KIR3DL1 Genetic Diversity and Phenotypic Variation in the Chinese Han Population

ORIGINAL ARTICLE KIR3DL1 genetic diversity and phenotypic variation in the Chinese Han population

SD Tao1,2,YMHe1,2, YL Ying1,2,JHe1,2, FM Zhu1,2 and HJ Lv1,2

Allelic polymorphism and expression variation of killer cell immunoglobulin-like receptor (KIR) 3DL1 on natural killer (NK) cells differ among populations. To determine whether the phenotypic variants are due to KIR polymorphism, transcription or copy number, the allelic polymorphism, mRNA levels and antigen expression of KIR3DL1 were assessed in 162 individuals. We characterized 13 KIR3DL1 alleles, five of which were novel. In addition, 21 genotypes were identified. The correlation between the binding patterns of NK cells to anti-KIR3DL1 and KIR3DL1 alleles was also examined. NK cells with different 3DL1 alleles showed distinct binding levels to anti-KIR3DL1. The binding frequencies of NK cells to anti-KIR3DL1 were not accordant with their binding levels, but both associated with the allele copy numbers. The mRNA expression amounts of individuals with two copy alleles were higher than those of individuals with one copy allele. Our data indicate that both the allele copy number and polymorphism of KIR3DL1 influence the antigen expression on the NK-cell surface, but only the copy number was associated with mRNA expression.

Genes and Immunity (2014) 15, 8–15; doi:10.1038/gene.2013.55; published online 31 October 2013 Keywords: KIR3DL1; surface expression; mRNA transcription; polymorphism; copy number

INTRODUCTION necessary to determine the precise role of these receptors in Killer cell immunoglobulin-like receptors (KIRs) are glycoproteins transplantation and disease association. To date, the profile of expressed on the surface of natural killer (NK) cells and in a KIR3DL1 alleles on NK cells has been investigated in many 17,20–22 few subsets of T cells. KIRs regulate the function of these cells populations. However, the relationship between allelic through interaction with human leukocyte antigen class I polymorphism, mRNA and antigen expression level of KIR3DL1 is molecules.1,2 NK cell functions are regulated by many not yet known in the Chinese Han population. KIR-activating and inhibitory receptors that have great genomic In this study, we investigated gene frequency and allele diversity among various populations,1–3 including KIR3DL1. diversity of KIR3DL1 in 162 unrelated healthy individuals KIR3DL1 is one of the most important molecules of from the Chinese Han population by means of polymerase inhibitory receptors that recognize a subset of human leukocyte chain reaction sequence-based typing. The transcription level antigen-A and -B alleles that express the Bw4 motif at residues and surface expression of KIR3DL1 were determined by real-time 77–83,4–8 which are associated with infectious diseases9 as well as PCR and flow cytometry, respectively. We characterized being important in transplant outcome and donor selection.10–13 the expression patterns of 13 KIR3DL1 alleles, including five that Many clinical studies have shown the importance of were identified for the first time. Furthermore, the KIR3DL1 a KIR mismatch between the donor KIR repertoire and the polymorphisms of the Chinese Han population were also recipient ligand repertoire (human leukocyte antigen) in compared with those in available published data on other improving the outcome of allogeneic hemopoietic stem cell populations. transplantation for leukemia.14,15 However, the correlation between genotype and phenotype in some KIR genes is not very clear. Leung et al.16 revealed that, although some donors were positive for KIR3DL1 alleles, the KIR3DL1 antigen expression RESULTS or mRNA transcription was not detected. Moreover, the Genotyping for KIR3DL1 and KIR3DS1 gene distribution of KIR3DL1 alleles differed among populations17–22 A total of 162 samples from unrelated donors were collected and and different alleles showed diverse expression patterns.23–25 studied. PCR-SSP revealed that 151 samples (93.21%) were positive Therefore, we hypothesized that the levels of transcription and for 3DL1, and 11 samples were negative for 3DL1 but positive for surface expression of KIR3DL1 may be different in a variety of 3DS1. No samples lacking 3DL1 and 3DS1 together were identified populations. in our population. Of the 151 KIR3DL1-positive samples, 47 samples This divergence may have functional implications in the were positive for both 3DL1 and 3DS1. Overall, the data showed selection of bone marrow donors from whom a graft-versus- that 64.20% of samples were only 3DL1 positive, 6.79% were only leukemia activity of the recipient is sought26,27 or when 3DS1 positive and 29.01% were both 3DL1 and 3DS1 positive. The monitoring bone marrow engraftment after transplantation.28,29 frequencies of 3DL1 and 3DS1 were 73.94 and 19.88%, respectively, A more detailed understanding of KIR3DL1 expression is also according to the formula of Hsu et al.30

1Blood Center of Zhejiang Province, Hangzhou, People’s Republic of China and 2Key Laboratory of Blood Safety Research, Ministry of Health, Hangzhou, People’s Republic of China. Correspondence: Professor F Zhu, Blood Center of Zhejiang Province, Key Laboratory of Blood Safety Research of MOH, 345 Wulin Road, Hangzhou, Zhejiang Province 310006, People’s Republic of China. E-mail: [email protected] Received 5 June 2013; revised 18 September 2013; accepted 20 September 2013; published online 31 October 2013 Polymorphism and expression variation of KIR3DL1 S Tao et al 9 Table 1. The frequencies of KIR3DL1 alleles in the Chinese Han Table 2. The information of novel alleles population Allele Compared Nucleotide Amino acid Allele Number Frequency (%) allele substitution substitution

