (1:5000) and further probed with HRP-conjugated secondary antibodies (1:10,000) at room temperature for 60 min. The immune complexes were visualized using the enhanced chemiluminescence method (ECL™ Select Western blotting detection reagent: GE Healthcare, Piscataway, NJ, USA). Images of protein bands were captured by the DCP-165C brother scanner and evaluated using ImageJ software (National Institutes of Health). The expression level of APP was calculated using β-actin as the normalization control.

4.10. Determination of BACE1 Activity The cells were seeded overnight at density of 10,000 cells per well in a 6-well plate and subsequently cultured and treated as mentioned above. Additionally, the cells treated with quercetin (1 µM), a well-known BACE1 inhibitor, were also determined. After that, cell lysates were prepared in 1X cell lysis buffer and quantiﬁed for total protein concentrations using Bradford assay. An equal amount of protein (30 µg) from each condition was investigated for BACE1 activity using BACE1 activity Fluorometric Assay Kit (Sigma- Aldrich, St. Louis, MO, USA). An active BACE1 solution and a mixing of active BACE1 solution and BACE1 inhibitor provided by the kit were used as positive and negative controls, respectively.

4.11. In Silico Virtual Screening of Binding Afﬁnity between Candidate Ligands and BACE1 4.11.1. Protein Preparation Crystal structure of BACE1 complexed with 5HA (N’-[(2S,3R)-4-(cyclopropylamino)-3- hydroxy-1-phenyl-butan-2-yl]-5-(methyl-methylsulfonyl-amino)-N-[(1R)-1-phenylethyl] Pharmaceuticals 2021, 14, 901 20 of 24

benzene-1,3-dicarboxamide) inhibitor (PDB ID: 3TPP) was retrieved from RCSB Protein Data Bank [73]. The protein was prepared by using AutoDockTools (version 1.5.6) software. All water molecules and the original ligand presented in the complex structure were deleted. All missing hydrogens and Kollman charges were added to the protein structure. Then, the format ﬁle was generated in pdbqt format and set for further study.

4.11.2. Ligand Preparation The structures of all compounds were generated from the SMILES strings by using BIOVIA Draw 2019. Clean geometry and generating of pdb format of all compounds were performed using BIOVIA Discovery Studio Visualizer (version 20.1). The format ﬁle of ligands was converted to pdbqt format using AutoDockTools 1.5.6.

4.11.3. Molecular Docking Molecular docking study was adapted from the previous report [74]. In brief, the grid box was set based on the original ligand at the active site of BACE1 with the number of points in xyz-dimension of 35 × 35 × 35, spacing at 0.375 Å, and center grid box at 29.959 × 41.005 × 3.292 (xyz). The rigid docking was performed by AutoDock 4.2 with Lamarckian GA algorithm and default parameters. Ten conformations of the protein– ligand complex were generated; the conformation that provided the lowest binding energy was reported.

4.11.4. Protein–Ligand Interaction The interactions between BACE1 and candidate ligands were visualized by the BIOVIA Discovery Studio Visualizer (version 20.1). The hydrogen bonds, hydrophobic bonds, and electrostatic bonds of amino acid interactions were considered.

4.12. ADMET Analysis The structures of CM phytochemical compounds (Table2) were obtained from Pub- Chem database in SMILE ﬁles for evaluating the pharmacokinetic properties. ADMET were predicted via pkCSM database [49].

4.13. Statistical Analysis All experiments were carried out in at least three independent experiments. The experimental data were analyzed using GraphPad Prism version 6 (GraphPad Software Inc., San Diego, CA, USA) and expressed as mean ± standard deviation (SD). Statistical differences between two groups were analyzed by independent t-test. The comparison of more than two groups was analyzed by one-way analysis of variance (ANOVA), followed by Tukey’s post-hoc test. The p-value < 0.05 was considered to be signiﬁcant.

