STUDIES OF HUMAN NATURAL KILLER CELL DEVELOPMENT
DISSERTATION
Presented in Partial Fulfillment of the Requirements for The Degree Doctor of
Philosophy in the Graduate School of The Ohio State University
By
Aharon G. Freud, B.S.
*****
The Ohio State University
2006
Dissertation Committee:
Michael A. Caligiuri, M.D., Adviser
Yang Liu, Ph.D. Approved by
Clay Marsh, M.D. ______
Caroline Whitacre, Ph.D. Adviser The Integrated Biomedical Sciences Graduate Program
ABSTRACT
In recent years there has been increased emphasis placed on studying the immune system with the hope that its selective modulation, in combination with other forms of therapy, could one day eradicate infectious disease and cancer. Natural killer (NK) cells are specialized immune cells that have the ability to recognize and destroy virally
infected and malignantly transformed cells without prior stimulation and to produce and
release soluble factors, such as interleukins, cytokines, and chemokines, that can
stimulate and recruit other cells of the immune system. Because of their unique roles in
immunity, there is rationale to study NK cell development so that we might modulate NK
cell numbers and or functions in patients with immune deficiency or cancer. Although
much is known about how mature NK cells function and recognize their targets, the
development of these cells in humans is less well characterized. Specifically, whereas it
is well documented that T lymphocytes develop in the thymus and that B cell
development occurs in the bone marrow (BM), the anatomical site(s) and cellular
intermediates that give rise to human NK cells in vivo have remained elusive. For the
past four years, my research goal has been to address these two unknowns. Through the
course of many studies, we (myself along with my collaborators) have discovered that
human lymph nodes (LNs) and tonsils are naturally enriched with the full complement of
cellular intermediates spanning the developmental continuum from an immature
hematopoietic progenitor cell (HPC) to a functionally mature NK cell. For the first time,
ii these data implicate secondary lymphoid tissues (SLT) as the primary sites of human NK cell differentiation. Moreover, our data provide a new and comprehensive model for the development of human NK cells in vivo. Herein, I present these findings and provide an extended discussion relating our new data to current concepts in the field of NK cell developmental biology.
iii
To Ha-shem, Batyah, and Noah.
iv
ACKNOWLEDGMENTS
I thank G-d for blessing me with life, family, health, love, and the innumerable opportunities to learn.
I thank my wife, Bethany, for her undying support, love, and Noah.
I thank my parents and sisters for their unconditional love and support.
I thank my adviser, Michael Caligiuri, for his exceptional mentorship and guidance. I cannot thank him enough for the care he has taken in my training, professional development and personal growth. Nor can I adequately express my gratitude for the wonderful opportunity to be a part of his laboratory and to know him on both professional and personal levels.
I wish to thank all current and former members of the Caligiuri Laboratory including
Robert Baiocchi, Brian Becknell, Bradley Blaser, Megan Cooper, Adrienne Dorrance,
Chiara Giovenzana, Todd Fehniger, Martin Guimond, Tiffany Hughes, Melissa Lee, Tom
Liu, Charlene Mao, Trent Marburger, Sameek Roychowdhury, Matthew Strout, Rossana
Trotta, Jeff VanDeusen, and Susan Whitman. I thank each person for his/her friendship, advice, support, and contribution to my personal and professional growth.
I wish to thank Donna Bucci and Tamra Brooks for their administrative support.
I thank my collaborators, Amy Ferketich, Megan Jukich, Beth Mattarese
Mary McNulty, Gerard Nuovo, and Erin Smith for their assistance and expertise.
I thank Richard Fertel and William Carson for their outstanding mentorship.
- v - I thank my dissertation committee, Yang Liu, Clay Marsh, and Caroline Whitacre for their repeated commitments of time and effort on my behalf.
I thank Alan Yates and the faculty of the Integrated Biomedical Science Graduate
Program for their unwavering guidance and commitment to my education.
Finally I wish to acknowledge the generous support of my education through the
University Fellowship, the Medical Scientist Program Fellowship, and the multiple funding organizations that provide for the Caligiuri Laboratory.
- vi -
VITA
May 25, 1977 ……………………………………………Born, Bloomington, Indiana
1996-2000.……………………………………………….B.S. Genetics, University of Wisconsin-Madison
2000-present.…………………………………………….Medical Scientist Program Fellow, The Ohio State University
PUBLICATIONS
Peer-Reviewed Research Articles
1. Freud AG, Yokohama A, Becknell B, Lee MT, Mao HC, Ferketich AK, Caligiuri MA. Evidence for discrete stages of human natural killer cell differentiation in vivo. J Exp Med. 2006 Apr 17;203(4):1033-1043.Epub 2006 Apr 10.
2. Roychowdhury S, Blaser BW, Freud AG, Katz K, Bhatt D, Ferketich AK, Bergdall V, Kusewitt D, Baiocchi RA, Caligiuri MA. IL-15 but not IL-2 rapidly induces lethal xenogeneic graft-versus-host disease. Blood. 2005 Oct 1;106(7):2433-5. Epub 2005 Jun 23.
3. Freud AG, Becknell B, Roychowdhury S, Mao HC, Ferketich AK, Nuovo GJ, Hughes TL, Marburger TB, Sung J, Baiocchi RA, Guimond M, Caligiuri MA. A human CD34(+) subset resides in lymph nodes and differentiates into CD56bright natural killer cells. Immunity. 2005 Mar;22(3):295-304.
4. Roychowdhury S, May KF Jr, Tzou KS, Lin T, Bhatt D, Freud AG, Guimond M, Ferketich AK, Liu Y, Caligiuri MA. Failed adoptive immunotherapy with tumor-specific T cells: reversal with low-dose interleukin 15 but not low-dose interleukin 2. Cancer Res. 2004 Nov 1;64(21):8062-7.
5. Roychowdhury S, Baiocchi RA, Vourganti S, Bhatt D, Blaser BW, Freud AG, Chou J, Chen CS, Xiao JJ, Parthun M, Chan KK, Eisenbeis CF, Ferketich AK, Grever MR,
- vii - Chen CS, Caligiuri MA. Selective efficacy of depsipeptide in a xenograft model of Epstein-Barr virus-positive lymphoproliferative disorder. J Natl Cancer Inst. 2004 Oct 6;96(19):1447-57.
6. Imboden M, Shi F, Pugh TD, Freud AG, Thom NJ, Hank JA, Hao Z, Staelin ST, Sondel PM, Mahvi DM. Safety of interleukin-12 gene therapy against cancer: a murine biodistribution and toxicity study. Hum Gene Ther. 2003 Jul 20;14(11):1037-48.
7. Fehniger TA, Suzuki K, Ponnappan A, VanDeusen JB, Cooper MA, Florea SM, Freud AG, Robinson ML, Durbin J, Caligiuri MA. Fatal leukemia in interleukin 15 transgenic mice follows early expansions in natural killer and memory phenotype CD8+ T cells. J Exp Med. 2001 Jan 15;193(2):219-31.
8. Whitman SP, Strout MP, Marcucci G, Freud AG, Culley LL, Zeleznik-Le NJ, Mrozek K, Theil KS, Kees UR, Bloomfield CD, Caligiuri MA. The partial nontandem duplication of the MLL (ALL1) gene is a novel rearrangement that generates three distinct fusion transcripts in B-cell acute lymphoblastic leukemia. Cancer Res. 2001 Jan 1;61(1):59-63.
Invited Review Articles
9. Fehniger TA, Suzuki K, VanDeusen JB, Cooper MA, Freud AG, Caligiuri MA. Fatal leukemia in interleukin-15 transgenic mice. Blood Cells Mol Dis. 2001 Jan- Feb;27(1):223-30.
FIELDS OF STUDY
Major Field: Integrated Biomedical Sciences with an emphasis in Immunology
- viii -
TABLE OF CONTENTS
Page Abstract...... ii
Dedication...... iv
Acknowledgments...... v
Vita...... vii
List of Figures...... xi
List of Tables...... xiii
Chapters
1. Background...... 1 1.1. Natural killer cells: innate immune effector cells...... 1 1.2. General concepts of human NK cell development...... 2
2. Discovery of the human pre-NK cell and its natural enrichment in lymph nodes…. 6 2.1. Introduction...... 6 2.2. Results………...... 8 2.3. Discussion...... 15 2.4. Experimental Procedures...... 20
3. Elucidation of the in vivo stages of human NK cell development...... 44 3.1. Introduction and Review...... 44 3.2. Results...... 46 3.3. Discussion...... 56 3.4. Experimental Procedures...... 61
4. Unpublished Data and Extended Discussion.……………………………………….86 4.1. Terminal stages of human NK cell differentiation: CD56bright vs. CD56dim...... 86 4.2. Similarities to human T cell development...... 88 4.3. Regulation of human NK cell development...... 90 4.4. Sites of NK cell development...... 100 4.5. Concluding Remarks...... 105
- ix -
Literature Cited...... 112
- x -
LIST OF FIGURES
Figure Page
Figure 1. Co-expression of CD45RA on CD34(+) HPCs identifies human pre-NK cells...... 25
Figure 2. Functional and phenotypic attributes of CD34(+)-derived CD56bright NK cells...... 27
Figure 3. Representative phenotypic analysis of mature PB CD56bright NK cells. 31
Figure 4. Representative analyses showing the purity of CD34(+) and CD3(+) cell isolations...... 33
Figure 5. Phenotypic analysis of PB CD34(+) HPC subsets...... 35
dim bright Figure 6. The PB CD34 CD45RA(+)β7 subset uniquely differentiates into CD56bright NK cells in IL-2 or IL-15...... 37
dim bright Figure 7. Cellular yields from PB CD34 CD45RA(+)β7 HPC differentiation assays...... 39
Figure 8. Discovery of CD34dimCD45RA(+) HPCs in human LNs...... 41
Figure 9. T cell activation supports CD56bright NK cell differentiation from CD34(+) HPCs in vitro……..………………………………………...... 43
Figure 10. Surface marker expression patterns of human SLT populations...... 68
Figure 11. Progressive CD56 expression by in vivo stages of human NK cell differentiation...... 70
Figure 12. Surface marker expression profiles of stages 1-4….…………...... 72
Figure 13. Gene expression profiles of stages 1-4...... 74
Figure 14. Functional analyses of stages 3 and 4...... 76
- xi - Figure 15. B, T, and NK cell differentiation potentials of stages 1-4...... 78
Figure 16. DC differentiation potential of stages 1-4...... 80
Figure 17. Stage 1 and stage 2 NK cell developmental progression...... 82
Figure 18. Stage 3 to stage 4 differentiation ex vivo...... 84
Figure 19. CD94, CD16, and KIR expression patterns among CD3(-)CD56(+) cells in SLT and PB...... 108
Figure 20. Model of human NK cell development in vivo...... 110
- xii -
LIST OF TABLES
Table Pages
Table 1. Cytokine production by in vitro-derived CD56bright NK cells...... 29
Table 2. Functional characteristics of SLT-resident NK intermediates...... 85
Table 3. Surface antigen expression profiles of SLT-resident NK intermediates...... 111
- xiii -
CHAPTER 1
BACKGROUND
1.1 Natural killer cells: innate immune effector cells
The human immune system is composed of various cell types that act coordinately to defend against invading pathogens and malignancy. NK cells represent one component of the so-called innate immune system that responds immediately to infection and provides protection while the adaptive arm of the immune system, consisting of T and B lymphocytes, becomes activated. Although traditionally classified as innate immune effector cells, NK cells are functionally, morphologically, and phenotypically similar to T cells and are often described as large granular lymphocytes.
Among the total lymphocyte pool in human peripheral blood (PB), NK cells constitute
~10% of all lymphocytes (1).
NK cells can be identified on a per-cell basis by their distinct morphology that shows a large, round nucleus and many cytoplasmic granules. In addition, NK cells, like other immune cells, can be analyzed in single-cell suspensions using flow cytometry.
Using this technique, researchers have established that human NK cells in PB can be identified by the lack of surface expression of other lineage specific antigens, including
CD3 (T cells), CD14 (monocytes and macrophages), and CD19 (B cells), and by the positive expression of CD56 (1). Currently, the role for CD56 is unknown, yet most, if
- 1 - not all, NK cells in human PB express CD56. Therefore, typically, human NK cells are minimally identified by the CD3(-)CD56(+) phenotype.
1.2 General concepts of human NK cell development
NK cells in vivo have a limited lifespan and hence the stores of NK cells must be continually replenished to maintain sufficient numbers throughout the body (2). As with
any biological process, genetic and environmental components act in concert to ensure
that the body produces NK cells that are not only functional; they are also self-tolerant of
normal tissues (3). The genetic components dictate the relative lineage potentials of
intermediates at each stage of their development, the ability of cellular intermediates to
respond to receptor ligands, and the ways in which external stimuli are incorporated into
an individual cell’s differentiation status. The environmental components include other
hematopoietic cells and stroma, which reciprocally interact with developing NK cells and
sense their needs as well as the needs of the body, and growth factors that can promote
the survival, apoptosis, proliferation, and/or differentiation of cellular intermediates.
Defining these cell-intrinsic and cell-extrinsic components in vivo is critical in order to understand how we might potentially modulate NK cell activity in patients with cancer or immune deficiency.
For the past three decades, it has been generally accepted that NK cell
development primarily occurs within the BM microenvironment (2, 4, 5). Selective BM
ablation studies in mice provided the first evidence in support of an important role of the
BM for supporting NK cell maturation in vivo (6, 7), and mouse NK cell developmental
intermediates have been identified within this tissue (8, 9). In humans, hematopoietic
- 2 - stem cells (HSCs) and HPCs are normally enriched within adult BM (10), and co-culture of BM-derived HPCs on BM stromal cells promotes the differentiation of cytolytic NK cells in vitro (11). However, despite these data, the possibility that human BM-derived
NK cell developmental intermediates may traffic to peripheral tissues to undergo terminal maturation steps has never been excluded (12). Moreover, a complete and continuous pathway of NK cell differentiation has not been described within adult human BM that would more definitively demonstrate actual differentiation in situ.
Perhaps the main reason for this lack of evidence is that the in vivo stages of
human NK cell development have remained elusive for many years. As with other cells of the immune system, NK cells ultimately derive from self-renewing HSCs that are capable of giving rise to each of the hematopoietic lineages in response to environmental
cues. In general, hematopoiesis occurs in maturational stages, involving the
differentiation of HSCs first into oligo-potent HPCs, then into precursor cells, lineage
restricted immature cells, and, lastly, fully differentiated, functionally mature cell types.
Often, the terms progenitor and precursor are used interchangeably in the literature,
because these cell populations in humans commonly express the CD34 antigen, which is
not expressed on mature hematopoietic cells. Furthermore, these and other cellular
designations may mean different things, especially when pertaining to different
hematopoietic lineages. Therefore, it is helpful to classify such populations based on
their functional characteristics.
By definition, mature NK cells have cytolytic potential, can produce cytokines,
such as interferon (IFN)-γ, and express specific functional receptors that enable NK cells
to recognize and respond to cellular targets. In contrast, NK cell developmental
- 3 - intermediates lack these characteristics yet have the capacity to differentiate into mature
NK cells. But what distinguishes an NK cell progenitor (pro-NK) versus an NK cell precursor (pre-NK) or immature NK cell (iNK)? Based on in vitro and in vivo evidence
supporting a central physiologic role for interleukin (IL)-15 in both human and mouse
NK cell development, pro-NK, pre-NK, and iNK cells can be defined in relation to the
expression of and signaling through the shared IL-2/IL-15 receptor β chain (CD122) (12,
13). Accordingly, pro-NK cells can be defined as CD122(-) cells that have the capacity
to directly give rise to pre-NK cells, which express CD122(+). Following ligation of the
IL-15R by IL-2 or IL-15, pre-NK cells can differentiate into iNK cells that are presumed
committed to the NK cell lineage and can subsequently undergo additional maturation
steps to gain the phenotypic and functional attributes of mature NK cells.
Just as mature NK cells must be identified by the unique combination of surface
antigens, so too must the cellular intermediates in their developmental pathway.
However, because there are no known surface antigens that unambiguously identify cells
of the NK-lineage, it remained a challenge to definitively identify NK cell developmental
intermediates in humans (1, 12). In the next chapter, I present a study in which we
sought to refine the surface phenotype of the human IL-2/15-responsive pre-NK cell
using a combination of numerous antigens to discriminate subsets of CD34(+) HPCs in
the blood and BM. Intriguingly, through the course of this study, not only did we
identify the pre-NK cell population, this study also led to the serendipitous discovery that
these cells are naturally and selectively enriched within human lymph nodes (LNs),
suggesting that the latter may be sites of human NK cell development in vivo. Based on
this premise, we next elucidated the full developmental pathway within human LNs and
- 4 - tonsils, providing a new and comprehensive model for the development of NK cells in humans. This study is presented in Chapter 3.
- 5 -
CHAPTER 2
DISCOVERY OF THE HUMAN PRE-NK CELL AND ITS NATURAL
ENRICHMENT IN LYMPH NODES
2.1 Introduction
Human NK cells are CD3(-)CD56(+) large granular lymphocytes that can kill infected or transformed cells that fail to express normal major histocompatibility complex
(MHC) class I (MHC-I) molecules, thereby complementing protection provided by T cells (4). Similar to other lymphocytes, the total human NK cell population is heterogeneous, with the CD56bright and CD56dim subsets representing two phenotypically and functionally distinct subsets (14). CD56bright NK cells have few cytotoxic granules
and low expression of the low affinity Fc receptor, CD16, and killer cell
immunoglobulin-like receptors (KIR), all consistent with poor cytolytic properties, but are capable of potent activation-induced cytokine and chemokine production (14, 15). By comparison, CD56dim NK cells have abundant cytolytic granules and high surface density expression of CD16 and KIR for potent antibody dependent and natural cytolytic function, with little ability to produce immunomodulatory cytokines. Currently, the developmental relationship between the CD56bright and CD56dim human NK subsets is unclear, as is their site(s) of differentiation. Whereas ≥ 90% of NK cells in PB are
CD56dim, > 90% of NK cells in LNs and tonsils are CD56bright (14, 15). A recent study by
- 6 - Munz and colleagues showed that the resident CD56bright NK cells in SLT could be induced with IL-2 to adopt functional and phenotypic qualities of PB CD56dim NK cells
(16), suggesting that CD56bright NK cells may be less mature than CD56dim NK cells in a sequential scheme of human NK development. Considering these findings, we hypothesized that LNs might be sites of early human NK development in vivo.
A corollary to this hypothesis is that the human NK cell precursor would need to reside in LNs. Similar to other leukocyte populations, human NK cells are ultimately derived from CD34(+) HPCs, yet the precise phenotype of the human pre-NK cell is unknown (2, 4). Culture of purified human BM CD34(+) HPCs in either IL-2 or IL-15 primarily results in the generation of CD56bright NK cells (17). Similarly, mouse NK cells
can be generated by in vitro culture of immature BM progenitors in IL-2 or IL-15 (18).
Both IL-2 and IL-15 signal in part via a common IL-2/IL-15 receptor (R) β chain
(CD122) (13), and CD122-deficient mice are severely deficient in mature NK cells (19).
Indeed, the lineage (Lin)(-)CD122(+) population in mouse BM has clearly been identified as the committed mouse pre-NK cell (9), however, CD122 expression on freshly isolated human CD34(+) HPCs is below the limits of detection by flow cytometry (20, 21).
Therefore, while the human NK precursor can be defined by its functional ability to differentiate into a CD56bright NK cell in response to IL-2 or IL-15, the precise phenotype
of this CD34(+) HPC remains elusive.
Previous work by other laboratories has provided invaluable insight into the
phenotype of the CD34(+) human pre-NK cell by associating surface antigen expression
with pre-NK cell function. For example, Miller and colleagues provided early evidence
that co-expression of CD7 on CD34(+) HPCs selectively enriched for pre-NK cells (22).
- 7 - In addition, work by the Chen laboratory demonstrated that the co-expression of CD10 on
BM CD34(+) HPCs identified the human common lymphoid progenitor (CLP) that included pro-NK cells (23). Despite these advances, both CD34(+)CD7(-) and
CD34(+)CD10(-) HPC populations also contain some pre-NK cells as determined by differentiation into CD56bright NK cells following incubation in IL-2 or IL-15 (22-24).
Thus, the “all-inclusive” human CD34(+) pre-NK cell remains to be identified.
Here, we identify a novel subset of CD34dim HPCs that constitutively expresses
CD45RA and high surface density integrin α4β7, with functional evidence for expression
dim bright of the heterotrimeric high affinity (HA) IL-2Rαβγ. The CD34 CD45RA(+)β7 subset of CD34(+) HPCs is selectively and highly enriched for within human LNs and resides in the T cell-rich regions along with CD56bright NK cells. The
dim bright CD34 CD45RA(+)β7 subset is unique in that differentiation into functional
CD56bright NK cells appears to occur exclusively within this CD34(+) HPC subset and can occur in the presence of IL-15 or at concentrations of IL-2 that only saturate its HA
IL-2R. Further, we show that activated autologous LN T cells can also promote the
dim bright bright differentiation of the CD34 CD45RA(+)β7 NK precursor into a CD56 NK cell in vitro. The data support a model of human NK cell development in which a BM-
dim bright derived CD34 CD45RA(+)β7 pre-NK cell population selectively resides in LNs where endogenous cytokines can drive its differentiation into CD56bright NK cells in vivo.
2.2 Results
Human pre-NK cells are enriched within PB
The CD56bright NK cell is the only resting lymphocyte population in blood to constitutively express a heterotrimeric HA IL-2Rαβγ (25, 26). To identify its precursor, - 8 - we first searched for a subset of CD34(+) HPC that might also express the HA IL-2Rαβγ
and differentiate into a CD56bright NK cell via signaling through this receptor. The HA
IL-2Rαβγ is unique in that it can signal following the binding of very low concentrations
(10 pM or 2.3 U/ml) of IL-2, and this binding can be completely abrogated with the anti-
IL-2Rα monoclonal antibody (mAb) (27). This population was found entirely within the
CD45RA(+) subset of CD34(+) HPC of both BM and PB (Figure 1). We observed identical results in nanomolar concentrations of either IL-15 or IL-2 that utilize the shared IL-2/15Rβγ but not the IL-2Rα (CD25) (13) (not shown). Importantly, there was a significant difference in the absolute numbers of CD56bright NK cells derived from
2×104 CD34(+) BM HPC (537 ± 340, n=9) versus an equal number of PB CD34(+)
HPCs (6831 ± 4329, n=5) (P=0.0013), suggesting that PB contains a much higher
percentage of CD34(+) pre-NK cells than BM (see below).
Functional and phenotypic characterization of the CD34(+)-derived CD56bright NK cells
The CD56bright NK cells derived under these conditions from CD34(+) HPCs were cytotoxic against the NK-sensitive K562 cell line (Figure 2A) and capable of cytokine production when co-stimulated in recombinant monokines (Figure 2B and Table 1).
