Characterization of the Entomopathogenic Bacterium Photorhadus Luminescens Sonorensis, and Bioactivity of Its Secondary Metabolites

Characterization of the Entomopathogenic Bacterium Photorhadus Luminescens Sonorensis, and Bioactivity of its Secondary Metabolites

Item Type text; Electronic Thesis

Authors Orozco, Rousel Antonio

Publisher The University of Arizona.

Rights Copyright © is held by the author. Digital access to this material is made possible by the University Libraries, University of Arizona. Further transmission, reproduction or presentation (such as public display or performance) of protected items is prohibited except with permission of the author.

Download date 25/09/2021 03:57:11

Link to Item http://hdl.handle.net/10150/228614 1

CHARACTERIZATION OF THE ENTOMOPATHOGENIC BACTERIUM

PHOTORHADUS LUMINESCENS SONORENSIS, AND BIOACTIVITY OF ITS

SECONDARY METABOLITES.

Rousel Antonio Orozco

______

A Thesis Submitted to the Faculty of the

DEPARTMENT OF ENTOMOLOGY

In Partial Fulfillment of the Requirements

For the Degree of

MASTER OF SCIENCE

In the Graduate College

THE UNIVERSITY OF ARIZONA

2012

STATEMENT BY AUTHOR

This thesis has been submitted in partial fulfillment of requirements for an advanced degree at the University of Arizona and is deposited in the University Library to be made available to borrowers under rules of the Library.

Brief quotations from this thesis are allowable without special permission, provided that accurate acknowledgment of source is made. Requests for permission for extended quotation from or reproduction of this manuscript in whole or in part may be granted by the copyright holder.

SIGNED: Rousel. A. Orozco.

APPROVAL BY THESIS DIRECTOR

______

S. Patricia Stock, PhD. Professor of Entomology

Date ____May 1st 2012______

ACKNOWLEDGEMENTS

I want to begin by expressing my infinity gratitude to my mentor, Dr. S. Patricia Stock, whose guidance, support and advice has been invaluable in my journey. Also, I am very grateful to Dr. Itsvan Molnar for his technical advice and for all his encouragement. Thanks also to Dr.

Xianchun Li for the insightful discussions, and for your support.

I would like to thank my lab mates for all the laughs and candid conversations, especially to Patricia Navarro and John McMullen. I am also thankful to Ming-Min Lee for sharing her knowledge with me, and for her advice conducting phylogenetic analyses. Thank you Jesse,

Lindsay, Tan and Tara for sharing successes and frustrations bringing this project to reality.

I also want to acknowledge Rhodesia Celoy-Mateo for her technical assistance with the

HPLC analysis. I am also grateful to Dr. Helge Bode for conducting the mass spectrometry analysis. A thousand thanks for all your help to Mark, Daniel, Joe, Gilberto in the School of

Plant Sciences.

Endless love to my family: Rigo, Gloria, Adrian, and of course Dustin.

TABLE OF CONTENTS

LIST OF FIGURES...... 6

LIST OF TABLES...... 8

ABSTRACT ……………………………………………………………………………………... 9

INTRODUCTION ………………………………………..……………………………………. 10

CHAPTER I: CHARACTERIZATION, AND PHYLOGENETIC RELATIONSHIPS OF

PHOTORHABDUS LUMINESCENS SUBP. SONORENSIS (-PROTEOBACTERIA:

ENTEROBACTERIACEAE) THE BACTERIAL SYMBIONT OF THE

ENTOMPATHOGENIC NEMATODE HETEROROHABDISTIS SONORENSIS…………...... 24

Introduction ………………………………………………………………..………...... 24

Materials and methods ……………………………………...... ….………………... 25

Results ...... 29

Description of Photorhabdus luminescens subsp. sonorensis subsp. …...... 33

CHAPTER II: BIOPROSPECTING OF SECONDARY METABOLITES PRODUCED BY

THE ENTOMOPATHOGENIC BACTERIUM PHOTORHABDUS LUMINESCENS SUBSP.

SONORENSIS (GAMMA-PROTEOBACTERIA, ENTEROBACTERIACEAE) ……………...54

Introduction...... 54

Materials and Methods...... 57

Results …………………...... 60

Chemical characterization of NP extracts………………………………………. 61

Insecticidal activity ……………………………………..……………………… 61

Nematicidal, antimycotic, and antibiotic activity………………………………. 62

Discussion………………………………………………………………………………. 63

CONCLUSIONS ……………………………………………………………………...... 76

REFERENCES……………………………………………………………………………...... 81

LIST OF FIGURES

INTRODUCTION

Figure 1. Heterorhabditis-Photorhabdus life cycle ………………………………………….. 19

Figure 2. Families of secondary metabolites produced by Photorhabdus. sp. .……………… 20

CHAPTER I.

Figure 1. Phase variation on NBTA selective media ………………………………………….. 34

Figure 2. Colony morphology on different agar media ...……………………………………… 35

Figure 3. Best maximum parsimony tree, 16s rDNA ..………………………………………… 36

Figure 4 .Best maximum parsimony tree, dnaN ……....……………………………………..... 37

Figure 5. Best maximum parsimony tree, gtlX …....……………………………………...... 38

Figure 6. Best maximum parsimony trees, gyrB…..…………………………………………… 39

Figure 7. Best maximum parsimony trees, RecA ...... …………………………………………..40

Figure 8. MP analysis of concatenated matrix …………………………………………………. 41

Figure 9. Bayessian analysis of concatenated matrix .…………………………………………. 42

LIST OF FIGURES – Continued

CHAPTER II

Figure1. HPLC-UV spectra for crude extract of each bacteria train ………………………….. 67

Figure.2. Mass spectra of stilbene ……………………………………………………………. 68

Figure.3. Insecticidal activity of crude extracts……………………………………………….. 69

Figure.4. Nematicidal effect on M. incognita ………………………………………………... 70

Figure.5. Antibacterial activity on P. syringae...... 71

Figure.6. Antimycotic effect on F. oxysporum……………………………………..………………. 72

Figure. 7. Effect of crude extracts on F. oxysporum …………………….....…………………... 73

LIST OF TABLES

INTRODUCTION

Table 1. Current species of the genus Heterorhabditis ………………………………………… 21

Table. 2. Photorhabdus species and subspecies described up to date …………………………. 22

CHAPTER I

Table 1. Primers considered in this study ……………………………………………………... 43

Table 2. Photorhabdus species and isolates considered in this study ……………………….... 44

Table 3. BIOLOG GN2 assays ………………………………………………………………… 51

Table 4. API20 NE assays …...………………………………………………………………... 53

CHAPTER II

Table 1. Rf values ..…………………………………………………………………………….. 74

Table 2. Mass of compounds detected by MS analysis ………………………………………... 75

ABSTRACT

Photorhabdus are motile Gram-negative bacteria that have a mutualistic association with entomopathogenic Heterorhabditis nematodes. Nematodes vector the bacteria from one insect host to another, while the bacterial symbiont produces toxins and secondary metabolites that kill that the insect host. In this study, we characterize the bacterial symbiont of Heterorhabditis sonorensis, recently discovered in the Sonoran desert. Biochemical and molecular methods including sequence data from five genes: 16s rDNA, gyrB, recA, gltX, dnaN were considered.

Evolutionary relationships of this new Photorhabdus subsp. were inferred considering maximum parsimony and Bayesian analyses. We also surveyed for secondary metabolites (SM) produced by this microorganism, considering HPLC and mass spectrometry analyses. SM crude extracts showed activity against the corn ear worm Helicoverpa zea, the root-knot nematode

(Meloidogyne incognita), the bacterium Pseudomonas syringae, and the fungus Fusarium oxysporum; and were more toxic that those produced by related species. Results from these studies showed that Photorhabdus l. sonorensis’ secondary metabolites have potent antagonistic activity against these plant pathogens.

INTRODUCTION

Nematodes are pseudocoleomate roundworms in the phylum Nematoda. They have a worldwide distribution and have colonized a variety of niches in this planet ranging from aquatic to terrestrial ecosystems. Many groups are free-living, however, others are parasites of plants and animal, and are relevant to human and veterinary medicine, agriculture and forestry

(Barker, 1994, Kaplan 2004, Morales-Hojas, 2009. It has been estimated that more than 25,000 species of nematodes have been described. However, estimates of their diversity range between

50,000 to one million species (Lambshead, 2003).

Among invertebrate parasites, there are 30 nematode families that are associated with insects and other invertebrates (Stock and Hunt, 2005). Seven of these have the potential for being considered as biological control agents. Nematode- insects associations are very primitive and date from prehistoric times. The oldest fossil record dates from the Silurian period, almost

400 million years ago for a mermithid nematode associated to insects (Engel, 2004).

Nematode-insect associations occur in many contexts; and can be traced to back to 40 million years ago, as evidenced by fossils found in Baltic amber (Nickle, 1972). Many species of nematodes have a phoretic relationship with insects which carry them on their body from one location to another. This relationship is innocuous to the insect, but advantageous for the nematodes. For example, Bursaphelenchus cocophilus (Aphelenchida: Parasitapheleichidae) and

Monochamus beetles (Coleoptera: Cerambycidae) are involved in a commensal association

(Giblin-Davis., 2003). Insect parasitic behavior ranges from simple changes in the physiology of the host to its complete death. For instance, the dog heart worm Dirofilaria immitis (Spirurida:

Onchocercidae) uses the the mosquito Anopheles quadrimacualtus as an intermediate host. The nematode causes serious effects on the functioning of the insect’s Malpighian tubes (Weiner and

Bradley, 1970). Mermithids are another example of endoparasiteic lifestyle. They parasitize a wide range of arthropods in aquatic and terrestrial habitats (Nickle, 1972). Dufour (1837) described the species Sphaerularia bombi (Tylenchida, Sphaerulariidae) as an obligate parasite of bumble bees.

Among insect parasites, two nematode families, Heterorhabditidae Poinar, 1975 and

Steinernematidae Travassos, 1927 have been intensively studied. Because of their fast killing- action, these nematodes are commonly called “entomopathogenic nematodes” or “EPN”. Their pathogenic action is due to their bacterial symbionts, which reside in the intestine of the nematode.

EPN are widely distributed, both geographically and temporally. They exist in many habitats, and have a wide range of tolerance to abiotic parameters such as temperature and soil moisture (Grewal et al., 1994; Hominick, 2002). Moreover, EPN have been successfully commercialized and have been used in biocontrol for several decades. Some positive attributes these nematodes have are that they are compatible with several chemical pesticides, and have few effects on non-target organisms (Georgis et al., 1991). Due to their long-term sustainable effects, EPN are an environmentally friendly strategy for insect pest control. At present, several formulations exist and are available for use in greenhouse or field applications (Ehlers 2001). For example, the nematode, Heterorhabditis bacteriophora is currently successfully commercialized as Nemaseek™ for control of stationary pests such as citrus weevils, Japanese beetles, black vine weevils, ticks, and among other pests.

EPN and their bacterial symbionts represent an emerging model of terrestrial animal- microbe symbiotic relationships. Indeed, these organisms are now considered a tractable model

12 system that is amenable to study physiological, chemical, structural and developmental aspects of beneficial symbiotic associations and are a source for pharmaceutical bioprospecting (Burnell and Stock, 2000, Goodrich-Blair and Clarke, 2007, Stock and Goodrich-Blair, 2008). Moreover, post-genomic techniques and the ability to genetically manipulate the bacterium, the nematode, and the insect host, provide an unparalleled model system for understanding animal-bacteria interactions (Waterfield et al 2009).

The focus of this research is on nematodes of the family Heterorhabditidae. Specifically, on an Arizona-native species, Heterorhabditis sonorensis (Stock et al., 2009) and its bacterial

`symbiont. Below, is a brief summary on the natural history, biology and ecology of

Heterorhabditis nematodes and their bacterial symbionts.