3DL1*01502 163 63.67 3DL1*00503 3DL1*00501 576C4ANo 3DL1*00501 43 16.80 3DL1*01504 3DL1*01502 321G4ANo 3DL1*00701 21 8.20 3DL1*074 3DL1*020 263C4G 67Ala4Gly 3DL1*00101 10 3.91 3DL1*075 3DL1*00501 607T4C 182Ser4Pro 3DL1*020 6 2.34 3DL1*076 3DL1*01502 1085T4G 341Leu4Arg 3DL1*02901 3 1.17 3DL1*025 1 0.39 3DL1*00502 1 0.39 result and copy number assay, 21 genotypes have been identiﬁed. 3DL1*075 4 1.56 The frequencies of the genotypes are listed in Table 3, and 3DL1*01504 1 0.39 KIR3DL1*01502/*01502 is the most frequent genotype. The 3DL1*00503 1 0.39 genotype frequencies were ﬁtted with Hardy À Weinberg equili- 3DL1*074 1 0.39 brium (w2 ¼ 2.93, P40.05). 3DL1*076 1 0.39

KIR3DL1 gene polymorphism contributed to KIR3DL1 expression Distribution of KIR3DL1 alleles in the Chinese Han population variation Thirteen KIR3DL1 alleles were characterized in the Chinese Han The KIR3DL1 phenotype of NK cells from 151 individuals was population, the frequencies of which were calculated and are assessed by flow cytometry. It showed that NK cells from listed in Table 1. Eight were known alleles (3DL1*01502, *00501, homozygous individuals with 3DL1*00101,*01502, *01504 and *00701, *00101, *020, *029, *025, *00502) and five were novel ones. *025 had a high binding level to anti-KIR3DL1, whereas NK cells 3DL1*01502 was the most common allele, with a frequency of from 3DL1*00501 and *00701 homozygous individuals presented 63.67%. a low binding level (Figure 1a). Significant differences in mean fluorescent intensities (MFIs) were observed between homozy- Analysis of novel KIR3DL1 alleles gous individuals with 3DL1*00701 and 3DL1*01502. Although the After the cloning and sequence analysis of 3DL1 genes, five novel numbers of other homozygous groups were small and not alleles 3DL1*00503, 3DL1*01504, 3DL1*074, 3DL1*075 and suitable for statistical analysis, the results obviously indicated that 3DL1*076 were identified. These novel alleles were officially the binding levels of 3DL1*00101, *01504 and *025 individuals named by the WHO Nomenclature Committee for factors of the were higher than those of KIR3DL1*00501 and *00701 individuals. human leukocyte antigen System Subcommittee for Killer-cell Therefore, 3DL1*01502, *00101, *1504 and *025 contributed to a Immunoglobulin-like receptors in April 2013.31 high-binding phenotype, whereas 3DL1*00501 and *00701 con- The detailed sequence characterization and distribution of the tributed to a low-binding phenotype. novel alleles are shown in Table 2. DNA sequences of these five A total of 151 individuals were subdivided into three binding novel alleles have been deposited in GenBank (accession no: level patterns according to the MFI measured by flow cytometry: KC261297, KC261298, KC261299, KC261300 and KC485344). high-binding phenotype (relative high MFI), low-binding pheno- Compared with the sequence of 3DL1*020, 3DL1*074 had a type (relative low MFI) and a binding pattern with both high and single-nucleotide substitution C4G at position 263 in the coding low MFI (Table 3). Individuals with two high-binding alleles or region, resulting in an amino acid substitution from Ala to Gly at two low-binding alleles only exhibited a high or low binding position 67. 3DL1*075 had a nucleotide substitution T4Cat pattern, respectively. However, the heterozygous individuals with position 607 compared with 3DL1*00501, which caused a both a high-binding allele and a low-binding allele exhibited a transition Ser to Pro at 182. 3DL1*076 arose from 3DL1*01502 bimodal binding pattern (low and high MFIs). For example, with a nucleotide substitution T to G at position 1085, resulting in 3DL1*00101/*01502 individuals exhibited only a high-binding an amino acid substitution from Leu to Arg at position 341. pattern and 3DL1*00501/*00701 individuals showed a low- 3DL1*00503 had a nucleotide substitution C4A at 576 compared binding pattern, but 3DL1*00501/*01502, *00701/*01502 and with 3DL1*00501. 3DL1*01504 had a G4A at 321 compared with *00101/*00701 individuals exhibited bimodal binding patterns 3DL1*01502, but the substitution of these two new alleles did not (Table 3). result in any amino acid change. The individuals with 3DL1*01502/*020, *01502/*02901 and *020/ *02901 genotypes showed a high-binding phenotype level, confirming that 3DL1*020 and *02901 were responsible for a Genotype distribution of KIR3DL1 high-binding phenotype. The individuals with 3DL1*00502/*01502 Of the total 151 individuals who were positive for 3DL1,62 showed a bimodal binding pattern, which implied that individuals were heterozygous and 89 were homozygous. 3DL1*00502, like *00501, was responsible for a low binding level. According to the 3DL1 copy number assay, no individuals For five novel alleles, the homozygous individuals with a single were identified with three or four copies of 3DL1 in our 3DL1*01504 exhibited a high-binding pattern. The individuals with population. The 62 heterozygous individuals were all found with 3DL1*00501/*075 and *00501/*00503 demonstrated a low-binding two copies of 3DL1, and the 89 homozygous individuals pattern. Moreover, the individuals with 3DL1*00501/*076 and were divided into two groups: 43 individuals presented two *00501/*074 showed bimodal binding patterns. These findings copies of 3DL1 and the other 46 individuals had a single copy illustrated that 3DL1*01504, *076 and *074 were high-binding of 3DL1. Of the 46 individuals with one copy of 3DL1,37 phenotype alleles, whereas 3DL1*00503 and *075 were low- (80.43%) were positive for 3DS1, which was coincident with binding phenotype alleles. the fact that 3DL1 and 3DS1 genes segregate as allelic variants The frequencies of NK cells binding to anti-KIR3DL1 were also at the same locus. Of the 105 individuals with two copies of variable in the individuals (Table 3), and the binding frequencies 3DL1, 10 individuals were positive for 3DS1, which implied were not well in agreement with the binding levels (Figure 1b), that the frequency of haplotypes having two copies of 3DL1/S1 which showed that 3DL1*01502, *025 and *01504 exhibited was at least 6.17% (10/162). According to the sequencing relatively low binding frequencies.

