DOCSLIB.ORG

Calcium Signaling, Second Edition

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Calcium Signaling, Second Edition This is a free sample of content from Calcium Signaling, Second Edition. Click here for more information on how to buy the book. Index A ANO1, 441 ABT-199/Venetoclax, 471, 473 AP. See Action potential Action potential (AP), 407 Aquaporin, 441 Activin-A, 389 ARF1, 291 AD. See Alzheimer’s disease Arteriosclerosis. See Calcification ADAM10, 551 ASD. See Autism spectrum disorder Addiction. See Drug addiction Astrocyte Adenylyl cyclase, CRAC channel calcium brain aging modulation, 72–73 Alzheimer’s disease Aging amyloid-b effects on calcium dynamics, brain 549–550 Alzheimer’s disease astrogliopathology, 548–549 amyloid-b effects on calcium calcium signaling in astrocytes, 549–552 dynamics, 549–550 endoplasmic reticulum calcium release and astrogliopathology, 548–549 astrogliotic response, 552 calcium signaling in astrocytes, 549–552 astroglia support over life, 546–547 endoplasmic reticulum calcium release and ionic signaling and excitability, 547 astrogliotic response, 552 physiology in aging, 547–548 astrocyte transcription-dependent metabolic plasticity, 391–393 astroglia support over life, 546–547 ATF3, 389 ionic signaling and excitability, 547 Atherosclerosis. See Calcification physiology in aging, 547–548 Atrap, 164 overview, 545–546 Autism spectrum disorder (ASD) tissue calcification, 534–535 IL1RAPL1 mutations, 296 AKAP9, 470 parvalbumin neurons, 228–229 AKAP79, 75 ALN, 163 B Alzheimer’s disease (AD) BAP1, 482 astrocyte aging Bcl-2 amyloid-b effects on calcium dynamics, 549–550 endoplasmic reticulum function, 465–466 astrogliopathology, 548–549 immunity role, 465 calcium signaling in astrocytes, 549–552 IP receptor interactions endoplasmic reticulum calcium release and 3 modulators astrogliotic response, 552 Bcl-2, 134–138 calcium dysregulation, 501–502 Bcl-2L10, 140–141 calcium homeostasis Bcl-Xl, 138–140 IP3 receptor, 510–511 Bok stabilization, 132, 134 mitochondrial calcium handling, 512–513 Mcl-1, 140 ryanodine receptor, 511–512 overview, 133 store-operated calcium entry, 512 overview, 464, 466–467 CALHM1 receptor, 510 therapeutic targeting in cancer epidemiology, 500 Bcl-2 and cell death signaling, 469–470 histopathology, 500 BIRD-2, 468–469, 490 nicotinic acetylcholine receptors, 507–509 prospects, 473–474 NMDA receptors, 503, 506–507 small molecule mimics of BIRD-2, 470–473 purinergic receptors, 509–510 TAT-Pep2, 467–469 AMPA receptor, 383, 506 protein types and functions, 127–129, 465 AmpII, 413 ryanodine receptor modulation Amyloid-b. See Alzheimer’s disease Bcl-2, 141–142 559 © 2019 by Cold Spring Harbor Laboratory Press. All rights reserved This is a free sample of content from Calcium Signaling, Second Edition. Click here for more information on how to buy the book. Index Bcl-2 (Continued) diabetes, 329 Bcl-Xl, 142 kidney dysfunction and hypertension, 328–329 overview, 141 neurotoxicity, 329–330 VDAC modulation, 142–145 isozymes, 319–321 BIN-1, 413 short linear motif mediation of substrate recognition BiP/GRP78, endoplasmic reticulum function, 248–249 coordination of motifs during substrate BIRD-2, 136, 468–469, 490 dephosphorylation, 324–325 Bok, IP3 receptor stabilization, 132, 134 LxVP motif, 323–324 Bone. See Calcification overview, 322–323 BRAF, 485–486 PxlxIT motif, 323 Brain aging. See Aging signaling network evolution, 325–326 BTG2, 389 substrate identification Buffer proteins. See Cytosolic calcium buffers affinity purification–mass spectrometry, 326–327 in silico strategies, 327–328 overview, 326 C phosphoproteomics, 326 Cab45, 253 Calcium CaBPs. See Calcium-binding proteins amplitude and frequency modulation of signal, 69–70 CAC-NA2D2, 484 homeostasis overview, 202 CAC-NA2D3, 485 intracellular levels and signaling overview, 1–5 / CAD SOAR, 39–40, 44–46, 49, 56 local signals and discrete communication, 