5. Conclusions This study shows that CM methanol extract possesses neurite outgrowth properties. This effect was observed not only in the wild-type neurons but also in Swedish APP-overexpressing neuronal cells, indicating that CM extract counteracted APP interference in the neurite outgrowth. The known neurite outgrowth-inducing compounds, gallic acid and quercetin, were found in the CM extract. Additionally, other bioactive compounds yet to be identiﬁed in the CM extract likely contributed synergistically to this effect. The possible mechanisms include the upregulation of the neurite outgrowth activation genes GAP-43 and Ten-4 and the downregulation of the neurite outgrowth negative regulator genes NgR and Lingo-1. Moreover, BACE1 activity was inhibited after treatment with CM extract. The potential CM phytochemical compounds responsible for BACE1 inhibition indicated by the molecular docking study are quercetin-30-glucuronide, quercetin-3-O-glucoside, clausarinol, and theogallin. Notably, all the major CM-phytoconstituents were predicted not to be toxic. From these data, we conclude that CM twigs and leaves could be a potential natural source for developing novel therapeutic drugs for AD. Additional studies will Pharmaceuticals 2021, 14, 901 21 of 24

better clarify the active constituents responsible for promoting neurite outgrowth and BACE1 inhibition and the molecular mechanisms underlying such activities. In the future, we shall test in animal experimental AD models the beneﬁcial effects of these compounds in view of the translation into clinics.

Supplementary Materials: The following are available online at https://www.mdpi.com/article/10 .3390/ph14090901/s1, Figure S1: Diagrams represent protein-ligand interactions. Table S1: Diagrams of protein-ligand interactions of BACE1 and candidate ligands. Author Contributions: Conceptualization, P.R., A.P. and T.T.; investigation, P.R., C.D. and C.S.; resources, C.I. and T.T.; writing—original draft preparation, P.R.; writing—review and editing, C.D., C.S., C.I., A.P. and T.T.; supervision, A.P. and T.T. All authors have read and agreed to the published version of the manuscript. Funding: Panthakarn Rangsinth was financially supported for research expense by “The 100th Anniversary Chulalongkorn University Fund for Doctoral Scholarship” and “The 90th Anniver- sary Chulalongkorn University Fund (Ratchadaphiseksomphot Endowment Fund)” funding code GCUGR1125612058D No. 49 from Graduate School, Chulalongkorn University. Institutional Review Board Statement: Not applicable. Informed Consent Statement: Not applicable. Data Availability Statement: The data used to support the findings of this study are included within the article and supplementary information file. Acknowledgments: We would like to thank Yollada Fungthongcharoen for her help in preliminary experiments and Waluga Plaingam, for her help in HPLC analytical processes. Conflicts of Interest: The authors declare no conflict of interest.