& 2014 Macmillan Publishers Limited Genes and Immunity (2014) 8 – 15 Polymorphism and expression variation of KIR3DL1 S Tao et al 10 Table 3. The genotype frequency, surface expression and relative transcript abundance of KIR3DL1 in the Chinese Han population

Genotype N GF (%) Flow cytometry RQ-PCR

Allele 1 Allele 2 Binding frequency Bind level (MFI)

Low High Low High

3DL1*01502 3DL1*01502 39 25.83 16.0 75.4 63.25 3DL1*01502 — 35 23.18 9.2 72.2 27.12 3DL1*01502 3DL1*00501 23 15.23 3.2 8.1 28.0 76.1 62.52 3DL1*01502 3DL1*00701 12 7.95 5.8 7.6 34.3 80.4 51.79 3DL1*01502 3DL1*00101 7 4.64 21.4 65.6 54.48 3DL1*01502 3DL1*020 5 3.31 13.4 80.4 57.46 3DL1*00701 — 5 3.31 15.7 30.7 26.24 3DL1*00501 3DL1*00501 4 2.65 5.3 37.3 56.90 3DL1*00501 3DL1*00701 3 1.99 12.4 34.2 52.27 3DL1*01502 3DL1*02901 2 1.32 9.4 76.2 57.91 3DL1*00501 — 2 1.32 2.4 26.1 26.18 3DL1*00101 — 2 1.32 16.9 49.1 38.75 3DL1*01502 3DL1*00502 1 0.66 1.2 5.2 32.5 49.4 17.27 3DL1*00701 3DL1*00101 1 0.66 5.8 12.6 27.1 57.4 49.14 3DL1*020 3DL1*02901 1 0.66 24.5 64.4 34.9 3DL1*025 — 1 0.66 3.2 81.4 25.99 3DL1*01504 — 1 0.66 4.7 89.9 18.13 3DL1*075 3DL1*00501 4 2.65 6.9 28.7 32.00 3DL1*076 3DL1*00501 1 0.66 2.2 13.0 34.5 96.6 56.79 3DL1*074 3DL1*00501 1 0.66 2.9 5.3 28.4 68.9 30.48 3DL1*00503 3DL1*00501 1 0.66 4.2 23.1 34.90 Abbreviations: GF, genotype frequencies; KIR, killer cell immunoglobulin like receptor; MFI, mean ﬂuorescent intensity; RQ-PCR, real-time quantitative PCR. Note: ‘—’ in the genotype means the homozygous individual present in a single copy allele. 3DL1*00503, 3DL1*01504, 3DL1*074, 3DL1*075 and 3DL1*076 were novel alleles, which were submitted to the immuno polymorphism database-KIR database. Binding frequency means the frequency of the NK cells that bound anti-KIR3DL1. MFI was the binding level of NK cells to anti-KIR3DL1 measured by ﬂow cytometry. RQ-PCR presents the relative average transcript amountof KIR3DL1 estimated by the 2 À DCp method. ‘N’ means the corresponding individual numbers.

Relative mRNA transcription level of KIR3DL1 alleles showed that the binding frequencies of individuals with two high- The relative gene expression level was analyzed using equation binding phenotype alleles were obviously higher than those of 2 À DCp and is presented in Table 3. The influences of the copy individuals with one high-binding phenotype allele. Nevertheless, number on RNA transcription and 3DL1 expression on the NK the binding frequencies of the individuals with one low-binding cell surface were also explored. The average mRNA expression phenotype allele showed no significant difference compared with amount was not significant between heterozygous individuals those of individuals with two low-binding phenotype alleles. (3DL1*00701/*01502, *00101*/01502, *01502*/020, *01502/*02901, *00101/*00701, *00501/*00701, *00501/*01502 genotypes) and homozygous individuals with two copy alleles (3DL1*01502*/ DISCUSSION 01502, *00501/*00501 genotypes) (Figure 3, P40.05). KIR3DL1 has shown extensive genetic variants, and its variation Heterozygous individuals having a low-binding phenotype has functional significance in terms of cell surface expression allele (3DL1*00501/*00501, *00501/*01502, *00501/*00701, levels and inhibitory capacity, which could affect susceptibility or *00101/*00701 and *00701/*01502) showed an indistinctive resistance to some diseases. A total of 69 KIR3DL1 alleles have transcription level (Figure 2a). The mRNA expression amounts of been officially named according to the IPD/KIR Database 2.4.0 homozygous individuals only having a low binding phenotype version.31 The profile of KIR3DL1 alleles has been investigated in a allele (3DL1*00501/- and 3DL1*00701/-) were similar to those of variety of populations. However, the data on allelic diversity for individuals with other alleles (Figure 2b). These data indicated that KIR3DL1 in the Chinese Han population are very limited, especially the low binding levels of 3DL1*00501 and 3DL1*00701 to anti- data on the association between the allele polymorphism, mRNA KIR3DL1 may not be due to low transcription level. Statistical transcription and 3DL1 expression on NK cells. In the present analysis showed that the average transcription level was not study, we thoroughly investigated the 13 different KIR3DL1 allelic significantly different among individuals carrying two copies or variants in the Chinese Han population. individuals carrying one copy. 3DL1*01502 is the most common allele found in the Chinese Han population, which is similar to the finding in East and Southeast Asian populations as reported by Norman et al.17 The Influence of allele copy number on the expression of mRNA frequencies of KIR3DL1*01502, 3DL1*00501, 3DL1*00701 and and 3DL1 phenotype 3DL1*00101 are considered relatively high, consistent with those AsshowninTable3andFigure3,themRNAexpressionlevelsinthe of Taiwan Han and Japanese populations.18,19 However, the individuals with one copy 3DL1 were lower than those of individuals frequencies of 3DL1*01502 are 29.50% and 45.70% in the Taiwan with two copies of 3DL1 (Figure 3a). Furthermore, Han population and Japanese population, respectively, whereas the binding level of individuals with a single copy 3DL1 was that of 3DL1*01502 is 63.67% in the Chinese Han population. The also lower than those of individuals with two copies of 3DL1 (Table 3, distribution of KIR3DL1 in our study is different from that of Figure 3b). Interestingly, the binding frequencies of NK cells to anti- Caucasian and African-American populations.20,21 3DL1*002 and 3DL1 were also associated with allele copy number. Figure 3c 3DL1*00401 reported as the most common KIR3DL1 alleles in the