9–12 cADPR. See Cyclic ADP-ribose oscillations Caenorhabditis. See Planarian flatworm high-fidelity signaling, 7–9 Calbindin-D9k spatial profile, 70–72 functions, 232 Calcium-binding proteins (CaBPs) regulation, 232 CaBP1, 299–302 structure, 230–232 CaBP2, 299, 301–303 Calbindin-D28k CaBP3, 298 function, 233 CaBP4, 300–304 regulation, 233–234 CaBP5, 302 structure, 232–233 CaBP7, 298 Calcification CaBP8, 298 calcium salt types and distribution, 528 diseases, 303–304 mineral homeostasis, 525–526 overview, 297–303 pathological calcification Calcium/calmodulin-dependent protein blood vessels kinase II (CaMKII) aging and senescence, 534–535 Alzheimer’s disease, 551 apoptosis and necrosis, 531–532 autoinhibition, 267–268, 270 calcification inhibitors and triggers, 529–530 calcium pulse frequency sensitivity, 273 calcium-sensing receptor, 530–531 calmodulin trapping, 272 endoplasmic reticulum stress, 532–533 glycosylation, 273–274 matrix vesicle/exosome calcium release, 534 hub domain stoichiometry and geometry, 274–275 mitochondrial calcium and mitophagy, kinase domain tethering to central hub 533–534 assembly, 270–272 vascular smooth muscle cell calcium flux, 529 methionine oxidation, 273–274 fibrodysplasia ossificans progressiva, 536 oocyte/egg calcium signaling, 342 heart valve, 535–536 overview, 265–267 kidney stone, 536 phosphorylation, 269–270 osteoarthritis, 536 prospects for study, 278 overview, 527–528 substrate capture for phosphorylation, 272–273 prospects for study, 536–537 subunit exchange triggered by activation, 276–278 physiological calcification and calcium signaling, synapse-to-nucleus calcium-dependent 526–527 communication, 383–384 Calcineurin Calcium/calmodulin-dependent protein kinase IV activation, 321–322 (CaMKIV), synapse-to-nucleus Alzheimer’s disease, 551 calcium-dependent communication, calcineurin-b1, 322 383–384 inhibitor therapy adverse effects with cyclosporin Calcium-induced calcium release (CICR), 111, 116, A and tacrolimus 202, 412–413 560 © 2019 by Cold Spring Harbor Laboratory Press. All rights reserved This is a free sample of content from Calcium Signaling, Second Edition. Click here for more information on how to buy the book. Index Calcium-sensing receptor (CaSR), blood vessel IP3 receptors, 413–415 calcification, 530–531 mitochondrial calcium, 416–417 Caldendrin, 301 ryanodine receptor, 415–416 CALHM1 receptor, neurodegenerative disease, 510 STIM/Orai, 416 Calmodulin. See also Calcium/calmodulin-dependent two-pore channels, 415 protein kinase II; Calcium/calmodulin- prospects for calcium studies, 422–423 dependent protein kinase IV relaxation and calcium clearance, 410–411 CRAC channel–PMCA pump signal linking, 76–77 transverse and axial tubule system and microdomain diseases, 288–289 signaling, 410, 412–413 functional overview, 286–288 CaSR. See Calcium-sensing receptor TRP channel interactions, 31 Catecholaminergic polymorphic ventricular Calneuron 1, 299, 302–303 tachycardia (CPVT), 418–420 Calneuron 2, 299, 302–303 CAX, 438 CALNUC, Golgi function, 253 CBP, 384–386, 390 Calreticulin CCK. See Cholecystokinin endoplasmic reticulum function, 247–248 CD47, 531 function, 235–236 Cellular reticular network (CRN) regulation, 236–237 calcium dynamics, 245–246 structure, 234–235 endoplasmic reticulum Calsequestrin, sarcoplasmic reticulum function, 250–251 BiP/GRP78, 248–249 Calumenin, Golgi function, 253 calreticulin, 247–248 CaMKII. See Calcium/calmodulin-dependent GRP94, 249 protein kinase II overview, 246–247 CaMKIV. See Calcium/calmodulin-dependent protein disulfide isomerase, 249–250 protein kinase IV endosome, 254 CAMTA1, 382, 386 Golgi Cancer CALNUC, 253 calcium signaling remodeling calumenin, 253 cell death, 486–487 overview, 252–253 metastasis, 485–486 p54/NEFA, 253–254 ORAI1, 483, 485, 488 mitochondria, 252 ORAI3, 481–482 peroxisome, 254 proliferation, 483–485 prospects for study, 254–255 prospects for study, 490–491 