Similar to PB CD56bright NK cells, these cells could not produce cytokines when only co-
cultured with K562 targets (not shown). Figure 2C and 2D provide a representative
phenotype of CD34(+)-derived CD56bright NK cells. We did not observe any consistent phenotypic differences between BM or PB CD34(+)-derived CD56bright NK cells, but a few distinct differences in phenotype were noted between these cells (Figure 2C) and - 9 - mature PB CD56bright NK cells (Figure 3). For example, fresh or in vitro cultured mature
PB CD56bright NK cells display uniform expression of CD94 (bright) and leukocyte function-associated antigen-1 (LFA-1), whereas most of the CD34(+)-derived CD56bright
NK cells lack these antigens (Figure 2D). Given these qualitative differences in
phenotype, the consistent high purities of our CD34 preparations (Figure 4), and the very
limited growth potential of mature PB CD56bright NK cells cultured ex vivo (28), the detection of CD56bright NK cells following prolonged cultures of CD34(+) HPCs with IL-
2 or IL-15 cannot result from contamination by mature PB CD56bright NK cells. Rather, these data collectively show that the human pre-NK cell which differentiates to a
CD56bright NK cell in the presence of IL-15 or IL-2 is found exclusively within the
CD34(+)CD45RA(+) HPC population and is more abundant in PB than in BM.
Refinement of the phenotype of the CD34(+)CD45RA(+) pre-NK cell
Our statistical analyses of pre-NK cell frequency in BM and PB noted above
suggested that these CD34(+)CD45RA(+) pre-NK cells may be trafficking out of the BM to the periphery. We therefore analyzed surface expression of homing and chemokine receptors and cell adhesion molecules (CAMs) on total PB CD34(+) HPCs. We observed that all PB CD34(+) cells express similar levels of α4β1 integrin and PEN5 (not shown), whereas CD34(+)CD45RA(+) cells display relatively higher levels of LFA-1 compared to CD34(+)CD45RA(-) HPC (Figure 5). While PB CD56bright NK cells express CCR7 and CXCR3 (14, 29), we could not detect the expression of either of these chemokine receptors on any PB CD34(+) subset (not shown). Interestingly, we found that among total PB CD34(+) cells, a unique CD34dimCD45RA(+) subset expresses very high levels
- 10 - of CD62L (L-selectin) and integrin α4β7 (represented by integrin β7, Figure 5). Of note,
these cells are distinct from CD34dimCD45RA(+)CD4(+)CD123bright pro-DC2 cells (30),
dim which are CD25(-)CD117(-)α4β7 (our unpublished observations) and were depleted
from our PB CD34 preparations with an anti-CD4 mAb (see Experimental Procedures).
The PB CD34dimCD45RA(+) subset we describe here is strikingly reminiscent of mature
PB CD56bright NK cells based on its expression of CD2, CD7, CD117 (c-kit), and CD161
(shaded histograms in Figures 3 and 5) (14). In contrast, the majority of PB
CD34brightCD45RA(+) cells (open regions with solid lines in Figure 5) lack these markers yet express surface CD10, suggesting that this population may be functionally similar to the CD34(+)CD45RA(+)CD10(+) CLP population previously described in adult BM (23). In addition, the CD34brightCD45RA(+) subset expresses the early stem cell marker, AC133, potentially indicating that this subset is relatively immature compared to the CD34dimCD45RA(+) subset that displays no AC133 (Figure 5) (31).
Subtle overlaps in phenotype between the two PB CD34(+)CD45RA(+) populations presented an initial challenge to sort these subsets to high purity. For
example, not all the CD34dimCD45RA(+) cells are CD10(-) and not all the
CD34brightCD45RA(+) cells are CD7(-) (Figure 5). Among the surface markers we analyzed, relative bright expression of integrin β7 best differentiated the
CD34dimCD45RA(+) subset not only from other CD34(+) subsets but also from mature
bright dim CD56 and CD56 NK cells, which have absent or low expression of integrin β7, respectively (Figure 3 and data not shown). Therefore, we used a combination of mAbs against CD34, CD45RA, and integrin β7 to purify the two PB CD34(+)CD45RA(+) subsets and to reduce the potential for mature NK cell contamination in our sorts, a - 11 - representative of which is shown in Figure 6. After 2 weeks of culture in 10 pM IL-2 or
dim bright 1 nM IL-15 or IL-2, we observed that the CD34 CD45RA(+)β7 subset repeatedly
gave rise to CD3(-)CD14(-)CD56bright NK cells (n=11) by FACS with excellent purity
(Figure 6). Generally, we observed only ~1-3-fold expansion when the cells were
cultured in 10 pM IL-2, and ~15-fold expansion when cultured in 1 nM IL-2 or IL-15
(Figure 7). However, there was much greater expansion of these cells when cultured on
the AFT024 murine fetal liver stromal cell line (32) in the presence of 1 nM IL-2 and 100
ng/ml of flt3 ligand (FL), 100 ng/ml c-kit ligand (KL), and 10 ng/ml IL-7 (Figure 7),
indicating that these cells are highly proliferative when cultured in the presence of excess
cytokines and cellular support. The CD56bright NK cells derived on the AFT024 line
displayed the same phenotype as that shown in Figure 2C and 2D (not shown). In stark
dim bright contrast to the results obtained from the CD34 CD45RA(+)β7 subset, most of the
bright dim/neg CD34 CD45RA(+)β7 cells died in culture with only IL-2 or IL-15 (not shown), and none of the live cells had the CD3(-)CD14(-)CD56bright phenotype (Figure 6). Based on these results and those from Figure 1, we conclude that the CD56bright NK precursor
dim bright population is contained exclusively within the CD34 CD45RA(+)β7 PB subset.
dim bright CD34 CD45RA(+)β7 cells reside in human LNs
In contrast to PB where >90% of NK cells are CD56dim, >90% of NK cells in
human LNs are CD56bright and are located in the parafollicular T-cell rich regions (15).
One potential model predicts that CD56bright NK cells develop in the BM and traffic to
LN where they participate in the immune response through release of IFN-γ and other
cytokines (4, 15, 16, 29, 33). An alternative model is that BM-derived pre-NK cells first - 12 - traffic through PB to LNs where they can differentiate into CD56bright NK cells in
response to endogenous cytokines. Indeed, consistent with the significantly greater
number of CD56bright NK cells derived from PB versus BM CD34(+) HPCs noted above,
dim bright <1% of BM CD34(+) HPC display the phenotype of the CD34 CD45RA(+)β7 population shown in Figure 5 (n=5), compared to ~6% of PB CD34(+) HPC (n=20).
These data support the possibility that at least a subset of pre-NK cells is destined for the periphery. Further, in addition to integrin α4β7, our data also show that the PB
dim bright CD34 CD45RA(+)β7 subset displays very high surface density expression of LFA-
1 and CD62L (Figure 5), all three of which can facilitate the extravasation of leukocytes
across LN high endothelial venules (34).
dim bright To test the hypothesis that CD34 CD45RA(+)β7 cells reside in LNs, phenotypic analyses of CD34(+)-enriched single-cell LN suspensions from eight individual donors were performed. In striking contrast to PB, nearly the entire CD34(+)
dim bright population discovered within human LNs was CD34 CD45RA(+)β7 (Figure 8A
dim bright and 8B). Thus, while the CD34 CD45RA(+)β7 subset represents only ~6% of all
PB CD34(+) HPCs, this subset represents >95% of all LN CD34(+) HPCs (n=8). This
dim bright natural and nearly exclusive enrichment for the CD34 CD45RA(+)β7 subset of
CD34(+) HPCs in LNs eliminates PB contamination as the source of these cells. Further,
dim bright PB CD34 CD45RA(+)β7 cells express high levels of surface CD62L while the LN
dim bright CD34 CD45RA(+)β7 cells had lower or absent expression (compare Figure 5, bottom right panel to Figure 8B). This suggests that CD62L may be involved in the
dim bright extravasation of PB CD34 CD45RA(+)β7 cells into LNs and may subsequently
- 13 - downregulate upon entrance (34). As shown in Figure 8C, we were able to detect
CD34(+) cells within LN tissue sections using in situ RT-PCR (note the uniform cytoplasmic staining within the indicated cell). The frequency of CD34(+) cells detected by this method corresponds to an estimate of ~1 CD34(+) cell per 35,000-50,000 total LN
cells. This is in agreement with the predicted frequency from our flow cytometry data
that shows these cells to represent <0.05% of all events without CD34(+) enrichment
when using a live forward scatter/side scatter gate (not shown). To our knowledge, this
represents the first identification of CD34(+) HPCs in human LNs. Collectively, these
results support the notion that among all PB CD34(+) HPCs, it is the
dim bright bright CD34 CD45RA(+)β7 subset that exclusively contains the CD56 NK precursor and selectively resides in LNs. Formal proof that this cell actually traffics from PB to
LNs will await further study.
T cell activation promotes CD56bright NK differentiation in vitro
Immunohistochemistry (IHC) staining on serial LN sections with an anti-CD3 mAb revealed that the CD34(+) HPCs we observed by in situ RT-PCR (Figure 8C) were
located within T cell rich regions of LN sections (Figure 8D), where we previously
reported that CD56bright NK cells also reside (15). To recapitulate what might occur in vivo during T cell activation, total LN CD34(+) HPCs were co-cultured with autologous
LN CD3(+) T cells in the presence of CD3/CD28 stimulation. As shown in Figure 9, we observed CD3(-)CD56bright NK cell development after only 7 days under these conditions, along with a >10-fold increase in activated T cell numbers (not shown). We similarly
bright dim/neg dim bright cultured purified PB CD34 CD45RA(+)β7 and CD34 CD45RA(+)β7 - 14 - subsets with autologous PB CD3(+) T cells and observed that similar to the results
dim bright obtained by 7-day culture in exogenous IL-2 or IL-15, only CD34 CD45RA(+)β7 cells gave rise to NK cells in the presence of CD3/CD28 stimulated T cells (Figure 9).
The addition of an anti-IL-2 mAb to these co-cultures resulted in variable (average 25%, n=9) reduction in CD56bright NK cell development, likely due to the contribution of other endogenous factors (e.g., IL-7, IL-15, IL-21, KL) that might directly or indirectly contribute to this process. Thus, activated LN T cells, in close proximity to LN
dim bright bright CD34 CD45RA(+)β7 HPCs, can induce human CD56 NK cell differentiation without the addition of exogenous cytokines.
2.3 Discussion
NK cells are innate immune effectors that serve a number of important functions in the body’s defense against infection and malignant transformation. In one instance, the NK cell’s provision of IFN-γ to monocytes/macrophages recently infected by obligate intracellular pathogens results in a critical short-term containment of infection while the more sustaining T cell response can be mounted (35). In other instances, donor NK cell
KIR mismatch with host MHC-I expression on acute myeloid leukemia blasts appears critical in predicting a favorable response following haplo-identical BM transplantation
(36). Thus, both cytokine production and cytolytic activity are important NK cell properties in mediating effective host defense against disease. In humans, these two NK functions can be broadly assigned to two NK subsets. CD56bright NK cells have few cytolytic granules and low-absent KIR expression but produce abundant cytokines and chemokines when activated by monokines. CD56dim NK cells do not produce appreciable - 15 - amounts of cytokines yet have abundant expression of KIR and perforin that readily promote their potent cytolytic functions (14). Greater than 90% of NK cells in LNs are
CD56bright while ~90% of NK cells in PB are CD56dim (15).
While human NK cells originate from CD34(+) HPCs, the site(s) of their differentiation and the developmental relationship between CD56bright and CD56dim NK subsets are currently unresolved (4). To date, no one CD34(+) subset has been shown to contain all human NK precursors when differentiated to CD56(+) NK in the presence of
IL-2 or IL-15. We previously noted that the CD56bright NK cell has unique constitutive expression of the heterotrimeric HA IL-2Rαβγ among lymphocytes in resting blood (25) and hypothesized that its CD34(+) precursor might also express this receptor and differentiate into a CD56bright NK cell when the HA IL-2R was saturated. In this report, we used this functional assay to initially identify a novel CD34(+) subset of HPCs,
dim bright subsequently characterized as CD34 CD45RA(+)β7 which, when cultured in IL-15 or IL-2, appears to contain the pre-NK cell population in its entirety. The
dim bright CD34 CD45RA(+)β7 pre-NK cell co-expresses other surface receptors and CAMs
that facilitate trafficking to LNs (34) and we discovered that, among all CD34(+) HPCs
dim bright in BM and PB, the CD34 CD45RA(+)β7 population is uniquely enriched within human LNs. In addition to its NK development in the presence of IL-2 or IL-15, we demonstrate that endogenous T-cell derived cytokines can also drive the
dim bright CD34 CD45RA(+)β7 HPCs toward NK cell differentiation. We therefore propose
that this unique subset of CD34(+) HPCs is produced in the BM, traffics through the
blood to finally reside in LNs where it differentiates into a CD56bright NK cell under the influence of endogenous cytokines. - 16 - Despite the results presented here, such a model challenges the current conception of NK cell development in vivo. First of all, while it is well established that the human thymus contains CD34(+) HPCs with the potential for NK cell differentiation (37, 38), it
is generally accepted that in adults NK development primarily occurs in the BM, as its
ablation results in the loss of lytic NK cells that can be restored by BM transplantation (4,
39). However, this does not preclude the possibility that BM-derived pre-NK cells may
traffic to the periphery for final maturation. For instance, adult human PB contains
CD34(-)CD161(+)CD16(-)CD56(-) putative iNK cells (40). Further, Ferlazzo et al.
recently suggested that late events in human CD56bright NK maturation likely occur in
SLT, as the resident CD56bright NK cells in LNs and tonsils could be induced with low-
dose IL-2 to adopt functional and phenotypic qualities of PB NK cells (16). Our new
dim bright findings that human CD34 CD45RA(+)β7 HPCs reside within LNs and our previous findings that their CD56bright NK progeny are highly enriched in LNs (15)
strongly implicate the LN as a site of early human NK cell differentiation.
In adult mice, NK cell development is similarly thought to occur in the BM, yet it
is noteworthy that selective NK cell deficiencies are found in mice lacking LNs whereas
T or B cells are not deficient (4). During mouse embryonic development, integrin
α4β7(+) fetal lymphoid tissue inducer (LTi) cells traffic to developing LNs and Peyer’s
patches (PP) and induce formation of these tissues (41). Id2-/- mice lack fetal LTi cells and therefore fail to develop peripheral LN and PP (42). Similarly, the absence of membrane lymphotoxin (LT) β expression on LTi cells also results in failure of these tissues to develop (41). As fetal LTi cells have the potential to differentiate into mature
NK cells (43), it is noteworthy that both Id2-/- and LTβ-/- mice lack mature NK cells (42, - 17 - 44). In light of these reports, it is interesting to speculate that human
dim bright CD34 CD45RA(+)β7 HPCs may represent a similar cell population in humans, and,
if so, potentially regulate or maintain the generation of human SLT in vivo.
Our ex vivo studies show that soluble IL-15, like IL-2, specifically acts on the
dim bright bright CD34 CD45RA(+)β7 HPCs to drive CD56 NK cell differentiation. Further,
cultures with other cytokines, such as KL, FL, IL-7 and the AFT024 fetal liver stromal
cell line also indicate that either IL-2 or IL-15 are required for NK cell differentiation.
Thus, in vivo, these two cytokines can likely both induce NK cell differentiation from the
dim bright LN CD34 CD45RA(+)β7 precursors, but their expression on different immune cells
and their differential expression during immune quiescence and activation may dictate
how and when each contributes to this process.
dim bright Although the LN CD34 CD45RA(+)β7 HPC constitutively expresses the
HA IL-2Rαβγ that selectively binds IL-2, the highly restricted availability of IL-2 strongly suggests that it alone cannot be responsible for CD56bright NK cell development
in the absence of T cell activation. We propose that in the absence of antigen specific immune activation, CD56bright NK cell differentiation is regulated by cytokines known to
be constitutively expressed by stroma and antigen presenting cells (e.g., FL, KL, and the
requisite IL-15). Then, during processes that activate resident T cells in LNs,
endogenously produced IL-2 might also contribute along with other cytokines to drive
bright dim bright CD56 NK cell differentiation from LN CD34 CD45RA(+)β7 HPCs, in addition
to promoting autocrine LN T cell activation and paracrine LN CD56bright NK cell activation (15). In this way, NK stores depleted during the early phase of infection could be replenished during the late, antigen specific phase of infection. Future studies using in - 18 - vivo models will be important to address the hypothesis that adaptive immune activation
can drive NK cell development.
In any of these scenarios, we would propose that IL-2 is not required for the
dim bright bright survival of either the CD34 CD45RA(+)β7 HPC subset or the CD56 NK cell, because of IL-2’s restricted expression (13). We believe that the tyrosine kinase receptors, flt3 and CD117, which we observed are also expressed on
dim bright CD34 CD45RA(+)β7 precursors, likely mediate the survival signal(s) for this subset and may be involved in its development, as incubation of BM CD34(+) HPC in either FL or KL increases the frequency of NK cell precursors (21). Indeed, FL is produced in the
BM while KL is normally abundant in both BM and human serum (4, 17, 45). Further,
KL binding and signaling through CD117 expressed on CD56bright NK cells mediates
BCL-2-dependent survival in serum-free medium (46). In addition, other cytokines
signaling through the common IL-2Rγ chain (47, 48) as well as membrane-bound LTβ
(49) also likely play important roles in the generation, survival, and/or maturation of
dim bright CD34 CD45RA(+)β7 HPCs.
The insights gained from this study do not appear to help resolve the issue of
human CD56bright and CD56dim NK subset development. CD56bright NK cells may have a pathway of development that is distinct from the CD56dim NK cell that lacks a functional
dim bright HA IL-2R (25). In our short-term cultures of the CD34 CD45RA(+)β7 precursor with IL-2 or IL-15, we never observed the development of bona fide
[CD16(+)KIR(+)CD117(-)] CD56dim NK cells (14), yet we currently have no data to
suggest that the CD56dim NK cell is derived from a separate HPC. Therefore, an
- 19 - alternative hypothesis is that a developing NK cell may first proceed from CD56bright to the CD56dim NK cell, but again, data supporting this pathway is lacking (4).
dim bright In summary, we identify a novel CD34 CD45RA(+)β7 pre-NK cell that is uniquely enriched to reside within the parafollicular T cell-rich region of human LNs. We
dim bright demonstrate that incubation of the CD34 CD45RA(+)β7 pre-NK cell with activated
LN T cells can induce differentiation into a CD56bright NK cell. These data implicate human LNs as sites for CD56bright NK cell development.
2.4 Experimental Procedures
Purification of CD34(+) HPCs from human tissue
All protocols were approved by The Ohio State University (OSU) Institutional
Review Board. Fresh human BM was donated or purchased from AllCells, LLC
(Berkeley, CA) and received within 24 hours of harvest. PB leukopaks were obtained
from the American Red Cross. BM or PB mononuclear cells were enriched by a ficoll-
centrifugation step and then total CD34(+) cells were either enriched over 1 magnetic
column or purified (>97%, Figure 4) over 2 magnetic columns using the Miltenyi
CD34(+)-enrichment kit (Miltenyi Biotec, Auburn, CA). For sorting experiments and
phenotypic analyses, total PB was treated with a rosette cocktail against CD3, CD4,
CD19, CD36, and glycophorin A (StemCell Technologies, Vancouver, BC Canada) to
deplete cells expressing these markers during the ficoll-centrifugation step. Human LNs
were retrieved fresh from surgically discarded tissue from non-cancer patients by the
OSU Tissue Procurement Resource and from the National Disease Research Interchange
(NDRI). LN single cell suspensions were prepared as described (15) and total CD34(+) - 20 - cells were enriched as above. LN CD34(+) HPCs were either stained for flow cytometric analyses or sorted to purity for cell culture (Figure 4).
Flow cytometry and cell sorting
All conjugated and unconjugated experimental and isotype control mAbs used in this report were purchased from BD Biosciences except CD16, CD56, CD122, CD158a,
CD158b, NKp30, NKp44, NKp46 (Coulter, Miami FL), NKG2D (R&D Systems,
Minneapolis, MN), and AC133 (Miltenyi Biotec, Auburn, CA). Nonspecific binding was minimized by pre-incubation with whole mouse IgG (direct primary staining) or whole goat IgG (indirect staining) (Sigma, St. Louis, MO). Cells were assessed on a
FACSCalibur analyzer and analyzed with CellQuest (BD Biosciences) or WinMDI (J.
Trotter, Scripts Institute, La Jolla CA) software. For culture experiments of purified
CD34(+) subsets, cells were sorted on a FACSVantage cell sorter (BD Biosciences) and then sort purities were verified on a FACSCalibur.
NK cell development cultures
IL-2 was provided by Hoffman LaRoche (Nutley, NJ) and used at the indicated concentrations. FL and IL-15 were provided by Amgen (Thousand Oaks, CA), and KL and IL-7 were from R&D Systems. Unless otherwise indicated, human NK cell development cultures were initiated with 2×104 CD34(+) HPCs in 200 µl complete
medium consisting of RPMI-1640 with GlutaMAX, 10% heat-inactivated human AB
serum (ICN Biomedicals, Irvine, CA), antibiotics, 10 mM HEPES, 100 µM non-essential
amino acids, 1 mM Na pyruvate (all from Invitrogen), and 50 µM 2-βME (Sigma) plus - 21 - exogenous cytokines. Half the culture medium was replaced every 3-4 days. At the time of final harvest, total cells/well were determined on a hemacytometer using trypan blue dye exclusion. The absolute numbers of mature CD56bright NK cells/well were calculated
by multiplying the average numbers of total viable cells from triplicate wells by the
average percent of CD3(-)CD56bright NK cells determined by FACS analyses. For
CD34(+) HPC/T cell co-culture experiments, 0.5-2×103 PB CD34(+) HPC subsets or total LN CD34(+) HPCs were incubated with 2.5×103 autologous PB or LN CD3(+) T cells (purified via FacsVantage sorting, Figure 4) stimulated with 5×103 anti-CD3/CD28 beads (Dynal Biotech, Brown Deer, WI) in the presence or absence of 10 µg/ml anti-IL-2 or control Ab (R&D Systems). After 7 days of culture, cells were harvested, counted for viability, and stained for flow cytometry.
Functional analyses of in vitro-derived NK cells
Purified CD34(+) cells were cultured as above for 2-4 weeks. To assess IFN-γ production by intracellular flow cytometry, cultured cells were pooled and then
resuspended at 106 cells/ml in complete medium plus 10 ng/ml IL-12 (Genetics Institute,
Cambridge, MA) and 100 ng/ml IL-18 (BASF, Worcester, MA) for overnight culture at
37°C. Golgi-plug (BD Biosciences) was added for a 4-hour incubation, and cells were next stained for surface CD3, CD14, and CD56 and then permeabilized using the
Cytofix/Cytoperm reagent (BD Biosciences). Cells were stained with either anti-IFN-γ-
FITC mAb or isotype control-FITC mAb, washed, and then analyzed by FACS.
Alternatively, cultured cells were stimulated with recombinant monokines or 5×103 K562
- 22 - target cells for 72 hours, and then supernatants were analyzed by ELISA for cytokine production using Quantikine kits from R&D Systems. CD34(+)-derived CD56bright NK
cells were tested for their ability to lyse K562 target cells in a standard chromium-release
assay as described (17, 21).