Genes and Immunity (2014) 8 – 15 & 2014 Macmillan Publishers Limited Polymorphism and expression variation of KIR3DL1 S Tao et al 11

150 300 ns ***

100 200 MFI

50 100 Relative RNA expression

0 0 *00101 *00501 *00701 *01502 *025 *1504 02 3DL1 allele

*01502/020 40 *00501/00501*00501/00701*01502/00101*01502/00501*01502/00701*01502/015 *01502/02901

3DL1 allele group

30 ns 80

20 60 % NK cells

10 40

0 20 Relative RNA expression *00101 *00501 *00701 *01502 *025 *01504

3DL1 allele 0 Figure 1. Different binding levels and binding frequencies of NK *00101 *00501 *00701 *01502 *025 *01504 cells to anti-KIR3DL1 were identified by flow cytometry. (a) Binding levels. x axis represents the individuals with one copy of 3DL1 allele; 3DL1 allele y axis represents the mean fluorescence intensity (MFI). Significant Figure 2. mRNA expression of KIR3DL1 alleles relative to the differences are observed between 3DL1*00701 (low binding) and housekeeping gene NKp46.(a) The relative mRNA expression 3DL1*01502 (high binding). (b) Binding frequencies. x axis represents showed no significant difference between the heterozygous the individuals with one copy of 3DL1 allele; y axis represents the individuals and homozygous individuals with two copies of 3DL1. percentage of NK cells that binds to the antibody. (b) KIR3DL1 mRNA expression in a single copy of 3DL1. mRNA expression of 3DL1*00701 and 3DL1*01502 was not significantly different. England population20 and 3DL1*00401, *01501 and *017, *031 reported as common in the African-American population,21 however, are not identified in the Chinese Han population. Flow cytometric results revealed that alleles 3DL1*01502, Moreover, most previous studies on KIR3DL1-positive individuals *00101, *020 and *02901 determined a high-binding phenotype, did not detect the copy numbers of KIR3DL1, nor did they perform whereas 3DL1*00501 and *00701 determined a low-binding a family study, which may affect the accuracy of frequency of phenotype, which was similar to the report of Gardiner et al.34 KIR3DL1. Our results also confirmed that 3DL1*025 and *01504 showed a On the basis of the sequence of coding regions and copy number high-binding phenotype. Interestingly, 3DL1*004 reported to not assays, accurate frequencies of KIR3DL1 alleles were obtained in our bind to anti-3DL1, was not identified, which suggested that the study. Of the 13 identified alleles, five are novel and have been 3DL1*004 allele was rare in the Chinese Han population. officially named. The diversity of these alleles in the Chinese A total of 151 individuals were subdivided into three binding population indicates that the KIR3DL1 locus shows a high degree of level patterns according to the MFI measured by flow cytometry. genetic polymorphism in the population. Most of the individuals Heterozygotes for high- and low-binding KIR3DL1 alleles have with one copy 3DL1 were also positive for 3DS1, which implied that distinct subpopulations of NK cells that bind anti-KIR3DL1 at high there was a low-frequency 3DL1/S1 deletion haplotype present in and low levels, giving characteristic bimodal distributions in the this population. No samples having three or four copies of 3DL1 flow cytometry, which implied that the two alleles of heterozygotes were identified in our population, but the frequency of haplotypes are independent for producing its corresponding phenotype. having two copies of 3DL1 was 0.07% in the populations of the A previous study reported that the 182Pro and 283Try in the United Kingdom and United States.32 The frequency of haplotypes extracellular domains were considered as key amino acids, and having two copies of 3DL1/S1 at least was 6.17% in our population, substitutions in these two positions acted to reduce the affinity of which was similar to that of the Taiwan-Chinese population binding to anti-3DL1. However, the novel allele 3DL1*075, which according to the report of Norman et al.33 had one amino acid change from Trp to Leu at position 283