Evolutionary Origin and Taxonomic Position

Heterorhabditis nematodes

According to Poinar (1983, 1993) members of the family Heterorhabditidae originated during the mid-Palaeozoic era about 375 million years ago. Based on similarities of the buccal capsule and male tail morphology, Poinar suggested that Heterorhabditis evolved from a

‘Pellioditis-like’ ancestor in a sandy, marine environment. Phylogenetic studies of the 18S ribosomal DNA by Blaxter, (1998) supported Poinar’s ideas about the origins of

Heterorhabditis.

The family Heterorhabditidae was erected by Poinar (1975) and currently comprises one genus, Heterorhabditis Poinar, 1975 with more than 16 species currently described. The type species of this genus is H. bacteriophora, which was isolated from a noctuid moth larva

(Heliothis punctigera) in Brecon, South Australia (Poinar, 1976).

Photorhabdus Symbionts

Photorhabdus are Eubacteria in the subclass γ-Proteobacteria, and within the family

Enterobacteriaceae. This family encompasses a wide spectrum of animal and human pathogens

(Boemare and Arkhurst, 2006). Photorhabdus was first isolated from the intestinal lumen of the

nematode H. bacteriophora by Poinar and Thomas (1965). This bacterium was originally

identified as a new species and was assigned to the genus Achromobacter, with the species

Achromobacter nematophilus.

More than a decade later, this bacterium was switched to the genus: Xenorhabdus

(Poinar, 1979). Because of its bioluminescent properties, this bacterium was renamed as

Xenorhabdus luminescens. More recently, based on molecular and DNA-DNA hybridization

methods, Xenorhabdus luminescens was transferred to the genus Photorhabdus and the species

synonymized as Photorhabdus luminescens (Boemare et al., 1993). At present three

Photorhabdus species: Photorhabdus luminescens, Boemare 1993; Photorhabdus temperata, and

Photorhabdus asymbiotica, have been described (Fischer-Le Saux, et al 1999). Each of them has

multiple subspecies which are all associated with Heterorhabditis nematodes (Tables 1, Table 2).

Heterorhabditis-Photorhabdus Life Cycle

Heterorhabditis nematodes owe their pathogenic effects to their bacterial symbionts,

Photorhabdus spp. with which they have a mutualistic relationship. The nematode’s only free-

living stage, the third-stage infective juvenile (J3 or IJ) vectors the bacteria from one insect host

to another. In return, the bacteria degrade insect tissues and provide appropriate conditions for

14 nematode growth and multiplication. In searching for a suitable host, Heterorhabditis nematodes exhibit a “cruising behavior”. IJs are attracted and respond to insect host cues, such as CO2.

They can move up and down the soil, with a range of about 10cm depth, but they also can actively move horizontally. The IJs gain access to the insect host by penetrating through natural openings (spiracles, mouth, and anus). Additionally Heterorhabditis nematodes have a cuticular tooth that helps them penetrate the insect’s integument (Bedding and Molyneux., 1982).

Once in the hemocoel, IJs undergo recovery by stripping of the protective second cuticle and regurgitating the bacterial symbionts. Photorhabdus bacteria produce then an array of toxins and hydrolytic enzymes that kill the insect by septicemia within 48-72hrs (Daborn et al, 2001).

The insect tissues are then degraded and provide an ideal environment for nematode growth and reproduction. The IJs feed, develop to adults and reproduce (Figure 1). In Heterorhabditis, the

IJs first mature to adult hermaphrodites (i.e., a female that has a sperm-filled spermatheca), which self-fertilizes producing progeny that will later become the second adult generation. The second adult generation is amphimictic (i.e. males and females are present). A phenomenon commonly observed in older hermaphrodites and females is the hatching of eggs inside their uterus, and all maternal organs explode with the presences of an event named “endotokia matricida”. It has been suggested that through this process juveniles hatching inside the other acquire their bacterial symbionts (i.e. horizontal transmission) (Ciche et al. 2008)

Both the bacteria and nematodes must evade the insect immune system. Eleftherianos et al. (2009) suggested that pattern recognition receptors in the insect’s innate immune system may elicit humoral and cellular immune responses upon nematode invasion. The invading nematode- bacteria system elicits phenoloxidase activity and hemocyte aggregation, but nematodes and bacteria contribute separately to the pathogenic modulation of the host immune responses during

15 natural infections (Eleftherianos et al., 2009). Although aposymbiotic (i.e. symbiont free) nematodes have been shown to escape encapsulation, it is the bacterial symbiont that evades the initial response of melanization by inhibition of the phenol oxidase enzyme activity on phenolic compounds and blocks the genesis of quinones, resulting in inhibition of melanization.

Recently a major step characterized in insect immune response evasion, is the activity of the “make caterpillars floopy” (Mcf1) toxin and its effect of paralyzing of hemocytes and the halting of their phagocytic capability, this seems to occur due to disrupted actin dynamics.

(Vlisidou et al 2012). Other toxins that contribute towards insect lethality are the ones produced by the toxin complexes (Tcs), Photorhabdus insect related (Pir) proteins, and Photorhabdus virulence cassettes (PVCs). Several of the toxins produced by the bacterial symbiont protect the cadaver microenvironment due to their antimicrobial, antihelmintic and insecticidal activities.

Photorhabdus secondary metabolites have parallel function acting to protect the insect cadaver form competitors. Secondary metabolite production in vivo peaks on the 8th day post infection, efficiently eliminating saprophytic competitors (Hu et al., 1999, Brachman et al., 2009).

It usually takes 15 – 21 days for heterorhabditid progeny to emerge from their host cadaver (Figure 1). It has been proposed that nutrient depletion and increased ammonia levels within the cadaver trigger emergence of infective juvenile nematodes (J3) into the environment

(San-Blass et al, 2008). Emerging IJ’s and their bacterial load will remain in the soil (without feeding), moving through a water film (Ishibashi and Kondo, 1990) searching or waiting for a suitable host to parasitize.

Photorhabdus toxins and secondary metabolites

Photorhabdus bacteria represent and underexploited source of novel chemical structures

(Bode 2009). Over the past two decades, attention has focused on the toxins and small molecules produced by Photorhabdus. The driving motivation for this research is their potential applications for agriculture and pest management, as well for pharmaceutical bioprospecting.

Bacterial natural products are important components in crop protection (Dayan et al, 2009).

Several Photorhabdus protein products and their genes have been proposed as an alternative to

Bt for transgenic crops, yet their application has not been pursued.

The recent sequencing of all three species of Photorhabdus TT01 genome has provided a valuable source that predicts the existence of 23 biosynthetic clusters encoding for enzymes involved in secondary metabolite synthesis (Bode, 2009). More than fifteen compound classes have been isolated from Photorhabdus in the last three decades denoting a high structural biodiversity and specificity among these compounds (Brachman et al., 2008).

As mentioned before, a critical challenge for Heterorhabditis-Photorhabdus symbiosis is the maintenance of a monoaxenic infection in an insect cadaver in the presence of other soil organisms such as competing nematodes, protozoans and other microorganisms. In this respect, it is known that Photorhabdus produces a range of antimicrobial factors such as stilbenes (ST), which have broad-spectrum antibiotic (antibacterial) and strong antifungal properties.

Photorhabdus sp. also produce Carbapenem, a class of β-lactam antibiotic that has been reported to have activity against a many Gram-negative bacteria (Coulhoroust et al 2005). Furthermore, the purified ST and another compound, indole produced by P. luminescens have strong, wide- spectrum of nematicidal effects.

Compounds such as stilbenes, which are conjugated alkenes and are typically y produced in the plant kingdom, have been found in all Photorhabdus species. Until now, this bacterium is

17 the only non-plant organism that produces this family of compounds (Crawford and Clardy,

2011). There are three types usually isolated, 2-isopropyl-5-[(E)-2-phenylethenyl] benzene-1,3- diol (IPS), and 2-ethyl-5-[(E)-2-phenylethenyl]benzene-1,3-diol (ES), 2-isopropyl-5-(3-phenyl- oxiranyl)benzene-1,3-diol (eIPS). These compounds have activity against many bacteria, including Staphylococcus aureus (Hu et al., 2006). Stilbenes are currently commercialized to treat psoriasis in Canada, and are synthesized for medical purposes in China. Webster et al

(2002) found that hydroxystilbenes produced by Photorhabdus also have antibiotic activity and exhibit nematicidal activity.

Another type of molecule present in Photorhabdus are polyaromatic anthraquinones.

These molecules are a product of a type II polyketide synthase (PKS), with weak antibacterial activity, but have been reported to be bird and ant deterrents. Another compound, a catecholate siderophore (photobactin) has been found to contribute to antibiosis in the insect cadaver (Ciche at al., 2003). Also, certain peptides encoded in the Photorhabdus genome are predicted to have cytotoxic effect against human cells (Waterfield et al, 2007).

In this study, we characterized a novel Photorhabdus symbiont. This bacterium is the natural symbiont of Heterorhabditis sonorensis (Stock et al., 2009), a nematode that is endemic to Southwestern USA (Arizona) and NW of Mexico (Sonora). The nematode is adapted to drought and hot climate conditions, and has the potential to control a number of insect pests that prevail in the southwest (Stock pers. comm.). Specific objectives in this project were:

1. Identify and characterize the bacterial symbiont of the nematode Heterorhabditis

sonorensis considering classical microbiology and molecular methods (Chapter 1).

a. Phenotypic characterization and resistotyping of novel bacterium

b. Molecular characterization considering a multigene approach

c. Assess evolutionary origins of novel bacterium in relation with other

Photorhabdus spp.

2. Isolate and assess the bioactivity of crude extracts of this bacterial symbiont against a

selection of plan pests and pathogens (Chapter 2).

a. Chemical characterization of NP extracts

b. Evaluate insecticidal and nematicidal activities of crude bacterial extracts

c. Evaluate antibacterial and antimycotic properties of bacterial extracts.

Figure 1.

Heterorhabditis-Photorhabdus life cycle (From Stock and Goodrich Blair, 2008)

Figure 2. Families of secondary metabolites produced by Photorhabdus. spp.

A. Carbapenem B. Anthraquinones C. Stilbene

D. Siderophores

References:. A-C from Kontnik et al., 2010; D. from Ciche et al., 2003. E. from

Brachman et al., 2011.

Table 1. Current species of the genus Heterorhabditis.

SPECIES NAME AUTHOR

H. argentinensis Stock, 1993

H. bacteriophora Poinar, 1975

H. indica Poinar, Karunakar and David, 1992

H. marelatus Liu and Berry, 1996

H. megidis Poinar, Jackson and Klein, 1987

H. zealandica Poinar, 1990

H. amazonensis Andaló, Nguyen and Alcides, 2006

H. gerrardi Plichta, Joyce, Clarke, Waterfield and Stock, 2009

H. sonorensis Stock, Rivera-Orduno and Flores-Lara, 2008

H. georgiana Nguyen, Shapiro-Ilan, and Mbata, 2008

H. safricana Malan, Nguyen, de Waal, and Tiedt, 2008

H. mexicana Nguyen , Shapiro-Ilan, Stuart, McCoy , James &

Adams, 2004

H. baujardi Phan, Subbotin, Nguyen & Moens, 2003

Table. 2. Photorhabdus species and subspecies described up to date.

Photorhabdus luminescens.