sarcoplasmic reticulum PTEN, 482 calsequestrin, 250–251 STIM, 482–483, 485, 487 HRC, 251 therapeutic targeting, 488–490 junctate, 251–252 TRPM8, 481 overview, 250 TRPV4, 481, 486–489 sarcalumenin, 252 TRPV6, 481 Cholecystokinin (CCK), 108, 439–440 tumor microenvironment, 487–488 Chronic pain, synapse-to-nucleus calcium-dependent IP3 receptor–Bcl-2 interactions communication, 389–390 overview, 464, 466–467 CICR. See Calcium-induced calcium release therapeutic targeting CLN3 disease, 210–211 Bcl-2 and cell death signaling, 469–470 CPVT. See Catecholaminergic polymorphic ventricular BIRD-2, 468–469, 490 tachycardia prospects, 473–474 CRAC channel small molecule mimics of BIRD-2, 470–473 calcium tunneling through endoplasmic reticulum TAT-Pep2, 467–469 near Orai1 channels, 80–81 SERCA, 480, 490 clustering and signal strength, 75–76 store-operated calcium entry, 479, 482, 485, 487 functional overview, 38, 43, 71 Cardiac hypertrophy, calcium in remodeling, 420–422 PMCA pump cross talk, 76–80 Cardiomyocyte structure, 43–44 excitation–contraction coupling targets for local calcium entry calcium transient generation and contraction adenylyl cyclase, 72–73 induction, 408–410 NFAT, 74–75 remodeling in disease, 417–422 phospholipase A2,73–74 tuning, 411–412 PIP5 kinase, 74 non-canonical calcium signal generation CREB, 301, 382, 384–386, 390, 392–393 561 © 2019 by Cold Spring Harbor Laboratory Press. All rights reserved This is a free sample of content from Calcium Signaling, Second Edition. Click here for more information on how to buy the book. Index CREST, 384 signaling complexes and membrane junctions, CRN. See Cellular reticular network 57–59 Cyclic ADP-ribose (cADPR), cardiomyocyte stimulus intensities and activation of SOCE, 59–60 signaling, 415–416 Bcl-2 function, 465–466 Cyclosporin A. See Calcineurin CRAC channel clustering, 75–76 Cytosolic calcium buffers endoplasmic
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Early B-Cell Factors Are Required for Specifying Multiple Retinal Cell Types and Subtypes from Postmitotic Precursors
    11902 • The Journal of Neuroscience, September 8, 2010 • 30(36):11902–11916 Development/Plasticity/Repair Early B-Cell Factors Are Required for Specifying Multiple Retinal Cell Types and Subtypes from Postmitotic Precursors Kangxin Jin,1,2 Haisong Jiang,1,2 Zeqian Mo,3 and Mengqing Xiang1,2 1Center for Advanced Biotechnology and Medicine and Department of Pediatrics, 2Graduate Program in Molecular Genetics, Microbiology and Immunology, and 3Department of Cell Biology and Neuroscience, University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, Piscataway, New Jersey 08854 The establishment of functional retinal circuits in the mammalian retina depends critically on the proper generation and assembly of six classes of neurons, five of which consist of two or more subtypes that differ in morphologies, physiological properties, and/or sublaminar positions. How these diverse neuronal types and subtypes arise during retinogenesis still remains largely to be defined at the molecular level. Here we show that all four family members of the early B-cell factor (Ebf) helix-loop-helix transcription factors are similarly expressedduringmouseretinogenesisinseveralneuronaltypesandsubtypesincludingganglion,amacrine,bipolar,andhorizontalcells, and that their expression in ganglion cells depends on the ganglion cell specification factor Brn3b. Misexpressed Ebfs bias retinal precursors toward the fates of non-AII glycinergic amacrine, type 2 OFF-cone bipolar and horizontal cells, whereas a dominant-negative Ebf suppresses the differentiation of these cells as well as ganglion cells. Reducing Ebf1 expression by RNA interference (RNAi) leads to an inhibitory effect similar to that of the dominant-negative Ebf, effectively neutralizes the promotive effect of wild-type Ebf1, but has no impact on the promotive effect of an RNAi-resistant Ebf1.
