DOCSLIB.ORG

Role of Hox Genes in Stem Cell Differentiation

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Role of Hox Genes in Stem Cell Differentiation Submit a Manuscript: http://www.wjgnet.com/esps/ World J Stem Cells 2015 April 26; 7(3): 583-595 Help Desk: http://www.wjgnet.com/esps/helpdesk.aspx ISSN 1948-0210 (online) DOI: 10.4252/wjsc.v7.i3.583 © 2015 Baishideng Publishing Group Inc. All rights reserved. REVIEW Role of Hox genes in stem cell differentiation Anne Seifert, David F Werheid, Silvana M Knapp, Edda Tobiasch Anne Seifert, David F Werheid, Silvana M Knapp, Edda of any Hox gene expression, but these transcription Tobiasch, Department of Applied Sciences, Bonn-Rhine-Sieg factors are activated in varying spatial and temporal University of Applied Sciences, 53359 Rheinbach, Germany patterns defining the development of various body Author contributions: Seifert A, Werheid DF, Knapp SM and regions. In the adult body, Hox genes are among others Tobiasch E contributed to this paper. responsible for driving the differentiation of tissue Supported by BMBF, AdiPaD, 1720X06, BMBF, FHprofUnt, stem cells towards their respective lineages in order to FKZ: 03FH012PB2; FH-Extra, “Europäischer Fonds für repair and maintain the correct function of tissues and regionale Entwicklung”, “Europa-Investition in unsere Zukunft”, FKZ: z1112fh012; EFRE co-financed NRW Ziel 2: “Regionale organs. Due to their involvement in the embryonic and Wettbewerbsfähigkeit und Beschäftigung”, DAAD, PPP Vigoni, adult body, they have been suggested to be useable for FKZ: 314-vigoni-dr and FKZ: 54669218 for Edda Tobiasch. improving stem cell differentiations in vitro and in vivo . Conflict-of-interest: The authors certify that there is no conflict In many studies Hox genes have been found as driving of interest with any organization or entity with financial interests factors in stem cell differentiation towards adipogenesis, or non-financial interests, including commercial, personal, in lineages involved in bone and joint formation, mainly political, intellectual, or religious interests, regarding the material chondrogenesis and osteogenesis, in cardiovascular discussed in the manuscript. lineages including endothelial and smooth muscle cell Open-Access: This article is an open-access article which was differentiations, and in neurogenesis. As life expectancy selected by an in-house editor and fully peer-reviewed by external is rising, the demand for tissue reconstruction continues reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, to increase. Stem cells have become an increasingly which permits others to distribute, remix, adapt, build upon this popular choice for creating therapies in regenerative work non-commercially, and license their derivative works on medicine due to their self-renewal and differentiation different terms, provided the original work is properly cited and potential. Especially mesenchymal stem cells are used the use is non-commercial. See: http://creativecommons.org/ more and more frequently due to their easy handling licenses/by-nc/4.0/ and accessibility, combined with a low tumorgenicity Correspondence to: Edda Tobiasch, Professor, Department and little ethical concerns. This review therefore intends of Applied Sciences, Bonn-Rhine-Sieg University of Applied to summarize to date known correlations between Sciences, von-Liebig-Str. 20, 53359 Rheinbach, natural Hox gene expression patterns in body tissues Germany. [email protected] and during the differentiation of various stem cells Telephone: +49-2241-865576 towards their respective lineages with a major focus on Fax: +49-2241-8658576 Received: July 29, 2014 mesenchymal stem cell differentiations. This overview Peer-review started: July 29, 2014 shall help to understand the complex interactions of Hox First decision: October 16, 2014 genes and differentiation processes all over the body Revised: December 1, 2014 as well as in vitro for further improvement of stem cell Accepted: December 16, 2014 treatments in future regenerative medicine approaches. Article in press: December 17, 2014 Published online: April 26, 2015 Key words: Genes; Homeobox; Stem cells; Asymmetric cell division; Mesenchymal stromal cells; Growth; Development; Regeneration; Patterning; Cell lineage Abstract © The Author(s) 