Boemare, Akhurst & Mourant, 1993

P. luminescens luminescens Fischer-Le Saux, Viallard, Brunel, Normand

& Boemare, 1999

P. luminescens akhurstii Fischer-Le Saux, Viallard, Brunel, Normand

& Boemare, 1999

P. luminescens laumondii Fischer-Le Saux, Viallard, Brunel, Normand

& Boemare, 1999

P. luminescens kayaii Hazir et al., 2004

P. luminescens caribbeansis Tailliez et al., 2010

P. luminescens hainenesis Tailliez et al., 2010

P. luminescens kleinii An and Grewal, 2011

Photorhabdus temperata

Fischer-Le Saux, Viallard, Brunel, Normand & Boemare, 1999

P. temperate temperata Fischer-Le Saux, Viallard, Brunel, Normand

& Boemare, 1999

P. temperta thracensis Hazir et al., 2004

P. temperata cinerea Tóth and Lakatos 2008

P. temperata khanii Tailliez et al., 2010

P. temperata tasmaniensis Tailliez et al., 2010

P. temperata stackebrandtii An and Grewal, 2011

Photorhabdus asymbiotica

Fisher-Le saux, Viallard, Brunel, Normand & Boemare, 1999.

P. asymbiotica asymbiotica Akhurst et al., 2004

P. asymbiotica australis Akhurst et al., 2004

CHAPTER I

CHARACTERIZATION, AND PHYLOGENETIC RELATIONSHIPS OF

PHOTORHABDUS LUMINESCENS SUBP. SONORENSIS (-PROTEOBACTERIA:

ENTEROBACTERIACEAE) THE BACTERIAL SYMBIONT OF THE

ENTOMPATHOGENIC NEMATODE HETEROROHABDISTIS SONORENSIS1.

Introduction

Photorhabdus are Gram-negative bacteria (Gamma-Proteobacteria, Enterobacteriaceae), which have a mutualistic association with entomopathogenic nematodes of the genus

Heterorhabditis (Rhabditida: Heterorhabditidae). These bacteria are maintained in the intestinal lumen of the non-feeding third-stage infective juvenile nematodes also known as IJs. The nematodes (IJs) vector the bacteria from one insect host to another and together they act as a complex that kills insect hosts in a short period of time, usually 48-72 h [5, 9]. The bacteria are not known to live outside the insect host, so the nematodes facilitate their dissemination from one insect host to another. The IJs also provide to the bacteria, shelter form environmental stressors and soil antagonists. Once the IJs find a suitable host, they penetrate it through natural openings (i.e. spiracles, mount or anus) or by perforating the cuticle, with the help of a cuticular tooth and migrate to the host’s hemocoel. In the presence of hemolymph, the IJs regurgitate the bacterial symbionts, which kill the host by septicemia. At this point, the bacteria and degraded insect tissues become the food source for the nematodes, which mature to adults (hermaphroditic females) and produce progeny. Usually 1-2 additional nematode generations are produced in the

1To be submitted to Current Microbiology. This chapter has been formatted according to the authors’ guidelines of this journal.

insect cadaver based on food availability. In the insect host, Photorhabdus bacteria produce a wide range of toxins and hydrolytic enzymes such as lipases, phospholipases proteases, and broad-spectrum antibiotics [3, 4]. Once nutrient availability is depleted, IJs reassociate with the bacterial symbionts and exit the insect cadaver in search of a new host.

At present, three Photorhabdus spp. have been identified: P. luminescens, P. asymbiotica, and P. temperata, and many subspecies for each taxon have been differentiated [1,

2, 8, 16]. In particular, for P. luminescens, there are currently six subspecies described [16].

Characterization of new species and subspecies has been based on sequence data, mostly

16SrDNA gene [11], and also on a selection of protein coding genes including recA, gyrB, dnaN, gltX and rplB [16]. In addition to this, phenotypic traits including temperature growth in

LB agar, colony morphology, color, light production, carbohydrate response and assimilation have been considered. In this study we characterize the bacterial symbiont of Heterorbabditis sonorensis, a recently discovered entomopathogenic nematode species form the Sonoran desert

[15]. We considered a selection of classic biochemical and molecular methods including sequence data from six genes: 16s rDNA, serC, gyrB, recA, gltX, dnaN. We also inferred phylogenetic relationships of this new Photorhabdus subsp. with other related species and subspecies. Results from this study are herein presented and discussed.

Material and Methods

Bacterial isolation and rearing

Bacterial strains were isolated from 48h infected G. mellonella cadavers infected with H. sonorensis strains Caborca and CH-35, respectively. Briefly, cadavers were surface sterilized by submerging them in 70% ethanol for 1 min, and quickly rinsed in 10% v/v bleach solution. A drop of hemolymph was extracted by puncturing the cuticle behind the head and diluting it 1:10 in Luria Bertani (LB) broth. Ten microliters of the resulting solution were stricken on NBTA supplemented with ampicillin (100 µl •ml-1) agar. Dark blue or dark green colonies on NBTA where subcultured in 10 ml. of LB broth with 0.1% pyruvate added, and incubated shaking for

48hrs at 28 °C temperature. Adsorption of bromothymol blue was tested on nutrient agar supplemented with 0.004% (wt/ vol) triphenyltetrazolium chloride and 0.0025% (wt/vol) bromothymol blue (NBTA medium) and dye adsorption of neutral red was tested on McConkey agar plus 0.1% pyruvate [10]. Dark blue or dark green colonies on NBTA were subcultured in 10 ml of LB broth with 0.1% pyruvate added, and incubated for 48h at 28 °C temperature. Only bacterial colonies producing light and showing positive catalase activity were selected for further studies. Glycerol stock cultures were maintained at -80 °C, in LB supplemented with 50%

Phenotypic characterization of bacterial isolates

Cultural properties (i.e. colony shape, size, color) were observed after 72 h incubation at

28 °C, and compared to the following isolates: P. luminescens, subsp. lamoundii.from H. bacteriophora;; P. temperata from H. megidis; and P. asymbiotica from H. gerrardi (Table 5).

Substrate utilization was tested in mineral salt solution (0.85% NaCl). Acid production from carbohydrates was assayed under aerobic conditions on BIOLOG GN plates (Oxoid) incubated for 24 h at 28 °C before reading. Readings were performed at 4, 16, and 24 h. To further test carbohydrates utilization and acid production, API 20NE strips (BioMerieux, Inc. Durham, NC)

27 were used. To test catalase activity, a drop of hydrogen peroxide was placed on colonies presenting the appropriate morphology and evaluated for oxidase reaction. To evaluate the growth temperature range, triplicate liquid cultures were prepared by inoculating 2 ml of LB broth with 20µl of an overnight liquid culture maintained at 28 °C. Liquid cultures were incubated on temperatures ranging from 25 to 39°C, and observed for growth at 24hr and 48 hr.

A selection of agar media including Egg Yolk (EYA), DNA and Sheep- Blood (SBA) agar were also considered to further characterize these novel Photorhabdus strains.

Bacterial resistance to antibiotics was tested considering twelve antibiotics of various families and mechanisms of action including: gentamicin, kanamycin, neomycin, spectinomycin, streptomycin, rifampcin, ampicillin, erythromycin, chloramphenicol, tetracycline, naldixic acid, and D-cycloserine. Antibiotic concentration and inocula varied depending of the antibiotic considered. Antibiotics were dissolved following manufacturer’s instructions. A 48-well tissue culture plate was used for the antibiotic susceptibility assay.

Briefly, each well was inoculated with 500µL of the bacterial culture. TSB without antibiotic used as a positive control. Plates were incubated at 28°C in the dark for 36 hours. Inhibition of growth (relative to the positive control) was evaluated by measuring light absorbance at 600nm on a Shimadzu® Bio Spec-Mini spectrophotometer. Protease production and activity assays were performed as described in Hatab et al [7]. Cultures were incubated for 5 days at 28°C on a rotating shaker at 95 rpm. After the incubation period, a 500 µl of cell-free supernatant was reacted with 2mL of gelatin solution (2% gelatin w/v in 50mM phosphate buffer at pH 7.8) for two hours at 28°C. Light absorbency of the reacted supernatant was read using a Shimadzu®

Bio Spec-Mini spectrophotometer, at 280 nm – 270 nm. The absorbance was calculated according to Hatab et al [7]. All assays were performed in triplicates and repeated three times.

Genotypic characterization

Total bacterial genomic DNA following was extracted by growing isolated bacteria in LB broth with 0.1% pyruvate for 48hrs. One milliliter of culture was centrifuged for 5 min at 10,000 rpm.

After removing supernatant, cells were washed with 400 µl of STE buffer (pH 8.0) twice as described in Hai-Rong et al. [8]. Sample was then centrifuged at 13,000 rpm for 2 min, supernatant discarded and the pellet resuspended in 400 µl of TE buffer and 200 µl of Tris saturated phenol (pH 8.0) which was then mechanically lysed by vortexing for 60 sec. Organic and aqueous layers were separated by centrifugation at 13,000 rpm for 5 min. To purify the lysate, 150 µl of the aqueous phase was transferred to a clean tube, a mixed with 200µl of chloroform and 100 µl of TE, twice. RNA was digested by incubating the recovered aqueous phase with 40 µl additional TE and 5 µl of RNase at 10mg•µl-1 for 10 min at 37°C. Nucleic acid extraction was completed by adding 100 µl of chloroform and centrifuged at 13,000 rpm for 5 min.

The 16S rRNA gene and four housekeeping genes including gyrB (encodes DNA gyrase subunit B), recA (encodes recombinase protein), dnaN (encodes beta subunit of DNA polymerase III holoenzyme) and gltX (encodes glutamyl-tRNA synthetase) were considered in this study. Primer information is given in Table 1. PCR cycle conditions followed those described previously by Tailliez et al. [16] and Sergeant et al. [14]. All PCR amplifications were performed in a MyCycler thermal cycler (Bio-Rad®). All products were examined by standard electrophoresis on a 1% agarose gel. The length of the 16s rDNA region was ~1500 bps, recA ~ 420 bps, gltX was ~ 1200 bp, dnaN was ~ 1400 bp, gyrB was ~ 1440 bp.

2.3. Sequence Editing and Alignment

Contig assembly and sequence ambiguity resolution was performed with the aid of SeqEdit and EditSeq software (DNA Star Inc., Madison, WI.) Multiple sequence alignments were performed using ClustalX v1.83.1 [17] under default alignment parameters. Alignment inconsistencies were corrected by hand in Mesquite v2.6 [10]. Sequences corresponding to the PCR amplification primers were removed prior to multiple sequence alignment and phylogenetic analysis. The phylogenetic analysis was conducted with PAUP v 4.0b10

(Swofford 2002) using unweighted parsimony. Then, all Photorhabdus genes sequenced were concatenated, and the set was partitioned according to the appropriate models obtained with MrModel Test (Nylander, 2004). Finally, MrBayes was executed (Huelsenbeck &

Ronquist, 2001) with two runs of Markov-Chain Monte-Carlo until the convergence statistics reached 0.1. All sequences generated in this study were deposited in GenBank. Accession numbers of these sequences and those retrieved from GenBank are listed in Table 2.

Results and Discussion

Phenotypic variants (phase I & phase II) were observed during in vitro incubation, they presented altered metabolic properties. Phase I colonies are round, of small to medium size, convex and glossy, of slimy consistency. Phase II colonies were characterized by the formation of less mucous and sticky colonies, the loss of dye-binding ability, and a reduction in the amount of pigments. Antibiotics and crystalline inclusion bodies were also produced. Both

Photorhabdus sp. strains (CH35 and Caborca) showed green-blue to dark green colonies and absorbed neutral red in McConkey agar. Colony morphology on nutrient and LB agar revealed

30 identical morphology to that observed for other P. luminescens strains (Figure 1).

Bioluminescence was observed by naked eye after allowing eyes to adjust in a completely dark room for ten minutes. Colonies also presented catalase activity when tested with hydrogen peroxide.