References 1. Murphy, M.P.; LeVine, H., 3rd. Alzheimer’s disease and the amyloid-beta peptide. J. Alzheimer’s Dis. 2010, 19, 311–323. [CrossRef] 2. De-Paula, V.J.; Radanovic, M.; Diniz, B.S.; Forlenza, O.V. Alzheimer’s disease. Sub-Cell. Biochem. 2012, 65, 329–352. 3. Hamano, T.; Gendron, T.F.; Causevic, E.; Yen, S.H.; Lin, W.L.; Isidoro, C.; Deture, M.; Ko, L.W. Autophagic-lysosomal perturbation enhances tau aggregation in transfectants with induced wild-type tau expression. Eur. J. Neurosci. 2008, 27, 1119–1130. [CrossRef] 4. Tiraboschi, P.; Hansen, L.A.; Thal, L.J.; Corey-Bloom, J. The importance of neuritic plaques and tangles to the development and evolution of AD. Neurology 2004, 62, 1984–1989. [CrossRef] 5. Serrano-Pozo, A.; Frosch, M.P.; Masliah, E.; Hyman, B.T. Neuropathological alterations in Alzheimer disease. Cold Spring Harb. Perspect. Med. 2011, 1, a006189. [CrossRef] 6. Gong, C.X.; Iqbal, K. Hyperphosphorylation of microtubule-associated protein tau: A promising therapeutic target for Alzheimer disease. Curr. Med. Chem. 2008, 15, 2321–2328. [CrossRef] 7. Prasansuklab, A.; Tencomnao, T. Amyloidosis in Alzheimer’s Disease: The Toxicity of Amyloid Beta (A beta), Mechanisms of Its Accumulation and Implications of Medicinal Plants for Therapy. Evid.-Based Complementary Altern. Med. 2013, 2013, 413808. [CrossRef][PubMed] 8. Luu, L.; Ciccotosto, G.D.; Vella, L.J.; Cheng, L.; Roisman, L.C.; Multhaup, G.; Hill, A.F.; Munter, L.M.; Cappai, R. Amyloid Precursor Protein Dimerisation Reduces Neurite Outgrowth. Mol. Neurobiol. 2019, 56, 13–28. [CrossRef][PubMed] 9. Thinakaran, G.; Koo, E.H. Amyloid precursor protein trafﬁcking, processing, and function. J. Biol. Chem. 2008, 283, 29615–29619. [CrossRef][PubMed] 10. Mullan, M.; Houlden, H.; Windelspecht, M.; Fidani, L.; Lombardi, C.; Diaz, P.; Rossor, M.; Crook, R.; Hardy, J.; Duff, K.; et al. A locus for familial early-onset Alzheimer’s disease on the long arm of chromosome 14, proximal to the alpha 1-antichymotrypsin gene. Nat. Genet. 1992, 2, 340–342. [CrossRef] 11. Scheuner, D.; Eckman, C.; Jensen, M.; Song, X.; Citron, M.; Suzuki, N.; Bird, T.D.; Hardy, J.; Hutton, M.; Kukull, W.; et al. Secreted amyloid beta-protein similar to that in the senile plaques of Alzheimer’s disease is increased in vivo by the presenilin 1 and 2 and APP mutations linked to familial Alzheimer’s disease. Nat. Med. 1996, 2, 864–870. [CrossRef][PubMed] 12. Wang, Y.P.; Wang, Z.F.; Zhang, Y.C.; Tian, Q.; Wang, J.Z. Effect of amyloid peptides on serum withdrawal-induced cell differentiation and cell viability. Cell Res. 2004, 14, 467–472. [CrossRef][PubMed] 13. Kiryushko, D.; Berezin, V.; Bock, E. Regulators of neurite outgrowth: Role of cell adhesion molecules. Ann. N. Y. Acad. Sci. 2004, 1014, 140–154. [CrossRef] 14. Read, D.E.; Gorman, A.M. Involvement of Akt in neurite outgrowth. Cell. Mol. Life Sci. 2009, 66, 2975–2984. [CrossRef] 15. Li, H.L.; Roch, J.M.; Sundsmo, M.; Otero, D.; Sisodia, S.; Thomas, R.; Saitoh, T. Defective neurite extension is caused by a mutation in amyloid beta/A4 (A beta) protein precursor found in familial Alzheimer’s disease. J. Neurobiol. 1997, 32, 469–480. [CrossRef] Pharmaceuticals 2021, 14, 901 22 of 24