Immunohistochemistry and in situ RT-PCR
The protocols we used have been previously described (15, 50). Briefly, optimal
protease digestions of LN sections were followed by overnight incubation in RNase free-
DNase (10 U per sample, Boehringer Mannheim, Indianapolis, IN) and one step RT-PCR
using the rTth system and digoxigenin dUTP (50). The primer sequences for CD34
mRNA detection were: forward 5' accctgtgtctcaacatggca 3'; reverse 5' tctctgatgcctgaacat
3'. Additional controls included pretreatment with RNase digestion as well as RT-PCR
with irrelevant primers (HPV p16 specific primers) that have been described (50). IHC
using an anti-human CD3 mAb (Zymed Laboratories Inc., San Francisco, CA) was
performed as described (15).
Statistical analyses
The paired data were analyzed using an exact Wilcoxon Signed Rank test and the
unpaired data an exact Wilcoxon Rank Sum test. S-Plus version 6.0 and SAS version
8.02 were used for the analyses.
- 23 -
Figure 1. Co-expression of CD45RA on CD34(+) HPCs identifies human pre-NK cells. CD34(+)CD45RA(-) and CD34(+)CD45RA(+) populations from BM (n=3) and
PB (n=7) were sorted and cultured for 2 weeks in 10 pM IL-2, 1 nM IL-2, or 1 nM IL-15.
Results shown are representative. Only CD34(+)CD45RA(+) cells differentiate into
CD56bright NK cells in IL-2 or IL-15.
- 24 - CD34 CD45RA Preso identifies h Figure 1.Co-expressionofCD45RAonCD34(+)HPCs r t u man pre-NKcells. CD56 CD45R CD34(+) - 25 1 nM A ( 10 pM - ) IL- CD3 2 IL- orIL-15 2 or CD45 CD34 (+ R A ) ( + )
Figure 2. Functional and phenotypic attributes of CD34(+)-derived CD56bright NK cells. (A) CD34(+)-derived CD56bright NK cells are cytotoxic against K562 target cells at the indicated effector:target cell ratios. Results are representative of 6 experiments. (B)
IFN-γ production by CD34(+)-derived CD56bright NK cells. The dot plots were gated on
CD3(−) events. (C) Surface expression of CD34(+)-derived CD56bright NK cells. The histograms were gated on CD3(−)CD56bright events; shaded regions represent staining
with the specific mAbs as indicated, whereas dotted lines (open regions) represent isotype controls. No consistent differences in function or phenotype were observed between CD56bright NK cells derived from CD34(+) cells of BM or PB origin. (D)
Representative phenotypic comparison of CD56bright NK cells derived from CD34(+)
HPCs following a two week culture in IL-2 or IL-15 versus purified mature PB CD56bright
NK cells cultured for two weeks in IL-2 or IL-15.
- 26 - A B 100% sis y
L 80% ific
c 60% CD56 40% Spe t 20% Isotype IFN-γ 0% Percen 40:1 20:1 10:1 5:1 Effector:Target Ratio C D CD34(+)-derived CD56bright NK
CD161 NKG2D CD7 CD56
CD62L CD16 CD158a/b LFA-1 CD94 Cultured PB CD56bright NK
NKp30 NKp44 NKp46 CD56
CD25 CD122 CD117 LFA-1 CD94
Figure 2. Functional and phenotypic attributes of CD34(+)-
derived CD56bright NK cells.
- 27 -
Table 1. Cytokine production by in vitro-derived CD56bright NK cells. 2×104 purified
CD34(+) HPCs were cultured in 10 pM IL-2 for 2 weeks. Subsequently, one-half the
medium was replaced with 2× concentrations of stimulatory monokines, the
combinations of which were chosen based on optimal cytokine production by PB
CD56bright NK cells that produce measurable amounts of each of these cytokines as
previously reported (51). For production of IL-10, cultures were treated with 10 ng/ml
IL-12 and 100 ng/ml IL-15. For production of TNF-β, GM-CSF, and IL-13, cultures
were treated with 100 ng/ml IL-15 and 100 ng/ml IL-18. For production of TNF-α and
IFN-γ, cultures were treated with 10 ng/ml IL-12 and 100 ng/ml IL-18. Cultures that
received medium alone or 5×103 K562 target cells had undetectable cytokine levels (data not shown).
- 28 -
IL-10 TNF-β TNF-α IFN-γ GM-CSF IL-13 Donor # (pg/ml) (pg/ml) (pg/ml) (pg/ml) (pg/ml) (pg/ml) 367 <3.9 <7.0 37.8 68,000 94.1 177.6 998 <3.9 <7.0 23.9 110,700 729.1 272.5 999 <3.9 <7.0 31.5 103,800 1,811.5 405.8
Table 1. Cytokine production by in vitro-derived CD56bright NK cells.
- 29 -
Figure 3. Representative phenotypic analysis of mature PB CD56bright NK cells. The histograms are gated on CD3(-)CD56bright events; shaded regions represent staining with the specific mAbs as indicated, whereas dotted lines (open regions) represent isotype controls.
- 30 - CD161 NKG2D CD7
CD62L CD16 CD158a/b
NKp30 NKp44 NKp46
CD25 CD122 CD117
LFA-1 CD94 Integrin β7
Figure 3. Representative phenotypic analysis of mature PB
CD56bright NK cells.
- 31 -
Figure 4. Representative analyses showing the purity of CD34(+) and CD3(+) cell isolations. (A) After two rounds of positive magnetic selection cells were stained with
either an isotype control mAb (left) or anti-CD34 mAb that does not cross-react with the
mAb used for positive selection. (B) Representative analysis showing pre- (left) and
post-sort (right) staining for LN CD34(+) cells. (C) Representative analysis showing pre-
(left) and post-sort (right) staining for PB and LN CD3(+) T cells. In A-C, each of the
populations shown are >98% pure.
- 32 - A B Presort Sorted cells
Isotype CD34 LN CD34
C Presort Sorted cells
CD3
Figure 4. Representative analyses showing the purity of
CD34(+) and CD3(+) cell isolations.
- 33 -
Figure 5. Phenotypic analysis of PB CD34(+) HPC subsets. Dotted lines (open
regions) in the histograms represent isotype control staining of total PB CD34(+) cells;
shaded regions represent surface expression on CD34dimCD45RA(+) cells; solid lines
(open regions) represent expression on CD34brightCD45RA(+) cells; and dashed lines
(open regions) represent expression on CD34(+)CD45RA(-) cells. Prior to staining for flow cytometry, CD19(+) and CD4(+) cells, including pro-B (52) and pro-DC2 (30)
HPC, were removed. The data shown are representative of 10 donors.
- 34 - 4
CD3 CD10 CD117
CD45RA CD2 LFA-1
CD25 CD7 Integrin β7
AC133 CD161 CD62L
Figure 5. Phenotypic analysis of PB CD34(+) HPC subsets.
- 35 -
dim bright Figure 6. The PB CD34 CD45RA(+)β7 subset uniquely differentiates into
bright bright dim/neg CD56 NK cells in IL-2 or IL-15. PB CD34 CD45RA(+)β7 and
dim bright CD34 CD45RA(+)β7 cells were sorted and subsequently cultured for 2 weeks in 10
pM IL-2 or 1 nM IL-2 or IL-15 followed by FACS analysis to assess for CD3(-
)CD56bright NK cell development. The results are representative of 11 donors.
- 36 - CD34bright CD34dim CD45RA(+) CD45RA(+) dim/neg bright Presort Integrin β7 Integrin β7 CD34
CD45RA CD34
Integrin β7 IL-2 or IL-15 CD56
CD3
dim bright Figure 6. The PB CD34 CD45RA(+)β7 subset
uniquely differentiates into CD56bright NK cells in IL-2 or
IL-15.
- 37 -
dim bright Figure 7. Cellular yields from PB CD34 CD45RA(+)β7 HPC differentiation
dim bright assays. Sorted PB CD34 CD45RA(+)β7 cells were cultured for 12 days in 10 pM
IL-2, 1 nM IL-2, 1 nM IL-15, or on the AFT024 stromal cell line (32) with 10 ng/ml IL-7
(7), 100 ng/ml KL (K), and 100 ng/ml FL (F) with or without 1 nM IL-2. Shown are the combined results + standard deviation (SD) from 3 representative donors. The values were obtained by dividing the absolute numbers of CD56bright NK cells enumerated per
dim bright well at the end of the culture period by the starting number of CD34 CD45RA(+)β7 cells per well.
- 38 - 50 se 45 40 crea
In 35 30 25 20 NK Fold t h 15 g
bri 10
56 5
CD 0 F/K/7 + F/K/7 + 10 pM IL-2 1 nM IL-2 1 nM IL-15 AFT024 + AFT024 1 nM IL-2
dim bright Figure 7. Cellular yields from PB CD34 CD45RA(+)β7 HPC
differentiation assays.
- 39 -
Figure 8. Discovery of CD34dimCD45RA(+) HPCs in human LNs. (A) Comparative
flow cytometric analysis of CD34(+) HPC subsets in PB and LN following enrichment
for CD34(+) cells in each tissue. In contrast to PB, LN CD34(+) cells are almost
dim bright exclusively CD34 CD45RA(+)β7 . (B) Surface antigen expression of enriched LN
CD34(+) cells as determined by flow cytometric analysis. The
dim bright CD34 CD45RA(+)β7 subset in LNs is strikingly similar to the subset in PB except
for the former’s low or absent CD62L expression (compare with bottom right panel in
Figure 5). (C) RT in situ PCR for CD34 mRNA on human LN sections. The power of these images is 1000x. Control primers used in the left panel were specific for the human papilloma virus (HPV) p16 gene (50). The red arrow in the right panel indicates a
representative LN CD34(+) cell detected by this method. Note the uniform cytoplasmic signal coming from this cell indicative of cytoplasmic CD34 mRNA. (D) CD34(+) cells reside within the parafollicular T cell-rich regions of LNs. Shown on the right panel is the same LN section depicted on the right in C but at a lower power (200x). The red arrow in both images indicates the location of the CD34(+) cell detected by in situ RT-
PCR. On the left is a serial section from the same region of the LN stained with an anti-
CD3 mAb. Cells with brown staining are CD3(+). GC, germinal center; PF, parafollicular region.
- 40 -
B A PB LN
Isotype Integrin β7 AC133 CD34
CD45RA C CD2 CD7 CD10 CD34
CD4 CD19 CD56
Control primers CD34 primers D PF PF CD117 CD161 CD62L
GC GC
CD3 mAb CD34 primers CD25 CD122 CD132
Figure 8. Discovery of CD34dimCD45RA(+) HPCs in human
LNs.
- 41 -
Figure 9. T cell activation supports CD56bright NK cell differentiation from CD34(+)
bright dim/neg dim bright HPCs in vitro. PB CD34 CD45RA(+)β7 and CD34 CD45RA(+)β7 subsets
dim bright (n=6) or total LN CD34(+) HPCs [>95% CD34 CD45RA(+)β7 ] (n=3) were cultured for 7 days in exogenous IL-2 or IL-15 (left column) or co-cultured for 7 days with autologous PB or LN CD3(+) T cells activated via CD3/CD28 stimulation (right column). The CD3(-)CD56bright NK cells derived from these cultures are seen in the
upper left quadrant of each histogram. In data not shown, culture of sorted LN CD3(+) T
cells stimulated with anti-CD3/CD28 beads did not produce any CD56bright NK cells
without co-culture of the CD34(+) HPCs.
- 42 - IL-2 or IL-15 Activated T cells
PB CD34bright CD45RA(+) dim/neg Integrin β7
PB CD34dim CD45RA(+) bright
CD56 Integrin β7
LN CD34
CD3
Figure 9. T cell activation supports CD56bright NK cell
differentiation from CD34(+) HPCs in vitro.
- 43 -
CHAPTER 3
ELUCIDATION OF THE IN VIVO STAGES OF HUMAN NK CELL
DEVELOPMENT
3.1 Introduction and Review
NK cells are large granular lymphocytes that can kill infected or malignantly transformed cells and produce cytokines, such as IFN-γ, that regulate the innate and adaptive immune systems. Similar to other lymphocytes, human NK cells are thought to originate from CD34(+) HPCs that differentiate through discrete stages of maturation (4).
Whereas T and B cell developmental intermediates have been identified within the human thymus and BM, respectively, in vivo stages of human NK cell differentiation have not been defined.
Our current understanding of NK cell development stems primarily from findings in mice and in vitro differentiation systems (2, 4). Early studies revealed that IL-15 can promote the differentiation of cytolytic NK cells from CD34(+) HPCs in vitro (17). IL-
15 signals in part via the IL-2/15 receptor β chain (CD122), and mice lacking either IL-
15 or CD122 have severe NK cell deficiencies supporting their physiologic roles during
NK cell development in vivo (19, 53). Other cytokines, such as FL and KL, can induce the generation of CD122(+) pre-NK cells from IL-15-non-responsive mouse BM progenitors, indicating that the acquisition of “IL-15-responsiveness” marks a critical - 44 - stage in mouse NK cell development (18), and indeed the earliest committed mouse pre-
NK cells in vivo express CD122 yet lack other markers of mature NK cells (9). CD122 expression is also maintained throughout the downstream stages of mouse NK cell differentiation, which were recently elucidated by correlating integrin expression patterns with stages of proliferation, receptor expression, and acquisition of NK cell function (8).
In humans, CD122 expression on freshly isolated CD34(+) HPCs is below the limits of detection by flow cytometry, making it difficult to identify IL-15-responsive pre-NK cells (Figure 8) (20, 21, 54). In addition, mouse NK cells express NK1.1 and
DX5, whereas human NK cells are generally defined by the expression of CD56, which is not expressed by mouse NK cells (2, 4). Therefore, it has remained a challenge to identify the orthologous NK cell developmental intermediates in humans. However, despite these differences in antigen expression between the species, results from in vitro differentiation assays initiated with human CD34(+) HPCs have revealed important general consistencies with the in vivo mouse data. First of all, both the human in vitro data as well as the mouse in vivo data indicate that NK cell functional maturity (i.e. the ability to mediate natural cytotoxicity and produce IFN-γ) is acquired at a late stage of development, likely distal to the acquisition of surface CD56 in humans (8, 55, 56). In addition, similar to mouse NK cell differentiation, in vitro human NK cell differentiation is associated with the non-random, orderly acquisition of NK cell receptors (2, 4), with
CD161 and NKp46 being among the first NK cell receptors to be detected, followed by
CD94, and lastly CD16 and killer-cell immunoglobulin-like receptors (KIRs) (17, 47,
55). Collectively, these results suggest that human NK cells would differentiate through
- 45 - discrete developmental stages in vivo, yet the precise intermediates have not yet been described.
As mentioned in Chapter 2, humans, unlike mice, have two NK cell subsets, with the CD56bright subset being significantly more capable of proliferation and cytokine production while the fresh CD56dim subset displays a higher capacity for natural
cytotoxicity ex vivo (14). Currently, the developmental relationship between mature human NK cell subsets is unknown as are their sites of differentiation in vivo (4, 14).
Although >90% of PB NK cells are CD56dimCD16(+)KIR(+), the majority of NK cells in human LNs and tonsils are CD56brightCD16(-)KIR(-) (15, 16). In Chapter 2, we described a population of CD34dimCD45RA(+) HPCs that is highly enriched with pre-NK cells and that is unique among all CD34(+) subsets by its ability to co-localize within the T cell-
rich regions of human LNs near mature CD56bright NK cells (54). Based on these findings, we hypothesized that SLT might be sites of CD56bright NK cell differentiation and would, therefore, contain all the requisite NK cell developmental intermediates spanning the continuum of differentiation from a CD34(+) progenitor to a CD56bright NK cell. In the current study, we identify and functionally characterize such intermediates from SLT, thereby providing a new model for the development of human NK cells in vivo.
3.2 Results
Delineation of NK cell developmental stages within human SLT
We noted from previous work that although primary CD56bright NK cells found in
BM and PB co-express CD94, the majority of CD56bright NK cells derived in vitro from
- 46 - CD34(+) HPCs cultured in IL-15 lack CD94 (Figure 2D and 10A) (54), suggesting that a
CD94(-) intermediate stage may exist in vivo. Interestingly, fresh human SLT contain
CD3(-)CD56(+)CD94(-) cells (Figure 10A). We speculated that the latter may be immature NK cell developmental intermediates, and additional phenotypic analyses revealed that these cells are uniformly CD117(+) and some express CD34 (Figure 10B).
Based on these results we made the following three predictions of in vivo human NK cell development. First, given that CD34 and CD94 are mutually exclusive antigens (Figure
10B, right), a developing NK cell would first lose CD34 before acquiring CD94. Second, as all CD3(-)CD56(+) cells in SLT express at least either CD117 and/or CD94 (Figure
10B, left), NK cell developmental intermediates with the CD34(-)CD94(-) phenotype would be identifiable by the expression of CD117. Third, the CD34(+) HPC, that represents the human IL-15-responsive pre-NK cell, would express CD117.
Within human SLT, CD117 expression on CD34dimCD45RA(+) HPCs identifies a
CD56(+) and CD56(-) population (Figure 10C). The gradual upregulation of CD56
expression seen exclusively on the CD34(+)CD117(+) population suggested that NK
cells are derived from this population and that CD34(+)CD117(-) cells may be
functionally distinct as it pertains to NK cell developmental potential (Figure 10C).
Within the CD34(-) mononuclear fraction of human SLT, CD117 expression is absent on
CD3(+) T cells and CD19(+) B cells, whereas CD34(-)CD117(+) cells display a similar gradual upregulation of CD56 as that seen on CD34(+)CD117(+) HPCs and they uniformly co-express the pan-NK cell receptor, CD161 (Figure 10D). Thus, within both
CD34(+) and CD34(-) mononuclear fractions of human SLT, CD117 expression is highly
associated with the NK cell lineage.
- 47 - Given these collective data, we hypothesized that human NK cells differentiate through four discrete stages within SLT: stage 1: CD34(+)CD117(-)CD94(-); stage 2:
CD34(+)CD117(+)CD94(-); stage 3: CD34(-)CD117(+)CD94(-); and stage 4:
CD34(-)CD117(+/-)CD94(+). Although we did not include CD56 as a definitive criterion for the intermediate populations, its progressive expression through the stages, including high-density expression within stage 4 being similar to PB CD56bright NK cells, lends additional support to this paradigm of in vivo human NK cell differentiation
(Figure 11). Through the remainder of Chapter 3, these four populations are referred to as stages 1-4.
Surface marker and gene expression profiles of stages 1-4
To more comprehensively characterize stages 1-4 as they exist in vivo, we first performed flow cytometric analyses on freshly isolated stages as found in SLT, with a focus on antigens expressed by either immature HPCs or mature PB NK cells (Figure
12). In agreement with our model, antigens previously associated with immature lymphoid progenitors, including HLA-DR, CD10, and integrin β7 (23, 54), were detected at stages 1 and 2 yet not at stages 3 and 4. In contrast, similar to the gradual accumulation of CD56 expression within the stages (Figure 11), CD2, CD7, and CD11b expression were gradually increased from stage 1 to stage 4. Notably, the accumulation of CD11b at stages 3 and 4 is consistent with CD11b being a surrogate marker for
maturity during in vivo mouse NK cell differentiation (8). However, there were no
detectable differences in terms of CD43 expression in this regard (Fig. 3).
- 48 - Analysis of NK cell receptors on fresh stages 1-4 found within human SLT from multiple donors also revealed a consistent pattern, such that a greater number of these receptors was expressed at each progressive stage of differentiation (Figure 12). None of
the NK cell receptors we analyzed were detected at stage 1. CD161 was consistently the
only receptor expressed at stage 2, whereas both CD161 and NKp44 were detected at
stage 3. Stage 4 cells expressed CD161, NKp44 (albeit at low levels), NKp46 and
NKG2D, and we could also detect the expression of CD16 and CD158b at stage 4 on low
percentages of cells, similar to the low level expression of CD16 and KIRs on PB
CD56bright NK cells (14). Similarly, surface expression of CD122 was first noted at stage
3 and only readily detectable at stage 4. In contrast to these data, we could not detect the expression of NKp30 at any of the four stages in SLT (data not shown).
Next, we compared freshly isolated stages 1-4 for their relative mRNA expression of genes important for mouse NK cell development (57). Figure 13A and B shows representative sorts to purify these four populations directly from human SLT. As comparisons for the gene expression assay, we also analyzed each transcript in total PB
CD34(+) HPCs and PB CD56bright NK cells. As a control for methodology, CD34 mRNA was highest among PB CD34(+) HPCs, lower among stages 1 and 2, and invariably undetectable in lysates from stages 3 and 4 and PB CD56bright NK cells (Figure 13C).
Among stages 1-4, CD122 mRNA was first detectable at stage 2, more abundant in stage
3, and relatively more so in stage 4. ETS-1 mRNA is expressed by mature mouse NK cells (58), and we observed that it was detectable at stages 1 and 2, yet higher at stages 3 and 4. Mice lacking GATA-3 and T-BET display NK cell functional defects (59, 60), and it has been postulated that GATA-3 may function upstream of T-BET during mouse NK
- 49 - cell differentiation (57). Consistent with this hypothesis, we observed that GATA-3 mRNA expression peaked at stage 3, whereas T-BET mRNA was low or undetectable at stages 1-3, yet relatively much higher at stage 4, comparable to PB CD56bright NK cells
(Figure 13C).
Natural killing and cytokine production of NK cell development stages
According to the model of mouse NK cell differentiation proposed by Yokoyama and colleagues, acquisition of the capacities to mediate natural cytotoxicity and produce cytokines occurs at a late stage of maturation in vivo (8). Limiting cell numbers prevented us from directly assessing such functional capacities of stages 1 and 2 from human SLT. However, we were able to purify enough fresh stage 3 and 4 cells for analyses. As detected by intracellular flow cytometry, stages 1-3 lack perforin whereas perforin expression was detected at stage 4 (Figure 14A and data not shown).
Accordingly, stage 3 cells showed no killing against either K562 or Jurkat target cells, whereas stage 4 cells displayed >30% and >90% specific lysis against these targets, respectively (effector/target (E/T) ratio = 20:1, Figure 14B). In the presence of EGTA and MgCl2, the combination of which inhibits perforin-mediated killing (56), an anti-
TNF-related apoptosis-inducing ligand (TRAIL) blocking mAb had no effect on the
ability of stage 4 cells to lyse Jurkat targets, whereas an anti-Fas ligand (FasL) blocking
mAb did inhibit killing (Figure 14C). Therefore, under the conditions tested, freshly
isolated stage 4 cells mediated both perforin- and FasL-dependent killing but not TRAIL-
dependent killing, similar to PB NK cells (56), whereas stage 3 cells did not mediate
natural cytotoxicity via any of the three mechanisms.
- 50 - Freshly purified stage 3 and stage 4 cells were also stimulated for 12 hrs in either the combination of IL-12, IL-15, and IL-18 or phorbol-12-myristate 13-acetate (PMA), ionomycin, and IL-2 in order to assess for cytokine production ex vivo (Figure 14D). As predicted by the significant difference in T-BET mRNA expression (Figure 13C), stage 4 cells produced IFN-γ under both conditions, whereas IFN-γ was not detected in the supernatants of stimulated stage 3 cells (Figure 14D). Similar results were obtained using intracellular flow cytometry to detect IFN-γ, and we were also unable to detect
IFN-γ production by stages 1 and 2 via this method (data not shown). GM-CSF was detected from both stage 3 and 4 supernatants, although stage 3 cells produced less GM-
SCF than stage 4 cells and did so only in the presence of PMA, ionomycin, and IL-2
(Figure 14D). In contrast, we could not detect the production of either IL-13 or TNF-α after 12-hr stimulation of either SLT population under either stimulation condition (data not shown). Collectively, these data suggest that functional maturity occurs within stage
4 of NK cell differentiation in vivo.