Physiological properties were determined for the two isolates and were compared with published data for other Photorhabdus species and subspecies (Tables 3 and 4). On the GN2 biolog plates, the following substrates were utilized to characterize both strains: N-acetyl-D galactosamine, d.mannose, d-trehalose, methylpiruvate, cis-aconitic acid, D-alanine, L-aspartic acid, L-glutamic acid, L-proline. These strains also had weak reactions to maltose, succinic acid, glycyl-L-asparctic acid, glycil-L-aspartic acid. When compared to the type isolate, this novel subspecies differs in the utilization of several GN2 compounds, including m-inositol, formic acid, Propionic acid, Citric acid, D-glucoronic acid, D-alanine, Glycyl-L-aspartic acid, Glycyl-L- glutamic acid, L-threonine, thymidine. The following substrates from the GN2 plates (not listed in Table 3) were utilized by all strains: Tween 40, Tween 80, N-acetyl-D-glucosamine, D- fructose, α-D-glucose, D-gluconic acid, alanine amide, L-alanylglycine, L-asparagine, L-serine, inosine, and glycerol.

Both isolates utilized the following compounds on the API20 strips: manitol, maltose, gluconate, malate, citrate, inositol, and produces indole from tryptophan. The following reactions were positive for all strains: hydrolysis of gelatine, mannose and N-acetylglucosamine. All strains were negative for nitrate reduction, ß-galactosidase, utilization of arabinose, and phenylacetate.

The two novel Photorhabdus strains did not react on DNAse agar, and no proteinase activity was observed after 48 h. However, a very weak reaction was observed after 5 days.

Similarly, no lecithinase activity was observed on EY agar. It is likely that the very weak proteinase activity was due to the proliferations of phase II form variants over the more metabolically active phase I. Colonies grown on 5% Sheep Blood agar; exhibit annular α- hemolysis after incubation for 48h. Both Caborca and Ch35 isolates grew at a temperature ranging from 28 to 32°C, with a minimal observable growth at 9 C after 48h.

The Minimum Inhibitory Concentration 50 (MIC50) of each of the twelve antibiotics tested, was empirically determined or it was obtained by reverse prediction using logistic regression if outside the tested range (MIC50†). Of the twelve antibiotics tested, both strains showed resistance to ampicillin (MIC50† 10.39 ±8 mg/ml), chloramphenicol (MIC50

80±1.1µg/ml), D-cycloserine (MIC50†165.78 ±1.0µg/ml), neomycin (MIC50 400µg/ml), and a weak resistance to rifampicin (MIC50†4.0±0.5mg/ml). Both Caborca and Ch35 isolates appear to be susceptible to tetracycline (MIC50 200µg/ml), erythromycin (MIC50 350ug/ml) and highly susceptible to gentamicin (MIC50 50µg/ml) and nalixidic acid (MIC50 20µg/ml). Also a weak susceptibility response to streptomycin (MIC50 40µ/ml), kanamycin (MIC50 50 µg/ml), and spectinomycin (MIC50 120µg/ml) was observed. There was no evidence of difference in growth between media control and solvent control (P= 0.9018). For the protease production assay, the

Caborca strain produced an average pellet size of 0.011g, with an average activity of 0.0278 (as defined by Hatab et al [7]. The CH35 strain produced an average pellet size of 0.013g, with an average activity of 0.2673. No difference was found in protease activity between CH35 and

Caborca (ANOVA, P=0.1939).

The 16S rDNA sequences of the Caborca and CH35 Photorhabdus strains studied here displayed 99 % similarity to its closest related species, P. luminescens luminescens. On the other hand, the protein coding genes, dnaN, gltX, gyrB, RecA, exhibited 95 %, 94 %, 96 %, 98 % similarity to the closest related species respectively . The differences between the two novel

Photorhabdus strains and the closest species were often less than 4 % and always less than 6%.

Maximum parsimony trees inferred from the nucleotide sequence of all genes are given in Figures 2-7. Of 1,385 characters used in the 16s rDNA analysis, 114 were parsimony informative. The recA dataset contained 426 characters, of which 83 were parsimony informative. A total of 864 characters were analyzed in the gyrB nucleotide dataset, with 188 characters being informative. The dnaN gene yielded 828 parsimony informative characters out of a total of 155. Of the 1057 characters used in the gltX gene, 238 were informative.

For all individual tree reconstructions, three tight monophyletic clusters were depicted:

‘temperata’, ‘luminescens’ and ‘asymbiotica’ clusters. The two isolates focus of this study were consistently placed sister to one another and as members of the ‘luminescens’ clade. Species topology between genes did not vary much and always depicted the two novel P. luminescens isolates as sister taxa to a clade that contains the bacterial symbionts subspecies of H. bacteriophora and H. indica. Maximum parsimony analysis revealed in all instances a strong bootstrap support for the clustering of the new P. luminescens subspecies, with values ranging from 99 (gltX, recA) to 100 (gyrB) to moderate support 89 (dnaN). As with individual gene trees, the combined Bayesian analyses of the concatenated data did not differed in topology form the maximum parsimony analysis of the same set.

Description of Photorhabdus luminescens subsp. sonorensis subsp. nov.

Photorhabdus luminescens subsp. sonorensis subsp. nov. is named after the type locality where its nematode host was first isolated.

Maximum temperature growth in nutrient broth is 39 C. Cells are Gram-negative, motile, oxidase negative, catalase positive, arginine dihydrolase and gelatinase positive. Partial hemolysis on sheep blood agar is present, lethicinase activity is weak. Other metabolic properties are indicated in Tables 3 and 4. Phase I colonies are bioluminescent, granulated, convex and glossy and have a sticky consistency. Phase II colonies were characterized by the formation of less mucous and sticky colonies, the loss of dye-binding ability, and a reduction in the amount of pigments.

The type strain of this bacterium has been deposited in ATCC collection. Sequence data from all genes considered in this study were deposited in GenBank and are listed in Table 2.

FIGURES

Figure 1. Phase variation on NBTA selective media, The blue green/dark green colony results from the absorption of bromothymol blue from the media (Phase I), the red colonies flanking the primary phase colony are Phase II colonies, which reduce TTC giving the red coloration.

A B C

D E F

Figure 2. Colony morphology on different agar media. Top row, left to right: A) Photorhabdus on McConkey agar showing the typical neutral red absorption, B) Nutrient agar on which colonies produce a yellow pigment,. C) 5% sheep blood agar displaying α-hemolysis. Bottom row. Left to right: D) On LB agar, the colonies appear cream colored, E) Image of the weak dnase activity of DNA agar, F) Egg yolk agar presenting no lethicinase activity.

Figure 3. 16S rDNA tree constructed with Jukes and Cantor (1969) and maximum parsimony module of PAUP. Numbers on branches indicate bootstrap values of 1,000 replicates. Tree rooted with E. coli K12.

Figure 4. dnaN tree constructed with Jukes and Cantor (1969) and maximum parsimony module of PAUP. Numbers on branches indicate bootstrap values of 1,000 replicates. Tree rooted with E. coli K12.

Figure 5. gltX tree constructed with Jukes and Cantor (1969) and maximum parsimony module of PAUP. Numbers on branches indicate bootstrap values of 1,000 replicates. Tree rooted with E. coli K12.

Figure 6. gyrB tree constructed with Jukes and Cantor (1969) and maximum parsimony module of PAUP. Numbers on branches indicate bootstrap values of 1,000 replicates. Tree rooted with E. coli K12.

Figure 7. RecA tree constructed with Jukes and Cantor (1969) and maximum parsimony module of PAUP. Numbers on branches indicate bootstrap values of 1,000 replicates. Tree rooted with E. coli K12.

Figure 8. Concatenated tree of housekeeping genes (dnaN, glXx, gyrB, ReacA) constructed with

Jukes and Cantor (1969) and maximum parsimony module of PAUP. Numbers on branches indicate bootstrap values of 1,000 replicates. Tree rooted with E. coli K12.

Figure 9. Bayessian analisys of the concatenated housekeeping genes (dnaN, glXx, gyrB, ReacA) partitioned according to the appropriate models for each gene . Numbers on branches indicate posterior probabilities. Tree rooted with E. coli K12.

TABLES

Table 1. Primers considered in this study. † From Tailliez et al. 2010, from Sergeant et al. [11].

Primer Region Orientation 5-3 Sequence

16SP1† 16s rDNA Fwd GAAGAGTTGATCATGGCTC

16SP2† 16s rDNA Rev AAGGAGGTGATCCAGCCGCA

SP1† 16s rDNA Rev ACCGCGGCTGCTGGCACG

SP2† 16s rDNA Rev CTCGTTGCGGGACTTAAC gyrB† gyrB Fwd ATTGGCACTGTATGGTATCAC gyrB† gyrBrev Rev TACTCATCC ATTGCTTCATCATCT gyrB† gyrBSP1 Fwd ATAACTCTTATAAAGTTCCG gyrB† gyrBSP2 Fwd CGGGTTGTATTCGTCACGGCC gyrB† gyrBSP4 Fwd GCAGTAAATATTTTCCTGG recA recA Fwd CCAATGGGCCGTATTGTTGA recA recAR Rev TCATACGGATCTGGTTGATGAA gltX† gltX1 Fwd GCACCAAGTCCTACTGGCTA gltX† gltX2(R) Rev GGCATRCCSACTTTACCCATA gltX† gltX3 Rev TCCATATCCCAGTCATC dnaN† dnaN1 Fwd GAAATTYATCATTGAACGWG dnaN† dnaN2 Rev CGCATWGGCATMACRAC dnaN† dnaN6 Rev GTTRTTRCTGCCAATCTG

Table 2. Photorhabdus species and isolates considered in this study. Sequence data and GenBank accession no. considered in this study.