2015. Published by Baishideng Publishing Group Inc. All rights reserved. Hox genes are an evolutionary highly conserved gene family. They determine the anterior-posterior body axis in bilateral organisms and influence the developmental Core tip: Hox genes are involved in embryonic development fate of cells. Embryonic stem cells are usually devoid as well as in repair mechanisms in the adult body, thus WJSC|www.wjgnet.com 583 April 26, 2015|Volume 7|Issue 3| Seifert A et al . Hox genes in differentiations regulating cell fate. These genes have also been found to be character in certain niches, since it is also regulated on driving factors in various stem cell differentiations in vitro an epigenetic level[12]. and in vivo which makes them interesting tools for future This review will outline the Hox profile of various improvements in stem cell therapies. Therefore, this review stem cells, and discuss the wide range of findings outlines the involvement of Hox genes in various stem cell concerning Hox genes in stem cell differentiations differentiations with a major emphasis on mesenchymal gathered over the last decade. The nomenclature stem cell differentiations. used for Hox genes in this study is according to the current regulations, meaning that Hox genes related to findings in mice and rats are written with the first letter Seifert A, Werheid DF, Knapp SM, Tobiasch E. Role of Hox genes capitalized, whereas the following are in small capitals in stem cell differentiation. World J Stem Cells 2015; 7(3): 583-595 (e.g., Hoxc8). For findings in human and chicken, all Available from: URL: http://www.wjgnet.com/1948-0210/full/v7/ letters are capitalized (e.g., HOXC8). Understanding the i3/583.htm DOI: http://dx.doi.org/10.4252/wjsc.v7.i3.583 principle behind the role of Hox genes in differentiations and development may provide improved possibilities to alter stem cell fate in vitro and in vivo, and therefore might result in new or improved approaches in reg- INTRODUCTION enerative medicine. The life expectancy of the overall population has Therapeutic approaches are more and more based increased in most countries, accompanied by an increase on the use of mesenchymal stem cells (MSCs), due to in injuries, diseases, and age related degenerative their easy accessibility and handling compared to other diseases. Thus, reconstructions of hard and soft tissues kinds of stem cells. Hence, we put specific emphasis are an increasing challenge in regenerative medicine[1]. on the differentiation lineages of MSCs within this Stem cells could help to overcome these restrictions review. using their self-renewal and differentiation properties, with or without biomaterials or artificial scaffolds[1-3]. Numerous sources are known from which stem cells HOX TRANSCRIPTION FACTORS IN can be isolated, often with a varying differentiation STEM CELLS potential[4]. Additionally, the commitment might depend on the body site from which the stem cells were isolated[4,5]. Embryonic stem cells Embryonic stem cells (ESCs) can be gained from the In vivo, stem cell fate is determined according to tissues inner cell mass of the blastocyst and are therefore and thus extracellular but also intracellular factors, derived from an early stage embryo[13,14]. They are among them p53, purinergic receptors, collagens, parathyroid hormone-related proteins, or homeobox characterized by various markers, having the most (Hox) genes[6-9]. The later are the central players in significant surface markers SSEA-1, SSEA-3, SSEA-4 [15] determining regional specificity in the developing as well as TRA-1-60 and TRA-1-81 . Additionally embryo and not astonishingly also in numerous ESCs are positive for the transcription factors NANOG [16,17] differentiations[10]. and OCT3/4 . Their pluripotency, the potential to The Hox gene family consists of 39 members, differentiate into each cell lineage and all types of cells which are clustered in four paralogous groups and of the body, and the proliferation rate causes huge [18,19] are numbered from 1-13 within the groups. During interest in this stem cell type . An active repression embryogenesis, Hox genes show an expression pattern of Hox clusters has been demonstrated in various which is specific for each body region, commonly studies. On the other hand Hox genes are