    [Show full text]
  • 1 Metabolic Dysfunction Is Restricted to the Sciatic Nerve in Experimental
    Page 1 of 255 Diabetes Metabolic dysfunction is restricted to the sciatic nerve in experimental diabetic neuropathy Oliver J. Freeman1,2, Richard D. Unwin2,3, Andrew W. Dowsey2,3, Paul Begley2,3, Sumia Ali1, Katherine A. Hollywood2,3, Nitin Rustogi2,3, Rasmus S. Petersen1, Warwick B. Dunn2,3†, Garth J.S. Cooper2,3,4,5* & Natalie J. Gardiner1* 1 Faculty of Life Sciences, University of Manchester, UK 2 Centre for Advanced Discovery and Experimental Therapeutics (CADET), Central Manchester University Hospitals NHS Foundation Trust, Manchester Academic Health Sciences Centre, Manchester, UK 3 Centre for Endocrinology and Diabetes, Institute of Human Development, Faculty of Medical and Human Sciences, University of Manchester, UK 4 School of Biological Sciences, University of Auckland, New Zealand 5 Department of Pharmacology, Medical Sciences Division, University of Oxford, UK † Present address: School of Biosciences, University of Birmingham, UK *Joint corresponding authors: Natalie J. Gardiner and Garth J.S. Cooper Email: [email protected]; [email protected] Address: University of Manchester, AV Hill Building, Oxford Road, Manchester, M13 9PT, United Kingdom Telephone: +44 161 275 5768; +44 161 701 0240 Word count: 4,490 Number of tables: 1, Number of figures: 6 Running title: Metabolic dysfunction in diabetic neuropathy 1 Diabetes Publish Ahead of Print, published online October 15, 2015 Diabetes Page 2 of 255 Abstract High glucose levels in the peripheral nervous system (PNS) have been implicated in the pathogenesis of diabetic neuropathy (DN). However our understanding of the molecular mechanisms which cause the marked distal pathology is incomplete. Here we performed a comprehensive, system-wide analysis of the PNS of a rodent model of DN.
    [Show full text]
  • Altered Calcium Handling in Cerebellar Purkinje Neurons with the Malignant Hyperthermia Mutation, Ryr1-Y522S/+
    University of Denver Digital Commons @ DU Electronic Theses and Dissertations Graduate Studies 1-1-2011 Altered Calcium Handling in Cerebellar Purkinje Neurons with the Malignant Hyperthermia Mutation, RyR1-Y522S/+ George C. Talbott University of Denver Follow this and additional works at: https://digitalcommons.du.edu/etd Part of the Biochemistry, Biophysics, and Structural Biology Commons, and the Biology Commons Recommended Citation Talbott, George C., "Altered Calcium Handling in Cerebellar Purkinje Neurons with the Malignant Hyperthermia Mutation, RyR1-Y522S/+" (2011). Electronic Theses and Dissertations. 638. https://digitalcommons.du.edu/etd/638 This Thesis is brought to you for free and open access by the Graduate Studies at Digital Commons @ DU. It has been accepted for inclusion in Electronic Theses and Dissertations by an authorized administrator of Digital Commons @ DU. For more information, please contact [email protected],[email protected]. ALTERED CALCIUM HANDLING IN CEREBELLAR PURKINJE NEURONS WITH THE MALIGNANT HYPERTHERMIA MUTATION, RYR1 Y522S/+ __________ A Thesis Presented to The Faculty of Natural Sciences and Mathematics University of Denver __________ In Partial Fulfillment of the Requirements for the Degree Master of Science __________ by George C. Talbott June 2011 Advisor: Nancy M. Lorenzon, PhD ©Copyright by George C. Talbott 2011 All Rights Reserved Author: George C. Talbott Title: ALTERED CALCIUM HANDLING IN CEREBELLAR PURKINJE NEURONS WITH THE MALIGNANT HYPERTHERMIA MUTATION, RYR1 Y522S/+ Advisor: Nancy M. Lorenzon, PhD Degree Date: June 2011 Abstract To investigate the etiology of malignant hyperthermia and central core disease, mouse models have recently been generated and characterized (Chelu et al., 2006). These RyR Y522S/+ knock-in mutant mice provide an excellent tool to investigate calcium dysregulation, its pathological consequences, and potential therapeutic approaches.