Lineage differentiation potentials of stages 1-4
For functional assessment of the lineage potentials of stages 1-4, we employed a series of in vitro differentiation assays. Stages 1-4 were first cultured in semi-solid methylcellulose medium containing KL, GM-CSF, IL-3, and erythropoietin. Whereas multiple CFUs of both erythroid and myeloid lineages were derived from a positive control of total PB CD34(+) HPCs, we did not observe any CFUs from stages 1-4 in three separate experiments (data not shown). Similarly, we observed that in conditions promoting B cell differentiation on MS-5 stroma using control cord blood (CB) - 51 - CD34(+)CD19(-) HPCs, freshly isolated stages 1-4 failed to give rise to any
CD10(+)CD19(+) B lineage cells (Figure 15A).
Numerous reports from the literature indicate that NK cells are developmentally most closely related to T cells and dendritic cells (DCs) (23, 37, 38, 43, 61). We cultured stages 1-4 in FL and IL-7 on the OP9-DL1 cell line, which supports human T cell differentiation (62). After 4-5 weeks, stage 1 cells underwent profound expansions, with cell numbers increasing between 1.5×102-5.4×103-fold (Figure 15B). In contrast, stages
2-4 displayed less than one tenth the propensity for proliferation on the OP9-DL1 line.
By flow cytometry, both stage 1 and stage 2 cultures contained CD3(+) T cells, that expressed either TCRαβ or TCRγδ receptors, as well as CD3(-)CD4(+/-)CD8(+/-) immature T cells (Figure 15B and data not shown). However, comparison of the absolute numbers of CD3(+) T cells derived from stage 1 (1.37×105 per 103 initiating cells) versus stage 2 (5.7×103 per 103 initiating cells) cells revealed that there was, on
average, a 24-fold difference (P = 0.024). In contrast to these results, we did not observe
the generation of CD3(+) T cells or CD3(-)CD4(+/-)CD8(+/-) immature T cells in human
T cell differentiation cultures initiated with purified stage 3 or 4 cells (Figure 15B and
data not shown). We did observe CD3(-)CD56brightCD94(+) NK cells (stage 4) in these cultures when initiated with freshly isolated stage 1, 2, and 3 cells (Figure 15C), confirming that each of these populations is capable of giving rise to stage 4 NK cells.
To assess for DC differentiation, purified stages 1-4 were cultured in FL, KL, IL-
3, IL-4, GM-CSF, and TNF-α. After two weeks, cultures initiated with stages 1-3 maintained live cells, although there was an overall net loss in total viable cell number
(ave. = 0.14-fold, 0.35-fold, and 0.28-fold contractions for stage 1-3 populations, - 52 - respectively). In contrast, stage 4 cells all died in these conditions. Cultured cells were harvested for analysis by flow cytometry. By forward scatter (FSC) vs. side scatter
(SSC) analysis, stage 1 and 2 cultures contained a distinct population that was absent from stage 3 and 4 cultures. Cells grown out from stage 1 and stage 2 cultures displayed a phenotype consistent with in vitro-derived DCs (HLA-DR(+)CD14(-)CD1a(+/-)) and expressed co-stimulatory molecules (Figure 16A and B) (23, 61). Further, these cells displayed typical DC morphology (Figure 16C). In contrast, stage 3 cultures contained only smaller cells that did not display the phenotype shown in Figure 16B nor the typical
DC morphology (data not shown). Altogether, these results suggest that full commitment to the NK cell lineage may occur at stage 3 of development in vivo.
Ex vivo NK cell developmental progression of stages 1-4
In addition to the phenotypic and functional assays performed on freshly isolated stages 1-4 of NK cell differentiation, we cultured these cells ex vivo to evaluate the effect(s) of individual cytokines that have been previously shown to support NK cell differentiation in vitro (17, 21, 32) and to assess each stage for evidence of lineage progression versus reversibility. Stages 1 and 2 were first purified from human SLT and cultured in IL-15 without any other cytokines or stroma. As predicted from the CD122 mRNA expression data (Figure 13C), after two weeks nearly all stage 1 cells died with an overall 0.17 ± 0.21-fold decrease in total viable cell number, whereas cultures initiated with stage 2 cells expanded 20.1 ± 9.9-fold (P = 0.0001) (Figure 17A). These data suggest that the ability to respond to IL-15 occurs at stage 2 of differentiation in vivo.
Stage 2 cells cultured in IL-15 primarily became CD3(-)CD34(-)CD56brightCD161(+) and
- 53 - displayed a pattern of CD117 versus CD94 expression similar to that of total SLT CD3(-
)CD56(+) cells in vivo (Figure 17B), indicative of progression to stages 3 and 4 (Figure
17B and data not shown).
Next, we cultured stage 1 cells in IL-15 on MS-5 stroma with FL, IL-3, and IL-7 added at the initiation of culture to determine if these additional factors would promote
NK cell differentiation from stage 1. In bulk culture, we observed profound expansions
(37.1 ± 26.9-fold) compared to cultures in IL-15 alone (n = 4, P = 0.004), and by flow cytometry the cells became CD56brightCD94(+/-) NK cells (data not shown). By limiting dilution analysis on MS-5 stroma, stage 1 cells cultured in IL-15 plus FL, IL-3, and IL-7 added at the beginning of culture displayed an increased pre-NK cell frequency (1/14-
1/9) compared to cultures in IL-15 alone (1/44-1/37), whereas stage 2 cells displayed a high pre-NK cell frequency in IL-15 with or without the additional cytokines (<1/3.5)
(Figure 17C). Thus, stage 1 cells require additional cytokines for differentiation into
CD56bright NK cells ex vivo, consistent with the notion that stage 1 cells are less mature than stage 2 cells that can respond to IL-15.
To gain evidence for a progenitor-progeny relationship between stages 1 and 2, respectively, purified cells were cultured in FL, IL-3, IL-7 and IL-15 and then assessed by flow cytometry after four days. Reproducibly, we observed the appearance of
CD34(+)CD117(+) cells in stage 1 cultures, whereas CD34(+)CD117(-) stage 1 cells were not detected in stage 2 cultures (Figure 17D). Furthermore, cultured stage 2 cells displayed lowered CD34 expression than the CD34(+)CD117(+) cells that had been derived from stage 1, suggesting that stage 2 cells were progressing to stage 3 and that the appearance of CD34(+)CD117(+) cells in stage 1 cultures was due to the de novo
- 54 - generation of these cells rather than contamination by stage 2 cells at day 0. As predicted, following ten more days of culture in IL-15, we observed the exclusive appearance of CD34(-)CD117(+)CD94(-) stage 3 and CD34(-)CD117(+/-)CD94(+) stage
4 NK cells in cultures initiated with either stage 1 or stage 2 cells (data not shown).
Thus, under these conditions in vitro, freshly isolated stage 1 cells gave rise to stages 2, 3 and 4, whereas freshly isolated stage 2 cells gave rise to stages 3 and 4 but not stage 1.
Although the results from the OP9-DL1 co-culture experiments demonstrated that freshly isolated stage 3 cells gave rise to stage 4 cells ex vivo, those experiments were performed in the absence of exogenous IL-15 (Figure 15C). Therefore, we cultured freshly isolated stage 3 and stage 4 cells for 2 weeks in IL-15 to determine if this cytokine was sufficient to promote stage 3 to stage 4 differentiation ex vivo (Figure 18).
Both populations proliferated indicating their responsiveness to this cytokine (Figure
18A). However, although neither population upregulated CD34, we repeatedly observed that only a small fraction (<2%) of the sorted stage 3 cells were induced to express CD94
(stage 4), whereas fresh stage 4 cells maintained their phenotype, as predicted by our previous results culturing PB CD56bright NK cells in IL-15 (Figure 18B) (54). Therefore, additional factors might be necessary to drive stage 3 to 4 differentiation in vivo. We previously observed that co-culture of total SLT CD34(+) HPCs with autologous activated SLT T cells preferentially promoted the differentiation of CD56bright NK cells that express CD94 (unpublished data), suggesting that endogenous factors produced by activated SLT T cells would promote stage 3 to stage 4 NK cell differentiation in vitro.
Indeed, in the presence of autologous activated SLT T cells, we observed the de novo generation of CD3(-)CD34(-)CD117(+/-)CD94(+) stage 4 cells in cultures initiated with
- 55 - purified stage 3 cells, whereas CD3(-)CD34(-)CD117(+)CD94(-) stage 3 cells were not observed in cultures initiated with purified stage 4 cells (Figure 18B).
3.3 Discussion
The in vivo developmental pathways for human B and T lymphocytes have been
generally understood for decades, and this has been important for studying disease
processes such as HIV, childhood and adult leukemia, and lymphoma. Although in vivo
stages of mouse NK cell differentiation were recently described (8), the similar
populations in humans have not yet been reported (2, 4). In this study, we identified four
novel populations that appeared to represent discrete stages of a human NK cell
developmental continuum within SLT. Each population was isolated directly from these
tissues and was shown to be capable of downstream NK cell differentiation ex vivo (i.e.
stage 1 → stage 2 → stage 3 → stage 4). Further, we demonstrated that each freshly
isolated population could be characterized by unique functional and phenotypic
attributes, and that overall progression through the stages was characterized by the
gradual restriction of non-NK cell lineage differentiation potential, concomitant with the gradual acquisition of the mature CD56bright NK cell phenotype, cytokine production and mediation of natural cytotoxicity (Table 2). Collectively, these data provide evidence for a new model of in vivo human NK cell differentiation.
Many of our results are consistent with previously published mouse and human data on this subject (2, 4, 37, 38, 57). Specifically, we observed that 1) human NK cells
share a common developmental origin with T cells and DCs; 2) commitment to the NK
cell lineage precedes acquisition of the capacities for IFN-γ production and natural
- 56 - cytotoxicity; 3) the proposed progression of NK cell development in vivo is supported by
the observed patterns of CD122, ETS-1, GATA-3, and T-BET mRNA expression; and 4)
the expression and accumulation of NK cell receptors is non-random during in vivo
maturation. In addition, we observed that CD94 expression in vivo correlates with the
ability to produce IFN-γ, which is consistent with previous reports of in vitro human NK
cell differentiation (55). However, we did observe some functional and phenotypic
differences between human NK cell intermediates derived in vitro and those purified
directly from human SLT. For example, CD3(-)CD56brightCD94(-) NK cells derived in
vitro uniformly express NKp44 and NKp46 (Figure 2) (47, 54), yet these expression
patterns were not observed in vivo. Furthermore, whereas CD94(-) immature NK cells derived in vitro can mediate TRAIL-dependent killing and produce large amounts of IL-
13 (55, 56), we did not detect these functions from stage 3 intermediates isolated ex vivo.
The reasons for these differences are not yet known. However, considering that in vivo differentiation to a stage 4 cell is associated with the acquisition of the capacities for both
natural killing and IFN-γ production, this process is likely to be tightly regulated to
ensure self-tolerance and, therefore, may not be fully recapitulated in culture systems
currently used to study human NK cell differentiation. In addition, we currently do not
know the specific mechanism(s) of action of many cytokines, including FL, IL-3, IL-7,
and IL-15, that have been previously implicated as critical in this pathway (17, 21, 32),
nor do we yet know whether the cytokines themselves are present in SLT near developing
NK cells at the concentrations used to promote NK cell differentiation in vitro.
Therefore, these discrepancies may result from missing factors and/or the addition of
non-physiologic stimuli during NK cell development in vitro. - 57 - In light of the above, it is also noteworthy that IL-15 stimulation alone was insufficient to promote significant stage 4 differentiation from freshly isolated stage 3 cells despite the generation of stage 4 cells in IL-15-supplemented stage 1 and stage 2 cultures as well as in cultures initiated with BM or PB CD34(+) HPCs (54). One interpretation of these data is that IL-15 may have induced the differentiation of stage 4 cells directly from stage 2, thus bypassing stage 3. However, this is not supported by the fact that CD34 and CD94 are mutually exclusive antigens, both in vitro and in vivo, and
we would expect to find some CD34(+)CD94(+) intermediates in human SLT if this was
the case. Stage 3 cells in vivo display a phenotype that is intermediate between those of
stage 2 and stage 4 cells in terms of CD2, CD7, CD11b, CD56, CD117, CD161, and
NKp44 expression. Furthermore, freshly isolated stage 3 cells failed to generate T cells
or DCs, yet reproducibly gave rise to stage 4 cells when cultured with either activated
SLT T cells or OP9-DL1 stroma. Therefore, we favor the hypothesis that stage 4 cells
are the direct progeny of stage 3 cells in vivo and that this differentiation step may require
signals other than, or in addition to, IL-15. Moreover, we speculate that signals
promoting stage 4 differentiation may be common to OP9-DL1 and activated SLT T cell
co-cultures as well as to cultures initiated with CD34(+) HPCs.
The work presented here provides new evidence that LNs and tonsils are sites for
human NK cell development in vivo. Previous studies established that CD56bright NK cells predominate in SLT (15, 16), and we have now demonstrated that these tissues are also naturally and selectively enriched with the full complement of newly discovered intermediates spanning the continuum of NK cell differentiation from a
CD34dimCD45RA(+) pro-NK cell to a mature CD56bright NK cell. However, there are
- 58 - now many new questions that arise from this study. For example, it is still unclear how
SLT-derived NK cells might be related to NK cells in other compartments in the body.
Although SLT stage 4 cells closely resemble PB CD56bright NK cells in terms of their phenotypic and functional attributes, it is possible that SLT-resident NK cells represent a lineage distinct from that of CD56bright NK cells in the blood, as has been postulated for
human decidual NK cells (63). In addition, the majority of NK cells in PB are CD56dim
and express high levels of CD16 and KIRs (14). Based on their phenotypic and
functional characteristics, we speculate that PB CD56dim NK cells might represent the terminally differentiated stage of human NK cell development (stage 5). This possibility will be further addressed in Chapter 4. However, it is important to note that we currently lack direct evidence to support this hypothesis and cannot yet formally exclude the possibility that PB CD56bright and/or CD56dim NK cells might be derived from distinct
pre-NK cells that differentiate in the BM.
It is also unclear to what extent stage 4 cells, or any of the other NK cell-lineage
populations, actually arise within SLT or merely traffic through these tissues. On the one
hand, our flow cytometry data provide strong evidence for the existence of ongoing NK
cell maturation within these tissues, as for example analysis of CD94 versus CD117
expression reveals a continuous pattern with cells at all points in the spectrum between stages 3 and 4 (Figure 10B). On the other hand, previous evidence suggests that both PB
CD34dimCD45RA(+) HPCs and PB CD56bright NK cells have the capacity to migrate into
SLT, given the relatively high expression of CD62L on these subsets in the blood versus low or undetectable expression within SLT (Figures 5 and 8) (16, 54, 64). Therefore, some of these cells, in particular those that we have characterized as stage 4, may have
- 59 - recently migrated into SLT from other sites. In future studies it will be important to determine the relative capacity for NK cell developmental intermediates to re-circulate in and out of multiple lymphoid organs, given the potential implications regarding self- tolerance acquisition and overall regulation of this process in vivo.
A primary goal of this study was to identify surface antigens that could be used to specifically and positively identify developing human NK cells in vivo, ideally providing an all-inclusive framework upon which to base future research on the NK cell developmental pathway. In this regard, CD34, CD117, and CD94 are useful antigens because they are relatively specific to the NK cell lineage in SLT, they provide continuity for “following” developing NK cells, and they account for most if not all of the CD3(-
)CD56(+) cells within these tissues. However, stages 1-4 as we defined them are likely to be yet functionally heterogeneous, with the potential to identify additional subsets within each of these populations. For example, our flow cytometric analyses revealed that stage 1 and 2 cells are heterogeneous with regards to the expression of CD2, CD7,
CD10 and CD56. Therefore, in future experiments, it might be determined that the true
NK cell progenitors within the stage 1 population are distinct from non-NK lineage cells that share the CD34(+)CD45RA(+)CD117(-) phenotype or that the stage 2 population consists of mono-committed T, DC, and NK cell precursors rather than cells with multi- potency. Indeed, we cannot rule out these possibilities using the techniques we employed in our study. In addition, there are expected to be differentiation steps that are downstream of the acquisition of CD94, including those involving the acquisition of
CD16 and KIRs (see Chapter 4). Therefore, future studies are warranted to continue to
- 60 - refine the human NK cell developmental pathway in vivo and to elucidate the physiologic mechanisms regulating this process in SLT.
3.4 Experimental Procedures
Cell isolation from human tissues
All protocols were approved by The OSU Institutional Review Board. The data in this study were generated from the combined analyses of tissue specimens from more than 50 tonsil and 30 LN donors and we observed no appreciable differences between
LNs and tonsils by phenotype or functional assays. Normal human tonsils and LNs were obtained within 24 hours of elective surgery through the Tissue Procurement Shared
Resource of the OSU Comprehensive Cancer Center or from brain dead tissue donors through NDRI. Tissue cells were dispersed through 70 µm cell strainers into sterile PBS followed by ficoll-centrifugation. For each donor’s tissues, all cells from multiple tonsil pieces or multiple LNs were pooled in order to obtain sufficient numbers of NK cell developmental intermediates for the experiments. Mononuclear fractions were depleted of CD3(+) and CD19(+) cells via magnetic negative selection (Miltenyi Biotec, Auburn,
CA). For certain experiments, T and B cell-depleted preparations were either stimulated to detect intracellular IFN-γ production or directly stained with mAbs for phenotypic analyses. Alternatively, CD34(+) cells were enriched from CD3(-)CD19(-) preparations with the CD34 progenitor isolation kit (Miltenyi Biotech), subsequently stained with
FITC-conjugated anti-CD45RA, PE-conjugated anti-CD117, and APC-conjugated anti-
CD34 mAbs (BD Biosciences), and sorted for stage 1 [CD34(+)CD45RA(+)CD117(-)] and stage 2 [CD34(+)CD45RA(+)CD117(+)] populations with a FACSVantage cell - 61 - sorter (BD Biosciences). Remaining CD3(-)CD19(-)CD34(-) cells were stained with the combination of FITC-conjugated anti-CD94 mAb (clone 131412, R&D Systems,
Minneapolis, MN), PE-conjugated anti-CD117, APC-conjugated anti-CD3, and APC- conjugated anti-CD34 mAbs (BD Biosciences), and stage 3 [(CD3(-)CD34(-
)CD117(+)CD94(-)] and stage 4 [CD3(-)CD34(-)CD117(+/-)CD94(+)] populations were sorted to >99% purity. SLT-derived T cells and BM, PB, and CB (obtained from NDRI) mononuclear cell populations were obtained as described in Chapter 2 (54).
Flow cytometry
All mAbs used in this report were purchased from BD Biosciences, except CD16,
CD56, CD122, CD158b, NKp30, NKp44, NKp46 (Coulter, Miami FL), and CD94 (R&D
Systems). Flow cytometry and data analyses were performed as described in Chapter 2
(54).
Real-time PCR
RNA extraction and reverse transcription from >2×104 sorted cells were
performed as described (65). All primers and probes were designed using Primer Express
software (Applied Biosystems, Foster City, CA) and the sequences are as follows:
CD34: forward 5’-ATCGCCGCAGCTGGAG-3’, reverse 5’-
CCGTTTTCCGTGTAATAAGGGT-3’, probe 5’- FAM-
CCACAGGAGAAAGGCTGGGCGA-Tamra-3’; CD122: forward 5’-
CCTGGCTACCTCTTGGGCA-3’, reverse 5’- GAAGCATGTGAACTGGGAAGTG-3’,
probe 5’-FAM-TGCAGCGGTGAATG-MGB-3’; ETS-1: forward 5’-
CGATCTGGAGCTTTTCCCC-3’, reverse 5’- TGGAGTTAATAGTGGGACATCTGC-
- 62 - 3’, probe 5’- FAM-CCCCGGATATGGAATG-MGB-3’; GATA-3: forward 5’-
AAATGAACGGACAGAACCGG-3’, reverse 5’-TGCTCTCCTGGCTGCAGAC-3’, probe 5’-FAM-CCCTCATTAAGCCCAAGCGAAGGC-Tamra-3’; T-BET: forward 5’-
CAACAATGTGACCCAGATGAT-3’, reverse 5’-AATCTCGGCATTCTGGTAGG-3’,
probe 5’-FAM-CCGGCTGCATATCGTTGAGGTGAAC-Tamra-3’. Real-time PCR
reactions were performed in an ABI prism 7700 sequence detector (Applied Biosystems)
as follows: 50ºC for 2 min; 95ºC for 10 min; 45 cycles of 95ºC for 15 sec and 60ºC for 1
min. Data were analyzed with the Sequence Detector version 1.6 software to establish
the PCR cycle at which fluorescence exceeded a set threshold, CT, for each sample.
Experimental CT values were used to calculate gene-specific copy numbers from a standard curve, and the gene-specific copy numbers were normalized to ribosomal 18S copy numbers from the same samples.
Cytotoxicity assays and cytokine production
Cytotoxicity assays were performed in 100 µl RPMI-1640 medium with
GlutaMAX containing 10% FBS and antibiotics (Invitrogen, Carlsbad, California) in 96- well V-bottom plates (BD Biosciences) with 2×102 K562 or Jurkat cloned targets stably infected with MSCV retrovirus to express the firefly luciferase enzyme. Following 8-hr incubations, cell pellets were lysed with Passive Lysis Buffer from Promega (Madison,
WI) and frozen at –80ºC. 25 µl thawed lysates were transferred into Costar 96-well flat-
bottom solid-white plates (Fisher Scientific, Hanover Park, IL) and mixed with 100 µl of
Luciferase Assay Reagent (Promega) by a Fluoroskan Ascent® FL luminometer (Thermo
Electron Inc., Milford, MA). Luminescence was measured as relative light units (RLU)
- 63 - during 10 sec intervals. The percent of specific lysis for each experiment was calculated as: ((mean RLU from wells containing target cells only) – (mean RLU from experimental wells))/(mean RLU from wells containing target cells only) × 100%. Blocking experiments with the Jurkat cell line were performed with 1 mM EGTA and 2 mM
MgCl2. The anti-TRAIL (clone RIK-2), anti-FasL (clone NOK-2), and isotype-matched
control mAbs (BD Biosciences) were used at 10 µg/ml.
For cytokine production, 2×104 purified stage 3 or 4 cells were stimulated in either the combination of 10 ng/ml IL-12 (Genetics Institute, Cambridge, MA), 100 ng/ml IL-15 and 100 ng/ml IL-18 (BASF, Worcester, MA) or 50 ng/ml PMA (Sigma), 1
µM ionomycin (Calbiochem, San Diego, CA), and 1 nM IL-2 (Hoffman LaRoche,
Nutley, NJ) for 12 hrs at 37°C. Supernatants were analyzed by ELISA for the production of IFN-γ as described (51) using commercially available mAbs (Endogen, Woburn, MA) or for the production of GM-CSF, TNF-α, and IL-13 using Quantikine ELISA kits from
R&D Systems.