16. Bai, Y.; Markham, K.; Chen, F.; Weerasekera, R.; Watts, J.; Horne, P.; Wakutani, Y.; Bagshaw, R.; Mathews, P.M.; Fraser, P.E.; et al. The in vivo brain interactome of the amyloid precursor protein. Mol. Cell. Proteom. 2008, 7, 15–34. [CrossRef][PubMed] 17. Andrews, J.L.; Fernandez-Enright, F. A decade from discovery to therapy: Lingo-1, the dark horse in neurological and psychiatric disorders. Neurosci. Biobehav. Rev. 2015, 56, 97–114. [CrossRef] 18. Fernandez-Enright, F.; Andrews, J.L. Lingo-1: A novel target in therapy for Alzheimer’s disease? Neural Regen. Res. 2016, 11, 88–89. [CrossRef][PubMed] 19. Shao, Z.; Browning, J.L.; Lee, X.; Scott, M.L.; Shulga-Morskaya, S.; Allaire, N.; Thill, G.; Levesque, M.; Sah, D.; McCoy, J.M.; et al. TAJ/TROY, an orphan TNF receptor family member, binds Nogo-66 receptor 1 and regulates axonal regeneration. Neuron 2005, 45, 353–359. [CrossRef] 20. Wang, K.C.; Kim, J.A.; Sivasankaran, R.; Segal, R.; He, Z. P75 interacts with the Nogo receptor as a co-receptor for Nogo, MAG and OMgp. Nature 2002, 420, 74–78. [CrossRef][PubMed] 21. Calabrese, E.J. Enhancing and regulating neurite outgrowth. Crit. Rev. Toxicol. 2008, 38, 391–418. [CrossRef][PubMed] 22. Huang, E.J.; Reichardt, L.F. Neurotrophins: Roles in neuronal development and function. Annu. Rev. Neurosci. 2001, 24, 677–736. [CrossRef] 23. Larkfors, L.; Ebendal, T.; Whittemore, S.R.; Persson, H.; Hoffer, B.; Olson, L. Decreased level of nerve growth factor (NGF) and its messenger RNA in the aged rat brain. Brain Res. 1987, 427, 55–60. [CrossRef] 24. Bartus, R.T. On neurodegenerative diseases, models, and treatment strategies: Lessons learned and lessons forgotten a generation following the cholinergic hypothesis. Exp. Neurol. 2000, 163, 495–529. [CrossRef] 25. Budni, J.; Bellettini-Santos, T.; Mina, F.; Garcez, M.L.; Zugno, A.I. The involvement of BDNF, NGF and GDNF in aging and Alzheimer’s disease. Aging Dis. 2015, 6, 331–341. [CrossRef][PubMed] 26. Granholm, A.C.; Albeck, D.; Backman, C.; Curtis, M.; Ebendal, T.; Friden, P.; Henry, M.; Hoffer, B.; Kordower, J.; Rose, G.M.; et al. A non-invasive system for delivering neural growth factors across the blood-brain barrier: A review. Rev. Neurosci. 1998, 9, 31–55. [CrossRef] 27. Pardridge, W.M. Neurotrophins, neuroprotection and the blood-brain barrier. Curr. Opin. Investig. Drugs 2002, 3, 1753–1757. 28. Nitta, A.; Murakami, Y.; Furukawa, Y.; Kawatsura, W.; Hayashi, K.; Yamada, K.; Hasegawa, T.; Nabeshima, T. Oral administration of idebenone induces nerve growth factor in the brain and improves learning and memory in basal forebrain-lesioned rats. Naunyn-Schmiedeberg’s Arch. Pharmacol. 