activated [20] referred to as the HOX code. They are an evolutionary when differentiation processes take place . However, highly conserved collection of genes binding to various it is not known which Hox code exactly commits these [20] DNA recognition sites and thus influencing a cell’s cells into the different lineages, yet . developmental fate in a huge variety of species, while determining the anterior-posterior body axis[11] (Figure Hematopoietic stem cells 1). The precise function of these genes is achieved by Hematopoietic stem cells (HSCs) are the best chara- their specific temporal and spatial activation over the cterized type of adult stem cells[21]. They can be obtained course of life. Due to this role in embryonic and adult from bone marrow, cytokine-mobilized peripheral blood, developmental stages, Hox genes are expected to also and cord blood[22]. HSCs are characterized with the have fundamental influences on the differentiation of antigen cell-surface markers CD34, C-KIT, TIE, and various stem cells in
Load more

Recommended publications
  • Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma
    Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Wong, Terence. 2018. Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma. Doctoral dissertation, Harvard University, Graduate School of Arts & Sciences. Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:42014990 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma A dissertation presented by Terence Cheng Wong to The Division of Medical Sciences in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the subject of Biological and Biomedical Sciences Harvard University Cambridge, Massachusetts November 2017 © 2017 Terence Cheng Wong All rights reserved. Dissertation Advisor: Levi Garraway Terence Cheng Wong Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma ABSTRACT Genomic characterization of human cancers over the past decade has generated comprehensive catalogues of genetic alterations in cancer genomes. Many of these genetic events result in molecular or cellular changes that drive cancer cell phenotypes. In melanoma, a majority of tumors harbor mutations in the BRAF gene, leading to activation of the MAPK pathway and tumor initiation. The development and use of drugs that target the mutant BRAF protein and the MAPK pathway have produced significant clinical benefit in melanoma patients.
    [Show full text]
  • Variable Clinical Expression in Patients with a Germline MEN1 Disease Gene Mutation: Clues to a Genotype–Phenotype Correlation
    CLINICS 2012;67(S1):49-56 DOI:10.6061/clinics/2012(Sup01)10 REVIEW Variable clinical expression in patients with a germline MEN1 disease gene mutation: clues to a genotype–phenotype correlation Cornelis J. Lips,I Koen M. Dreijerink,I Jo W. Ho¨ ppenerII I University Medical Center Utrecht, Department of Internal Medicine & Endocrinology, Utrecht, The Netherlands. II University Medical Center Utrecht, Department of Metabolic & Endocrine Diseases, Utrecht, The Netherlands. Multiple endocrine neoplasia type 1 is an inherited endocrine tumor syndrome, predominantly characterized by tumors of the parathyroid glands, gastroenteropancreatic tumors, pituitary adenomas, adrenal adenomas, and neuroendocrine tumors of the thymus, lungs or stomach. Multiple endocrine neoplasia type 1 is caused by germline mutations of the multiple endocrine neoplasia type 1 tumor suppressor gene. The initial germline mutation, loss of the wild-type allele, and modifying genetic and possibly epigenetic and environmental events eventually result in multiple endocrine neoplasia type 1 tumors. Our understanding of the function of the multiple endocrine neoplasia type 1 gene product, menin, has increased significantly over the years. However, to date, no clear genotype– phenotype correlation has been established. In this review we discuss reports on exceptional clinical presentations of multiple endocrine neoplasia type 1, which may provide more insight into the pathogenesis of this disorder and offer clues for a possible genotype–phenotype correlation. KEYWORDS: Multiple Endocrine Neoplasia type 1; MEN1; Menin; Genotype–Phenotype Correlation; Clinical Expression. Lips CJ, Dreijerink KM, Ho¨ ppener JW. Variable clinical expression in patients with a germline MEN1 disease gene mutation: clues to a genotype– phenotype correlation. Clinics. 2012;67(S1):49-56.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • An Evolutionary Conserved Region (ECR) in the Human Dopamine Receptor D4 Gene Supports Reporter Gene Expression in Primary Cultu