Cell culture
Stroma-free cultures were in 96-well round-bottom plates (BD Biosciences) in
200 µl RPMI-1640 medium with GlutaMAX (Invitrogen), 10% heat-inactivated human
AB serum (ICN Biomedicals, Irvine, CA), antibiotics and additional supplements previously described (54). Recombinant human IL-15 was provided by Amgen
(Thousand Oaks, CA) and used at 1 nM. Human KL (Amgen) and FL (Peprotech, Rocky
Hill, NJ) were used at 100 ng/ml, whereas human IL-3, IL-4, IL-7, G-CSF, GM-CSF, and
TNF-α (R&D Systems) were used at 10 ng/ml each. Activated T cell co-culture
- 64 - experiments were performed in 200 µl medium with 104 freshly isolated SLT stage 3 or 4 cells and 2.5×103 autologous SLT CD3(+) T cells (purified via sorting as in Chapter 2) with 5×103 anti-CD3/CD28 beads (Dynal Biotech, Brown Deer, WI) and IL-15. Half the medium was replaced every 3-4 days to replenish IL-15 only. Co-cultures on MS-5 stroma (a kind gift of J.E. Dick, Toronto General Research Institute, Toronto, ON) were in 96-well flat-bottom plates (BD Biosciences) in 200 µl α-MEM medium plus 20% FBS and antibiotics (all from Invitrogen) replacing half the medium every 3-4 days. CFU assays were performed with MethoCultTM GF+ from StemCell Technologies (Vancouver,
BC) following the manufacturer's protocol. T cell differentiation cultures on the OP9-
DL1 cell line (generously provided by J.C. Zúñiga-Pflücker, University of Toronto,
Toronto, ON) were maintained in α-MEM medium plus 20% FBS, antibiotics, FL and
IL-7 and were performed as described (62). Morphologies of in vitro-derived DCs were assessed via cytospin and Wright/Giemsa staining.
Limiting dilution analysis
Purified stage 1 and 2 cells were cultured at 50, 25, 12.5, 6.25, 3.125, and 1.5625 cells per well, 10 replicates each, on MS-5 stroma in either IL-15 alone or IL-15 with the one time addition of FL, IL-3, and IL-7 at the initiation of culture. Half the medium was changed every 3-4 days to replenish IL-15 only. It was confirmed that all live human cells remaining in such cultures after three weeks were CD56bright NK cells (data not
shown). Therefore, wells that contained visible growth (compared to wells not seeded
with HPCs) were scored positive for NK cells, whereas wells that did not contain visible
growth were harvested, stained with PE-conjugated anti-CD56 mAb, and assessed by
- 65 - flow cytometry for the presence or absence of CD56bright NK cells. Pre-NK cell frequencies reported in the text were calculated as the reciprocal of the concentration of cells that resulted in >63% positive wells using Poisson statistics and the weighted mean method, as described (21).
Statistical analyses
Data were log-transformed and analyzed using a paired t-test to obtain P-values. S-Plus version 6.0 and SAS version 8.02 software were used for the analyses.
- 66 -
Figure 10. Surface marker expression patterns of human SLT populations. (A)
CD3(-)CD56brightCD94(-) cells are absent in BM and PB, yet present in human SLT and in NK cell differentiation cultures. All four dot plots were gated on CD3(-) events. (B)
Distinct patterns of CD34, CD117, and CD94 expression within the CD3(-)CD56(+) fraction of human SLT. The dot plots were gated on total CD3(-)CD56(+) events. (C) A continuum of CD56 expression is observed within the CD117(+) fraction of SLT
CD34(+) HPCs. The left dot plot shows CD34 vs. CD45RA expression within a CD34- enriched preparation from human SLT. The right dot plot was gated on CD34(+) events as indicated by the box and arrow in the left dot plot. (D) Analysis of CD3, CD19,
CD56, and CD161 expression on total CD34(-)CD117(+) cells within the mononuclear fraction of human SLT. The dot plots were gated on CD34(-) SLT preparations. No qualitative differences were observed in comparing LN and tonsil specimens. The data are representative of at least five separate analyses.
- 67 - A BM PB SLT In vitro-derived NK BRIGHT BRIGHT BRIGHT BRIGHT
56 DIM DIM DIM DIM CD
CD94 B SLT CD3(-)CD56(+) C SLT CD34(+) 34 34 117 117 CD CD CD CD
CD94 CD94 CD45RA CD56 D 7 11 117 117 CD CD CD117 CD
CD3 CD19 CD56 CD161
Figure 10. Surface marker expression patterns of human
SLT populations.
- 68 -
Figure 11. Progressive CD56 expression by in vivo stages of human NK cell differentiation. The data were obtained by first separating CD3(-)CD19(-)CD34(+) and
CD3(-)CD19(-)CD34(-) fractions from SLT mononuclear cell suspensions via magnetic selection and then assessing for CD34, CD117, CD94, and CD56 expression by flow cytometry. It was confirmed that residual T cells or B cells did not contribute to the data.
- 69 - Stage 4 C D56 Stage 3 Stage 2 Stage 1
Stage 1: CD34(+)CD117(-)CD94(-) Stage 2: CD34(+)CD117(+)CD94(-) Stage 3: CD34(-)CD117(+)CD94(-) Stage 4: CD34(-)CD117(+/-)CD94(+)
Figure 11. Progressive CD56 expression by in vivo stages of
human NK cell differentiation.
- 70 -
Figure 12. Surface marker expression profiles of stages 1-4. Data were obtained by performing flow cytomtric analyses of CD3(-)CD19(-)CD34(+) and CD3(-)CD19(-
)CD34(-) cell preparations as in Figure 2. Shaded regions represent staining for the indicated surface antigens, whereas solid lines (open regions) represent staining with appropriate isotype-matched control mAbs. The data shown are representative of at least three separate experiments for each antigen, and we did not observe any differences in comparing LN and tonsil specimens.
- 71 - Stage 1 Stage 2 Stage 3 Stage 4 Stage 1 Stage 2 Stage 3 Stage 4
HLA-DR CD161
CD10 NKp44
Integrin β7 NKp46 s t n e CD2 NKG2D # Ev CD7 CD16
CD11b CD158b
CD43 CD122 Fluorescence intensity
Figure 12. Surface marker expression profiles of stages 1-4.
- 72 -
Figure 13. Gene expression profiles of stages 1-4. (A-B) Representative sorts to purify
stages 1-4 from human SLT. Stages 1 and 2 (A) and stages 3 and 4 (B) were sorted from
CD3(-)CD19(-)CD34(+) and CD3(-)CD19(-)CD34(-) fresh SLT cell preparations,
respectively, obtained via magnetic selection. Additional flow cytometric analyses
confirmed that sorted stage 3 and stage 4 cells were CD34(-) (data not shown). (C) Gene
expression analysis of stages 1-4. Gene expression for each sample was normalized to
18S expression. Depending upon the preferential expression of each gene of interest, the
average of normalized values from either total PB CD34(+) HPCs or total PB CD56bright
NK cells was set to a value of 1, and all other normalized values were adjusted to scale.
The y-axis of each graph is in arbitrary units and measures the adjusted value for each population. The data are expressed as the average of adjusted values ± SD of 3-5 separate samples tested per cell population. CD34, PB CD34(+) HPCs; CD56b, PB
CD56bright NK cells; S1, stage 1; S2, stage 2; S3, stage 3; S4, stage 4.
- 73 - A Presort Stage 1 Stage 2 34 CD
CD117 B Presort Stage 3 Stage 4 CD117
CD94 C 2 CD34 4 CD122 1.5 ETS-1 5 GATA-3 2.4 T-BET
4 1.5 3 1.8 1 3 1 2 1.2 2 0.5 0.5 1 0.6 1
0 0 0 0 0 CD34 CD56b S1 S2 S3 S4 CD34 CD56b S1 S2 S3 S4 CD34 CD56b S1 S2 S3 S4 CD34 CD56b S1 S2 S3 S4 CD34 CD56b S1 S2 S3 S4
Figure 13. Gene expression profiles of stages 1-4.
- 74 -
Figure 14. Functional analyses of stages 3 and 4. (A) Perforin expression of freshly isolated stage 3 and stage 4 cells as detected by intracellular flow cytometry. Shaded regions represent staining with the anti-perforin mAb whereas solid lines (open regions) represent staining with the isotype-matched control mAb. Histograms were gated on unsorted CD3(-)CD19(-) preparations from human SLT using mAbs directed against
CD34, CD117, and CD94 to identify discrete stages for analysis. Stages 1 and 2 lack significant intracellular perforin staining (data not shown). (B) Percents of specific lysis against K562 (black bars) and Jurkat (gray bars) targets by freshly isolated stage 3 and stage 4 cells. Data shown are the average results ± SD of four separate experiments performed in triplicate at a 20:1 E/T ratio. (C) Stage 4 cells mediate FasL-dependent, but not TRAIL-dependent, killing of Jurkat target cells. Data shown are the average results ±
SD of triplicate wells from one experiment with freshly isolated stage 4 cells targeted against the Jurkat cell line as in (B) but in the presence of 1 mM EGTA and 2 mM MgCl2
(20:1 E/T ratio). (D) Production of IFN-γ (left graph) and GM-CSF (right graph) by stage 3 and stage 4 cells after 12-hr stimulation with either the combination of IL-12, IL-
15, and IL-18 (black bars) or the combination of PMA, ionomycin, and IL-2 (gray bars).
Data shown are the combined results ± SD of four separate experiments.
- 75 - AB C Stage 3 100% 100% s s i i s s y 80% y 80% L L c 60% c 60% i i f f Stage 4 40% 40% eci eci 20% 20% Sp Sp % 0% % 0% b b IL L Perforin Stage 3 Stage 4 A A A as o TL R -F N C i-T ti nt n D A A )
10000 l 1000 ) m 8000 800 ml / pg/
g 6000 600 ( (p F 4000 400 γ S
2000 -C 200 M IFN- 0 0 Stage 3 Stage 4 G Stage 3 Stage 4
Figure 14. Functional analyses of stages 3 and 4.
- 76 -
Figure 15. B, T, and NK cell differentiation potentials of stages 1-4. (A)
Representative analysis from one of two experiments culturing SLT-derived stages 1-4 or
CB-derived CD34(+)CD19(-) cells on MS-5 stroma in FL, KL, and G-CSF for 6 weeks.
Dot plots were gated on live cells using a lymphocyte gate by FSC vs. SCC. (B)
Representative analysis from one of three experiments in which stages 1-4 were co- cultured for 4-5 weeks on the OP9-DL1 cell line in FL and IL-7. The OP9-DL1 line expresses GFP. The four dot plots shown were gated on GFP(-) events within the live fraction by FSC vs. SSC analysis. The graph on the right shows the fold-increase in total
GFP(-) cell number starting with 103 cells from each stage (S1-S4). (C) Generation of
CD3(-)CD56brightCD94(+) stage 4 cells on OP9-DL1 stroma. Stage 1-4 cells were cultured as in (B). The dot plots shown were gated on GFP(-)CD3(-) live cell events and are representative of three separate experiments.
- 77 - A Stage 1 Stage 2 Stage 3 Stage 4 CB CD34(+)CD19(-) 19 CD CD19
CD10 CD10 400 B Stage 1 Stage 2 Stage 3 Stage 4 n 300 nsio a 200 Exp CD56 100 Fold 0 CD3 S1 S2 S3 S4
C Stage 1 Stage 2 Stage 3 Stage 4 CD56
CD94
Figure 15. B, T, and NK cell differentiation potentials of stages 1-4.
- 78 -
Figure 16. DC differentiation potential of stages 1-4. (A-B) Representative flow cytometric analysis from one of three experiments culturing stages 1-4 in FL, KL, IL-3,
IL-4, GM-CSF, and TNF-α. (A) By FSC vs. SSC analysis, only stage 1 and 2 cultures
contained the population (black circles) notably absent in stage 3 and 4 cultures. (B)
Shaded regions in the histograms represent staining for the indicated surface antigens
whereas solid lines (open regions) represent staining with isotype-matched control mAbs.
The histograms were gated on the populations circled in (A) from stage 1 and 2 cultures.
We did not observe any qualitative differences between stage 1-derived DCs and stage 2-
derived DCs. (C) Wright/Giemsa staining of stage 1- and stage 2-derived DCs. Note the
typical DC morphology, including multiple dendrite processes and the large nucleus
displaced to one side of the cell. Viable cells in stage 3 cultures did not display the DC
morphology (data not shown).
- 79 - B A SSC HL Stag CD14 A - DR e 1 Figure 16.DCdifferen Stage 2 CD40 CD80 FSC tiation S CD11 CD1a t ag - 80 e 3 c potential ofstag Stage CD CD83 8 6 4 es 1-4. C
Stage 2 Stage 1
Figure 17. Stage 1 and stage 2 NK cell developmental progression. (A) Sorted stage
1 and 2 cells were cultured in IL-15 for two weeks and then total viable cell counts were determined. Cultures were initiated with 103 starting cells. Shown are the average results from seven separate experiments ± SD. (B) Representative phenotypic analysis of stage
2 cells cultured in IL-15 for two weeks. The few viable cells remaining in stage 1 cultures after two weeks in IL-15 displayed a similar phenotype shown for cultured stage
2 cells. (C) Limiting dilution analysis of stages 1 and 2 cultured in either IL-15 alone (○) or IL-15 with the one time addition of FL, IL-3, and IL-7 at the initiation of culture (■).
The graphs show initiating stage 1 and 2 cell numbers versus the percentages of NK- positive wells for one of two separate experiments yielding similar results. (D) De novo generation of CD34(+)CD117(+) cells from purified stage 1 cells. Purified stage 1 and stage 2 cells were cultured for four days in FL, IL-3, IL-7, and IL-15 and then analyzed by flow cytometry for the expression CD34 and CD117. Unsorted, unstained CD34- enriched cell preparations (obtained via magnetic selection) were cultured in parallel to set voltages and compensation parameters on the flow cytometer. Results are representative of three separate experiments.
- 81 - A B
40000
30000 56 20000 CD CD117 10000 # NK Cells 0 Stage 1 Stage 2 CD34 CD94 C D 120% Day 0 Day 4 100% Stage 1 80% 60% 40% 20% Stage 1 Wells 0% e v
ti 0204060 i 120%
Pos 100% Stage 2 80%
NK 60% 34 % 40% 20% Stage 2 CD 0% 0 204060 Cell # Per Well CD117
Figure 17. Stage 1 and stage 2 NK cell developmental
progression.
- 82 -
Figure 18. Stage 3 to stage 4 differentiation ex vivo. (A) Proliferation of stage 3 and stage 4 cells cultured in IL-15. Shown are the average results ± SD from seven separate
experiments starting with 103 cells. (B) Representative phenotypic analysis of one of three experiments with stage 3 and stage 4 cells cultured either in IL-15 (left dot plot for each population) or in IL-15 plus activated autologous SLT T cells (right dot plot for each population). All four dot plots were gated on total CD3(-) events, and none of the cultured cells expressed CD34 (data not shown). Cultures initiated with activated SLT T cells alone did not contain CD3(-)CD94(+) cells (54).
- 83 -
A 30000 25000 #
ll 20000
ce 15000 l 10000
Tota 5000 0 Stage 3 Stage 4
B IL-15 IL-15+Act. T
Stage 3 Cultures
IL-15 IL-15+Act. T
Stage 4 Cultures CD117
CD94
Figure 18. Stage 3 to stage 4 differentiation ex vivo.
- 84 -
Stage 1 Stage 2 Stage 3 Stage 4 B cell potential - - - - T cell potential + + - - DC potential + + - - NK cell potential + + + + IL-15-responsiveness - + + + IFN-γ production - - - + Cytotoxicb - - - + a Via perforin- and FasL-dependent mechanisms.
Table 2. Functional characteristics of SLT-resident NK intermediatesb
- 85 -
CHAPTER 4
UNPUBLISHED DATA AND EXTENDED DISCUSSION
4.1 Terminal stages of human NK cell differentiation: CD56bright vs. CD56dim
From the combined studies presented in Chapters 2 and 3 above, it is now clear
that relative CD56 expression alone is not sufficient to distinguish functionally discrete
NK cell developmental intermediates in vivo. CD56 expression increases gradually
during NK cell development from stage 2 to stage 4 in SLT rather than in an all-or-none
fashion (Figure 11), and although CD3(-)CD56dim cells in PB are primarily
CD16(+)KIR(+), the majority of CD3(-)CD56dim cells in SLT are CD16(-)KIR(-) stage 3 iNK cells (66). Previously we observed that gating on the total SLT CD3(-)CD56(+) population, irrespective of relative CD56 expression, provided important clues regarding
the early stages of NK cell development in that the CD94(-) fraction is CD117(+) and
partially CD34(+) (66). By using a similar approach and assessing for CD16 versus
CD94 expression within the total CD3(-)CD56(+) populations of SLT and PB, one can
visualize the theoretical progression of development from CD94(+)CD16(-) to CD94(+/-
)CD16(+) that may mark the terminal step of human NK cell development in vivo
(Figure 19). Since PB CD56bright NK cells are CD94(+)CD16(+/-) and PB CD56dim NK cells are primarily CD94(+/-)CD16(+) (14), the available data suggest that the latter derive directly from the former. Thus, CD56dimCD94(+/-)CD16(+) NK cells appear to
- 86 - represent stage 5 of human NK cell development, and this is consistent with the proposed progression of PB CD56bright to CD56dim NK cell development that was originally
reported by Lanier et al. and that is supported by observations of human NK cell
differentiation over time in vitro and in vivo (47, 67-70). Furthermore, KIR(+) NK cells
are primarily within the CD94(+/-)CD16(+) fraction of cells in both PB and SLT (Figure
19), consistent with numerous lines of evidence indicating that KIR acquisition is
cumulative and stable and occurs as a late event during NK cell maturation both in vitro
and in vivo (47, 70-73).
Based on these collective data, we can propose a comprehensive, sequential
model of human NK cell development using the relative surface expression of CD34,
CD117, CD94, and CD16, rather than that of CD56, to distinguish stages of
differentiation (Figure 20). Indeed, this model appears to be all-inclusive for human NK
cell development. However, it is important to realize that this model is based on two
fundamental assumptions. First, that all NK cell developmental intermediates are
contained within the mononuclear fractions of tissue-derived single cell suspensions
following centrifugation over ficoll density gradient. Second, that all mature NK cells,
like other human hematopoietic cell populations, ultimately derive from CD34(+) HSCs
and HPCs. The latter assumption is particularly tied to a number of conclusions we have
drawn based on surface marker expression patterns observed by flow cytometry. For
example, as mentioned above, CD34 and CD94 are mutually exclusive antigens in all
tissues we have analyzed, indicating that a cell must progress through a CD34(-)CD94(-)
in order to develop from a CD34(+) HPC to a CD94(+) NK cell (66). In addition, we
have observed that CD34 expression is also mutually exclusive from that of CD16 and
- 87 - KIRs (recognized by the DX9, DX27, and EB6 mAbs). Based on these patterns and those shown in Figures 10 and 19, we currently do not have evidence for a separate pathway of CD56dimCD16(+)KIR(+) NK cell differentiation other than through the model shown in Figure 20. That is, the available data indicate that CD16(+)KIR(+) NK cells derive from CD94(+)CD16(-)KIR(-) cells which in turn derive from CD117(+)CD94(-) cells and so forth in a sequential, linear pathway. Importantly, however, this model does not rule out the possibility that some cells within each stage may be terminally differentiated or that there may be branch points and parallel pathways of differentiation
(e.g. akin to CD4(+) and CD8(+) T cell development) that may be masked by the emphasis on these particular antigens.
4.2 Similarities to human T cell development
Extending upon the previous observations of colleagues in the field, there are
intriguing new parallels we can now appreciate between the human NK and T cell
developmental pathways (37, 74). Table 3 shows the phenotypic profiles of stages 1-5
within SLT. Notably, excluding the T cell lineage-specific antigens expressed by
developing thymocytes, the expression patterns of numerous cytokine receptors and
surface markers appear to follow somewhat similar trends as developing T cells and NK
cells progress through their respective stages of maturation within the thymus and SLT,
respectively (Table 3) (74-78). For example, both developmental pathways begin with
oligo-potent CD34(+)CD45RA(+) HPCs that have T cell, DC, and NK cell
developmental potential. In the thymus, as relative CD34 expression decreases,
developing T cells upregulate CD5 and CD1a, which signifies commitment to this cell
- 88 - lineage (75), whereas in SLT, stage 2 pre-NK cells lack CD1a and CD5 yet begin to upregulate CD56 and CD161 antigens that are primarily associated with the NK cell lineage (unpublished data) (66). As differentiation continues, CD34 is lost and CD45RA expression decreases as CD1a, CD3 and CD5 are expressed on CD4(+)CD8(+) double- positive (DP) intermediates in the thymus and CD161 is expressed by stage 3 iNK cells in SLT (66, 78). Of note, both DP thymocytes and stage 3 iNK cells represent the abundant developmental intermediate populations in their respective tissues (unpublished data) (79). CD69 is induced upon DP cells that have undergone positive selection and this antigen is also expressed on the majority of stage 3 iNK cells in SLT (unpublished data) (80). As DP cells differentiate into single-positive CD4(+) or CD8(+) cells, they must pass the test of negative selection that ensures the cells are not auto-reactive (81).
Moreover, CD45RA is induced again on the surface as CD69 is downregulated (78).
Similarly, as stage 3 iNK cells progress to stage 4, they undergo functional maturation steps (66), and the majority of stage 4 CD56bright NK cells express CD45RA yet lack
CD69 (unpublished data).
The anatomical distribution of human NK cell developmental intermediates is also strikingly reminiscent of that of T cell developmental intermediates. Although each of the requisite T cell developmental intermediates are highly enriched within the thymus, akin to NK cell developmental intermediates within SLT, early stages of T cell development can also be found in both the blood and BM at low frequencies (82).
Indeed, it is generally accepted that continued T cell development requires the constant influx of T cell progenitor populations that derive from HSCs in the BM and that traffic through the blood to colonize the thymus (83, 84). Interestingly, Lambolez et al. recently
- 89 - reported that the thymus also normally exports T cell precursors that can circulate
through the blood and return to the thymus for terminal maturation (85). These
observations are testament to the fact that there is likely a dynamic, rather than static,
equilibrium regarding the absolute numbers of T cell developmental intermediates within
the thymus. It is likely that the same is true for NK cell developmental intermediates that
can be normally identified in PB and BM, yet are naturally enriched within SLT (40, 54,
66). We do not yet know if and which SLT-derived NK cell developmental intermediates
can leave these tissues before their full maturation. However, it is interesting to consider
that uncommitted CD34(+)CD45RA(+) HPCs might circulate through the blood and,
depending upon the local stimuli and the overall needs of the body, these cells could
either be recruited into the thymus to differentiate into T cells or recruited into SLT to
develop into NK cells.