    [Show full text]
  • Synergetic Effect of Recoverin and Calmodulin on Regulation of Rhodopsin Kinase
    Thomas Jefferson University Jefferson Digital Commons Department of Biochemistry and Molecular Department of Biochemistry and Molecular Biology Faculty Papers Biology 1-1-2012 Synergetic effect of recoverin and calmodulin on regulation of rhodopsin kinase. Ilya I Grigoriev Lomonosov Moscow State University Ivan I Senin Lomonosov Moscow State University Natalya K Tikhomirova Lomonosov Moscow State University Konstantin E Komolov Lomonosov Moscow State University; University of Oldenburg, Oldenburg, Germany; Department of FBiochemistrollow this andy and additional Molecular works Biology at: ,https:/ Thomas/jdc.jeff Jeffersonerson.edu/bmpfp University Ser geiPar tE of P theermy Medicalakov Biochemistry Commons, and the Medical Molecular Biology Commons LetInstitute us for knowBiological Instrumentationhow access of the tRussiano this Academy document of Sciences benefits ouy RecommendedSee next page for Citation additional authors Grigoriev, Ilya I; Senin, Ivan I; Tikhomirova, Natalya K; Komolov, Konstantin E; Permyakov, Sergei E; Zernii, Evgeni Yu; Koch, Karl-Wilhelm; and Philippov, Pavel P, "Synergetic effect of recoverin and calmodulin on regulation of rhodopsin kinase." (2012). Department of Biochemistry and Molecular Biology Faculty Papers. Paper 36. https://jdc.jefferson.edu/bmpfp/36 This Article is brought to you for free and open access by the Jefferson Digital Commons. The Jefferson Digital Commons is a service of Thomas Jefferson University's Center for Teaching and Learning (CTL). The Commons is a showcase for Jefferson books and journals, peer-reviewed scholarly publications, unique historical collections from the University archives, and teaching tools. The Jefferson Digital Commons allows researchers and interested readers anywhere in the world to learn about and keep up to date with Jefferson scholarship. This article has been accepted for inclusion in Department of Biochemistry and Molecular Biology Faculty Papers by an authorized administrator of the Jefferson Digital Commons.
    [Show full text]
  • FAM210A Is a Novel Determinant of Bone and Muscle Structure And
    FAM210A is a novel determinant of bone and muscle PNAS PLUS structure and strength Ken-ichiro Tanakaa, Yingben Xuea, Loan Nguyen-Yamamotoa, John A. Morrisb,c,d, Ippei Kanazawae, Toshitsugu Sugimotoe, Simon S. Winga,f, J. Brent Richardsb,c,d, and David Goltzmana,f,1 aCalcium Research Laboratory, Metabolic Disorders and Complications Program, Research Institute of the McGill University Health Centre, Montreal, QC, Canada H4A 3J1; bDepartment of Medicine, McGill University, Montreal, QC, Canada H3T 1E2; cDepartment of Human Genetics, Jewish General Hospital, McGill University, Montreal, QC, Canada H3T 1E2; dDepartment of Epidemiology and Biostatistics, Jewish General Hospital, McGill University, Montreal, QC, Canada H3T 1E2; eInternal Medicine 1, Faculty of Medicine, Shimane University, 693-8501 Shimane, Japan; and fDivision of Endocrinology, Department of Medicine, McGill University, Montreal, QC, Canada H4A 3J1 Edited by John T. Potts, Massachusetts General Hospital, Charlestown, MA, and approved March 14, 2018 (received for review November 1, 2017) Osteoporosis and sarcopenia are common comorbid diseases, yet TOM1L2/SREBF1 locus were found to exert opposing effects on their shared mechanisms are largely unknown. We found that total body lean mass and total body less head BMD (13). SREBP- genetic variation near FAM210A was associated, through large 1, and the product of the SREBF1 gene, is known to exert op- genome-wide association studies, with fracture, bone mineral posing effects on osteoblast and myoblast differentiation (14, 15). density (BMD), and appendicular and whole body lean mass, in However, more commonly, bone loss coincides with a decrease in humans. In mice, Fam210a was expressed in muscle mitochondria muscle mass and function, suggesting that there are shared bio- and cytoplasm, as well as in heart and brain, but not in bone.