& 2014 Macmillan Publishers Limited Genes and Immunity (2014) 8 – 15 Polymorphism and expression variation of KIR3DL1 S Tao et al 12 compared with the high-binding phenotype allele *00101 and number affected the 3DL1 expression on NK cells. Individuals with only had an amino acid different at 182 compared with the low- two copy alleles exhibited higher binding levels to anti-KIR3DL1. binding phenotype allele *00501, also showed a low-binding However, the binding frequency data showed that the copy phenotype. This suggested that amino acid at position 283 was number affected only the individuals having high-binding crucial for the binding phenotype, but position 182 might not be phenotype alleles. Most studies have shown that the mRNA correlated to the binding affinity. The results of other novel expression of KIR genes is remarkably variable among the alleles (3DL1*00503, *01504, *074 and *076) also did not alter the individuals.34,35 However, our results showed that the binding phenotypes compared with their referenced alleles. transcription abundance of the individuals with two copy alleles 3DL1*00503 and *01504 did not cause amino acids to change, but was higher than that of individuals with one copy allele. The 3DL1*074 and *076 differ from *020 (high-binding phenotype) difference in the mRNA transcription amounts among the 3DL1 and *01502 (high-binding phenotype) by one amino acid at alleles was not significant. Moreover, there are still several positions 67 and 341, respectively, and still retain a high-binding individuals exhibiting unusual low or high mRNA expression phenotype, which suggested that the amino acids at position 67 among the individuals with the same genotype (data not shown). and 341 might not be significant for the binding affinity. The This could be due to the polymorphism in the KIR3DL1 promoter.36 findings should be further confirmed in future investigations. The proximal promoter of KIR3DL1 is polymorphic at transcription The binding frequencies of NK cells to anti-3DL1 were also factor binding sites known to affect promoter activity,37 and it has varied, but not consistent with the binding levels, which was recently been shown that the promoter region possesses bi- similar to the findings by Gardiner et al.34 Furthermore, the copy directional transcription activity, which may affect the frequency of NK cells expressing a given KIR within a given individual. *** *** Taken together, our data support and extend the contention 300 that the diversity of 3DL1 was different in various populations, and surface expression was also variable in different 3DL1 alleles. The antigen expression difference is associated with the allelic 200 polymorphism and copy number of the 3DL1 allele. The mechanism of the discrepancy between mRNA and antigen expression can be further researched in future studies, which may 100 help understand the functional heterogeneity of KIR3DL1 and offer useful information for donor selection. Relative RNA expression 0 MATERIALS AND METHODS Samples and nucleic acid extraction 1×01502 2×01502 1×00501 2×00501 A total of 162 samples were collected from volunteer healthy blood donors all one copyall two copy at Blood Center of Zhejiang province, China. Informed consent was 3DL1 allele group obtained from all participants. This study was approved by the regional ethics committee in Blood center of Zhejiang Province. The ethnic 150 background of these samples is Han. Peripheral blood mononuclear cells ****were isolated from buffy coats using lymphocyte separation medium after density gradient centrifugation. Total RNA was extracted from peripheral blood mononuclear cells using QIAamp RNA blood mini kits (Qiagen, 100 Shanghai, China) and stored at À 80 1C until use. Genomic DNA was MFI Figure 3. Influence of allele copy number on mRNA expression and 50 allotype expression. (a) The influence of copy number on mRNA expression in single- versus two-copy alleles. Six groups were formed, including the individuals with one copy allele (1 Â 00501, 0 1 Â 01502) and the corresponding homozygous individuals with two copy alleles (2 Â 00501, 2 Â 01502), all individuals with a single copy allele (all one copy), all individuals with two copy alleles (all two 1×low 2×low 1×high 2×high copy). The average transcription levels in the individuals with one 1×01502 2×01502 1×00501 2×00501 copy allele were lower than those of individuals with two copies 3DL1 allele group (1 Â 01502 vs 2 Â 01502; all one copy vs all two copy); the 1 Â 00501 allele group was detected on only two occasions and was not 80 suitable for statistical analysis, but the average transcription of the ** ns *** 2 Â 00501 group was twice that of the 1 Â 00501 group. (b) The influence of copy number on the binding level of NK cells to anti- 60 KIR3DL1. Eight groups were formed, 1 Â 00501, 1 Â 01502, 2 Â 00501, 2 Â 01502, all individuals with a single low-binding phenotype allele (1 Â low), all individuals with two low-binding 40 phenotype alleles (2 Â low), all individuals with a single high- binding phenotype allele (1 Â high) and all individuals with two % NK cells high-binding phenotype alleles (2 high). The binding levels in the 20 Â individuals with one copy allele were significantly lower than those in the individuals with two copies. (c) The influence of copy number 0 on binding frequencies. Significant difference was observed between two high-binding phenotype group and one high-binding phenotype group. The 1 Â 00501 group was detected on only two 1×low 2×low 1×high 2×high 1×01502 2×01502 1×00501 2×00501 occasion and was not suitable for statistical analysis, but the binding frequency of the 2 Â 00501 group was slightly higher than that of 3DL1 allele group the 1 Â 00501 group.

Genes and Immunity (2014) 8 – 15 & 2014 Macmillan Publishers Limited Polymorphism and expression variation of KIR3DL1 S Tao et al 13 Table 4. Primers used for KIR3DL1 ampliﬁcation and sequencing