    Paredes et al. BMC Neuroscience 2011, 12:46 http://www.biomedcentral.com/1471-2202/12/46 RESEARCHARTICLE Open Access An evolutionary conserved region (ECR) in the human dopamine receptor D4 gene supports reporter gene expression in primary cultures derived from the rat cortex Ursula M Paredes1,2, Vivien J Bubb1, Kate Haddley1, Gabriele A Macho1,3 and John P Quinn1* Abstract Background: Detecting functional variants contributing to diversity of behaviour is crucial for dissecting genetics of complex behaviours. At a molecular level, characterisation of variation in exons has been studied as they are easily identified in the current genome annotation although the functional consequences are less well understood; however, it has been difficult to prioritise regions of non-coding DNA in which genetic variation could also have significant functional consequences. Comparison of multiple vertebrate genomes has allowed the identification of non-coding evolutionary conserved regions (ECRs), in which the degree of conservation can be comparable with exonic regions suggesting functional significance. Results: We identified ECRs at the dopamine receptor D4 gene locus, an important gene for human behaviours. The most conserved non-coding ECR (D4ECR1) supported high reporter gene expression in primary cultures derived from neonate rat frontal cortex. Computer aided analysis of the sequence of the D4ECR1 indicated the potential transcription factors that could modulate its function. D4ECR1 contained multiple consensus sequences for binding the transcription factor Sp1, a factor previously implicated in DRD4 expression. Co-transfection experiments demonstrated that overexpression of Sp1 significantly decreased the activity of the D4ECR1 in vitro. Conclusion: Bioinformatic analysis complemented by functional analysis of the DRD4 gene locus has identified a) a strong enhancer that functions in neurons and b) a transcription factor that may modulate the function of that enhancer.
    [Show full text]
  • Olig1 and Sox10 Interact Synergistically to Drivemyelin Basic
    The Journal of Neuroscience, December 26, 2007 • 27(52):14375–14382 • 14375 Cellular/Molecular Olig1 and Sox10 Interact Synergistically to Drive Myelin Basic Protein Transcription in Oligodendrocytes Huiliang Li,1 Yan Lu,2 Hazel K. Smith,1 and William D. Richardson1 1Wolfson Institute for Biomedical Research and Department of Biology, University College London, London WC1E 6BT, United Kingdom, and 2Medical Research Council, Clinical Sciences Centre, Imperial College London, London W12 0NN, United Kingdom The oligodendrocyte lineage genes (Olig1/2), encoding basic helix-loop-helix transcription factors, were first identified in screens for master regulators of oligodendrocyte development. OLIG1 is important for differentiation of oligodendrocyte precursors into myelin- forming oligodendrocytes during development and is thought to play a crucial role in remyelination during multiple sclerosis. However, itisstillunclearhowOLIG1interactswithitstranscriptionalcofactorsandDNAtargets.OLIG1wasreportedlyrestrictedtomammals,but we demonstrate here that zebrafish and other teleosts also possess an OLIG1 homolog. In zebrafish, as in mammals, Olig1 is expressed in the oligodendrocyte lineage. Olig1 associates physically with another myelin-associated transcription factor, Sox10, and the Olig1/Sox10 complex activates mbp (myelin basic protein) transcription via conserved DNA sequence motifs in the mbp promoter region. In contrast, Olig2 does not bind to Sox10 in zebrafish, although both OLIG1 and OLIG2 bind SOX10 in mouse. Key words: Olig1; Olig2; Sox10; Mbp; oligodendrocyte; myelin; zebrafish; mouse; evolution; development Introduction directly regulates Mbp transcription (Stolt et al., 2002), and over- Myelin, the multilayered glial sheath around axons, is one of the expression of SOX10 alone is sufficient to induce myelin gene defining features of jawed vertebrates (gnathostomes). It is expression in embryonic chick spinal cord (Liu et al., 2007).