    [Show full text]
  • Myoplasmic Resting Ca2+ Regulation by Ryanodine Receptors Is
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Georgia State University Georgia State University ScholarWorks @ Georgia State University Chemistry Faculty Publications Department of Chemistry 2014 Myoplasmic resting Ca2+ regulation by ryanodine receptors is under the control of a novel Ca2+- binding region of the receptor Yanyi Chen Georgia State University, [email protected] Shenghui Xue Georgia State University, [email protected] Juan Zou Georgia State University, [email protected] Jose Lopez University of California, Davis Jenny J. Yang Georgia State University, [email protected] See next page for additional authors Follow this and additional works at: http://scholarworks.gsu.edu/chemistry_facpub Part of the Chemistry Commons Recommended Citation Chen, Yanyi; Xue, Shenghui; Zou, Juan; Lopez, Jose; Yang, Jenny J.; and Perez, Claudio, "Myoplasmic resting Ca2+ regulation by ryanodine receptors is under the control of a novel Ca2+-binding region of the receptor" (2014). Chemistry Faculty Publications. Paper 10. http://scholarworks.gsu.edu/chemistry_facpub/10 This Article is brought to you for free and open access by the Department of Chemistry at ScholarWorks @ Georgia State University. It has been accepted for inclusion in Chemistry Faculty Publications by an authorized administrator of ScholarWorks @ Georgia State University. For more information, please contact [email protected]. Authors Yanyi Chen, Shenghui Xue, Juan Zou, Jose Lopez, Jenny J. Yang, and Claudio Perez This article is available at ScholarWorks @ Georgia State University: http://scholarworks.gsu.edu/chemistry_facpub/10 Biochem. J. (2014) 460, 261–271 (Printed in Great Britain) doi:10.1042/BJ20131553 261 Myoplasmic resting Ca2 + regulation by ryanodine receptors is under the control of a novel Ca2 + -binding region of the receptor Yanyi CHEN*1, Shenghui XUE*1, Juan ZOU*, Jose R.
    [Show full text]
  • Computational Analysis of Surface Properties of Ef-Hand Calcium Binding Proteins
    BIOPHYSICS COMPUTATIONAL ANALYSIS OF SURFACE PROPERTIES OF EF-HAND CALCIUM BINDING PROTEINS DANA CRACIUN1, ADRIANA ISVORAN2 1Teacher Training Department, West University of Timisoara, 4 V.Pirvan, 300223 Timisoara, Romania, Email: [email protected] 2Department of Biology-Chemistry, West University of Timisoara, 16 Pestalozzi, 300316 Timisoara, Romania, Email: [email protected] Received August 14, 2013 Within present study we perform a computational analysis of the surface properties of the EF-hand calcium binding proteins (EFCaBPs), both at global and local levels. Among EFCaBPs there are calcium sensors involved in signal transduction processes and exhibiting extended spatial structures and calcium buffering proteins exhibiting compact structures. Structures superposition reflects higher structural similarity between extended forms, the compact ones being more divergent in good correlation with their sequence alignment. Surfaces of extended EFCaBPs present a smaller number of cavities but with larger volumes and areas than compact ones in correlation with their known biological functions. Surface electrostatic potential is higher for extended EFCaBPs, underlying the role of electrostatics repulsions in adopting their spatial structures and also the possible role in binding charged peptides. Key words: calcium binding proteins, surface, electrostatic potential. 1. INTRODUCTION Calcium ions are indispensable for the physiology of living cell being involved in many cellular processes. The key role of calcium ions strongly depends on a large number of proteins able to bind them, so-called calcium binding proteins, CaBPs [1]. The group of CaBPs is wide and heterogeneous. There are membrane intrinsic CaBPs acting as calcium transporters and involved in the control of calcium ions concentration, calcium buffers and calcium-modulated proteins involved in signal-transduction processes [2].