Isolate Gene GenBank Accession number

P. temperata temperata 16S rRNA AJ007405 XINach recA FJ862012

gltX FJ844918

dnaN FJ831485

gyrB AY278517

P. temperata tasmaniensis 16S rRNA EU930340 USCA01 FJ862006 recA FJ844924 gltX FJ831480 dnaN EU930357 gyrB

P. temperata temperata K122 16S rRNA AY278651

recA FJ862014

gltX FJ844920

dnaN FJ831484

gyrB EU930355

P. temperata tasmaniensis 16S rRNA FJ844932 NZH3 recA

gltX FJ862007

dnaN FJ844925

gyrB FJ831479 AY278513

P. temperata tasmaniensis 16S rRNA EU930339 T327 recA

gltX FJ862008

dnaN FJ844926 gyrB

FJ831478

EU930356 P. temperata khanii Habana 16S rRNA EU930338

recA FJ862009 gltX FJ844922 dnaN FJ831487 gyrB

AY278503

P. temperata khanii NC19 16S rRNA AY278657

recA FJ862011 gltX FJ844921 dnaN FJ831486 gyrB

AY278497

P. temperata khanii Meg1 16S rRNA AY278655

recA FJ862010 gltX FJ844923 dnaN FJ831488

gyrB AY278512

P. temperata temperata BE09 16S rRNA EU930337

recA FJ862013 gltX FJ844921 dnaN FJ831483 gyrB

EU930354

P. luminescens sonorensis 16S rRNA JQ912644 Caborca recA JQ912648 gltX JQ912646

dnaN JQ912645

gyrB JQ912647

P. luminescens sonorensis 16S rRNA JQ912649 CH35 recA JQ912653

gltX JQ912651

dnaN JQ912650

gyrB JQ912652

P. luminescens luminescens 16S rRNA AY278640 Hb recA FJ862000

gltX FJ844911

dnaN FJ831500

gyrB AY278501

P. luminescens luminescens 16S rRNA AY278641 Hm recA FJ862001

gltX FJ844912

dnaN FJ831501

gyrB AY278505

P. luminescens laumondii E21 16S rRNA EU930341

recA FJ861999

gltX FJ844910

dnaN FJ831497

gyrB EU930358

P. luminescens caribbeanensis 16S rRNA EU930344 HG26 recA FJ862002

gltX FJ844915

dnaN FJ861498

gyrB EU930359

P. luminescens caribbeanensis 16S rRNA EU930345 HG29 recA FJ862003

gltX FJ844915

dnaN FJ831499

gyrB EU930360

P. luminescens kayaii FR33 16S rRNA EU930333

recA FJ861994

gltX FJ844909

dnaN FJ861493

gyrB EU930349

P. luminescens kayaii KR04 16S rRNA EU930336

recA FJ861998

gltX FJ844907

dnaN FJ831496

gyrB EU930353

P. luminescens kayaii ITH 16S rRNA EU930334

recA FJ861995

gltX FJ844908

dnaN FJ831492

gyrB EU930350

P. luminescens kayaii C8406 16S rRNA EU930343

recA FJ861997

gltX FJ844906

dnaN FJ831495

gyrB AY322432

P. luminescens kayaii 16S rRNA AJ560630 DSM15194T

P. luminescens kayaii recA FJ861996 CIP108428 gltX FJ844917

dnaN FJ831494

gyrB EU930348

P. luminescens hainanensis 16S rRNA EU930342 C8404 recA FJ862004

gltX FJ844914

dnaN FJ831502

gyrB AY278498

P. luminescens akhurstii 16S rRNA NR_028869

FRG04 recA FJ862005

gltX FJ844914

dnaN FJ831403

gyrB EU930347

P. luminescens thracensis 16S rRNA AJ56063 DSM15199T

P. luminescens thracensis recA FJ862015 CIP108426 gltX FJ844927

dnaN FJ831481

gyrB EU930351

P. luminescens thracensis 16S rRNA EU930335 FR32 recA FJ862013

gltX FJ844928

dnaN FJ831432

gyrB EU930352

P. asymbiotica asymbiotica 16S rRNA NR_036851 3265-8 recA FJ862017

gltX FJ844929

dnaN FJ831491

gyrB AY278494

P. asymbiotica australis 16S rRNA AY280572 980289 recA FJ862017

gltX FJ844930

dnaN FJ831489

gyrB AY842795

P. asymbiotica Q614 16S rRNA AY216500

recA FJ862019

gltX FJ844931

dnaN FJ831490

gyrB AY278514

E. coli K12 16S rRNA NC_000913

recA NC_000913

gltX NC_000913

dnaN NC_000913

gyrB NC_000913

Table 3. BIOLOG GN2 assay: Phenotypic characters differentiating the CH35 and Caborca

isolates from other Photorhabdus species and subspecies (in light gray).

s, s,

kayaii

(CH35)

akhurstii

laumondii thracensis

(Caborca)

sonorensis sonorensis

ssonorensis ssonorensis

luminescens

P.temperata

P.luminescens P.luminescens

P. asymbiotica

P.luminescens, P.luminescens, P.luminescen P.luminescens P.luminescens P.luminescens P.luminescens

N-acetyl-D galactosamine + + + + - - + + +

2-aminoethanol - - - - + - - - -

m-inositol + - - w - v- + - +

Maltose W w w + - + v+ - +

D-mannose + + + + - + + + +

D-trehalose + + + + - + + - +

Methylpyruvate + + + + - vw - + +

Succinic acid W w w + w v- v+ - +

Cis-aconitic acid + + + + - v+ - - +

Formic acid + - - W - - v+ + +

Propionic acid + - - - - - v+ - +

Citric acid + - - + - + - - -

D-glucoronic acid + - - - + - - - +

Bromo-succinic acid - - - - - + - - +

D-alanine - + + + - v+ + + w

L-aspartic acid + + + + - + + + +

L-glutamic acid + + + + - + + + +

Glycyl-L-aspartic acid - w+ w+ w + + - + -

Glycyl-L-glutamic acid - w+ w+ - - - vw + w

L-histidine - - - - - v+ - - +

D-serine - - - - - + - - -

L-proline + + + - + + + + +

L-threonine - w w - - - v+ - +

Thymidine W - - - - - + + w

*, w – weak reaction; †, v – variable reactions.

Table 4. Results of API20 NE system. Reactions and comparison with other Photorhabdus species and subspecies. Reactions different from the type strain appear in light gray.

kayaii

(CH35)

akhurstii

(Caborca)

sonorensis sonorensis sonorensis

laumondii thracensis

luminescens

P.temperata

P. luminescens, P. luminescens,

P. asymbiotica

P. luminescens P.luminescens P.luminescens P.luminescens P.luminescens P.luminescens Indole from - + + - - + - - - tryptophan Acid from ------+ - glucose ADH w ------Urease w - - + + w w w + Esculin - - - W + + + + w Utilization + + + + - - - - - of mannitol Maltose + + + + w + w - + Gluconate + + + + + w w w + Caprate - - - + - - - - - Malate + + + + w w w - + Citrate + + + + w w- v+ - + Inositol + w W + + w- - - + Mannitol + + + + - - - - - Esculine + - - W w w + w + Trehalose - - - - - v- + + - Xylitol ------+ - L-fucose + - - + - - - + -

CHAPTER II

BIOPROSPECTING OF SECONDARY METABOLITES PRODUCED BY THE

ENTOMOPATHOGENIC BACTERIUM PHOTORHABDUS LUMINESCENS SUBSP.

SONORENSIS (GAMMA-PROTEOBACTERIA, ENTEROBACTERIACEAE)1

1. Introduction

For several decades, natural compounds produced by microbes have been researched for medical and agricultural applications (Strobel et al, 2003). The majority of these natural products are of bacterial origin. For instance, Streptomyces spp. produce molecules with antibiotic activity such as neomycin and chloramphenicol, which have saved and improved the life of millions of people worldwide (Kierser et al., 2000). In agriculture, Bacillus thuringiensis has been a key player in combating major agricultural pests and in the successful engineering of transgenic crops with its protein toxins (Shelton et al, 2002). Natural products (NP) can be an environmentally-safe alternative to current methods of chemical control, most of them do not persist in the environment; and have few effects on non-target organisms (Duke et al, 2003). Over the past decades there has been an increase interest for the study for natural products. In particular, symbiotic microorganisms have been targeted as an accessible source of novel bioactive compounds with medical and agricultural relevance (Webster, 2002).

In this respect, Photorhabdus bacteria represent a rich source of novel molecules with

1This Chapter will be submitted to the Journal of Invertebrate Pathology and has been formatted accordingly. insecticidal, nematicidal, antibiotic and antimycotic properties. Photorhabdus spp. arebioluminescent Gram-negative Gamma-Proteobacteria, that have a mutualistic association

55 with the insect-parasitic nematodes of the genus Heterorhabditis Poinar (Nematoda,

Heterorhabditidae). This bacterium can undergo phenotypic phase variation from primary to secondary form. These two different phases vary in light production, antibiotics, toxins and metabolites production (Boemare and Akhurst, 1988). These bacterial symbionts are vectored by the free living and infective stage (J3 or IJ) of the nematode, and serve as a source of potent protein toxins that kill the insect within 48 hours post invasion (Boemare et al., 2006). As a result of the combination of secreted toxins and highly bioactive secondary metabolites the microenvironment inside the cadaver is maintained in almost exclusive monoaxenity (Hu and

Webster, 2000, Li et al., 1995). The insect tissues are also bioprocessed by an array on hydrolytic enzymes, produced by these bacteria. The degraded tissues and the bacteria become then food for the nematode, allowing its growth and multiplication for up to three generations.

A considerable amount of literature has focused on the characterization and activity of the toxins produced by Photorhabdus. For example, some of the most studied are toxin complexes (Tcs) such as Mcf, make caterpillars floppy”; Pir, “Photorhabdus insect related proteins”, and PVCs , “Photorhabdus virulence cassettes” (French-Constant et al, 2004, 2004,

2006 ). Moreover, a number of small molecules (that contribute to their virulence have been characterized both in vivo and in vitro conditions. Yet, many of the compounds produced by the bacteria predicted in silico remain to be characterized.

Recent analysis of the genomes of two Photorhabdus spp.: P. luminescens (TTO1) and P. asymbiotica (ATCC 43949) have revealed the existence of a large repertoire of secondary metabolite biosynthetic gene clusters that might be expressed in the pathogenic phase of these bacteria. Moreover, a number of genes potentially involved in the mutualistic interaction with its nematode host have also been identified (Waterfield et al., 2009). In the Photorhabdus genome

56 there are 23 genes clusters that encode ribosomal peptide synthases (NPRS) among other compounds and enzymes, and a biosynthetic cluster coding for large polyketide synthase (PKS)

(Duchaud et al, 2003, Donadio et al 2007, Bode 2009). Therefore, there is significant potential in

Photorhabdus for the production of novel bioactive small molecule NPs. Secondary metabolites such as isopropylstibenes, ethylstilbene, and anthraquinones have been the most characterized.

Stilbenes are conjugated alkenes typically produced by plants. However, Photorhabdus spp. alsoproduce these compounds which play a key role in evading the insect’s immune system by inhibiting the phenol oxidase pathway (Eleftherianons et al., 2009). Stilbenes are also shown to have nematicidal, antimycotic and antibacterial activity (Williams et al 2005, Shapiro-Ilan et al,

2007) and have been implicated in bacterial feeding signaling for the nematode (Joyce et al,

2009). Another product of Photorhabdus secondary metabolism are anthraquinones. These molecules are type II PKS products that confer the typical red pigment to infected insect cadavers, and also acting as bird and ant deterrents (Bode, 2009).

It is believed that different Photorhabdus species and/or strains produce different NPs with not only diverse chemical structures, but also with a wide range of bioactivities of medicinal and agricultural interest (Webster et al., 2002). Thus, the main goal of this study was to identify and characterize NP secondary metabolites from an Arizona native entomopathogenic bacterium,

Photorhabdus luminescens sonorensis, as a source of novel bioactive molecules for agricultural and medical bioprospecting. Specifically, we assessed the bioactivity of crude extracts of the bacterium against a selection of plant pathogens and pests.

2. Materials and Methods

2.1. Bacterial Cultures

Two P. luminescens sonorensis strains, CABORCA and CH35, were considered in this study.

For comparisons, P. luminescens luminescens, strain TT01 was also included. This isolate was provided by Dr. Todd A. Ciche (Michigan State University). Briefly, bacteria were cultured in

Tryptic Soy Broth (TSB) and incubated at 28ºC in the dark. Purity of the cultures was verified by streaking on NBTA. Permanent glycerol stocks were prepared and were kept at - 80°C.

2.2.NPs extract preparation from in vitro cultures

Bacterial cultures were grown overnight by inoculating 50 ml of TSB. 500 ml of TSB were inoculated the following day with 1% (v/v) with the overnight culture, and incubated for 4 days at 28 °C in a shaker incubator in the dark. The cultures were then acidified with 5M HCl to pH

4.0. Extractions of secondary metabolites (SM) were performed, with equal volume of ethyl acetate, shaking vigorously for two hours. The organic layer was recovered by ultracentrifugation at 5000 rpm for 10 min on a Sorvall RC2-B centrifuge. A second extraction was conducted to ensure maximum recovery of SM. Samples were concentrated in a vacuum rotatory evaporator at 37 -40 °C to a thick oily residue consistency. The remaining solvent was evaporated to complete dryness by sterile directed air flow. Controls considered tryptic soy broth extractions (TSB) only.

2.3. Chemical characterization of NP extracts

Thin layer chromatography (TLC) was performed to monitor the success of the extractions as described in Hu et al. (1997). High pressure liquid chromatography (HPLC) analysis was performed using a Waters 717 liquid chromatograph with acetonitrile and water as the mobile phase, delivered at 0.8 ml/min to a SUPELCO C18 column, with the following program: 30%

MeCN in water for 5 min, followed by a linear gradient to 70% MeCN in 30 min, and isocratic

(70% MeCN) for 1 min. The eluate was passed through a Waters 996 turntable absorbance detector set at range of 275-310 nm. The results of the analysis were recorded with an Empower data module. The MS analysis was conducted solely by Dr. Helge Bode (Institute for Molecular

Bioscience, Goethe University in Frankfurt Germany).