1994, 349, 401–407. [CrossRef] 29. Tohda, C.; Kuboyama, T.; Komatsu, K. Search for natural products related to regeneration of the neuronal network. Neuro-Signals 2005, 14, 34–45. [CrossRef] 30. More, S.V.; Koppula, S.; Kim, I.S.; Kumar, H.; Kim, B.W.; Choi, D.K. The role of bioactive compounds on the promotion of neurite outgrowth. Molecules 2012, 17, 6728–6753. [CrossRef] 31. Duangjan, C.; Rangsinth, P.; Zhang, S.; Wink, M.; Tencomnao, T. Anacardium Occidentale, L. Leaf Extracts Protect Against Glutamate/H2O2-Induced Oxidative Toxicity and Induce Neurite Outgrowth: The Involvement of SIRT1/Nrf2 Signaling Pathway and Teneurin 4 Transmembrane Protein. Front. Pharmacol. 2021, 12, 627738. [CrossRef][PubMed] 32. Chanwitheesuk, A.; Teerawutgulrag, A.; Rakariyatham, N. Screening of antioxidant activity and antioxidant compounds of some edible plants of Thailand. Food Chem. 2005, 92, 491–497. [CrossRef] 33. Rangsinth, P.; Prasansuklab, A.; Duangjan, C.; Gu, X.; Meemon, K.; Wink, M.; Tencomnao, T. Leaf extract of Caesalpinia mimosoides enhances oxidative stress resistance and prolongs lifespan in Caenorhabditis elegans. BMC Complementary Altern. Med. 2019, 19, 164. [CrossRef] 34. Yodsaoue, O.; Karalai, C.; Ponglimanont, C.; Tewtrakul, S.; Chantrapromma, S. Potential anti-inﬂammatory diterpenoids from the roots of Caesalpinia mimosoides Lamk. Phytochemistry 2010, 71, 1756–1764. [CrossRef] 35. Rattanata, N.; Klaynongsruang, S.; Daduang, S.; Tavichakorntrakool, R.; Limpaiboon, T.; Lekphrom, R.; Boonsiri, P.; Daduang, J. Inhibitory Effects of Gallic Acid Isolated from Caesalpinia mimosoides Lamk on Cholangiocarcinoma Cell Lines and Foodborne Pathogenic Bacteria. Asian Pac. J. Cancer Prev. 2016, 17, 1341–1345. [CrossRef] 36. Tangsaengvit, N.; Kitphati, W.; Tadtong, S.; Bunyapraphatsara, N.; Nukoolkarn, V. Neurite Outgrowth and Neuroprotective Effects of Quercetin from Caesalpinia mimosoides Lamk. on Cultured P19-Derived Neurons. Evid.-Based Complementary Altern. Med. 2013, 2013, 838051. [CrossRef] 37. Pervin, M.; Unno, K.; Ohishi, T.; Tanabe, H.; Miyoshi, N.; Nakamura, Y. Beneﬁcial Effects of Green Tea Catechins on Neurodegen- erative Diseases. Molecules 2018, 23, 1297. [CrossRef] 38. Nakajima, K.-I.; Niisato, N.; Marunaka, Y. Quercetin stimulates NGF-induced neurite outgrowth in PC12 cells via activation of Na+/K+/2Cl− cotransporter. Cell. Physiol. Biochem. 2011, 28, 147–156. [CrossRef][PubMed] 39. Chen, M.-M.; Yin, Z.-Q.; Zhang, L.-Y.; Liao, H. Quercetin promotes neurite growth through enhancing intracellular cAMP level and GAP-43 expression. Chin. J. Nat. Med. 2015, 13, 667–672. [CrossRef] 40. Cagnin, M.; Ozzano, M.; Bellio, N.; Fiorentino, I.; Follo, C.; Isidoro, C. Dopamine induces apoptosis in APPswe-expressing Neuro2A cells following Pepstatin-sensitive proteolysis of APP in acid compartments. Brain Res. 2012, 1471, 102–117. [CrossRef] [PubMed] 41. Resende, R.; Ferreira-Marques, M.; Moreira, P.; Coimbra, J.R.M.; Baptista, S.J.; Isidoro, C.; Salvador, J.A.R.; Dinis, T.C.P.; Pereira, C.F.; Santos, A.E. New BACE1 Chimeric Peptide Inhibitors Selectively Prevent AβPP-β Cleavage Decreasing Amyloid-β Production and Accumulation in Alzheimer’s Disease Models. J. Alzheimer’s Dis. 2020, 76, 1317–1337. [CrossRef][PubMed] Pharmaceuticals 2021, 14, 901 23 of 24