4.3 Regulation of human NK cell development
What can these new data teach us about the regulation of human NK cell
development in vivo? First of all, the five NK cell developmental intermediate populations described above clearly have distinct phenotypic and functional characteristics, suggesting that in vivo human NK cell development occurs through discrete maturational stages and that there is physiological relevance to the model shown in Figure 20. Interestingly, just as the ratio of CD56bright to CD56dim NK cells is usually
<1:10 within PB (14), the relative proportions of each NK cell developmental
intermediate population to each other within SLT are incredibly conserved among
individuals. We have observed that in normal donor LNs and tonsils, stage 1 pro-NK and
- 90 - stage 2 pre-NK cells are generally of about equal frequency to each other, collectively representing <0.05% of all hematopoietic cells within these tissues (54). In contrast, stage 3 iNK cells are ~10-fold more abundant than either of these populations and are
also ~1.5-fold more prevalent than stage 4 and stage 5 NK cells combined (unpublished
data). These collective findings indicate that there are regulatory mechanisms in place
that maintain these relative proportions and that control the progression between each stage of NK cell development.
Homing and migration of NK cell developmental intermediates
For the T cell lineage, intra-thymic migration of developing thymocytes is highly
regulated by the coordinated actions of chemokines and cell-adhesion molecules (CAMs)
(86), and it is clear that developing thymocytes are located in discrete physical locations
within the thymus at each stage of their maturation (84). We predict that human NK cell
developmental intermediates are regulated in similar ways within SLT, although to date,
there is very little information on this subject. Within SLT, NK cell developmental
intermediates are located in the parafollicular T cell rich regions (15, 54). However,
whether these intermediates are clustered in discrete foci or scattered throughout the
parafollicular regions is not yet known. Moreover, the chemokine receptor profiles of
NK cell developmental intermediates within SLT have not been studied. Chemokines
and CAMs also regulate lymphocyte trafficking to SLT (34, 87). Stage 1-4 intermediates
in the blood have high expression of CD62L, whereas this molecule is downregulated in
SLT (unpublished data) (16, 54), suggesting that CD62L might facilitate the immigration
of these cells from PB into SLT across high endothelial venules. In addition, stage 1 and
- 91 - stage 2 intermediates also express integrin α4β7, which could potentially contribute to their migration to SLT (54, 66).
Lymphocyte egress from the thymus and LNs involves the binding of sphingosine-1-phosphate (S1P) to the S1P1 receptor (88). S1P is a chemoattractant molecule that is abundant in the blood and lymph, whereas it is at relatively lower concentrations within lymphoid organs (89). It is not yet known if SLT-resident NK cell developmental intermediates express S1P1, although PB NK cells express this receptor and others in the same family (90). Interestingly, it was recently observed that CD69, which is primarily expressed on DP thymocytes after positive selection (78), can bind and antagonize S1P1 to prevent thymocyte egress in response to S1P (91). CD69 is downregulated before fully mature naïve T cells leave the thymus, and these new data by
Shiow et al. are consistent with the earlier observation that transgenic expression of
CD69 inhibited thymic emigration (91, 92). As mentioned above, the majority of SLT- resident stage 3 iNK cells are also CD69(+), suggesting that these cells may be kept within SLT by a similar mechanism. Interestingly, we did not observe CD69 expression on stage 3 iNK cells within BM (unpublished data), and it is tempting to speculate that perhaps these cells are only activated, and hence induced to express CD69, within SLT in response to differentiation signals specifically within the latter.
Cytokines
The control of lymphocyte development and homeostasis has largely been attributed to cytokines (74). Numerous cytokine combinations, including those consisting of FL, KL,
IL-2, IL-3, IL-7, IL-12, IL-15 and/or IL-21, have been used by various groups to generate
- 92 - human NK cells from purified CD34(+) HPC populations in vitro. IL-2, IL-15 and, to a
lesser extent, IL-7, which all signal through the common gamma chain (γc), can support
the generation of CD3(-)CD56bright NK cells in the absence of additional cytokines or
stroma, although the majority of NK cells derived in these cytokines alone are
phenotypically and functionally immature compared to primary PB NK cells derived in
vivo (17, 22, 48, 54, 93). The other cytokines listed above can act in synergy with IL-2 or
IL-15 in vitro to either promote the generation and/or expansion of IL-2/15-responsive pre-NK cells or to promote the survival, proliferation, and/or maturation of IL-2/15- activated developing NK cell intermediates (17, 21, 32, 40, 47, 54). However, although these numerous studies have provided clues regarding the general cytokine- responsiveness of developing NK cells in vitro, the specific mechanism(s) of action of these cytokines during NK cell development in vivo are largely unknown (2, 12, 74, 94,
95).
As mentioned in Chapters 2 and 3, IL-15 is typically regarded as the most central and critical cytokine supporting NK cell development in vivo, because the NK cell deficiencies observed in mice and/or humans lacking IL-15 or components of its receptor are more pronounced than in the absence of IL-2 or IL-7 signaling (53, 96-101).
Importantly, this does not mean that IL-2 and IL-7 are irrelevant during NK cell development, as redundancy and compensatory mechanisms occurring in gene-deficient mice and humans can mask subtle effects of cytokines that share common signaling pathways. Furthermore, under certain conditions, such as during T cell activation, IL-2 may contribute to NK cell maturation in SLT, as stages 2-4 constitutively express high-
- 93 - affinity IL-2Rαβγ complexes enabling them to compete for limiting amounts of IL-2
released by nearby T cells (15, 16, 25, 26, 54).
Although high dose soluble IL-15 can bind to its receptor components and
promote the proliferation and differentiation of NK cells in vitro (17), physiologic IL-15
in vivo exists primarily bound to IL-15Rα as a membrane ligand on accessory cells that
can present the IL-15-IL-15Rα complex in trans to recipient cells that need only express
CD122 and the γc (102, 103). Despite solid evidence that trans-presentation of IL-15 is
essential for mature NK cell survival, the role of IL-15 during the maturation process, per
se, is less clear (104-107). Intriguingly, Vosshenrich et al. recently observed that even in
the absence of IL-15 in vivo, residual NK cells with near-normal phenotypic and
functional attributes could be identified (108). This is somewhat contradictory to an
earlier report by Minagawa et al. who observed that transgenic overexpression of the
survival factor, Bcl-2, in CD122-/- mice could restore the absolute number of splenic NK
cells but not their cytolytic potential (109). Both results support a definite role for IL-15
in mature NK cell survival, although the study by Minagawa et al. also suggests that IL-
15 (or IL-2) signaling initiates the cytolytic genetic program during mouse NK cell
development. Given that the acquisition of cytolytic activity is a late event during both
human and mouse NK cell maturation (8, 56, 66), one possibility is that IL-15 may act
primarily at a late stage during this process in vivo. For instance, in humans, despite the
detection of CD122 mRNA at stage 2 pre-NK cells in vivo, CD122 protein is not
detectable by flow cytometry until stage 4 of development, whereas all stage 3 iNK cells
express very high levels of CD117 (c-kit) and CD127 (IL-7Rα) (unpublished data) (66).
Perhaps IL-15 acts primarily at a late stage of development in vivo and other cytokines - 94 - (e.g. KL, IL-7) normally support the survival of developing intermediates at earlier stages. It is also possible that developing human NK cells do not, and perhaps should not, even gain access to IL-15 until a late stage of differentiation. Indeed, uncontrolled signaling through the IL-2/15 receptor in vivo resulted in the generation of T/NK cell leukemia (110, 111). In addition, IL-2 stimulation can override the self-tolerance of NK cells generated in transporter associated with antigen processing (TAP)-deficient human patients (112). As is discussed below, there is evidence that NK cells must undergo a process called licensing in order to become functionally competent (113). Given that trans-presentation of IL-15 is likely to be tightly regulated on a per-cell basis, its expression by accessory cells may require that a developing NK cell provide a reciprocal signal, perhaps indicating that it is self-tolerant, before it can receive IL-15 and initiate the cytolytic genetic program.
Interestingly, in the study presented in Chapter 3, we observed that the majority of freshly purified SLT-derived stage 3 iNK cells did not differentiate to stage 4 when
cultured in high-dose soluble IL-15 alone although this cytokine did induce their
proliferation (Figure 18) (66). This observation is similar to that of Bennett et al. who
observed that IL-2 stimulation was not sufficient to promote the terminal differentiation
of in vitro-derived iNK cells, whereas culture in IL-12 could induce NK cell maturation
from these cells (40). Collectively, these data suggest an alternative possibility that trans-
presentation of IL-15 in vivo is qualitatively different for developing NK cells at each
stage of their maturation. In this regard, trans-presentation of IL-15 to pre-NK and iNK
cells may promote NK cell commitment and proliferation, respectively, whereas trans-
- 95 - presentation of IL-15 at a late stage may induce the acquisition of cytolytic capability, perhaps in combination with accompanying signals from accessory cells.
Cell-cell interactions
Indeed, in addition to cytokines, other receptor-ligand interactions regulate NK cells as they mature. First of all, ligation of activating receptors may influence NK cell development. For example, some stage 3 iNK cells in SLT express NKp44 (Figure 12)
(66), which can activate mature NK cells (114), and stage 4 CD56bright NK cells express the activating receptors, NKG2D and NKp46 (Figure 12) (66, 115). Although these receptors, and many others not mentioned here, have been primarily studied in the context of mature NK cell activation, the potential for activating receptors to influence human NK cell development is noteworthy and has not yet been formally addressed
(116).
Inhibition of PB NK cells from killing autologous cells that express self MHC-I molecules is due to the interaction of the latter with the conserved inhibitory CD94-
NKG2A receptors and/or the polymorphic inhibitory KIRs expressed on mature NK cells
(115, 117). The expression of CD94-NKG2A and individual KIR molecules is
heterogeneous within the total NK cell pool in order to form a diverse NK cell repertoire
capable of sensing minute changes in the expression of various MHC-I molecules (116).
Although host expression of MHC-I is not essential for NK cell development or even for
maintaining self-tolerance (118), due to the additional expression of multiple non-MHC-
I-binding inhibitory receptors whose ligands are ubiquitously expressed (119-121), there
is strong evidence that MHC-I molecules do influence the overall outcome of NK cell
- 96 - maturation in vivo (2, 12). For example, Shilling et al. observed that among KIR- haplotype-identical sibling pairs, differences in HLA-haplotype resulted in statistically significant differences in the frequencies of KIRs expressed by the total PB NK cell pool
(72). In addition, in MHC-I-deficient mice, NK cells actually have higher frequencies of
Ly49 receptors (the family of MHC-I receptors akin to the KIR family in humans) (122,
123), do not display auto-reactivity (118), and are generally hypo-responsive to classic
MHC-I-negative targets in vitro compared to normal controls (124). Recently, Kim et al. reported that developing NK cells in mice undergo a process called licensing in order to become functionally equipped with the capacities for natural killing and cytokine production (113). Notably, in the absence of cognate ligands for individual Ly49 receptors, in vivo-derived NK cells expressing only those specific Ly49 receptors were hypo-responsive to stimulation through activating receptors, whereas the presence of ligands for Ly49 receptors conferred functionally maturity. Kim and colleagues determined that licensing of NK cells required signaling through Ly49 receptors themselves, because transgenic overexpression of a wt Ly49A receptor into mice with the cognate MHC-I ligand induced licensing, whereas the overexpression of mutant Ly49A molecules either lacking the entire cytoplasmic domain or containing a Tyr-to-Phe mutation in the immunotyrosine-based inhibitory motif did not (113). Interestingly, licensed NK cells were detected in gene-deficient mice lacking DAP10, DAP12, FcεRIγ and CD3ζ, which are adaptor molecules for many activating NK cell receptors (113,
115). Thus, at some point during development, maturing NK cells must bind their inhibitory Ly49 receptors with MHC-1 in order to become functionally competent.
- 97 - These new data have not yet been confirmed in humans, although similar to the
NK cells from MHC-I-deficient mice, NK cells derived from TAP-deficient patients are also hypo-responsive (112). Therefore, in humans, licensing could presumably regulate
NK cells as they acquire KIRs. In addition, given that PB- and SLT-derived stage 4
CD94-NKG2A(+)KIR(-) NK cells express perforin, can lyse K562 targets, and can produce IFN-γ following short-term stimulation ex vivo (51, 66, 125, 126), it seems likely
that licensing, or a similar regulatory process, should also occur earlier during
development, prior to the acquisition of KIRs and that inhibitory signals through the
CD94-NKG2A receptor could be involved in this process. Likewise, stage 3 iNK cells
express 2B4, which transmits an inhibitory signal during human NK cell development
(127), CD161, and/or LAIR-1. Perhaps these inhibitory receptors and others might
regulate cytokine production by iNK cells.
Gene expression
Fundamentally, the various cell-extrinsic stimuli discussed above influence NK
cell development via changes in gene expression. From the results of loss-of-function
studies with gene-deficient mice and gain-of-functions studies initiated with human
CD34(+) HSCs, numerous transcription factors (TFs) have been implicated in NK cell
lineage commitment, maturation, and functionality (12, 57, 74). Now, with a more
comprensive model of in vivo human NK cell development, it will be important to correlate the expression of these various TFs with the discrete stages of maturation to hopefully provide better insight into how and when these various molecules act in humans. As mentioned earlier, we observed that mRNA expression of ETS-1, which may
- 98 - be involved in NK cell lineage commitment (58), is expressed at low levels in stages 1 and 2 in SLT, yet is increased at stage 3 and remains high at stage 4 (66). GATA-3 and T-
BET-deficient mice have NK cell functional defects (59, 60), and we observed that
GATA-3 mRNA progressively increases from stage 1, is highest at stage 3, and then decreases again at stage 4 in human SLT. In contrast, T-BET mRNA was low or barely detectable at stages 1-3 but readily detectable at stage 4 (66).
In humans, as in mice, NK cell receptors are largely co-localized in the genome.
The genes encoding the C-type lectin receptors, including CD69, CD94, NKG2A, C, D,
and E, and CD161 are situated in a common region on human chromosome 12 in the so-
called NK complex (NKC) (128, 129). In contrast, the family of KIR genes are located
on chromosome 19 in the leukocyte receptor cluster (130). The patterns of surface
marker expression seen during in vitro and in vivo human NK cell development indicate
that genetic loci within the NKC are accessible to transcriptional machinery at earlier
stages than are the KIR genes (Table 2) (40, 47, 66). These gene expression patterns may
be due to global changes in chromatin structure that occur during development or simply
due to divergent TF expression patterns. Furthermore, DNA methylation and histone
modifications also likely influence gene transcription during NK cell development (131).
Chan et al. have shown that DNA methylation of KIR genes maintains the unique
expression patterns of these receptors on individual mature NK cells (132). It will be
important to determine if KIR genes are methylated during the early stages of NK cell
development in vivo or whether they are negatively regulated in some other manner.
- 99 - 4.4 Sites of NK cell development
Assuming that licensing exists in humans as a fail-safe mechanism to ensure NK cell self-tolerance, it is reasonable to imagine that NK cell maturation may occur in any tissue without the threat of auto reactivity to the host as long as the soluble and membrane-bound ligand milieu is supportive. The data described above suggest that all aspects of terminal human NK cell differentiation, including lineage commitment, functional maturation, and KIR acquisition, can and do occur within LNs and tonsils, and it seems reasonable to predict that these processes also occur in other SLT including mucosal-associated lymphoid tissue, Peyer’s patches and the white pulp of the spleen.
Naturally, this now raises questions as to whether or not these steps in NK cell development occur outside of SLT in humans and whether a similar developmental pathway exists in other species. With regard to the former, it is well known that CD34(+)
HPCs with NK cell differentiation potential normally exist in the thymus (75, 133).
However, the overwhelming majority of these cells are induced by the thymic environment towards T cell differentiation and any potential physiological importance of the thymus in promoting normal NK cell development has not yet been established, because athymic mice and humans have functionally competent NK cells (134-137). It is also clear that pro-, pre-, iNK, CD56bright, and CD56dim NK cells can each be found in human BM and PB (unpublished data) (40, 54, 66). However, whereas dynamic NK cell maturation within SLT is strongly suggested based on the surface expression patterns observed via flow cytometry (Figures 10 and 19) (66), the very few stage 3 iNK cells in
BM and PB are altogether distinct from the stage 4 CD3(-)CD56brightCD117(+/-
)CD94(+) subset without a “connecting band” of events that would be indicative of
- 100 - ongoing maturation in situ (unpublished data). Certainly, very early steps in NK cell
development, such as the generation of pro-NK cells from HSCs, likely occur within the
BM. However, given the anatomical distribution of downstream developmental
intermediates in this pathway, it is still unclear which if any of the latter matures within
BM or PB or if they are merely circulating through these tissues.
Is there evidence that mouse NK cells develop in SLT? The current general
consensus is that NK cells develop within the BM in adult mice (2, 12). As mentioned
earlier, studies using either β-estradiol or radioactive strontium to induce osteopetrosis
revealed that an intact BM-microenvironment might be required to support NK cell
development in vivo, because NK cell activities were drastically reduced in the spleens of
experimental animals compared to those of the controls (6, 7). Interestingly, Hackett et
al. reported that the reduction in splenic NK cell activity in β-estradiol-treated mice was
not due to an absolute deficiency of NK-lineage cells but rather a failure of these cells to
fully mature (138). Indeed, the spleens of β-estradiol-treated mice contained a similar
proportion of splenic NK1.1+ cells compared to untreated controls, yet the former could
not lyse Yac-1 target cells unless first primed with IL-2 or IL-15 in vitro (138, 139). The
authors of these studies hypothesized that functional maturation of NK cells therefore
requires an intact BM microenvironment and that NK cells mature within the BM.
However, the potential effect(s) of BM-ablation on hematopoietic accessory cells, which
may normally interact with and provide support to developing NK cells in the periphery,
should also be considered. In addition, BM-ablation affects not only the BM; the spleens
are converted into sites of hematopoiesis, and the LNs of mice treated with radioactive strontium become somewhat abnormal in that there are increased numbers of mast cells - 101 - in the cortex and capsular regions (140). Therefore, although these early data indicate that the BM is fundamentally important for mouse NK cell development, they neither prove nor disprove whether terminal steps in NK cell maturation must occur specifically within this tissue.
Current evidence in support of the hypothesis that SLT may be sites of mouse NK cell development is largely circumstantial, yet it is worthwhile to discuss in light of the human data. First of all, although there is clear in vivo data to conclude that mature NK cells can traffic into LNs to provide IFN-γ during the early phase of infection (141, 142),
Chen et al. recently reported that in the absence of infection, a lower proportion of the naturally occurring LN-resident CD3(-)NK1.1(+) cells produced IFN-γ upon LPS stimulation in vivo in comparison to freshly isolated splenic CD3(-)NK1.1(+) NK cells
(143). This observation could indicate that the majority of LN-resident CD3(-)NK1.1(+)
cells are functionally immature, although LN-derived CD3(-)NK1.1(+) cells killed YAC-
1 and RMA/S tumors equally well compared to splenic NK cells (143). In a recent
review, Di Santo reported that his group had identified Lin(-)CD122(+) pre-NK cells in
mouse LNs (12). In addition, two separate groups have independently identified what
they each refer to as putative precursor populations within normal mouse LNs. Terra et
al. described a Lin(-)CD117(+)CD127(+) population that could not give rise to T cells ex
vivo unless isolated from oncostatin M-transgenic mice (144). Likewise, Fallon et al.
described a novel population of non-B, non-T CD117(+)FcεRI(-) cells that were uniquely
enriched within mesenteric LNs and that could produce IL-4, IL-5, and IL-13 in response
to IL-25 stimulation (145). Neither group of investigators assessed for NK cell
maturation from these populations; however, based on the described characteristics, the - 102 - LN-resident CD117(+) populations might actually be redundant and potentially similar to stage 3 iNK cells in human SLT. Collectively, these studies suggest that mouse LNs may be enriched with immature NK cell developmental intermediates similar to humans.
Mice lacking genes encoding for molecules involved in the lymphotoxin (LT) signaling pathway fail to develop all or most of their LNs and Peyer’s patches (41, 146,
147). The membrane-bound ligand (mLT) consists of one LTα and two LTβ subunits that collectively form a heterotrimeric LTα1β2 complex that specifically binds the LTβR
(148-151). Intriguingly, in addition to the defects in SLT formation, LTα-/- and LTβR-/-
mice also have NK cell deficiencies in their BM and spleens, whereas their B and T cell
compartments are generally intact (49, 152-154). There are conflicting reports as to
whether or not the LT signaling pathway is absolutely required for qualitative NK cell
functional maturation (155, 156); however, all reports seem to indicate that these defects
impact overall NK cell numbers, although the mechanism is not yet clear and may be at
least two-fold. On the one hand, there is evidence that mLT must be expressed on the
surface of NK cells and/or their developmental intermediates to subsequently bind LTβR
expressed on stromal cells and potentially induce the latter to produce IL-15. This is
consistent with the observations that a) LTα-/- → wt and wt → LTβR-/- BM chimeras
failed to generate equal numbers of donor-derived NK cells compared to wt → wt control
chimeras, whereas LTβR-/- → wt chimeras produced normal NK cell numbers (49, 154);
b) BM stroma from LTα-/- and LTα-transgenic mice express relatively lower and higher
levels of IL-15 mRNA compared to wt stroma, respectively (155); and c) administration
of recombinant IL-15 to LTα-/- mice restored NK cell numbers in vivo (155). On the
- 103 - other hand, there is also evidence for an environmental defect in these knockout mice that specifically impairs NK cell development, because a) wt → LTα-/- BM chimeras failed to restore NK cell numbers in the spleens of the recipient mice, despite normal reconstitution of splenic NK cells when wt splenic-derived mature NK cells were transferred into LTα-/- recipients (49); and b) agonistic triggering of the LTβR in LTα-/- mice failed to restore splenic NK cell numbers to wt levels in vivo, whereas it promoted
the differentiation of NK cells from wt fetal liver-derived progenitor cells on LTα-/-
stromal cells in vitro (154). Indeed, the environmental defect in these mice could be attributed to the drastic reduction in SLT. Furthermore, DC development and homeostasis within lymphoid tissues are also aberrant in LTα-/- and LTβR-/- mice (157-
159), and NK-DC interactions may be required for normal mouse NK cell development.
There is a third layer of complexity with regard to mLT signaling and its relation to the NK cell lineage. As discussed in Chapter 2, during mouse embryonic development, a small population of so-called lymphoid tissue inducer (LTi) cells arrives at LN anlagens (sites of future LNs) and interacts with mesenchymal cells to initiate LN formation (160). These LTi cells are CD45(+)CD127(+)α4β7(+) and express mLT on their surface (43, 161). Current models hold that interaction of LTi cell-derived mLT with LTβR expressed on LN anlagen mesenchymal cells induces the latter to express a number of cell adhesion molecules and chemokines that in turn recruit other cells, including B cells and T cells, to the developing LNs (41, 146, 160). Thus, LTi are important for providing the initial stimulus for LN formation. Interestingly, mouse LTi cells have the potential to differentiate into NK cells ex vivo (43). In addition, both NK cells and LTi cells require the cell-intrinsic expression of the Id2 transcription factor for - 104 - their development, and as expected, Id2-/- mice have SLT deficiencies (42, 162). Thus, there may be a very close and intertwined relationship between the NK cell lineage and
SLT where each may be required for the normal development of the other. This kind of relationship is actually not unprecedented, as normal maturation of thymic epithelial cells requires reciprocal interactions with fetal thymocytes (163-165).