Name Sequence (50-30) Sequence covers Position

pair 1- Forward CAGGGCGCCRAATAACATC Exons 1–4 À 74 to À 56 pair 1- Reverse TARGTCYCTGCAAGGGCAA 3417 À 3435 pair 2- Forward GTGTCACTRTCRTCRTAGGTTTA Exons 3–5 1888 À 1910 pair 2- Reverse GAGAGAGAAGKTTTCTCATATGa 5068 À 5089 pair 3- Forward CCTCTTCTCCTTCCAGGTCCa Exons 5–9 5049 À 5068 pair 3- Reverse CAGGAGACAACTTTGGATCTG 13748 À 13768 Pair 4- Forward CCATYGGTYCCATGATGCT Exons 4 À 5 3399 À 3417 pair 4- Reverse GCTCTCTCCTGCCTGAACCa 5107 À 5126 5-UTR-F ATCCTGTGCGCTGCTGAGCTGAGCT Exon 1 À 58 to À 34 I1Fa CAAGACKCACAGCCCAGTG Exon 2 953 À 971 I2Fa GAGAATCTTCTGGGCACTGG Exon 3 1739 À 1758 I3Ra GAGGTGGGACAGTGAGAAGC Exon 3 2120 À 2139 I3Fa GAYGCCTTCTRAACTCACAAC Exon 4 3180 À 3200 I4Ra AAGTCCTRGATCATTCACTC Exon 4 3555 À 3574 E5Fa CTTCTCTCTCAGCCCAGC Exon 5 5080 À 5097 I5Ra TGCATCTGTCCATGCTTTTC Exon 5 5434 À 5453 I4Fa GGTCATAGAGCAGGGGAGTG Exon 5 4970 À 4989 I5Fa GCCTTTCTTTATGCCAATGT Exon 6 8254 À 8273 I6Ra CCCTTTCACTGTTGGAGTGT Exon 6 8708 À 8727 I6F ARGGGTCAAACATCTMAACT Exon 7 12638 À 12657 I7R ASCYGYGTGCTCCCATCCT Exon 7 13016 À 13036 I7F TGTGTTCCTCACTGGCA Exon 8 13036 À 13052 I8F CACTCAGCATTTCCCTCCCTCACTC Exon 9 13555 À 13579 Note: Primers of pair 1–4 were used for KIR3DL1 amplification. The amplicons of the four pairs of primers were overlapped. The amplicons by primer pairs 2 and 3 do not overlap and the overlapping sequence is provided by primer pair 4. aPrimer was cited from Belle et al. reported.39 extracted from buffy coats using QuickGene DNA whole-blood kits on a analyzed with SeqScape 2.5 software (Applied Biosystems). All nucleotide QuickGene Mini80 Nucleic Acid Isolation Device (FujiFilm Corporation, sequences obtained were compared with the standard KIR3DL1 poly- Tokyo, Japan) according to the manufacturer’s instruction. morphisms from the immunopolymorphism database-KIR database (www.ebi.ac.uk/ipd/kir) and each variant was analyzed and recorded. KIR3DL1 and KIR3DS1 detection by PCR-SSP method Copy number assay was performed for all the samples to detect whether the samples carried one, two or more copies of the KIR3DL1 gene as To verify the presence or absence of the KIR3DL1 and KIR3DS1 genes, PCR previously reported.35 sequence specific primers for KIR3DL1 and KIR3DS1 were designed, as we previously described.38 Cloning of novel KIR3DL1 alleles PCR amplification for the complete coding region of the KIR3DL1 Novel KIR3DL1 alleles were identified in some samples. To confirm these gene novel alleles, coding sequences of the five samples were amplified and The complete coding region including exons 1 À 9ofKIR3DL1 was directly ligated into the pCR4-TOPO vector using a TOPO cloning amplified using four pairs of overlapping primers (Table 4).39 Primer pair 1 sequencing kit (Invitrogen Co., Carlsbad, CA, USA) according to the amplifying a 3.5 kb amplicon anneals in 50 upstream region and in exon 4; manufacturer’s instruction. Recombinant colonies of the samples on Luria- primer pair 2 amplifying a 3.2 kb amplicon anneals in exons 3 and 5; primer Bertani plates were randomly selected. Plasmid DNA was extracted from pair 3 amplifying a 8.7 kb amplicon anneals in exons 5 and 9; and primer each colony with 3S Spin Plasmid Miniprep Kits (Shenergy Biocolor, pair 4 amplifying a 1.7 kb amplicon anneals in exons 4 and 5. All the PCR Shanghai, China) and subjected to KIR3DL1 sequencing reactions. Confirmed novel alleles were submitted to Genbank and the immunopo- reactions were performed in 25 ml volume containing about 100 ng 31 genomic DNA in 1 Â LA buffer, 0.5 mmol l À 1 of each primer, 200 mmol l À 1 lymorphism KIR database. À 1 of each dNTP, 2.0 mmol l MgCl2 and 0.5 unit of LA-Taq DNA polymerase (Takara, Dalian, China). The PCR amplifications were carried out in a PTC- Real-time quantification PCR for KIR3DL1 mRNA 240 thermocycler (MJ Research, Waltham, MA, USA). The PCR reaction condition for primer pairs 1, 2 and 3 were 92 1C for 2 min, followed by five cDNA was reverse transcribed from 5 mg total RNA using oligo(dT)20 primer cycles at 92 1C for 30 s, 60 1C for 45 s and 68 1C for 5 min and by 25 cycles at and superscript III reverse transcriptase (Invitrogen Corporation, Brown 92 1C for 30 s, 65 1C for 45 s, 68 1C for 5 min and a final extension for 10 min Deer, WI, USA). Real-time quantitative PCR was performed using the at 68 1C. The PCR reaction condition for primer pair 4 was 94 1C for 1 min, published primers combined with a short locked nucleic acid hydrolysis 1 1 probe from a pre-designed genome-wide probe library (Roche, Shanghai, followed by 25 cycles at 98 C for 10 s, 68 C for 2 min and a final extension 35,40 for 10 min at 68 1C. The amplicons were analyzed in 1% agarose gel stained China). Each amplification reaction was performed with 2 ml of cDNA, 4 mlof5Â buffer, 0.2 mmol l À 1 of each dNTP, 0.5U Go-Taq polymerase with ethidium bromide and visualized by ultraviolet light (Genegenius, À 1 Syngene, Cambridge, UK) and then digested with 10 units of exonuclease I (Promega), 0.2 ml locked nucleic acid probe and 0.5 mmol l forward and (Takara) and 2 units of shrimp alkaline phosphatase (Promega, Madison, reverse primers in a final reaction volume of 20 ml. The cycling parameter WI, USA) at 37 1C for 30 min and at 80 1C for 15 min. was 95 1C for 5 min, followed by 40 cycles at 94 1C for 30 s and 60 1C for 60 s. The NKp46 gene was used as an internal control, as in the study by McErlean C et al.,35 and was used to normalize the difference in the Genotyping for KIR3DL1 gene amount of cDNA contained in each initial reaction and each sample and The purified PCR amplicons were used as templates in direct sequencing was carried out in a parallel control experiment. The reaction was using BigDye3.1 terminator cycle sequencing kits (Applied Biosystems, performed with a chromo 4 four-color real-time PCR detection system (Bio- Foster City, CA, USA). The sequencing primers were designed according to Rad, Hercules, CA, USA). The Cp value is directly related to amplicon the previous report with minor modification39 (Table 4). The thermocycling abundance and commonly used for the parameter of quantification. condition was set as follows: 96 1C for 1 min, followed by 25 cycles at 96 1C Relative quantification was obtained with respect to the housekeeping for 10 s, 50 1C for 5 s and 60 1C for 4 min. The sequence reaction products gene NKp46 and was estimated by the 2 À DCp method,41 where DCp ¼ Cp were processed with an ABI 3730 DNA Analyzer and the data were (KIR3DL1) À Cp (NKp46).