    [Show full text]
  • Getic Pathways Critical Issues in Contractile fibres [132]
    Journal of Neuromuscular Diseases 1 (2014) 15–40 15 DOI 10.3233/JND-140011 IOS Press Review Mass Spectrometry-Based Identification of Muscle-Associated and Muscle-Derived Proteomic Biomarkers of Dystrophinopathies Paul Dowling, Ashling Holland and Kay Ohlendieck∗ Department of Biology, National University of Ireland, Maynooth, Ireland Abstract. The optimization of large-scale screening procedures of pathological specimens by genomic, proteomic and metabolic methods has drastically increased the bioanalytical capability for swiftly identifying novel biomarkers of inherited disorders, such as neuromuscular diseases. X-linked muscular dystrophy represents the most frequently inherited muscle disease and is characterized by primary abnormalities in the membrane cytoskeletal protein dystrophin. Mass spectrometry-based proteomics has been widely employed for the systematic analysis of dystrophin-deficient muscle tissues, using patient samples and animal models of dystrophinopathy. Both, gel-based methods and label-free mass spectrometric techniques have been applied in compar- ative analyses and established a large number of altered proteins that are associated with muscle contraction, energy metabolism, ion homeostasis, cellular signaling, the cytoskeleton, the extracellular matrix and the cellular stress response. Although these new indicators of muscular dystrophy have increased our general understanding of the molecular pathogenesis of dystrophinopathy, their application as new diagnostic or prognostic biomarkers would require the undesirable usage of invasive methodology. Hence, to reduce the need for diagnostic muscle biopsy procedures, more recent efforts have focused on the proteomic screening of suitable body fluids, such as plasma, serum or urine, for the identification of changed concentration levels of muscle-derived peptides, protein fragments or intact proteins. The occurrence of muscular dystrophy-related protein species in biofluids will be extremely helpful for the future development of cost-effective and non-invasive diagnostic procedures.
    [Show full text]
  • Absence of S100A4 in the Mouse Lens Induces an Aberrant Retina-Specific Differentiation Program and Cataract
    www.nature.com/scientificreports OPEN Absence of S100A4 in the mouse lens induces an aberrant retina‑specifc diferentiation program and cataract Rupalatha Maddala1*, Junyuan Gao2, Richard T. Mathias2, Tylor R. Lewis1, Vadim Y. Arshavsky1,3, Adriana Levine4, Jonathan M. Backer4,5, Anne R. Bresnick4 & Ponugoti V. Rao1,3* S100A4, a member of the S100 family of multifunctional calcium‑binding proteins, participates in several physiological and pathological processes. In this study, we demonstrate that S100A4 expression is robustly induced in diferentiating fber cells of the ocular lens and that S100A4 (−/−) knockout mice develop late‑onset cortical cataracts. Transcriptome profling of lenses from S100A4 (−/−) mice revealed a robust increase in the expression of multiple photoreceptor‑ and Müller glia‑specifc genes, as well as the olfactory sensory neuron‑specifc gene, S100A5. This aberrant transcriptional profle is characterized by corresponding increases in the levels of proteins encoded by the aberrantly upregulated genes. Ingenuity pathway network and curated pathway analyses of diferentially expressed genes in S100A4 (−/−) lenses identifed Crx and Nrl transcription factors as the most signifcant upstream regulators, and revealed that many of the upregulated genes possess promoters containing a high‑density of CpG islands bearing trimethylation marks at histone H3K27 and/or H3K4, respectively. In support of this fnding, we further documented that S100A4 (−/−) knockout lenses have altered levels of trimethylated H3K27 and H3K4. Taken together,