What is it about SLT that might make them especially suited to support NK cell differentiation? Although the BM microenvironment can provide growth factors that may be needed for at least the early stages of NK cell development, there may be unique cell-cell interactions and other cytokines in the periphery that are required for the
terminal stages of NK cell maturation. For example, there is evidence that both BM-
derived hematopoietic cells and, to a lesser extent, radioresistant stromal cells contribute
to NK cell development (102, 166, 167), and within both human and mouse SLT, NK
cells are in close contact DCs (141, 168). The latter can express IL-15, LTβR, IL-12, and
numerous other soluble factors and membrane-bound ligands and receptors that could theoretically enable DCs to interact with, support, and promote the differentiation of developing NK cells in vivo. Therefore, SLT may simply provide the unique setting for immature NK cell developmental intermediates to interact with accessory cells such as
DCs.
4.5 Concluding remarks
From the collective works of numerous investigators over that last two decades, we now have a much clearer picture of the human NK cell developmental pathway in vivo that will hopefully lead us closer to discovering ways to manipulate this system in
- 105 - patients and to better treat NK-associated malignancies. Indeed, new and exciting questions arise as to how and why human NK cells develop in SLT, and it is also fascinating to consider that in addition to their roles as reservoirs of mature NK cells, stage 1-4 developmental intermediates may have other functions and participate in immunity. It could be predicted that because of the availability of human tonsils and the natural enrichment of NK cell developmental intermediates within these tissues, human
NK cell development may become an even more attractive system for future investigation. Therefore, as researchers continue to characterize the cellular intermediates in this developmental pathway, it will also be important to thoroughly characterize the accessory cells that support NK cell maturation and licensing in vivo and to understand the reciprocal interactions that occur at each stage of development. In addition, focused studies are warranted to determine if mouse NK cells also differentiate within SLT so that we can continue to learn and gain insight from this invaluable model system. In closing, I hope that these new findings can contribute to our general knowledge of the human immune system and can one day be useful for the treatment of patients.
- 106 -
Figure 19. CD94, CD16, and KIR expression patterns among CD3(-)CD56(+) cells in SLT and PB. Representative analyses by flow cytometry of T and B cell-depleted human tonsil (top row) and PB (bottom row) samples. Dot plots were either gated on total CD3(-)CD56(+) events for the left column, or for KIR(+) events within the total
CD3(-)CD56(+) fraction for the other three columns. KIR2DL2/L3/S2, KIR2DL1/S1, and KIR3DL1 receptors were detected by the DX27, EB6, and NKB1 mAbs, respectively. The red arrow in the left panel (upper row) illustrates the proposed progression of NK cell development within human SLT.
- 107 - Total KIR2DL2/ KIR2DL1/ CD3(-)CD56(+) 2DL3/2DS2(+) 2DS1(+) KIR3DL1(+)
SLT 94 CD
CD16 4 PB CD9
CD16
Figure 19. CD94, CD16, and KIR expression patterns among
CD3(-)CD56(+) cells in SLT and PB.
- 108 -
Figure 20. Model of human NK cell development in vivo. This figure illustrates the
developmental stages through which human NK cells are thought to mature from BM-
derived HSCs to terminally differentiated stage 5 NK cells. The gray box represents
developmental steps that can occur within SLT. As NK cells progress from stage 1 to
stage 3, they become committed to the NK cell lineage and lose the capacities for T cell
or DC development. From stages 3 to 5, NK cells undergo functional maturation and transitioning, such that stage 3 iNK cells may preferentially produce type-2 cytokines, stage 4 CD56bright NK cells may preferentially produce type-1 cytokines, and stage 5
CD56dim NK cells may preferentially mediate cellular cytotoxicity in vivo. KIR
acquisition occurs late at the stage 4 to stage 5 transition.
- 109 - STAGE 1 STAGE 2 STAGE 3 STAGE 4 STAGE 5 CD122(-) CD122(+) Committed (CD56bright) (CD56dim) HSC NKpro NKpre iNK NK NK
CD34(+) CD34(+) CD34(+) CD34(-) CD34(-) CD34(-) CD38(-) CD117(-) CD117(+) CD117(+) CD117(+/-) CD117(-) CD94(-) CD94(-) CD94(-) CD94(+) CD94(+/-) CD16(-) CD16(-) CD16(-) CD16(-) CD16(+)
Commitment to NK lineage
Functional maturation/transitioning
KIR acquisition
Figure 20. Model of human NK cell development in vivo.
- 110 -
Surface Stage 1 Stage 2 Stage 3 Stage 4 NK Stage 5 NK Antigen pro-NK pre-NK iNK CD1a - - - - - CD2 - +/- +/(-) +/(-) +/(-) CD3 - - - - - CD5 - - - - - CD7 +/- +/- +/- +/(-) +/(-) CD10 + (+)/- - - - CD11b - - (+)/- + + CD16 - - - - + CD25 + + +/- (+) - CD33 + + + (+)/- (+)/- CD34 + + - - - CD43 + + + + + CD44 + + + + + CD45RA + + (+)/- +/(-) +/(-) CD56 - (+)/- +/- + + CD69 - - +/(-) (+)/- (+)/- CD94 - - - + +/- CD117 - + + +/- - CD122 - - - + + CD123 (+) - - - - CD127 (+) (+) + (+)/- - CD161 - +/- + + + Integrin β7 +/(-) + - - - HLA-DR +/- + - - - LAIR-1 + + + + + 2B4 + + + + + NKp30 - - - - - NKp44 - - +/- (+)/- (+)/- NKp46 - - - + + NKG2A - - - + +/- NKG2C - - - (+)/- (+)/- NKG2D - - - + + KIRa - - - (+)/- +/- a KIRs recognized by the DX27, EB6, and DX9 mAbs. + All cells are positive; - All cells are negative; +/- Variable expression depending upon the donor; (+)/- Majority of cells are negative; +/(-) Majority of cells are positive; (+) Barely detectable on cells.
Table 3. Surface antigen expression profiles of SLT-resident NK intermediates
- 111 -
LITERATURE CITED
1. Trinchieri G. Biology of natural killer cells. Adv Immunol. 1989;47:187-376.
2. Yokoyama WM, Kim S, French AR. The dynamic life of natural killer cells. Annu Rev Immunol. 2004;22:405-29.
3. Raulet DH. Development and tolerance of natural killer cells. Curr Opin Immunol. 1999 Apr;11(2):129-34.
4. Colucci F, Caligiuri MA, Di Santo JP. What does it take to make a natural killer? Nat Rev Immunol. 2003 May;3(5):413-25.
5. Williams NS, Klem J, Puzanov IJ, Sivakumar PV, Schatzle JD, Bennett M, et al. Natural killer cell differentiation: insights from knockout and transgenic mouse models and in vitro systems. Immunol Rev. 1998 Oct;165:47-61.
6. Haller O, Wigzell H. Suppression of natural killer cell activity with radioactive strontium: effector cells are marrow dependent. J Immunol. 1977 Apr;118(4):1503-6.
7. Kumar V, Bennett M, Eckner RJ. Mechanisms of genetic resistance to friend virus leukemia in mice. J Exp Med. 1974 May 1;139(5):1093-109.
8. Kim S, Iizuka K, Kang HS, Dokun A, French AR, Greco S, et al. In vivo developmental stages in murine natural killer cell maturation. Nat Immunol. 2002 Jun;3(6):523-8.
9. Rosmaraki EE, Douagi I, Roth C, Colucci F, Cumano A, Di Santo JP. Identification of committed NK cell progenitors in adult murine bone marrow. Eur J Immunol. 2001 Jun;31(6):1900-9.
10. Srour EF, Brandt JE, Briddell RA, Leemhuis T, van Besien K, Hoffman R. Human CD34+ HLA-DR- bone marrow cells contain progenitor cells capable of self- renewal, multilineage differentiation, and long-term in vitro hematopoiesis. Blood Cells. 1991;17(2):287-95.
- 112 - 11. Miller JS, Verfaillie C, McGlave P. The generation of human natural killer cells from CD34+/DR- primitive progenitors in long-term bone marrow culture. Blood. 1992 Nov 1;80(9):2182-7.
12. Di Santo JP. NATURAL KILLER CELL DEVELOPMENTAL PATHWAYS: A Question of Balance. Annu Rev Immunol. 2006;24:257-86.
13. Waldmann T, Tagaya Y, Bamford R. Interleukin-2, interleukin-15, and their receptors. Int Rev Immunol. 1998;16(3-4):205-26.
14. Cooper MA, Fehniger TA, Caligiuri MA. The biology of human natural killer-cell subsets. Trends Immunol. 2001 Nov;22(11):633-40.
15. Fehniger TA, Cooper MA, Nuovo GJ, Cella M, Facchetti F, Colonna M, et al. CD56bright natural killer cells are present in human lymph nodes and are activated by T cell-derived IL-2: a potential new link between adaptive and innate immunity. Blood. 2003 Apr 15;101(8):3052-7.
16. Ferlazzo G, Thomas D, Lin SL, Goodman K, Morandi B, Muller WA, et al. The abundant NK cells in human secondary lymphoid tissues require activation to express killer cell Ig-like receptors and become cytolytic. J Immunol. 2004 Feb 1;172(3):1455- 62.
17. Mrozek E, Anderson P, Caligiuri MA. Role of interleukin-15 in the development of human CD56+ natural killer cells from CD34+ hematopoietic progenitor cells. Blood. 1996 Apr 1;87(7):2632-40.
18. Williams NS, Moore TA, Schatzle JD, Puzanov IJ, Sivakumar PV, Zlotnik A, et al. Generation of lytic natural killer 1.1+, Ly-49- cells from multipotential murine bone marrow progenitors in a stroma-free culture: definition of cytokine requirements and developmental intermediates. J Exp Med. 1997 Nov 3;186(9):1609-14.
19. Suzuki H, Duncan GS, Takimoto H, Mak TW. Abnormal development of intestinal intraepithelial lymphocytes and peripheral natural killer cells in mice lacking the IL-2 receptor beta chain. J Exp Med. 1997 Feb 3;185(3):499-505.
20. Shibuya A, Kojima H, Shibuya K, Nagayoshi K, Nagasawa T, Nakauchi H. Enrichment of interleukin-2-responsive natural killer progenitors in human bone marrow. Blood. 1993 Apr 1;81(7):1819-26.
21. Yu H, Fehniger TA, Fuchshuber P, Thiel KS, Vivier E, Carson WE, et al. Flt3 ligand promotes the generation of a distinct CD34(+) human natural killer cell progenitor that responds to interleukin-15. Blood. 1998 Nov 15;92(10):3647-57.
- 113 - 22. Miller JS, Alley KA, McGlave P. Differentiation of natural killer (NK) cells from human primitive marrow progenitors in a stroma-based long-term culture system: identification of a CD34+7+ NK progenitor. Blood. 1994 May 1;83(9):2594-601.
23. Galy A, Travis M, Cen D, Chen B. Human T, B, natural killer, and dendritic cells arise from a common bone marrow progenitor cell subset. Immunity. 1995 Oct;3(4):459- 73.
24. Canque B, Camus S, Dalloul A, Kahn E, Yagello M, Dezutter-Dambuyant C, et al. Characterization of dendritic cell differentiation pathways from cord blood CD34(+)CD7(+)CD45RA(+) hematopoietic progenitor cells. Blood. 2000 Dec 1;96(12):3748-56.
25. Caligiuri MA, Zmuidzinas A, Manley TJ, Levine H, Smith KA, Ritz J. Functional consequences of interleukin 2 receptor expression on resting human lymphocytes. Identification of a novel natural killer cell subset with high affinity receptors. J Exp Med. 1990 May 1;171(5):1509-26.
26. Nagler A, Lanier LL, Phillips JH. Constitutive expression of high affinity interleukin 2 receptors on human CD16-natural killer cells in vivo. J Exp Med. 1990 May 1;171(5):1527-33.
27. Queen C, Schneider WP, Selick HE, Payne PW, Landolfi NF, Duncan JF, et al. A humanized antibody that binds to the interleukin 2 receptor. Proc Natl Acad Sci U S A. 1989 Dec;86(24):10029-33.
28. Fehniger TA, Bluman EM, Porter MM, Mrozek E, Cooper MA, VanDeusen JB, et al. Potential mechanisms of human natural killer cell expansion in vivo during low-dose IL-2 therapy. J Clin Invest. 2000 Jul;106(1):117-24.
29. Vitale M, Della Chiesa M, Carlomagno S, Romagnani C, Thiel A, Moretta L, et al. The small subset of CD56brightCD16- natural killer cells is selectively responsible for both cell proliferation and interferon-gamma production upon interaction with dendritic cells. Eur J Immunol. 2004 Jun;34(6):1715-22.
30. Blom B, Ho S, Antonenko S, Liu YJ. Generation of interferon alpha-producing predendritic cell (Pre-DC)2 from human CD34(+) hematopoietic stem cells. J Exp Med. 2000 Dec 18;192(12):1785-96.
31. Yin AH, Miraglia S, Zanjani ED, Almeida-Porada G, Ogawa M, Leary AG, et al. AC133, a novel marker for human hematopoietic stem and progenitor cells. Blood. 1997 Dec 15;90(12):5002-12.
- 114 - 32. Miller JS, McCullar V, Punzel M, Lemischka IR, Moore KA. Single adult human CD34(+)/Lin-/CD38(-) progenitors give rise to natural killer cells, B-lineage cells, dendritic cells, and myeloid cells. Blood. 1999 Jan 1;93(1):96-106.
33. Cooper MA, Fehniger TA, Fuchs A, Colonna M, Caligiuri MA. NK cell and DC interactions. Trends Immunol. 2004 Jan;25(1):47-52.
34. von Andrian UH, Mempel TR. Homing and cellular traffic in lymph nodes. Nat Rev Immunol. 2003 Nov;3(11):867-78.
35. Bendelac A, Fearon DT. Innate pathways that control acquired immunity. Curr Opin Immunol. 1997 Feb;9(1):1-3.
36. Ruggeri L, Capanni M, Urbani E, Perruccio K, Shlomchik WD, Tosti A, et al. Effectiveness of donor natural killer cell alloreactivity in mismatched hematopoietic transplants. Science. 2002 Mar 15;295(5562):2097-100.
37. Lanier LL, Spits H, Phillips JH. The developmental relationship between NK cells and T cells. Immunol Today. 1992 Oct;13(10):392-5.
38. Spits H, Blom B, Jaleco AC, Weijer K, Verschuren MC, van Dongen JJ, et al. Early stages in the development of human T, natural killer and thymic dendritic cells. Immunol Rev. 1998 Oct;165:75-86.
39. Hackett J, Jr., Bennett M, Kumar V. Origin and differentiation of natural killer cells. I. Characteristics of a transplantable NK cell precursor. J Immunol. 1985 Jun;134(6):3731-8.
40. Bennett IM, Zatsepina O, Zamai L, Azzoni L, Mikheeva T, Perussia B. Definition of a natural killer NKR-P1A+/CD56-/CD16- functionally immature human NK cell subset that differentiates in vitro in the presence of interleukin 12. J Exp Med. 1996 Nov 1;184(5):1845-56.
41. Mebius RE. Organogenesis of lymphoid tissues. Nat Rev Immunol. 2003 Apr;3(4):292-303.
42. Yokota Y, Mansouri A, Mori S, Sugawara S, Adachi S, Nishikawa S, et al. Development of peripheral lymphoid organs and natural killer cells depends on the helix- loop-helix inhibitor Id2. Nature. 1999 Feb 25;397(6721):702-6.
43. Mebius RE, Rennert P, Weissman IL. Developing lymph nodes collect CD4+CD3- LTbeta+ cells that can differentiate to APC, NK cells, and follicular cells but not T or B cells. Immunity. 1997 Oct;7(4):493-504.
- 115 - 44. Alimzhanov MB, Kuprash DV, Kosco-Vilbois MH, Luz A, Turetskaya RL, Tarakhovsky A, et al. Abnormal development of secondary lymphoid tissues in lymphotoxin beta-deficient mice. Proc Natl Acad Sci U S A. 1997 Aug 19;94(17):9302- 7.
45. Wodnar-Filipowicz A. Flt3 ligand: role in control of hematopoietic and immune functions of the bone marrow. News Physiol Sci. 2003 Dec;18:247-51.
46. Carson WE, Haldar S, Baiocchi RA, Croce CM, Caligiuri MA. The c-kit ligand suppresses apoptosis of human natural killer cells through the upregulation of bcl-2. Proc Natl Acad Sci U S A. 1994 Aug 2;91(16):7553-7.
47. Sivori S, Cantoni C, Parolini S, Marcenaro E, Conte R, Moretta L, et al. IL-21 induces both rapid maturation of human CD34+ cell precursors towards NK cells and acquisition of surface killer Ig-like receptors. Eur J Immunol. 2003 Dec;33(12):3439-47.
48. Barao I, Hudig D, Ascensao JL. IL-15-mediated induction of LFA-1 is a late step required for cytotoxic differentiation of human NK cells from CD34+Lin- bone marrow cells. J Immunol. 2003 Jul 15;171(2):683-90.
49. Iizuka K, Chaplin DD, Wang Y, Wu Q, Pegg LE, Yokoyama WM, et al. Requirement for membrane lymphotoxin in natural killer cell development. Proc Natl Acad Sci U S A. 1999 May 25;96(11):6336-40.
50. Nuovo GJ, Plaia TW, Belinsky SA, Baylin SB, Herman JG. In situ detection of the hypermethylation-induced inactivation of the p16 gene as an early event in oncogenesis. Proc Natl Acad Sci U S A. 1999 Oct 26;96(22):12754-9.
51. Cooper MA, Fehniger TA, Turner SC, Chen KS, Ghaheri BA, Ghayur T, et al. Human natural killer cells: a unique innate immunoregulatory role for the CD56(bright) subset. Blood. 2001 May 15;97(10):3146-51.
52. Lassoued K, Nunez CA, Billips L, Kubagawa H, Monteiro RC, LeBlen TW, et al. Expression of surrogate light chain receptors is restricted to a late stage in pre-B cell differentiation. Cell. 1993 Apr 9;73(1):73-86.
53. Kennedy MK, Glaccum M, Brown SN, Butz EA, Viney JL, Embers M, et al. Reversible defects in natural killer and memory CD8 T cell lineages in interleukin 15- deficient mice. J Exp Med. 2000 Mar 6;191(5):771-80.
54. Freud AG, Becknell B, Roychowdhury S, Mao HC, Ferketich AK, Nuovo GJ, et al. A human CD34(+) subset resides in lymph nodes and differentiates into CD56bright natural killer cells. Immunity. 2005 Mar;22(3):295-304.
- 116 - 55. Loza MJ, Perussia B. Final steps of natural killer cell maturation: a model for type 1-type 2 differentiation? Nat Immunol. 2001 Oct;2(10):917-24.
56. Zamai L, Ahmad M, Bennett IM, Azzoni L, Alnemri ES, Perussia B. Natural killer (NK) cell-mediated cytotoxicity: differential use of TRAIL and Fas ligand by immature and mature primary human NK cells. J Exp Med. 1998 Dec 21;188(12):2375- 80.
57. Vosshenrich CA, Samson-Villeger SI, Di Santo JP. Distinguishing features of developing natural killer cells. Curr Opin Immunol. 2005 Apr;17(2):151-8.
58. Barton K, Muthusamy N, Fischer C, Ting CN, Walunas TL, Lanier LL, et al. The Ets-1 transcription factor is required for the development of natural killer cells in mice. Immunity. 1998 Oct;9(4):555-63.
59. Samson SI, Richard O, Tavian M, Ranson T, Vosshenrich CA, Colucci F, et al. GATA-3 promotes maturation, IFN-gamma production, and liver-specific homing of NK cells. Immunity. 2003 Nov;19(5):701-11.
60. Townsend MJ, Weinmann AS, Matsuda JL, Salomon R, Farnham PJ, Biron CA, et al. T-bet regulates the terminal maturation and homeostasis of NK and Valpha14i NKT cells. Immunity. 2004 Apr;20(4):477-94.
61. Shen HQ, Lu M, Ikawa T, Masuda K, Ohmura K, Minato N, et al. T/NK bipotent progenitors in the thymus retain the potential to generate dendritic cells. J Immunol. 2003 Oct 1;171(7):3401-6.
62. De Smedt M, Hoebeke I, Plum J. Human bone marrow CD34+ progenitor cells mature to T cells on OP9-DL1 stromal cell line without thymus microenvironment. Blood Cells Mol Dis. 2004 Nov-Dec;33(3):227-32.
63. Koopman LA, Kopcow HD, Rybalov B, Boyson JE, Orange JS, Schatz F, et al. Human decidual natural killer cells are a unique NK cell subset with immunomodulatory potential. J Exp Med. 2003 Oct 20;198(8):1201-12.
64. Frey M, Packianathan NB, Fehniger TA, Ross ME, Wang WC, Stewart CC, et al. Differential expression and function of L-selectin on CD56bright and CD56dim natural killer cell subsets. J Immunol. 1998 Jul 1;161(1):400-8.
65. Trotta R, Parihar R, Yu J, Becknell B, Allard J, 2nd, Wen J, et al. Differential expression of SHIP1 in CD56bright and CD56dim NK cells provides a molecular basis for distinct functional responses to monokine costimulation. Blood. 2005 Apr 15;105(8):3011-8.
- 117 - 66. Freud AG, Yokohama A, Becknell B, Lee MT, Mao HC, Ferketich AK, et al. Evidence for discrete stages of human natural killer cell differentiation in vivo. J Exp Med. 2006 Apr 10.
67. Jacobs R, Stoll M, Stratmann G, Leo R, Link H, Schmidt RE. CD16- CD56+ natural killer cells after bone marrow transplantation. Blood. 1992 Jun 15;79(12):3239- 44.
68. Lanier LL, Le AM, Civin CI, Loken MR, Phillips JH. The relationship of CD16 (Leu-11) and Leu-19 (NKH-1) antigen expression on human peripheral blood NK cells and cytotoxic T lymphocytes. J Immunol. 1986 Jun 15;136(12):4480-6.
69. Shilling HG, McQueen KL, Cheng NW, Shizuru JA, Negrin RS, Parham P. Reconstitution of NK cell receptor repertoire following HLA-matched hematopoietic cell transplantation. Blood. 2003 May 1;101(9):3730-40.
70. Vitale C, Chiossone L, Morreale G, Lanino E, Cottalasso F, Moretti S, et al. Analysis of the activating receptors and cytolytic function of human natural killer cells undergoing in vivo differentiation after allogeneic bone marrow transplantation. Eur J Immunol. 2004 Feb;34(2):455-60.
71. Miller JS, McCullar V. Human natural killer cells with polyclonal lectin and immunoglobulinlike receptors develop from single hematopoietic stem cells with preferential expression of NKG2A and KIR2DL2/L3/S2. Blood. 2001 Aug 1;98(3):705- 13.
72. Shilling HG, Young N, Guethlein LA, Cheng NW, Gardiner CM, Tyan D, et al. Genetic control of human NK cell repertoire. J Immunol. 2002 Jul 1;169(1):239-47.