& 2014 Macmillan Publishers Limited Genes and Immunity (2014) 8 – 15 Polymorphism and expression variation of KIR3DL1 S Tao et al 14 Detection of KIR3DL1 expression by flow cytometry 13 Martin MP, Qi Y, Gao XJ, Yamada E, Martin JN, Pereyra F et al. Innate partnership of Expression of KIR3DL1 on the NK cell surface was measured by flow HLA-B and KIR3DL1 subtypes against HIV-1. Nat Genet 2007; 39: 733–740. cytometry using double staining with monoclonal antibodies. FITC 14 Beelen DW, Ottinger HD, Ferencik S, Elmaagacli AH, Peceny R, Trenschel R et al. conjugate of anti-KIR3DL1 (Clone DX9, Becton Dickinson, Mountain View, Genotypic inhibitory killer immunoglobulin-like receptor ligand incompatibility CA, USA) was used in combination with Phycoerythrin conjugate of anti- enhances the long-term antileukemic effect of unmodified allogeneic hemato- CD56 to stain NK cells. Freshly isolated peripheral blood mononuclear cells poietic stem cell transplantation in patients with myeloid leukemias. Blood 2005; (1 Â 106) in a 100 ml experimental solution were labeled with 10 ml PE-anti- 105: 2594–2600. CD56 and 10 ml FITC-anti-KIR3DL1 at room temperature, protected from 15 Davies SM, Ruggieri L, DeFor T, Wagner JE, Weisdorf DJ, Miller JS et al. Evaluation light. After 15 min incubation, 400 ml FACS lysing solution (Becton of KIR ligand incompatibility in mismatched unrelated donor hematopoietic Dickinson) was added and mixed together. An additional 15 min later, transplants. Killer immunoglobulin like receptor. Blood 2002; 100: 3825–3827. samples were acquired on a FACScan flow cytometer measuring at least 16 Leung W, Iyengar R, Triplett B, Turner V, Behm FG, Holladay MS et al. Comparison 10 000 cells and analyzed by Cellquest 1.1 software (Becton Dickinson). The of killer Ig-like receptor genotyping and phenotyping for selection of allogeneic binding frequencies of NK cells to antibody and the MFI representing the blood stem cell donors. J Immunol 2005; 174: 6540–6545. binding ability were measured. 17 Norman PJ, Rached LA, Gendzekhadze K, Korbel D, Gleimer M, Rowley D et al. Unusual selection on the KIR3DL1/S1 natural killer cell receptor in Africans. Nat Statistical analysis Genet 2007; 39: 1092–1099. 18 Wu GQ, Zhao YM, Lai XY, Yang KL, Zhu FM, Zhang W et al. Distribution of killer-cell On the basis of the assumption of Hardy-Weinberg equilibrium, KIR gene immunoglobulin-like receptor genes in Eastern mainland Chinese Han and 30 frequencies were calculated using the formula of Hsu et al. The observed Taiwanese Han populations. Tissue Antigens 2009; 74: 499–507. frequencies of KIR genotypes and alleles were determined by the ratio of 19 Yawata M, Yawata N, Draghi M, Little AM, Partheniou F, Parham P. Roles for HLA genotypes and alleles present in the population to the total number of and KIR polymorphisms in natural killer cell repertoire selection and modulation samples and alleles, respectively. The expression diversity in the different of effector function. J Exp Med 2006; 203: 633–645. alleles was estimated by the Mann À Whitney test. In figures, ns indicates 20 Trundley A, Frebel H, Jones D, Chang C, Trowsdale J. Allelic expression patterns of not significant; * indicates Po0.05; ** indicates Po0.01 and *** indicates KIR3DS1 and 3DL1 using the Z27 and DX9 antibodies. Eur J Immunol 2007; 37: Po0.001. The above statistical analyses were performed using GraphPad 780–787. software (GraphPad, La Jolla, CA, USA). 21 Jiang B, Hou L, Chen M, Ng J, Hurley CK. The profile of KIR3DL1 and KIR3DS1 alleles in an African American population resembles that found in African populations. Tissue Antigens 2010; 76: 64–66. CONFLICT OF INTEREST 22 O’Connor GM, Guinan KJ, Cunningham RT, Middleton D, Parham P, Gardiner CM. The authors declare no conflict of interest. Functional polymorphism of the KIR3DL1/S1 receptor on human NK Cells. J Immunol 2006; 178: 235–241. 23 Pando MJ, Gardiner CM, Gleimer M, McQueen KL, Parham P. The protein made ACKNOWLEDGEMENTS from a common allele of KIR3DL1 (3DL1*004) is poorly expressed at cell surfaces due to substitution at positions 86 in Ig domain 0 and 182 in Ig domain 1. This work was sponsored by Zhejiang Provincial Program for the Cultivation of High- J Immunol 2003; 171: 6640–6649. Level Innovative Health Talents, by the Science Research Foundation of Zhejiang 24 Thomas R, Yamada E, Alter G, Martin MP, Bashirova AA, Norman PJ et al. Novel Province (Y2090988 and LY12H10001) and by Science Research Foundation of KIR3DL1 alleles and their expression levels on NK cells: convergent evolution of Zhejiang Healthy Bureau (2012KYA061). KIR3DL1 phenotype variation? J Immunol 2008; 180: 6743–6750. 25 Martin MP, Pascal V, Yeager M, Phair J, Kirk GD, Hoots K et al. A mutation in KIR3DS1 that results in truncation and lack of cell surface expression. Immuno- REFERENCES genetics 2007; 59: 823–829. 1 Uhrberg M, Valiante NM, Shum BP, Shilling HG, Weidenbach KL, Corliss Brian et al. 26 Cooley S, Trachtenberg E, Bergemann TL, Saeteurn K, Klein J, Le CT et al. Donors Human diversity in killer cell inhibitory receptor genes. Immunity 1997; 7: with group B KIR haplotypes improve relapse free survival after unrelated 753–763. hematopoietic cell transplantation for acute myelogenous leukemia. Blood 2009; 2 Single RM, Martin MP, Gao X, Meyer D, Yeager M, Kidd JR et al. Global diversity 113: 726–732. and evidence for coevolution of KIR and HLA. Nat Genet 2007; 39: 1114–1119. 27 Hsu KC, Gooley T, Malkki M, Pinto-Agnello C, Dupont B, Bignon JD et al. KIR 3 Hollenbach JA, Nocedal I, Ladner MB, Single RM, Trachtenberg EA. Killer cell ligands and prediction of relapse after unrelated donor hematopoietic cell immunoglobulin-like receptor (KIR) gene content variation in the HGDP-CEPH transplantation for hematologic malignancy. Biol Blood Marrow Transplant 2006; populations. Immunogenetics 2012; 64: 719–737. 12: 828–836. 4 Gumperz JE, Valiante NM, Parham P, Lanier LL, Tyan D. Heterogeneous pheno- 28 Cooley S, Xiao F, Pitt M, Gleason M, McCullar V, Bergemann TL et al. types of expression of the NKB1 natural killer cell class I receptor among indivi- A subpopulation of human peripheral blood NK cells that lacks inhibitory duals of different human histocompatibility leukocyte antigens types appear receptors for self-MHC is developmentally immature. Blood 2007; 110: 578–586. genetically regulated, but not linked to major histocompatibility complex 29 Denis L, Gagne K, Gueglio B, Kerdudou N, Milpied N, Simon P et al. KIR transcript haplotype. J Exp Med 1996; 183: 1817–1827. kinetics correlate with acute graft-versus-host disease occurrence after allogeneic 5 Gumperz JE, Litwin V, Phillips JH, Lanier LL, Parham P. The Bw4 public epitope of bone marrow transplantation. Hum Immunol 2005; 66: 447–459. HLA-B molecules confers reactivity with natural killer cell clones that express 30 Hsu KC, Liu XR, Selvakumar A, Mickelson E, O’Reilly RJ, Dupont B. Killer Ig-like NKB1, a putative HLA receptor. J Exp Med 1995; 181: 1133. receptor haplotype analysis by gene content: evidence for genomic diversity with 6 Parham P, Norman PJ, Abi-Rached L, Guethlein LA. Variable NK cell receptors a minimum of six basic framework haplotypes, each with multiple subsets. J exemplified by human KIR3DL1/S1. J Immunol 2011; 187: 11–19. Immunol 2002; 169: 5118–5129. 7 Sharma D, Bastard K, Guethlein LA, Norman PJ, Yawata N, Yawata M et al. 31 Robinson J, Halliwell JA, McWilliam H, Lopez R, Parham P, Marsh SG. The IMGT/ Dimorphic motifs in D0 and D1 þ D2 domains of killer cell Ig-like receptor 3DL1 HLA database. Nucleic Acids Res 2013; 41: D1222–D1227. combine to form receptors with high, moderate, and no avidity for the complex 32 Jiang W, Johnson C, Jayaraman J, Simecek N, Noble J, Moffatt MF et al. Copy of a peptide derived from HIV and HLA-A*2402. J Immunol 2009; 183: 4569–4582. number variation leads to considerable diversity for B but not A haplotypes 8 Vivian JP, Duncan RC, Berry R, O’Connor GM, Reid HH, Beddoe T et al. Killer of the human KIR genes encoding NK cell receptors. Genome Res 2012; 22: immunoglobulin receptor 3DL1-mediated recognition of human leukocyte anti- 1845–1854. gen B. Nature 2011; 479: 401–405. 33 Norman PJ, Rached LA, Gendzekhadze K, Hammond JA, Moesta AK, Sharma D 9 Pelak K, Need AC, Fellay J, Shianna KV, Feng S, Urban TJ et al. NIAID center for HIV/ et al. Meiotic recombination generates rich diversity in NK cell receptor genes, AIDS. Vaccine immunology. Copy number variation of KIR genes influences HIV-1 alleles, and haplotypes. Genome Res 2009; 19: 757–769. control. PLoS Biol 2011; 9: e1001208. 34 Gardiner CM, Guethlein LA, Shilling HG, Pando M, Carr WH, Rajalingam R et al. 10 Kulkarni S, Martin MP, Carrington M. The Yin and Yang of HLA and KIR in human Different NK cell surface phenotypes defined by the DX9 antibody are due to disease. Semin Immunol 2008; 20: 343–352. KIR3DL1 gene polymorphism. J Immunol 2001; 166: 2992–3001. 11 Velardi A, Ruggeri L, Moretta A, Moretta L. NK cells: a lesson from mismatched 35 McErlean C, Gonzalez AA, Cunningham R, Meenagh A, Shovlin T, Middleton D. hematopoietic transplantation. Trends Immunol 2002; 23: 438–444. Differential RNA expression of KIR alleles. Immunogenetics 2010; 62: 431–440. 12 Leung W, Iyengar R, Turner V, Lang P, Bader P, Conn P et al. Determinants of 36 Li H, Pascal V, Martin MP, Carrington M, Anderson SK. Control of variegated KIR antileukemia effects of allogeneic NK cells. J Immunol 2004; 172: 644–650. gene expression: polymorphisms of the bi-directional KIR3DL1 promoter are