    [Show full text]
  • IHC Test Menu
    Immunohistochemistry Test Menu A Alpha fetoprotein [I AFP] CD99 Ewings sarcoma PNET [I CD99] Anaplastic lymphoma kinase -1 [I ALK] CD103 Integrin alpha E [I CD103] Androgen receptor [I ANDRO]* CD117 C-Kit, myeloid, mast cells, GIST [I CD117] Annexin A1, hairy cell, B cell lymphoma [I ANXA1] CD138 plasma cells, subset epithelial cells [I CD138] Anti-Arginase-1 [I ARGINASE] CD163 histiocytes [I CD163] CDK4 cyclin-depdendent kinase-4, clone DCS-31 [I CDK4] B CDX2 colorectal carcinoma [I CDX2] BCL2 follicular lymphoma, apoptosis inhibiting protein [I BCL2] Chromogranin A [I CHROGRAN] BCL6 follicle center B-cell [I BCL6] CMYC C-MYC oncoprotein [I CMYC] BER EP4 Epithelial antigen [I BER EP4] Collagen IV, basement membrane protein [I CLLGIV] BRAF [I V600E] Cyclin D1/PRAD1 mantle cell lymphoma [I CYCLIN] Cytokeratin 5/6, squamous, mesothelial [I CK5/6] C Cytokeratin 7, 54kD [I CK7] CA 19-9 pancreas, liver, ovary, lung tumors [I CA19 9] Cytokeratin 7/8 CAM5.2 [I CAM 5.2] CA 125 epitheliod malignancies ovary, breast [I CA125] Cytokeratin 8, 35BH11 [I CK8] Calcitonin [I CALCT] Cytokeratin 8/18, adenocarcinoma [I CK8/18] Caldesmon, smooth muscle [I CALDSM] Cytokeratin 19 [I CK19] Calretinin; Calcium binding protein [I CALRT] Cytokeratin 20 [I CK20] CAM 5.2 Cytokeratin 7/Cytokeratin 8 [I CAM 5.2] Cytokeratin cocktail, PAN (AE1/AE3) [I AE1/AE3] Carcinoembryonic antigen (CEA) [I CEA] Cytokeratin high molecular weight; 34BE12 [I CK HMW] Cathepsin D, breast carcinoma [I CATHD] Cytomegalovirus [I CMV] CD1a cortical thymocyctes, Langerhans cells [I CD1a]
    [Show full text]
  • Triadin, a Linker for Calsequestrin and the Ryanodine Receptor
    Triadin, a Linker for Calsequestrin and the Ryanodine Receptor Wei Guo,* Annelise 0. Jorgensen,' and Kevin P. Campbell* *Howard Hughes Medical Institute, Department of Physiology and Biophysics, University of Iowa College of Medicine, Iowa City, Iowa 52242, and *Departmentof Anatomy and Cell Biology, University of Toronto, Toronto, Ontario, Canada M5S 1A8 Introduction Protein components of the triad junction play essential roles in muscle excitation- contraction coupling (EC coupling). Considerable research has been performed on the identification and characterization of proteins that regulate calcium storage and release from the sarcoplasmic reticulum (McPherson and Campbell, 1993; Franzini- Armstrong and Jorgensen, 1994). Key proteins characterized include the dihydro- pyridine receptor; the voltage sensor and L-type calcium channel in t-tubules; the ryanodine receptor/Ca2+-releasechannel in the terminal cisternae of the sarcoplas- mic reticulum; and calsequestrin, a moderate-affinity, high-capacity calcium-bind- ing protein located in the lumen of the junctional sarcoplasmic reticulum. Study of these proteins has been instrumental to our understanding of the molecular mecha- nisms of EC coupling. Recent research from our laboratory has focused on triadin, an abundant transmembrane protein in the junctional sarcoplasmic reticulum. Here, we briefly review recent results on the structure of triadin and its interactions with other protein components of the junctional complex in skeletal and cardiac muscle. Identification of Triadin Using purified skeletal muscle triads, we generated a library of monoclonal anti- bodies against different proteins of the junctional sarcoplasmic reticulum (Camp- bell et al., 1987). Several monoclonal antibodies recognize a protein of 94 kD (now called triadin) on reducing SDS-PAGE (Fig.
    [Show full text]