42. Shigeta, M.; Shibukawa, Y.; Ihara, H.; Miyoshi, E.; Taniguchi, N.; Gu, J. Beta1,4-N-Acetylglucosaminyltransferase III potentiates beta1 integrin-mediated neuritogenesis induced by serum deprivation in Neuro2a cells. Glycobiology 2006, 16, 564–571. [CrossRef] [PubMed] 43. Suzuki, N.; Numakawa, T.; Chou, J.; de Vega, S.; Mizuniwa, C.; Sekimoto, K.; Adachi, N.; Kunugi, H.; Arikawa-Hirasawa, E.; Yamada, Y.; et al. Teneurin-4 promotes cellular protrusion formation and neurite outgrowth through focal adhesion kinase signaling. FASEB J. 2014, 28, 1386–1397. [CrossRef][PubMed] 44. Gohlke, H.; Hendlich, M.; Klebe, G. Knowledge-based scoring function to predict protein-ligand interactions. J. Mol. Biol. 2000, 295, 337–356. [CrossRef] 45. Ramírez, D.; Caballero, J. Is It Reliable to Take the Molecular Docking Top Scoring Position as the Best Solution without Considering Available Structural Data? Molecules 2018, 23, 1038. [CrossRef] 46. Shimmyo, Y.; Kihara, T.; Akaike, A.; Niidome, T.; Sugimoto, H. Flavonols and flavones as BACE-1 inhibitors: Structure–activity relationship in cell-free, cell-based and in silico studies reveal novel pharmacophore features. Biochim. Biophys. Acta (BBA)-Gen. Subj. 2008, 1780, 819–825. [CrossRef][PubMed] 47. Mphahlele, M.J.; Agbo, E.N.; More, G.K.; Gildenhuys, S. In Vitro Enzymatic and Kinetic Studies, and In Silico Drug-Receptor Interactions, and Drug-Like Profiling of the 5-Styrylbenzamide Derivatives as Potential Cholinesterase and β-Secretase Inhibitors with Antioxidant Properties. Antioxidants 2021, 10, 647. [CrossRef][PubMed] 48. Lu, Y.; Liu, Q.; Yu, Q. Quercetin enrich diet during the early-middle not middle-late stage of alzheimer’s disease ameliorates cognitive dysfunction. Am. J. Transl. Res. 2018, 10, 1237–1246. [PubMed] 49. Pires, D.E.V.; Blundell, T.L.; Ascher, D.B. pkCSM: Predicting Small-Molecule Pharmacokinetic and Toxicity Properties Using Graph-Based Signatures. J. Med. Chem. 2015, 58, 4066–4072. [CrossRef] 50. Lipinski, C.A.; Lombardo, F.; Dominy, B.W.; Feeney, P.J. Experimental and computational approaches to estimate solubility and permeability in drug discovery and development settings. Adv. Drug Deliv. Rev. 2001, 46, 3–26. [CrossRef] 51. Schachter, S.C. Botanicals and herbs: A traditional approach to treating epilepsy. Neurotherapeutics 2009, 6, 415–420. [CrossRef] [PubMed] 52. Benowitz, L.I.; Routtenberg, A. GAP-43: An intrinsic determinant of neuronal development and plasticity. Trends Neurosci. 1997, 20, 84–91. [CrossRef] 53. Aarts, L.H.; Schotman, P.; Verhaagen, J.; Schrama, L.H.; Gispen, W.H. The role of the neural growth associated protein B-50/GAP- 43 in morphogenesis. Adv. Exp. Med. Biol. 1998, 446, 85–106. [PubMed] 54. Gundimeda, U.; McNeill, T.H.; Schiffman, J.E.; Hinton, D.R.; Gopalakrishna, R. Green tea polyphenols potentiate the action of nerve growth factor to induce neuritogenesis: Possible role of reactive oxygen species. J. Neurosci. Res. 2010, 88, 3644–3655. [CrossRef] 55. Lai, H.C.; Wu, M.J.; Chen, P.Y.; Sheu, T.T.; Chiu, S.P.; Lin, M.H.; Ho, C.T.; Yen, J.H. Neurotrophic effect of citrus 5-hydroxy- 3,6,7,8,30,40-hexamethoxyflavone: Promotion of neurite outgrowth via cAMP/PKA/CREB pathway in PC12 cells. PLoS ONE 2011, 6, e28280. [CrossRef][PubMed] 56. Phan, C.W.; David, P.; Wong, K.H.; Naidu, M.; Sabaratnam, V. Uridine from Pleurotus giganteus and Its Neurite Outgrowth Stimulatory Effects with Underlying Mechanism. PLoS ONE 2015, 10, e0143004. [CrossRef] 57. Wansawat, S.; Mani Iyer, P.; Isidoro, C.; Tencomnao, T. Mucuna pruriens Seed Extract Promotes Neurite Outgrowth via TEN-4 Dependent and Independent Mechanisms in NEURO2A Cells. Sains Malays. 2018, 47, 3009–3015. [CrossRef] 58. Duangjan, C.; Rangsinth, P.; Zhang, S.; Gu, X.; Wink, M.; Tencomnao, T. Neuroprotective Effects of Glochidion zeylanicum Leaf Extract against H2O2/Glutamate-Induced Toxicity in Cultured Neuronal Cells and Aβ-Induced Toxicity in Caenorhabditis elegans. Biology 2021, 10, 800. [CrossRef][PubMed] 59. Duangjan, C.; Rangsinth, P.; Zhang, S.; Gu, X.; Wink, M.; Tencomnao, T. Vitis Vinifera Leaf Extract Protects Against Glutamate- Induced Oxidative Toxicity in HT22 Hippocampal Neuronal Cells and Increases Stress Resistance Properties in Caenorhabditis Elegans. Front. Nutr. 2021, 8, 250. 60. Zhang, S.; Duangjan, C.; Tencomnao, T.; Liu, J.; Lin, J.; Wink, M.J.F. Function, Neuroprotective effects of oolong tea extracts against glutamate-induced toxicity in cultured neuronal cells and β-amyloid-induced toxicity in Caenorhabditis elegans. Food Funct. 2020, 11, 8179–8192. [CrossRef][PubMed] 61. de Laat, R.; Meabon, J.S.; Wiley, J.C.; Hudson, M.P.; Montine, T.J.; Bothwell, M. LINGO-1 promotes lysosomal degradation of amyloid-β protein precursor. Pathobiol. Aging Age Relat. Dis. 2015, 5, 25796. [CrossRef][PubMed] 62. Fan, T.K.; Gundimeda, U.; Mack, W.J.; Gopalakrishna, R. Counteraction of Nogo-A and axonal growth inhibitors by green tea polyphenols and other natural products. Neural Regen. Res. 2016, 11, 545–546. 63. Liu, W.; Zhou, Y.; Jia, Q.; Han, B.; Zhang, G. Effects of Fujian tablet on Nogo-A mRNA expression and plasticity of the corticospinal tract in a rat model of focal cerebral ischemia. Neural Regen. Res. 2011, 6, 2577–2581. 64. Qin, X.D.; Kang, L.Y.; Liu, Y.; Huang, Y.; Wang, S.; Zhu, J.Q. Chinese Medicine’s Intervention Effect on Nogo-A/NgR. Evid.-Based Complementary Altern. Med. 2012, 2012, 528482. [CrossRef][PubMed] 65. Palazzolo, G.; Horvath, P.; Zenobi-Wong, M. The flavonoid isoquercitrin promotes neurite elongation by reducing RhoA activity. PLoS ONE 2012, 7, e49979. [CrossRef] 66. Jung, H.A.; Karki, S.; Kim, J.H.; Choi, J.S. BACE1 and cholinesterase inhibitory activities of Nelumbo nucifera embryos. Arch. Pharmacal Res. 2015, 38, 1178–1187. [CrossRef] Pharmaceuticals 2021, 14, 901 24 of 24