    [Show full text]
  • The BTB-ZF Family of Transcription Factors: Key Regulators of Lineage
    The BTB-ZF Family of Transcription Factors: Key Regulators of Lineage Commitment and Effector Function Development in the Immune System This information is current as of September 27, 2021. Aimee M. Beaulieu and Derek B. Sant'Angelo J Immunol 2011; 187:2841-2847; ; doi: 10.4049/jimmunol.1004006 http://www.jimmunol.org/content/187/6/2841 Downloaded from References This article cites 103 articles, 44 of which you can access for free at: http://www.jimmunol.org/content/187/6/2841.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 27, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2011 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The BTB-ZF Family of Transcription Factors: Key Regulators of Lineage Commitment and Effector Function Development in the Immune System Aimee M. Beaulieu* and Derek B. Sant’Angelo*,†,‡ Successful immunity depends upon the activity of mul- 1, -2, -4, -5, and -7 (1–11).
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Birth Defects Caused by Mutations in Human GLI3 and Mouse Gli3 Genescga
    doi:10.1111/j.1741-4520.2009.00266.x Congenital Anomalies 2010; 50, 1–7 1 REVIEW ARTICLE Birth defects caused by mutations in human GLI3 and mouse Gli3 genescga_ 266 1..71..7 Ichiro Naruse1, Etsuko Ueta1, Yoshiki Sumino1, Masaya Ogawa1, and Satoshi Ishikiriyama2 1School of Health Science, Faculty of Medicine, Tottori University, Yonago, and 2Division of Clinical Genetics and Cytogenetics, Shizuoka Children’s Hospital, Shizuoka, Japan ABSTRACT GLI3 is the gene responsible for Greig cepha- type-A (PAP-A) and preaxial polydactyly type-IV (PPD-IV). A lopolysyndactyly syndrome (GCPS), Pallister–Hall syndrome mimic phenomenon is observed in mice. Investigation of human (PHS) and Postaxial polydactyly type-A (PAP-A). Genetic poly- GLI3 and Gli3 genes has progressed using the knowledge of dactyly mice such as Pdn/Pdn (Polydactyly Nagoya), XtH/XtH Cubitus interruptus (Ci) in Drosophila, a homologous gene of GLI3 (Extra toes) and XtJ/XtJ (Extra toes Jackson) are the mouse and Gli3 genes. These genes have been highly conserved in the homolog of GCPS, and Gli3tmlUrtt/Gli3tmlUrt is produced as the animal kingdom throughout evolution. Now, a lot of mutant mice of mouse homolog of PHS. In the present review, relationships Gli3 gene have been known and knockout mice have been pro- between mutation points of GLI3 and Gli3, and resulting phe- duced. It is expected that the knowledge obtained from mutant and notypes in humans and mice are described. It has been con- knockout mice will be extrapolated to the manifestation mecha- firmed that mutation in the upstream or within the zinc finger nisms in human diseases to understand the diseases caused by the domain of the GLI3 gene induces GCPS; that in the post-zinc mutations in GLI3 gene.
    [Show full text]
  • Identifying Isl1 Genetic Lineage in the Developing Olfactory System and in Gnrh-1 Neurons 2 3 Ed Zandro M
    bioRxiv preprint doi: https://doi.org/10.1101/2020.08.31.276360; this version posted August 31, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Identifying Isl1 genetic lineage in the developing olfactory system and in GnRH-1 neurons 2 3 Ed Zandro M. Taroc1, Raghu Ram Katreddi1 and Paolo E. Forni1*. 4 5 1Department of Biological Sciences; The RNA Institute, and the Center for Neuroscience 6 Research; University at Albany, State University of New York, Albany, NY 12222, USA. 7 8 * Corresponding Author 9 [email protected] 10 11 12 Keywords: Olfactory neurons, vomeronasal sensory neurons, GnRH neurons, Islet-1/Isl1, Isl1 13 Conditional knock-out; genetic lineage tracing, olfactory placode, neural crest. 14 15 Abstract (299, at 245 after editing) 16 During embryonic development, symmetric ectodermal thickenings (olfactory placodes) give rise 17 to several cell types that comprise the olfactory system, such as those that form the terminal nerve 18 ganglion (TN), gonadotropin releasing hormone-1 (GnRH-1) neurons and other migratory 19 neurons in rodents. Even though the genetic heterogeneity among these cell types are 20 documented, unidentified cell populations arising from the olfactory placode remain. One 21 candidate to identify placodal derived neurons in the developing nasal area is the transcription 22 factor Isl1, which was recently identified in GnRH-3 neurons of the terminal nerve in fish, as well 23 as expression in neurons of the nasal migratory mass. Here, we analyzed the Isl1 genetic lineage 24 in chemosensory neuronal populations in the nasal area and migratory GnRH-1 neurons in mice 25 using in-situ hybridization, immunolabeling a Tamoxifen inducible Isl1CreERT and a constitutive 26 Isl1Cre knock-in mouse lines.
