Downloaded from the Worldclim Database

o Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.

o NonCommercial — You may not use the material for commercial purposes.

o ShareAlike — If you remix, transform, or build upon the material, you must distribute your contributions under the same license as the original.

How to cite this thesis

Surname, Initial(s). (2012) Title of the thesis or dissertation. PhD. (Chemistry)/ M.Sc. (Physics)/ M.A. (Philosophy)/M.Com. (Finance) etc. [Unpublished]: University of Johannesburg. Retrieved from: https://ujdigispace.uj.ac.za (Accessed: Date).

INVASIVE ALIEN PLANTS OF SOUTH AFRICA'S FRESHWATER SYSTEMS:

ACCELERATING IDENTIFICATION OF SPECIES AND CLIMATICALLY

SUITABLE AREAS FOR SPECIES INVASION

Lerato Nakedi Hoveka

Dissertation submitted in fulfilment of the requirements for the degree

MAGISTER SCIENTIAE

Botany

in the

Faculty of Science

at the

University of Johannesburg

Supervisor: Prof Michelle van der Bank

Co-supervisor: Dr J. Stephen Boatwright

Co-supervisor: Dr Kowiyou Yessoufou

January 2014

DECLARATION

I declare that this dissertation hereby submitted to the University of Johannesburg for the degree MAGISTER SCIENTIAE (Botany), is my own work and has not been previously submitted by me for a degree at another institution.

Lerato Nakedi Hoveka

January 2014

DEDICATION

I dedicate my thesis to my beloved nephew and niece, Lethabo and Toriso Hoveka.

“A good head and good heart are always a formidable combination. But when you add to that a literate tongue or pen, then you have something very special” - Nelson

Mandela

TABLE OF CONTENTS

Index to figures vii

Index to tables ix

List of abbreviations x

Acknowledgements xi

Abstract xiii

1. Chapter one: General introduction and objectives 1

1.1. A brief summary of plant diversity and threats in South Africa 2

1.2. Species invasion: processes and impacts 3

1.2.1 Conceptual clarification 3

1.2.2. Processes of species invasion 3

1.2.2.1. Introduction of alien invasive species to new 4 environments

1.2.2.2. Colonization 7

1.2.2.3. Naturalization 7

1.2.2.3.1. The enemy release and Darwin 8 naturalization hypotheses

1.2.2.3.2. The allelopathy hypothesis 9

1.2.2.3.3. The border tolerance hypothesis 10

1.2.2.3.4. The hybrid vigour hypothesis 11

1.2.3. Impacts of invasive alien plants 11

1.2.3.1. Ecological impacts of invasive alien plants 12

1.2.3.2. Economic impacts f invasive alien plants in 14 South Africa

1.3. Management of invasive aquatic plants in South Africa 16

iii

1.3.1. Classification of invasive aquatic plants 16

1.3.1.1. Emergents plants 17

1.3.1.2. Floating plants 17

1.3.1.3. Submerged plants 17

1.3.2. Management action 21

1.3.2.1. Preventive actions 21

1.3.2.1.1. Environmental education approach 21

1.3.2.1.2. Environmental legislative approach 22

1.3.2.2. Early detection and rapid response (EDRR) 24

1.3.2.2.1. Early detection 24

1.3.2.2.2. Identification and verification with 25 emphasis on DNA barcoding

1.3.2.3. Risk assessment 27

1.3.2.4. Rapid response planning and implementation 30

1.3.2.5. Control and eradication 30

1.4. Aim and objectives of the study 33

2. Chapter two: DNA barcoding of invasive aquatic plants of 34 South Africa’s freshwater systems

2.1. Introduction 35

2.2. Material and methods 38

2.2.1. Taxon sampling and taxa templates 38

2.2.2. DNA extraction, amplification, sequencing and alignment 53

2.2.3. Satistical data analyses, species monophyly and BLAST 56 analysis 2.3. Results 60

2.3.1. Barcoding gap analysis 60

2.3.2. Discriminatory power 62

2.3.3. PCR success 66

2.3.4. Species monophyly 66

2.3.5. BLAST results 69

2.4 Discussion 70

2.5 Conclusions 73

3. Chapter three: Potential effects of the changing climate on the 74 five worst invaders of South Africa’s freshwater systems

3.1. Introduction 75

3.2. Material and methods 78

3.2.1. Occurrence data 78

3.2.2. Predictor variables 79

3.2.3. Ecological niche modelling 81

3.2.4. Model performance evaluation 81

3.2.5. Model output 82

3.3 Results 83

3.3.1. Best climatic predictors for species distribution of the bad 83 five

3.3.2. Model performance 86

3.3.3. Model output 89

3.4. Discussion 100

3.5 Conclusion 103

4. Chapter four: General conclusions 104

5. Chapter five: References 110

Appendices 135

INDEX TO FIGURES

Chapter one

Figure 1.1 9

An illustration of the Enemy Release Hypothesis.