2.4. NP extracts activity bioassays

We evaluated NP extracts for antibacterial, antifungal, insecticidal and nematicidal properties. For this purpose we selected the following organisms: corn earworm, Helicoverpa zea (Lepidoptera: Noctuidae); the root-knot nematode, Meloidogyne incognita (Tylenchida:

Meloidogynidae); the bacterium Pseudomonas syringae (Pseudomonadales:

Pseudomonadacedae) and the fungus Fussarium oxysporum (Hypocreales: Nectriceae)

2.4.1. Insect toxicity. Helicoverpa zea larvae were grown on artificial diet according to procedures described by Hutchison et al (2007). Neonates (n = 30) were individually placed in

48 well tissue culture plates. Each insect was fed 0.25 g of diet containing methanol (control) or bacterial extracts at 1, 2, 3, 4 mg of crude extract per gram of diet. Mortality was recorded every day for 1 week.

2.4.2. Nematicidal activity. Second stage juveniles (J2) of M. incognita obtained from M.

McClure’s laboratory (University of Arizona) were considered for this assay, the concentration of J2 was adjusted to 100 IJ/ml. 990 µL of a nematode suspension was mixed with the 10µL of each test concentrations of SM crude extract, and water and DMSO only as the controls (solvent

≤ 1% final volume). 3.5cm petri dishes where used for each concentration to increase nematode recovery for counting and evaluation.

2.4.3. Antibacterial activity: Pseudomonas syringae cultures were obtained from H.

VanEtten’s laboratory (University of Arizona). Briefly, cultures were grown for two hours in LB broth and the cells were then centrifuged and washed with physiological saline solution. Mid- log cells were resuspended in 0.85% NaCl adjusting the cell count to 1x106 cell/ ml. Twenty microliters of the bacterial suspension were spread on 5 cm LB agar plates. A 2mm well was cut in the center and 10μl of the test solution was added. One plate was used per test concentration; a plate with water and one with DMSO were used as controls. The plates were incubated in the dark at 25°C for 24h, the area of inhibition around the well was measured and recorded.

2.4.4. Antifungal activity: For this assay we considered the fungus Fusarium oxysporum f..sp. asparagi that was obtained from B. Pryor’s laboratory (University of Arizona). The fungus was grown according to procedures described by transferring fungal plugs for the original PDA plates onto fresh ones, and then incubating at room temperature under direct light for seven days.

Suppressive activity of crude extracts was determined by measuring the zone of inhibition of the fungus on potato dextrose agar. The fungal suspension was prepared by flooding the plates with

0.5% KCl solution and filtering through sterile cheese cloth. 50μl of fungal spore suspension

(1x106 spores/ml) was spread on a 10 cm petri dish. After drying the plates for ten minutes, a

2mm diameter well was cut in the center of the dish and 10μl of the bacterial SM extract

(4mg/10μl) was added. Controls considered the addition of DMSO into the well of the fungus plate. Plates were incubated in the dark at 25°C for 24h.

2.5. Statistical analysis

Each bioassay described above was repeated at least 3 times. Insect and nematode mortality data was corrected using Sun-Shepperd’s formula. All data was analyzed by Welch’s ANOVA to correct for unequal variances. Multiple comparisons where conducted by Tukey-Kramer method, and confirmed by (non-parametric) Wilcoxon/ Krustallis. JMP statistical package (Version 9,

2011) was considered for this purpose.

3. Results

3.1. Chemical characterization of NP extracts

All strains tested produced nine peaks with similar Rf values (Table 3) with the solvent ratio used (98.5:1.5 chloroform: methanol). All three settings showed a peak with an Rf value of 0.5 corresponding to the value reported by Hu et al, 1997 for 3-5-hydroxystilbene. Three of these peaks were only visible under UV exposure. This simple and quick chromatographic analysis served to monitor and conduct quality control of the all extractions. The control extraction (TSB only) showed no other peaks except for the initial one with 0.08 Rf value. This band was not considered because is a standard peak observed at the initiation of the process.

At a UV wavelength of 275nm-315nm, various peaks where detected that correspond to putative anthraquinones, anthraquinones derivatives, and the precursor of stilbene synthesis, cinnamic acid (Brachman et al., 2007,Joyce et al., 2008, Kontnik et al. 2010). The largest peak observed corresponding to the major stilbene product of Photorhabdus metabolism. This peak was detected at an elution time of 22 min (Hu et al., 1997, Joyce et al., 2008). The main peak had a wavelength absorbance of 315nm, but no shoulder absorption at 211nm, which is usually present on the spectra of the stilbene produced by TT01. Another peak of interest was observed for both the CH35 and CABORCA strains at 18 min elution time, with absorption at 280nm. For the CABORCA strain a peak was produced at 24 min with absorption of 223nm and 266nm.

These peaks may correspond to precursors or shunt products of secondary metabolic pathways not yet characterized.

Mass spectrometry analysis confirmed results obtained HPLC analysis. Moreover, for the

CABORCA and CH35 strains, two anthraquinones (m/z 255 and 285) were also detected (Table

1). The strain TT01 also produces a compound designated 265-Pyron, a non-aromatic heterocyclic ring and an additional anthraquinone (m/z 271), which were not detected in either of the P. l. sonorensis strains. In contrast, nine compounds with masses ranging from 331.3 – 713.5 not previously identified were detected and represent potential novel compounds to be further characterized (Table1).

3.2. NP extracts bioactivity assays

3.2.1. Insecticidal activity

P. luminescens sonorensis CABORCA was the most virulent strain tested for all concentrations tried. Helicoverpa zea neonate mortality ranged from 2.5±1.5% (for the lowest concentration) to

40.7±11.1% (for the highest concentration) (F5, 12=5.88, P < 0.005). For strain CH35 mortality

† ranged from 7.27±3.6% to 14.5±4% (F5, 10=4.5, P < 0.02 ) (Fig. 3). The mortality resulting from the CH35 and CABORCA crude extracts was greater than that of P. l. laumondii strain TT01

(Fig.3). A significant difference in toxicity between CABORCA and CH35 was observed for the highest crude extract concentration (4 mg/g). For P. luminescens lamoundii TT01, an increasing trend was observed as the dose increased. However, this strain showed the lowest mortality on H. zea. Results from the control treatments (data not shown) confirmed that mortality effects were due to compounds produced by the bacterial symbionts and not due to the media or solvent effects (F5, 12x= 6.9, P=0.002). There was no significant difference between diet only and solvent only controls for any strain (all: t test, P > 0.12).

3.2 2. Nematicidal activity.

Free living juveniles of M. incognita (J2) where highly susceptible to the SM crude extracts. A

75% mortality of J2 was observed at the highest concentration (4mg/ml) for all bacterial crude extracts tested. For strain TT01mortality varied between 45.9±5.3 to 100±0%, (F5, 11= 92.5, P <

0.001) depending on the extract concentration. For the CABORCA strain J2 mortality ranged between 38.4±12.9% to 74.93±15.0%, (F5,9=6. 084, P < 0.0088†). Contrarily, CH35 extracts had a higher effect than the CABORCA extracts. J2 mortality with this strain extracts ranged between 46.5±8.7percent to 99.7±0.2% (Figure 4).

3.2. 3. Antibacterial activity.

Strain CH35 showed the highest antibacterial effect. The radii of inhibition ranged from 2.82±0.8 mm to 4.42±0.6 mm (F5, 10 = 6.77, P < 0.005). The CABORCA strain produced an inhibition radius of 1.16±0.2mm to 3.16±0.2mm, (F5, 12= 57.44, P < 0.001). TT01 showed comparable results to the CABORCA strain. The concentration of 1mg/ml produced an inhibition radius of

0.75±0.4mm, up to 2.28±0.2 with the concentration of 4mg/ml (F5,17= , P< 0.001) (Figure 5). No significant difference was observed between controls for any strains. (All: t test, P > 0.4).

3.4. Antimycotic activity

Crude extras of isolate TT01 had the highest effect on F. oxysporum, with zones of inhibition ranging from 4.88 ±0.6mm to 6.25 ± 0.5 mm, (F5,12=49.28, P <0.001). Isolates CH35 and

CABORCA had a lower bioactivity against this plant pathogen. The inhibition zone produced by strain CH35 ranged from 0.875 ±0.1mm to 3.16667 ±0.16 (F5,12= 69.69, P < 0.001). For the

CABORCA strain the extracts’ zone of inhibitions had radii ranging from 1.79 ±0.1mm to 4.0

±0.4mm (F5,12= 44.50, P <0.001). All controls showed no zone on inhibition.

Discussion

Results from both chromatography and spectroscopic analyses showed that the strains

CABORCA and CH35 produce a similar amount of compounds than strain TT01. HPLC-UV spectra analyses revealed peaks for stilbene and anthraquinone molecules with wavelength

64 absorbance and retention time similar to those described by Hu (1997) and Joyce (2007). MS analysis also confirmed the presence of the putative major stilbene and anthraquinone products and of unidentified compounds for CABORCA and CH35. These compounds were not detected by the HPLC-UV analysis and may represent novel compounds not previously characterized.

We speculate these compounds could be siderophores, cytotoxic peptides, carbapenem, indigoidine or derivatives of any of these biosynthetic pathways. Some of these compounds are not easily detected by current screening techniques due to their minimal (trace) amounts naturally produced, and/or chemical instability. Production and characterization of these cryptic molecules will be pursued by cloning and heterologus production (Crawford et al 2011,

Brachman et al 2012).

In this study, we assess the effect of these secondary metabolites crude extracts considering a selection of plant and pest pathogens. SM crude extracts exhibited insecticidal activity against H. zea neonates. It is likely that stilbenes present in these extracts triggered inhibition of the enzyme phoenoloxidase in the neonates. This enzyme blocks the production of melanotic nodules therefore reducing defense mechanisms in the insects (Eleftherianos et al,

2006). The differences in insecticidal activity between CH35 and CABORCA strains may be due to differential expression of secondary metabolite gene machinery, or due to a differential strain adaptation. Another explanation for this difference could be due to the presence of different proportions of phase I and phase II phenotypes in the bacteria during culture. Strain

TT01 did show high insecticidal activity. Insect mortality by this strain was comparable to the mortality results in the control. Future studies will contemplate fractionation and purification of compounds for a better assessment of the secondary metabolites bioactivity against H. zea.

The nematicidal activity of the SM crude extract against Meloidogyne incognita was very high with an average of 90% J2 mortality for all strains. However, strains TT01 and CH35 were most effective in their nematicidal activity at the highest concentration used. These results agree with previous studies by Li and Webster (1999). However, these authors reported that stilbene compounds produced by P. luminescens MD strain were not lethal to M. incognita J2 at concentrations of 100 µg/ml. Instead indole and other secondary metabolites produced by the same strain were lethal at 400 µg/ ml. In this respect, HPLC_UV analyses in this study showed that CABORCA and CH35 strains produced a peak at a UV absorption of ~280 mm that could be indole or the molecule responsible for the antihelmintic activity of the extracts. Purification of these compounds remains to be identified. It must also be investigated if there exist nematode specific signals that further regulate SM production; and whether or not in vivo production of

SM vary when nematodes are present or absent in the infection process.

The antibacterial and antimycotic activities of Photorhabdus SM extracts have been well documented (Arkhurst et al., 1982, Chen et al.; 1992). They produce antibiotic compounds such as carbapenem, active against Gram-negative bacteria, and ST has antibiotic effect against both

Gram-negative and Gram-positive bacteria (Derzelle et al., 2002, Chen et al., 1992). In this study, the inhibitory responses observed in P. syringae, were similar to those observed for M. luteus and B. subitillis (Poinar et al., 1980, Ciche et al., 2003).