Genes and Immunity (2014) 8 – 15 & 2014 Macmillan Publishers Limited Polymorphism and expression variation of KIR3DL1 S Tao et al 15 associated with distinct frequencies of gene expression. PLoS Genet 2008; 4: 39 Belle I, Hou L, Chen M, Steiner NK, Ng J, Hurley CK. Investigation of killer cell e1000254. immunoglobulin-like receptor gene diversity in KIR3DL1 and KIR3DS1 in a 37 Stewart CA, Bergen JV, Trowsdale J. Different and divergent regulation of the transplant population. Tissue Antigens 2008; 71: 434–439. KIR2DL4 and KIR3DL1 promoters. J Immunol 2003; 170: 6073–6081. 40 You Y, Moreira BG, Behlke MA, Owczarzy R. Design of LNA probes that improve 38 Jiang K, Zhu FM, Zhang W, Lv QF, He J, Fu QH et al. The establishment of PCR-SSP mismatch discrimination. Nucleic Acids Res 2006; 34: e60. method for killer cell immunoglobulin-like receptor gene family and its applica- 41 Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time tion. Chin J Microbiol Immunol 2005; 25: 1044–1048. quantitative PCR and the 2(-delta delta C(T)) method. Methods 2001; 25: 402–408.

& 2014 Macmillan Publishers Limited Genes and Immunity (2014) 8 – 15