    [Show full text]
  • Ablation of Ezh2 in Neural Crest Cells Leads to Hirschsprung's Disease-Like Phenotype in Mice
    bioRxiv preprint doi: https://doi.org/10.1101/265868; this version posted February 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Ablation of Ezh2 in neural crest cells leads to Hirschsprung’s disease-like phenotype in mice Hana Kim, Ingeborg M. Langohr, Mohammad Faisal, Margaret McNulty, Caitlin Thorn, Joomyeong Kim* Department of Biological Sciences, Louisiana State University, Baton Rouge, LA 70803, USA. Correspondence should be forwarded to: [email protected], 225-578-7692(ph), or 225-578-2597(fax) Running title: Function of Ezh2 in enteric neural crest cell development 1 bioRxiv preprint doi: https://doi.org/10.1101/265868; this version posted February 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract In the current study, we examined the role of Ezh2 as an epigenetic modifier for the enteric neural crest cell development through H3K27me3. Ezh2 conditional null mice were viable up to birth, but died within the first hour of life. In addition to craniofacial defects, Ezh2 conditional null mice displayed reduced number of ganglion cells in the enteric nervous system. RT-PCR and ChIP assays indicated aberrant up-regulation of Zic1, Pax3, and Sox10 and loss of H3K27me3 marks in the promoter regions of these genes in the myenteric plexus. Overall, these results suggest that Ezh2 is an important epigenetic modifier for the enteric neural crest cell development through repression of Zic1, Pax3, and Sox10.
    [Show full text]
  • To Proliferate Or to Die: Role of Id3 in Cell Cycle Progression and Survival of Neural Crest Progenitors
    Downloaded from genesdev.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press To proliferate or to die: role of Id3 in cell cycle progression and survival of neural crest progenitors Yun Kee and Marianne Bronner-Fraser1 Division of Biology, California Institute of Technology, Pasadena, California 91125, USA The neural crest is a unique population of mitotically active, multipotent progenitors that arise at the vertebrate neural plate border. Here, we show that the helix–loop–helix transcriptional regulator Id3 has a novel role in cell cycle progression and survival of neural crest progenitors in Xenopus. Id3 is localized at the neural plate border during gastrulation and neurulation, overlapping the domain of neural crest induction. Morpholino oligonucleotide-mediated depletion of Id3 results in the absence of neural crest precursors and a resultant loss of neural crest derivatives. This appears to be mediated by cell cycle inhibition followed by cell death of the neural crest progenitor pool, rather than a cell fate switch. Conversely, overexpression of Id3 increases cell proliferation and results in expansion of the neural crest domain. Our data suggest that Id3 functions by a novel mechanism, independent of cell fate determination, to mediate the decision of neural crest precursors to proliferate or die. [Keywords: Xenopus; Id3; neural crest; cell cycle; survival] Received September 1, 2004; revised version accepted January 19, 2005. The neural crest is an embryonic cell population that origi- et al. 2003), c-Myc (Bellmeyer et al. 2003), and Msx1 nates from the lateral edges of the neural plate during (Tribulo et al. 2003) have been identified in Xenopus nervous system formation.
    [Show full text]