Regarding the antimycotic activity in our study, we observed a strong and permanent effect with an inhibition zone that remained unaltered during ten days of observation. Chen et al

(1992) assessed antifungal activity of Photorhabdus against F. oxysporum. In their study the authors showed that an area of inhibition developed but that diffused over time.

One of the main problems encountered during with in vitro culture of Photorhabdus, is stabilizing the Phase I phenotype. Even when careful monitoring conditions are followed (i.e. aeration, head space during culture and osmolarity), it is difficult to know the proportion of the culture that has switched to phase II. It has been proposed that a solution for this problem is the creation of “superstrains”. Recently, ∆hexA Photorhabdus mutants were shown to have dramatic up-regulation of small molecule synthesis leading to the characterization of stilbene derived compounds (Kontick et al., 2010).

Genomic characterization of novel biosynthetic pathways will allow the full utilization of

Photorhabdus luminescens subsp. sonorensis molecular richness. Cloning and heterologous expression of genes encoding for carbapenem, photobactin and indigoidine have been successfully conducted, and offer the possibility of production of pure compounds at large scale.

The results of this study show that secondary metabolite expression varies between

Photorhabdus luminescens subspecies, and even between strains like CH35 and CABORCA.

The bioactivity assays demonstrate that the activity of secondary metabolites from each strain tested is significantly different. The results of the toxicity assays illustrate that CABORCA and

CH35 have the same high antibiotic and antimycotic activity as its closest isolates (TT01).

Furthermore, the sonorensis strains superior anthelminthic and insecticidal properties make it a promising organism for bioprospecting. The data generated will serve as basis for future genomic studies on this Sonoran desert native system.

FIGURES

Fig. 1. HPLC-UV spectra for crude extract of each bacterial strain. Detection wavelength 275-

310 nm. First column shows retention time, second column shows the UV absorption of the compounds of each peak.

Fig.2. Mass spectra of the main stilbene product of all Photorhabdus strains. y axis) relative % abundance, x axis) m/z, mass/charge ratio

Intens. ZQ_20111103_IIIS48_10_RC2_01_10646.d: +MS, 9.2min #448 x106 1.5 255.2

1.0

228.2 213.2 0.5 200.4 246.2 278.2 285.2 301.1 309.4 121.1 234.2 239.2 272.3 290.9 0.0 x106 ZQ_20111103_IIIS48_10_RC2_01_10646.d: +MS2(255.2), 9.2min #449

213.1 0.8

0.6

0.4

0.2 239.1 123.1 135.1 199.1 0.0 100 125 150 175 200 225 250 275 300 m/z

Fig.3. Insecticidal activity for different concentrations of the SM crude extract on Helicoverpa zea neonates after seven days of feeding on artificial diet.

30 TT01 25 CABOR 20 CH35

15 TSB Corrected mortality (%) mortality Corrected

0 0 1 2 3 4 dose (mg/g)

Fig.4. Nematicidal effect on M. incognita J2.

100

60 TT01 50 CABOR

40 CH35 Corrected mortality (%) mortality Corrected

TSB 30

0 0 0.5 1 1.5 2 2.5 3 3.5 4 dose (mg/ml)

Fig.5. Antibacterial activity on P. syringae,

4.5

3.5

3 TT01 2.5 CABOR 2 CH35

1.5 TSB radius of inhibition (mm) inhibitionof radius

0.5

0 0 1 2 3 4 dose (mg/ml)

Fig.6. Antimycotic effect on F. oxysporum.

4 TT01 CABOR 3 CH35

TSB radius of inhibition (mm) inhibitionof radius 2

0 0 0.5 1 1.5 2 2.5 3 3.5 4 dose (mg/ ml)

Fig.7. PDA plate of F. oxysporum treated with, SM extracts of Photorhabdus l. sonorensis starin CH35.,

References Upper row, from left to right: water control, DMSO control, treatment 1. Lower row, from left to right: treatments 2-4.

TABLES

Table 1. Rf values from TLC for crude extracts from each strain.

Band TT01 CABOR CH35 TSB

1 0.07 0.08 0.10 0.08 2 0.11 0.16 0.13 *

3 0.15 0.25 0.17 *

4 0.14 0.32 0.21 *

5 0.26 0.40 0.27 *

6 0.46 0.48 0.35 * 7 0.51 0.52 0.38 *

8 0.55 0.63 0.48 *

9 0.60 0.69 0.56 *

10 0.65 0.75 0.69 *

Reference: * Absence of compound

Table 2. Mass of compounds detected by MS analysis. IPS isopropylstilbene, AQ anthraquinones, others indicated. Mass only, unknowns.

All strains CH35 and CABOR TT01

GameXpeptide A* 331.3, 360, 271AQ

255IPS 424.3, 432.5, 265Pyron

255AQ 452.4, 511,

285AQ 519.3, 672.5,

243Sarnoff 713.5.

References: *Bode et al, 2012

DISCUSSION

In this study I characterized the bacterial symbiont of the entomopathogenic nematode Heterorhabditis sonorensis. This nematode was isolated both in SW of USA and Northern Mexico. This nematode is adapted to heat and low humidity levels, therefore it shows great potential for use in controlling insect pest problems in arid and/or semiarid regions. Morover, its bacterial symbiont may offer a new source for natural products with application not only in agriculture but also in the medical field.

Phenotypic and biochemical analyses of this bacterium showed unique traits including high growth temperature (39ºC), reduced utilization of acids as carbon source, and the production of indole from tryptophan. Moreover, sequence data of ribosomal and protein coding genes revealed this bacterium is closely related to the subspecies P. l. luminescens

(Hb, Hm), yet both isolates formed a distinct clade. Based on phylogenetic, molecular, phenotypic and biochemical evidence, this bacterium was depicted as a novel subspecies of Photorhabdus luminescens. Differences in carbon source utilization and secondary metabolite production observed in this study suggest both the CABORCA and CH35 strains may have unique adaptions to natural hosts and environmental conditions.

Furthermore, these differences may involve the presence of novel molecules as suggested by the unknown compounds detected by both chromatographic and spectroscopy analysis.

Bacterial natural products represent over 60 % of drugs in the market today

(Mollinary, 2009). Moreover, five of the most commonly used insecticides classes

(neonicotinoids, pyrethroids) are based on natural products and account for 19.5%,

15.7%, and 7.6% of the combined worldwide sales (Nauen, 2007). However, there is still a great need for the use and discovery of pesticides that are not only highly effective, but that also have low toxicity and have minor impact in the environment. (Strobel et al,2003).

The data obtained in this study demonstrates that SM crude extracts produced by P. luminescens sonorensis have great potential due to their insecticidal, antibacterial, antimycotic and nematicidal activities. For example, the insecticidal activity of the SM crude extracts from both strains had more than ten times the activity of subsp. lamoundii

(TT01), although all strains produced the same stilbene. Stilbene is the main molecule implicated in insecticidal activity due to its inhibiting activity in the insect’s melanization response. It is possible that a synergistic effect of different compounds produced by

CABORCA and CH35 caused the oral toxicity in H. zea, or that they alone can kill the insect.

Other types of compounds produced by Photorhabdus spp. with relevant biological activity are indoles. Indoles have been confirmed toxic to root knot nematodes

(Hu et al 1999, Ruanpanun et al 2010); a concentration of 500 µg ml causes mortality of

100%. The sonorensis crude extracts caused mortality of 100% with a concentration of

4mg/ml (approx.18 µg indole). It may be that these strains produce a higher amount of indole, since the BIOLOG assay revealed that CABORCA and CH35 are two of the few isolates to produce indole from tryptophan. Although stilbenes from plants have a

nematicidal effect on M. incognita (Suga et al 1994), Photorhabdus stilbenes do not, nevertheless it has been confirmed to have an effect on egg hatching. (Andaló.et al 2012).

These are only two of the compounds with potential for application in nematode control.

Although the antimycotic activity varied among all three strains tested; statically the antimycotic properties of both P. l. sonorensis strains SM were the same against F. oxysporum. Application of Photorhabdus sp. crude extracts to treat fungal infections were conducted by Shapiro-Ilan (2009). In this study the authors showed that

Photorhabdus crude extracts of were able to stop the progress of the decease on peach and pecan leaves. The antifungal properties of Photorhabdus metabolites make these compounds worth of more research as antymicotics against plant pathogenic fungi.

The antibacterial activity of P. l. sonorensis SM extracts evaluated in this study had a clear dose-effect response on Pseudomonas syringae. Hu, (2006) showed that the minimum inhibitory concentration of isopropyl-stilbene necessary to achieve the minimum inhibitory concentration (MIC) was a concentration of 100 µg for

Pseudomonas aeruginosa, and although it is a different species than our test organism,

Hu’s data support our findings.

The results of this study also emphasize the difference in qualitative production of metabolites under in vitro conditions among subspecies and sister strains. In addition to the subspecies and strain inherent differences, the variability of activity of the extracts may be due to stochastic phenotypic variation Photorhabdus undergoes. The phase shift

makes it very difficult to assess the ratio of Phase to Phase II in liquid culture, and it directly affects metabolite production. To circumvent this issue, an approach taken has been the co-cultivation of Photorhabdus with other bacteria, trying to mimic their ecological environment (Brachman 2009), or the simply trying to optimize culture conditions. A more efficient approach is the heterologous expression of biosynthetic clusters; especially cryptic molecules normally not detected either in vivo on in vitro culture, due to their very low production.

The instability of the compounds upon extraction and their sensitivity to environmental factors are certainly a barrier to overcome with methods such as with combinatorial biosynthesis. Something else too consider is direct screening of some fractions may not have activity against some organisms but can have extraordinary effect on others, as demonstrated by the results presented in this study. In this respect, Fabre et al., (1998) report that a variety of metabolites with insecticidal activity which had been compounds originally classified as inactive on microbes gave positive activity when screened against insects.

Small molecules not only serve the bacterium as defense against soils competitors, they also play an important part in symbiosis with the nematode host.

(Watson et al., 2010). Photorhabdus also produce signals that promote the infective juvenile nematodes invading the insect host to become reproducing adults, i.e., stilbenes and an anisocyanide product (Crawford and Clardy, 2011). Further research of the signaling properties of SM and their role in nematode-bacteria communication will increase our understanding of eukaryote-prokaryote associations and interactions. In the

field of biocontrol, it will lead to more efficient mass production of EPN and in an improved performance in the field. The potential of secondary metabolites produced by

Photorhabdus luminescens sonorensis for application in biological control was explored in this study, but continued research is still needed for the isolation, identification and evaluation of effects metabolites.

REFERENCES

Akhurst RJ, Boemare NE, Janssen PH, et al. (2004) Taxonomy of Australian clinical

isolates of the genus Photorhabdus and proposal of Photorhabdus asymbiotica subsp.

asymbiotica subsp. nov. and P. asymbiotica subsp. australis subsp. nov. Int J Syst

Evol Microbiol 54: 1301-1310

An RS, Sreevatsan S, Grewal PS. (2009) Comparative in Vivo Gene Expression of the

Closely Related Bacteria Photorhabdus Temperata and Xenorhabdus Koppenhoeferi

upon Infection of the Same Insect Host, Rhizotrogus Majalis. BMC genomics 10:

433.

Barker KR et al (1994) Plant and Soil Nematodes: Societal Impact and Focus for the

Future. Journal of Nematology. 26(2): 127–137.

Bedding RA and Molyneux AS (1982) Penetration of Insect Cuticle by Infective

Juveniles of Heterorhabditis Spp. (Heterorhabditidae:

Nematoda). Nematologica. 28.3: 354-9.

Bode HB, et al (2012) Determination of the Absolute Configuration of Peptide Natural

Products by using Stable Isotope Labeling and Mass Spectrometry. Chem. Eur. J.

Chemistry 18.8: 2342-8.