73. Valiante NM, Uhrberg M, Shilling HG, Lienert-Weidenbach K, Arnett KL, D'Andrea A, et al. Functionally and structurally distinct NK cell receptor repertoires in the peripheral blood of two human donors. Immunity. 1997 Dec;7(6):739-51.
74. Blom B, Spits H. Development of human lymphoid cells. Annu Rev Immunol. 2006;24:287-320.
75. Sanchez MJ, Muench MO, Roncarolo MG, Lanier LL, Phillips JH. Identification of a common T/natural killer cell progenitor in human fetal thymus. J Exp Med. 1994 Aug 1;180(2):569-76.
76. Spits H, Lanier LL, Phillips JH. Development of human T and natural killer cells. Blood. 1995 May 15;85(10):2654-70.
- 118 - 77. Vanhecke D, Leclercq G, Plum J, Vandekerckhove B. Characterization of distinct stages during the differentiation of human CD69+CD3+ thymocytes and identification of thymic emigrants. J Immunol. 1995 Aug 15;155(4):1862-72.
78. Vanhecke D, Verhasselt B, De Smedt M, Leclercq G, Plum J, Vandekerckhove B. Human thymocytes become lineage committed at an early postselection CD69+ stage, before the onset of functional maturation. J Immunol. 1997 Dec 15;159(12):5973-83.
79. Mathieson BJ, Fowlkes BJ. Cell surface antigen expression on thymocytes: development and phenotypic differentiation of intrathymic subsets. Immunol Rev. 1984 Dec;82:141-73.
80. Jung LK, Haynes BF, Nakamura S, Pahwa S, Fu SM. Expression of early activation antigen (CD69) during human thymic development. Clin Exp Immunol. 1990 Sep;81(3):466-74.
81. Palmer E. Negative selection--clearing out the bad apples from the T-cell repertoire. Nat Rev Immunol. 2003 May;3(5):383-91.
82. Schwarz BA, Bhandoola A. Circulating hematopoietic progenitors with T lineage potential. Nat Immunol. 2004 Sep;5(9):953-60.
83. Bhandoola A, Sambandam A. From stem cell to T cell: one route or many? Nat Rev Immunol. 2006 Feb;6(2):117-26.
84. Ladi E, Yin X, Chtanova T, Robey EA. Thymic microenvironments for T cell differentiation and selection. Nat Immunol. 2006 Apr;7(4):338-43.
85. Lambolez F, Arcangeli ML, Joret AM, Pasqualetto V, Cordier C, Di Santo JP, et al. The thymus exports long-lived fully committed T cell precursors that can colonize primary lymphoid organs. Nat Immunol. 2006 Jan;7(1):76-82.
86. Petrie HT. Cell migration and the control of post-natal T-cell lymphopoiesis in the thymus. Nat Rev Immunol. 2003 Nov;3(11):859-66.
87. Cyster JG. Chemokines, sphingosine-1-phosphate, and cell migration in secondary lymphoid organs. Annu Rev Immunol. 2005;23:127-59.
88. Matloubian M, Lo CG, Cinamon G, Lesneski MJ, Xu Y, Brinkmann V, et al. Lymphocyte egress from thymus and peripheral lymphoid organs is dependent on S1P receptor 1. Nature. 2004 Jan 22;427(6972):355-60.
89. Schwab SR, Pereira JP, Matloubian M, Xu Y, Huang Y, Cyster JG. Lymphocyte sequestration through S1P lyase inhibition and disruption of S1P gradients. Science. 2005 Sep 9;309(5741):1735-9.
- 119 - 90. Maghazachi AA. G protein-coupled receptors in natural killer cells. J Leukoc Biol. 2003 Jul;74(1):16-24.
91. Shiow LR, Rosen DB, Brdickova N, Xu Y, An J, Lanier LL, et al. CD69 acts downstream of interferon-alpha/beta to inhibit S1P1 and lymphocyte egress from lymphoid organs. Nature. 2006 Mar 23;440(7083):540-4.
92. Feng C, Woodside KJ, Vance BA, El-Khoury D, Canelles M, Lee J, et al. A potential role for CD69 in thymocyte emigration. Int Immunol. 2002 Jun;14(6):535-44.
93. Mingari MC, Vitale C, Cantoni C, Bellomo R, Ponte M, Schiavetti F, et al. Interleukin-15-induced maturation of human natural killer cells from early thymic precursors: selective expression of CD94/NKG2-A as the only HLA class I-specific inhibitory receptor. Eur J Immunol. 1997 Jun;27(6):1374-80.
94. Leonard WJ, Spolski R. Interleukin-21: a modulator of lymphoid proliferation, apoptosis and differentiation. Nat Rev Immunol. 2005 Sep;5(9):688-98.
95. Ma A, Koka R, Burkett P. Diverse functions of IL-2, IL-15, and IL-7 in lymphoid homeostasis. Annu Rev Immunol. 2006;24:657-79.
96. DiSanto JP, Keever CA, Small TN, Nicols GL, O'Reilly RJ, Flomenberg N. Absence of interleukin 2 production in a severe combined immunodeficiency disease syndrome with T cells. J Exp Med. 1990 May 1;171(5):1697-704.
97. Giliani S, Mori L, de Saint Basile G, Le Deist F, Rodriguez-Perez C, Forino C, et al. Interleukin-7 receptor alpha (IL-7Ralpha) deficiency: cellular and molecular bases. Analysis of clinical, immunological, and molecular features in 16 novel patients. Immunol Rev. 2005 Feb;203:110-26.
98. Kundig TM, Schorle H, Bachmann MF, Hengartner H, Zinkernagel RM, Horak I. Immune responses in interleukin-2-deficient mice. Science. 1993 Nov 12;262(5136):1059-61.
99. Lodolce JP, Boone DL, Chai S, Swain RE, Dassopoulos T, Trettin S, et al. IL-15 receptor maintains lymphoid homeostasis by supporting lymphocyte homing and proliferation. Immunity. 1998 Nov;9(5):669-76.
100. Maki K, Sunaga S, Komagata Y, Kodaira Y, Mabuchi A, Karasuyama H, et al. Interleukin 7 receptor-deficient mice lack gammadelta T cells. Proc Natl Acad Sci U S A. 1996 Jul 9;93(14):7172-7.
101. von Freeden-Jeffry U, Vieira P, Lucian LA, McNeil T, Burdach SE, Murray R. Lymphopenia in interleukin (IL)-7 gene-deleted mice identifies IL-7 as a nonredundant cytokine. J Exp Med. 1995 Apr 1;181(4):1519-26.
- 120 - 102. Burkett PR, Koka R, Chien M, Chai S, Boone DL, Ma A. Coordinate expression and trans presentation of interleukin (IL)-15Ralpha and IL-15 supports natural killer cell and memory CD8+ T cell homeostasis. J Exp Med. 2004 Oct 4;200(7):825-34.
103. Dubois S, Mariner J, Waldmann TA, Tagaya Y. IL-15Ralpha recycles and presents IL-15 In trans to neighboring cells. Immunity. 2002 Nov;17(5):537-47. 104. Cooper MA, Bush JE, Fehniger TA, VanDeusen JB, Waite RE, Liu Y, et al. In vivo evidence for a dependence on interleukin 15 for survival of natural killer cells. Blood. 2002 Nov 15;100(10):3633-8.
105. Jamieson AM, Isnard P, Dorfman JR, Coles MC, Raulet DH. Turnover and proliferation of NK cells in steady state and lymphopenic conditions. J Immunol. 2004 Jan 15;172(2):864-70.
106. Koka R, Burkett PR, Chien M, Chai S, Chan F, Lodolce JP, et al. Interleukin (IL)- 15R[alpha]-deficient natural killer cells survive in normal but not IL-15R[alpha]- deficient mice. J Exp Med. 2003 Apr 21;197(8):977-84.
107. Ranson T, Vosshenrich CA, Corcuff E, Richard O, Muller W, Di Santo JP. IL-15 is an essential mediator of peripheral NK-cell homeostasis. Blood. 2003 Jun 15;101(12):4887-93.
108. Vosshenrich CA, Ranson T, Samson SI, Corcuff E, Colucci F, Rosmaraki EE, et al. Roles for common cytokine receptor gamma-chain-dependent cytokines in the generation, differentiation, and maturation of NK cell precursors and peripheral NK cells in vivo. J Immunol. 2005 Feb 1;174(3):1213-21.
109. Minagawa M, Watanabe H, Miyaji C, Tomiyama K, Shimura H, Ito A, et al. Enforced expression of Bcl-2 restores the number of NK cells, but does not rescue the impaired development of NKT cells or intraepithelial lymphocytes, in IL-2/IL-15 receptor beta-chain-deficient mice. J Immunol. 2002 Oct 15;169(8):4153-60.
110. Baldassarre G, Fedele M, Battista S, Vecchione A, Klein-Szanto AJ, Santoro M, et al. Onset of natural killer cell lymphomas in transgenic mice carrying a truncated HMGI-C gene by the chronic stimulation of the IL-2 and IL-15 pathway. Proc Natl Acad Sci U S A. 2001 Jul 3;98(14):7970-5.
111. Fehniger TA, Suzuki K, Ponnappan A, VanDeusen JB, Cooper MA, Florea SM, et al. Fatal leukemia in interleukin 15 transgenic mice follows early expansions in natural killer and memory phenotype CD8+ T cells. J Exp Med. 2001 Jan 15;193(2):219-31.
112. Zimmer J, Donato L, Hanau D, Cazenave JP, Tongio MM, Moretta A, et al. Activity and phenotype of natural killer cells in peptide transporter (TAP)-deficient patients (type I bare lymphocyte syndrome). J Exp Med. 1998 Jan 5;187(1):117-22.
- 121 - 113. Kim S, Poursine-Laurent J, Truscott SM, Lybarger L, Song YJ, Yang L, et al. Licensing of natural killer cells by host major histocompatibility complex class I molecules. Nature. 2005 Aug 4;436(7051):709-13.
114. Vitale M, Bottino C, Sivori S, Sanseverino L, Castriconi R, Marcenaro E, et al. NKp44, a novel triggering surface molecule specifically expressed by activated natural killer cells, is involved in non-major histocompatibility complex-restricted tumor cell lysis. J Exp Med. 1998 Jun 15;187(12):2065-72.
115. Lanier LL. NK cell recognition. Annu Rev Immunol. 2005;23:225-74.
116. Raulet DH, Vance RE, McMahon CW. Regulation of the natural killer cell receptor repertoire. Annu Rev Immunol. 2001;19:291-330.
117. Moretta L, Moretta A. Killer immunoglobulin-like receptors. Curr Opin Immunol. 2004 Oct;16(5):626-33.
118. Liao NS, Bix M, Zijlstra M, Jaenisch R, Raulet D. MHC class I deficiency: susceptibility to natural killer (NK) cells and impaired NK activity. Science. 1991 Jul 12;253(5016):199-202.
119. Carlyle JR, Jamieson AM, Gasser S, Clingan CS, Arase H, Raulet DH. Missing self-recognition of Ocil/Clr-b by inhibitory NKR-P1 natural killer cell receptors. Proc Natl Acad Sci U S A. 2004 Mar 9;101(10):3527-32.
120. Kumar V, McNerney ME. A new self: MHC-class-I-independent natural-killer- cell self-tolerance. Nat Rev Immunol. 2005 May;5(5):363-74.
121. McNerney ME, Guzior D, Kumar V. 2B4 (CD244)-CD48 interactions provide a novel MHC class I-independent system for NK-cell self-tolerance in mice. Blood. 2005 Aug 15;106(4):1337-40.
122. Held W, Dorfman JR, Wu MF, Raulet DH. Major histocompatibility complex class I-dependent skewing of the natural killer cell Ly49 receptor repertoire. Eur J Immunol. 1996 Oct;26(10):2286-92.
123. Salcedo M, Diehl AD, Olsson-Alheim MY, Sundback J, Van Kaer L, Karre K, et al. Altered expression of Ly49 inhibitory receptors on natural killer cells from MHC class I-deficient mice. J Immunol. 1997 Apr 1;158(7):3174-80.
124. Hoglund P, Ohlen C, Carbone E, Franksson L, Ljunggren HG, Latour A, et al. Recognition of beta 2-microglobulin-negative (beta 2m-) T-cell blasts by natural killer cells from normal but not from beta 2m- mice: nonresponsiveness controlled by beta 2m- bone marrow in chimeric mice. Proc Natl Acad Sci U S A. 1991 Nov 15;88(22):10332-6.
- 122 - 125. Konjevic G, Schlesinger B, Cheng L, Olsen KJ, Podack ER, Spuzic I. Analysis of perforin expression in human peripheral blood lymphocytes, CD56+ natural killer cell subsets and its induction by interleukin-2. Immunol Invest. 1995 Mar;24(3):499-507.
126. Nagler A, Lanier LL, Cwirla S, Phillips JH. Comparative studies of human FcRIII-positive and negative natural killer cells. J Immunol. 1989 Nov 15;143(10):3183- 91.
127. Sivori S, Falco M, Marcenaro E, Parolini S, Biassoni R, Bottino C, et al. Early expression of triggering receptors and regulatory role of 2B4 in human natural killer cell precursors undergoing in vitro differentiation. Proc Natl Acad Sci U S A. 2002 Apr 2;99(7):4526-31.
128. Ryan JC, Naper C, Hayashi S, Daws MR. Physiologic functions of activating natural killer (NK) complex-encoded receptors on NK cells. Immunol Rev. 2001 Jun;181:126-37.
129. Yabe T, McSherry C, Bach FH, Fisch P, Schall RP, Sondel PM, et al. A multigene family on human chromosome 12 encodes natural killer-cell lectins. Immunogenetics. 1993;37(6):455-60.
130. Long EO, Burshtyn DN, Clark WP, Peruzzi M, Rajagopalan S, Rojo S, et al. Killer cell inhibitory receptors: diversity, specificity, and function. Immunol Rev. 1997 Feb;155:135-44.
131. Chan HW, Miller JS, Moore MB, Lutz CT. Epigenetic control of highly homologous killer Ig-like receptor gene alleles. J Immunol. 2005 Nov 1;175(9):5966-74.
132. Chan HW, Kurago ZB, Stewart CA, Wilson MJ, Martin MP, Mace BE, et al. DNA methylation maintains allele-specific KIR gene expression in human natural killer cells. J Exp Med. 2003 Jan 20;197(2):245-55.
133. Michon JM, Caligiuri MA, Hazanow SM, Levine H, Schlossman SF, Ritz J. Induction of natural killer effectors from human thymus with recombinant IL-2. J Immunol. 1988 May 15;140(10):3660-7.
134. Herberman RB, Nunn ME, Holden HT, Lavrin DH. Natural cytotoxic reactivity of mouse lymphoid cells against syngeneic and allogeneic tumors. II. Characterization of effector cells. Int J Cancer. 1975 Aug 15;16(2):230-9.
135. Ramos SB, Garcia AB, Viana SR, Voltarelli JC, Falcao RP. Phenotypic and functional evaluation of natural killer cells in thymectomized children. Clin Immunol Immunopathol. 1996 Dec;81(3):277-81.
- 123 - 136. Sihvola M, Hurme M. The development of NK cell activity in thymectomized bone marrow chimaeras. Immunology. 1984 Sep;53(1):17-22.
137. Sirianni MC, Businco L, Seminara R, Aiuti F. Severe combined immunodeficiencies, primary T-cell defects and DiGeorge syndrome in humans: characterization by monoclonal antibodies and natural killer cell activity. Clin Immunol Immunopathol. 1983 Sep;28(3):361-70.
138. Hackett J, Jr., Tutt M, Lipscomb M, Bennett M, Koo G, Kumar V. Origin and differentiation of natural killer cells. II. Functional and morphologic studies of purified NK-1.1+ cells. J Immunol. 1986 Apr 15;136(8):3124-31.
139. Puzanov IJ, Bennett M, Kumar V. IL-15 can substitute for the marrow microenvironment in the differentiation of natural killer cells. J Immunol. 1996 Nov 15;157(10):4282-5.
140. Bennett M, Baker EE, Eastcott JW, Kumar V, Yonkosky D. Selective elimination of marrow precursors with the bone-seeking isotope 89Sr: implications for hemopoiesis, lymphopoiesis, viral leukemogenesis and infection. J Reticuloendothel Soc. 1976 Jul;20(1):71-87.
141. Bajenoff M, Breart B, Huang AY, Qi H, Cazareth J, Braud VM, et al. Natural killer cell behavior in lymph nodes revealed by static and real-time imaging. J Exp Med. 2006 Mar 20;203(3):619-31.
142. Martin-Fontecha A, Thomsen LL, Brett S, Gerard C, Lipp M, Lanzavecchia A, et al. Induced recruitment of NK cells to lymph nodes provides IFN-gamma for T(H)1 priming. Nat Immunol. 2004 Dec;5(12):1260-5.
143. Chen S, Kawashima H, Lowe JB, Lanier LL, Fukuda M. Suppression of tumor formation in lymph nodes by L-selectin-mediated natural killer cell recruitment. J Exp Med. 2005 Dec 13.
144. Terra R, Louis I, Le Blanc R, Ouellet S, Zuniga-Pflucker JC, Perreault C. T-cell generation by lymph node resident progenitor cells. Blood. 2005 Jul 1;106(1):193-200.
145. Fallon PG, Ballantyne SJ, Mangan NE, Barlow JL, Dasvarma A, Hewett DR, et al. Identification of an interleukin (IL)-25-dependent cell population that provides IL-4, IL-5, and IL-13 at the onset of helminth expulsion. J Exp Med. 2006 Apr 17;203(4):1105-16.
146. Cyster JG. Lymphoid organ development and cell migration. Immunol Rev. 2003 Oct;195:5-14.
- 124 - 147. Fu YX, Chaplin DD. Development and maturation of secondary lymphoid tissues. Annu Rev Immunol. 1999;17:399-433.
148. Browning JL, Androlewicz MJ, Ware CF. Lymphotoxin and an associated 33- kDa glycoprotein are expressed on the surface of an activated human T cell hybridoma. J Immunol. 1991 Aug 15;147(4):1230-7.
149. Browning JL, Dougas I, Ngam-ek A, Bourdon PR, Ehrenfels BN, Miatkowski K, et al. Characterization of surface lymphotoxin forms. Use of specific monoclonal antibodies and soluble receptors. J Immunol. 1995 Jan 1;154(1):33-46.
150. Browning JL, Ngam-ek A, Lawton P, DeMarinis J, Tizard R, Chow EP, et al. Lymphotoxin beta, a novel member of the TNF family that forms a heteromeric complex with lymphotoxin on the cell surface. Cell. 1993 Mar 26;72(6):847-56.
151. Crowe PD, VanArsdale TL, Walter BN, Ware CF, Hession C, Ehrenfels B, et al. A lymphotoxin-beta-specific receptor. Science. 1994 Apr 29;264(5159):707-10.
152. Ito D, Back TC, Shakhov AN, Wiltrout RH, Nedospasov SA. Mice with a targeted mutation in lymphotoxin-alpha exhibit enhanced tumor growth and metastasis: impaired NK cell development and recruitment. J Immunol. 1999 Sep 1;163(5):2809-15.
153. Smyth MJ, Johnstone RW, Cretney E, Haynes NM, Sedgwick JD, Korner H, et al. Multiple deficiencies underlie NK cell inactivity in lymphotoxin-alpha gene-targeted mice. J Immunol. 1999 Aug 1;163(3):1350-3.
154. Wu Q, Sun Y, Wang J, Lin X, Wang Y, Pegg LE, et al. Signal via lymphotoxin- beta R on bone marrow stromal cells is required for an early checkpoint of NK cell development. J Immunol. 2001 Feb 1;166(3):1684-9.
155. Lian RH, Chin RK, Nemeth HE, Libby SL, Fu YX, Kumar V. A role for lymphotoxin in the acquisition of Ly49 receptors during NK cell development. Eur J Immunol. 2004 Oct;34(10):2699-707.
156. Stevenaert F, Van Beneden K, De Colvenaer V, Franki AS, Debacker V, Boterberg T, et al. Ly49 and CD94/NKG2 receptor acquisition by NK cells does not require lymphotoxin-beta receptor expression. Blood. 2005 Aug 1;106(3):956-62.
157. Kabashima K, Banks TA, Ansel KM, Lu TT, Ware CF, Cyster JG. Intrinsic lymphotoxin-beta receptor requirement for homeostasis of lymphoid tissue dendritic cells. Immunity. 2005 Apr;22(4):439-50.
158. Wang YG, Kim KD, Wang J, Yu P, Fu YX. Stimulating lymphotoxin beta receptor on the dendritic cells is critical for their homeostasis and expansion. J Immunol. 2005 Nov 15;175(10):6997-7002.
- 125 - 159. Wu Q, Wang Y, Wang J, Hedgeman EO, Browning JL, Fu YX. The requirement of membrane lymphotoxin for the presence of dendritic cells in lymphoid tissues. J Exp Med. 1999 Sep 6;190(5):629-38.
160. Nishikawa S, Honda K, Vieira P, Yoshida H. Organogenesis of peripheral lymphoid organs. Immunol Rev. 2003 Oct;195:72-80.
161. Yoshida H, Kawamoto H, Santee SM, Hashi H, Honda K, Nishikawa S, et al. Expression of alpha(4)beta(7) integrin defines a distinct pathway of lymphoid progenitors committed to T cells, fetal intestinal lymphotoxin producer, NK, and dendritic cells. J Immunol. 2001 Sep 1;167(5):2511-21.
162. Fukuyama S, Hiroi T, Yokota Y, Rennert PD, Yanagita M, Kinoshita N, et al. Initiation of NALT organogenesis is independent of the IL-7R, LTbetaR, and NIK signaling pathways but requires the Id2 gene and CD3(-)CD4(+)CD45(+) cells. Immunity. 2002 Jul;17(1):31-40.
163. Anderson G, Jenkinson EJ. Lymphostromal interactions in thymic development and function. Nat Rev Immunol. 2001 Oct;1(1):31-40.
164. Hollander G, Gill J, Zuklys S, Iwanami N, Liu C, Takahama Y. Cellular and molecular events during early thymus development. Immunol Rev. 2006 Feb;209:28-46.
165. Klug DB, Carter C, Gimenez-Conti IB, Richie ER. Cutting edge: thymocyte- independent and thymocyte-dependent phases of epithelial patterning in the fetal thymus. J Immunol. 2002 Sep 15;169(6):2842-5.
166. Schluns KS, Nowak EC, Cabrera-Hernandez A, Puddington L, Lefrancois L, Aguila HL. Distinct cell types control lymphoid subset development by means of IL-15 and IL-15 receptor alpha expression. Proc Natl Acad Sci U S A. 2004 Apr 13;101(15):5616-21.
167. Sykes M, Harty MW, Karlhofer FM, Pearson DA, Szot G, Yokoyama W. Hematopoietic cells and radioresistant host elements influence natural killer cell differentiation. J Exp Med. 1993 Jul 1;178(1):223-9.
168. Ferlazzo G, Pack M, Thomas D, Paludan C, Schmid D, Strowig T, et al. Distinct roles of IL-12 and IL-15 in human natural killer cell activation by dendritic cells from secondary lymphoid organs. Proc Natl Acad Sci U S A. 2004 Nov 23;101(47):16606-11.
- 126 -