67. Yang, M.; Zhou, K.Y.; Li, F.F.; Yang, H.Y.; Yin, M.; Zhang, L.H.; Wang, F.S. Effects of Gentiana delavayi Flower Extract on APP Processing in APP/PS1 CHO Cells. Biol. Pharm. Bull. 2020, 43, 767–773. [CrossRef] 68. Song, Y.; Kim, H.D.; Lee, M.K.; Kim, M.K.; Kang, S.N.; Ko, Y.G.; Won, C.K.; Kim, G.S.; Lee, S.S.; Bai, H.W.; et al. Protective effect of centipedegrass against Aβ oligomerization and Aβ-mediated cell death in PC12 cells. Pharm. Biol. 2015, 53, 1260–1266. [CrossRef] 69. Khan, M.I.; Shin, J.H.; Kim, M.Y.; Shin, T.S.; Kim, J.D. Green Tea Seed Isolated Theasaponin E1 Ameliorates AD Promoting Neurotoxic Pathogenesis by Attenuating Aβ Peptide Levels in SweAPP N2a Cells. Molecules 2020, 25, 2334. [CrossRef] 70. Cao, G.; Su, P.; Zhang, S.; Guo, L.; Zhang, H.; Liang, Y.; Qin, C.; Zhang, W. Ginsenoside Re reduces Aβ production by activating PPARγ to inhibit BACE1 in N2a/APP695 cells. Eur. J. Pharmacol. 2016, 793, 101–108. [CrossRef] 71. Di Meo, F.; Valentino, A.; Petillo, O.; Peluso, G.; Filosa, S.; Crispi, S. Bioactive Polyphenols and Neuromodulation: Molecular Mechanisms in Neurodegeneration. Int. J. Mol. Sci. 2020, 21, 2564. [CrossRef][PubMed] 72. Wang, C.J.; Qu, C.Q.; Zhang, J.; Fu, P.C.; Guo, S.G.; Tang, R.H. Lingo-1 inhibited by RNA interference promotes functional recovery of experimental autoimmune encephalomyelitis. Anat. Rec. 2014, 297, 2356–2363. [CrossRef][PubMed] 73. Xu, Y.; Li, M.J.; Greenblatt, H.; Chen, W.; Paz, A.; Dym, O.; Peleg, Y.; Chen, T.; Shen, X.; He, J.; et al. Flexibility of the ﬂap in the active site of BACE1 as revealed by crystal structures and molecular dynamics simulations. Acta Crystallogr. Sect. D Biol. Crystallogr. 2012, 68 Pt 1, 13–25. [CrossRef] 74. Rangsinth, P.; Sillapachaiyaporn, C.; Nilkhet, S.; Tencomnao, T.; Ung, A.T.; Chuchawankul, S. Mushroom-derived bioactive compounds potentially serve as the inhibitors of SARS-CoV-2 main protease: An in silico approach. J. Tradit. Complementary Med. 2021, 11, 158–172. [CrossRef][PubMed]