Boemare N E, Akhurst R J, Mourant R G (1993) DNA relatedness between

Xenorhabdus spp. (Enterobacteriaceae), Symbiotic bacteria of entomopathogenic

nematodes, and a proposal to transfer Xenorhabdus luminescens to a new genus,

Photorhabdus gen. nov. Int. J. Syst. Bacteriology. 43: 249-255.

Boszormenyi E, et al (2009) Isolation and Activity of Xenorhabdus Antimicrobial

Compounds against the Plant Pathogens Erwinia Amylovora and Phytophthora

Nicotianae. Journal of applied microbiology. 107.3 (2009): 746-59.

Brown S E, et al. (2006) Txp40, a Ubiquitous Insecticidal Toxin Protein from

Xenorhabdus and Photorhabdus Bacteria. Applied and Environmental

Microbiology 72.2 (2006): 1653-62.

Burnell A, and Stock SP. (2000) Heterorhabditis, Steinernema and their Bacterial

Symbionts - Lethal Pathogens of Insects. Nematology 2.1: 31-42..

Cowles, K N, and Goodrich-Blair H. (2005) Expression and Activity of a Xenorhabdus

Nematophila Haemolysin Required for Full Virulence Towards Manduca Sexta

Insects. Cellular Microbiology 7.2: 209-19.

Crawford, JM and Clardy J. (2011) Bacterial symbionts and natural products . Chem.

Commun. 47(27): 7559–7566

Daborn P J, et al. (2001) Measuring Virulence Factor Expression by the Pathogenic

Bacterium Photorhabdus Luminescens in Culture and during Insect

Infection. Journal of Bacteriology 183.20 (2001): 5834-9.

Dayan FE, Franck E, Charles L et al. (2009) Natural Products in Crop

Protection. Bioorganic & Medicinal Chemistry 17.12: 4022-34.

Duchaud E, et al. (2003) The Genome Sequence of the Entomopathogenic Bacterium

Photorhabdus Luminescens. Nature Biotechnology 21.11: 1307-13.

Eleftherianos I, Boundy S, Joyce SA, et al. (2007) An antibiotic produced by an insect-

pathogenic bacterium supresses host defenses through phenoloxidase inhibition.

Proceedings of the Nationa Academy of Sciences of the United States of America.

104: 2419-2424

Fischer-Le Saux M, Mauléon H, Constant P, Brunel B and Boemare, N (1998) PCR-

Ribotyping of Xenorhabdus and Photorhabdus isolates from the Caribbean region in

relation to the taxonomy and geographic distribution of their nematode hosts. Appl.

Environ. Microbiol. 64: 4246-4254.

ffrench-Constant R, et al. "Photorhabdus: Towards a Functional Genomic Analysis of a

Symbiont and Pathogen." FEMS microbiology reviews 26.5 (2003): 433-56. Print. ffrench-Constant, Richard H, Andrea Dowling, Nicholas R. Waterfield N.(2007)

Insecticidal Toxins from Photorhabdus Bacteria and their Potential use in

Agriculture. Toxicon. 49.4: 436-51..

Fodor E, et al. (1997) Composition and Biophysical Properties of Lipids in Xenorhabdus

Nematophilus and Photorhabdus Luminescens, Symbiotic Bacteria Associated with

Entomopathogenic Nematodes. Applied and Environmental Microbiology 63.7:

2826-31.

Forst S, and Nealson K. (1996) Molecular Biology of the Symbiotic-Pathogenic Bacteria

Xenorhabdus Spp. and Photorhabdus Spp. Microbiological Reviews 60.1: 21-43.

Forst S, Clarke D. (2002) Bacteria-Nematode Symbiosis. In Entomopathogenic

Nematology, Gaugle R (editor), 57-73. CABI Publishing.

Gaudriault S, et al. (2006) Whole-Genome Comparison between Photorhabdus Strains to

Identify Genomic Regions Involved in the Specificity of Nematode

Interaction. Journal of Bacteriology 188.2: 809-14.

Georgis R, Kaya H, and Gaugler R. (1991) Effect of steinernematid and heterorhabditid

nematodes on nontarget arthropods. Environmental Entomology 20: 815-22.

Georgis R, and Gaugler R. (1991) Predictability in biological control using

entomopathogenic nematodes. Journal of Economic Entomology. 84: 713-20

Goodrich-Blair H, Clarke D. (2007) Mutualism and pathogenesis in Xenorhabdus and 5:

two roads to the same destination. Molec. Microbiol. 64: 260-268.

Hai-Rong et al. (2006). Extremely Rapid Extraction of DNA from Bacteria and Yeasts.

Biotechnology Letters. 28:55-59.

Hatab MA, Stuart RJ, Gaugler R (1998) Antibiotic resistance and protease production

by Photorhabdus luminescens and Xenorhabdus poinarii bacteria symbiotic.

entomopathogenic nematodes: variation among species and strains. Soil Biol.

Biochem. 30: 1955-1961.

Hazir, S, Stackebrandt E, Lang E, Schumann P, Ehlers R-U and Keskin N (2004) Two

new subspecies of Photorhabdus luminescens, isolated from Heterorhabditis

bacteriophora (Nematoda: Heterorhabditidae): Photorhabdus luminescens subsp.

kayaii subsp. nov. and Photorhabdus luminescens subsp. thracensis subsp. nov.

Sys.t Appl. Microbiol. 27: 36-42

Heermann, R, and Fuchs TM. (2008) Comparative Analysis of the Photorhabdus

luminescens and the Yersinia enterocolitica Genomes: Uncovering Candidate Genes

Involved in Insect Pathogenicity. BMC genomics 9: 40. Print.

Hojas, RM. (2001) Molecular Systematics of (Nematoda: Filarioidea), its Simuliid

Vectors in West Africa and (Nematoda: Filarioidea) in South America. Greenwich:

University of Greenwich, 2001.

Isaacson, PJ, and Webster MJ. (2002) Antimicrobial Activity of Xenorhabdus Sp. RIO

(Enterobacteriaceae), Symbiont of the Entomopathogenic Nematode, Steinernema

Riobrave (Rhabditida: Steinernematidae). Journal of Invertebrate Pathology 79.3

146-53.

Kaplan, RM. (2204) Drug Resistance in Nematodes of Veterinary Importance: A Status

Report. Trends in Parasitology 20.10: 477-81..

Khan-Malek R, and Wang Y. (2011) Statistical Analysis of Quantitative Rt-PCR

Results. Methods in Molecular Biology (Clifton, N.J.) 691: 227-41.

Koppenhöfer HS (2007) Bacterial symbionts of Steinernema and Heterorhabditis. In

Nematology Monographs and Perspectives 2:735- 808.

Lambshead P, John D, and Boucher G. (2003) Marine Nematode Deep-Sea Biodiversity

? Hyperdiverse Or Hype? Journal of Biogeography 30.4: 475-85.

Liu J, Berry RE and Blouin MR (2001) Identification of symbiotic bacteria

(Photorhabdus and Xenorhabdus) from the entomopathogenic nematodes

Heterorhabditis marelatus and Steinernema oregonense based on 16S rDNA

sequence. J. Invert. Pathol .77: 87-91.

Molinari, G. (2009) Natural Products in Drug Discovery: Present Status and Perspectives.

Advances in Experimental Medicine and Biology. Vol. 655

Morgan JA, et al. (2001) Sequence Analysis of Insecticidal Genes from Xenorhabdus

Nematophilus PMFI296. Applied and Environmental Microbiology 67.5: 2062-9.

Print.

Munch A, et al. (2008) Photorhabdus Luminescens Genes Induced upon Insect

Infection. BMC Genomics 9: 229.

Nauen R. (2007) Insecticide Resistance in Disease Vectors of Public Health

Importance. Pest Management Science 63.7: 628-33.

Poinar Jr, GO. (1976) Description and biology of a new parasitic rhabditoid

Heterorhabditis bacteriophora (Rhabditida; Heterorhabditidae n. fam.).

Nematologica. 21 : 463-470

Poinar G, Hess R and Thomas G. (1980) Isolation of defective bacteriophages from

Xenorhabdus spp. (Enterobacteriaceae). Science 8: 141

Rosamond J and Allsop A. (2000) Harnessing the Power of the Genome in the Search for

New Antibiotics. Science 287.5460: 1973-6..

Ruanpanun P, et al. (2010) Actinomycetes and Fungi Isolated from Plant-Parasitic

Nematode Infested Soils: Screening of the Effective Biocontrol Potential, Indole-3-

Acetic Acid and Siderophore Production. World Journal of Microbiology and

Biotechnology. 26:9, 1569-1578.

San-Blas E, Simon RG, and Pembroke B. (2008) Steinernema Feltiae: Ammonia Triggers

the Emergence of their Infective Juveniles. Experimental parasitology 119.1: 180-5.

Sergeant M, Baxter L, Jarrett P, Shaw E, Ousley M, Winstanley C and Morgan JAW

(2006) Identification, typing, and insecticidal activity of Xenorhabdus isolates from

entomopathogenic nematodes in United Kingdom soil and characterization of the xpt

toxin Loci. Appl Environ. Microbiol 72: 5895-590

Stock SP, Rivera-Orduño B, and Flores-Lara Y. (2009) Heterorhabditis Sonorensis n. Sp.

(Nematoda: Heterorhabditidae), a Natural Pathogen of the Seasonal Cicada

Diceroprocta Ornea (Walker) (Homoptera: Cicadidae) in the Sonoran

Desert." Journal of invertebrate pathology 100.3: 175-84.

Strobel G, and Daisy B. (2003) Bioprospecting for Microbial Endophytes and Their

Natural Products. Microbiol. Mol. Biol. Rev. 67(4): 491–502

Tailliez P, Laroui C, Ginibre N, Paule A, Pages S, Boemare N (2009) Phylogeny of

Photorhabdus and Xenorhabdus based on universally conserved protein-coding

sequences and implications for the taxonomy of these two genera. Proposal of new

taxa: X. vietnamensis sp. nov., P. luminescens subsp. caribbeanensis subsp. nov., P.

luminescens subsp. hainanensis subsp. nov., P. temperata subsp. khanii subsp. nov.,

P. temperata subsp. tasmaniensis subsp. nov., and the reclassification of P.

luminescens subsp. thracensis as P. temperata subsp. thracensis. Int. J. Syst .Evol.

Microbiol. doi: ijs.0.014308-014300

Thompson JD, Gibston TJ, Plewniak F, Jeanmougin F, Higgins DG. (1997). The clustalX

windows interface: flexible strategies for multiple sequence alignment aided by

quality analysis tools. Nucleic.Acids Res. 24, 4876-4882

Vandesompele J, et al. (2002) Accurate Normalization of Real-Time Quantitative RT-

PCR Data by Geometric Averaging of Multiple Internal Control Genes. Genome

biology 3.7.

Watson R.J, Millichap P, Joyce S. (2010) The role of iron uptake in pathogenicity and

symbiosis in Photorhabdus luminescens TT01. BMC Microbiology 10:177

Wang Y, et al. (2007) Stability of Entomopathogenic Bacteria, Xenorhabdus nematophila

and Photorhabdus luminescens, during in Vitro Culture." Journal of industrial

microbiology & biotechnology 34.1: 73-81.

Waterfield NR, Daborn PJ, and ffrench-Constant RH. (2002) Insect Pathogenicity Islands

in the Insect Pathogenic Bacterium Photorhabdus. Physiological Entomology

29:3, 240-250.

Waterfield NR, et al. (2008) Rapid Virulence Annotation (RVA): Identification of

Virulence Factors using a Bacterial Genome Library and Multiple Invertebrate

Hosts." Proc.Natl.Acad.Sci.U.S.A.Proceedings of the National Academy of Sciences

of the United States of America. 105.41: 15967-72.

Wee, KE, Yonan CR, and Chang.NF (2000) A New Broad-Spectrum Protease Inhibitor

from the Entomopathogenic Bacterium Photorhabdus Luminescens. Microbiology

146, 12: 3141-7.