Figure 1.2 18

Emergent aquatic plants.

Figure 1.3 19

Floating aquatic plants.

Figure 1.4 20

Submerged aquatic plants.

Figure 1.5 32

Mechanical control of water hyacinth by Working for Water employees.

Figure 1.6 32

Eichhornia crassipes under biological control by Neochetina eichhorniae

Chapter two

Figure 2.1 61

Evaluation of the barcode gap in the core barcode.

Figure 2.2 64

Barplot showing the false positive and false negative rate of identification of invasive aquatic species as pre-set thresholds change.

Figure 2.3 66

PCR efficiency for the three DNA regions tested

vii

Figure 2.4 67

One of the most parsimonious trees from the combined plastid genes.

Chapter three

Figure 3.1 86

Jack-knife analysis indicating the predictor variable based on the AUC values.

Figure 3.2 89

ROC curve statistics results.

Figure 3.3 92

Assessment of the effects of climate change on the distribution of Azolla filiculoides.

Figure 3.4 93

Assessment of the effects of climate change on the distribution of Eichhornia crasspies.

Figure 3.5 94

Assessment of the effects of climate change on the distribution of Myriophyllum aquaticum.

Figure 3.6 95

Assessment of the effects of climate change on the distribution of Pistia stratiotes.

Figure 3.7 96

Assessment of the effects of climate change on the distribution of Salvinia molesta.

viii

INDEX TO TABLE

Chapter two

Table 2.1 40

List of taxa with voucher information and GenBank accession number for each DNA. region. Table 2.2 54

Primers used for DNA amplification and sequencing.

Table 2.3 56

Summary of statistics for the datasets generated.

Table 2.4 65

Identification efficacy of DNA barcode regions using distance-based methods.

Table 2.5 69

BLAST analysis of the aquarium plants.

Chapter three

Table 3.1 80

List of global bioclimatic variables from the WorldClim database used for predicting ecological niches.

Table 3.2 83

Conversion of pixel cover area in arc minutes to Kilometres.

Table 3.3 97

Dams occurring in climatically suitable areas for invasion by the ‘bad five’ currently and in the future.

Table 3.4 99

Summary of the area for potential suitable area currently and in the future in km2

LIST OF ABBREVIATIONS

°C = Degree Celsius

ABI = Applied Biosystems, Inc.

BOLD = Barcode of Life Database

CBOL = Consortium Barcode of Life

CTAB = Hexadecyltrimethylammonium bromide

DMSO = Dimethyl Sulfoxide

DNA = Deoxyribonucleic acid

F = Forward primer g = gram

GenBank (NCBI) = National Centre for Biotechnology Information

IAPs = Invasive Alien Plant species matK = Maturase K min = minutes

No = Number

PAUP = Phylogenetic Analysis Using Parsimony software program

PCR = Polymerase Chain Reaction

PVP = Polyvinyl pyrolidone

R = Reverse primer rbcL = ribulose-bisphosphate carboxylase gene sec = second trnH-psbA = spacer between trnH and psbA genes

Verdc. = Verdcourt, Bernard

Warner = Warner, Rose Ella

ACKNOWLEDMENTS

I thank God almighty for this guidance, mercy and protection throughout my academic career.

I wish to thank my parents, grandparents, and siblings for the love, encouragement and support that they have given me throughout my studies. To

Malome Mathome, Ausi Dodi, Mamokgolo Fenny and Malome Masilo, kea leboga

Bakone.

I am grateful for my supervisors Prof Michelle Van der Bank, Dr Stephen

Boatwright and Dr Kowiyou Yessoufou for their patience, guidance and the valuable contribution that they have made towards this study.

I am indebted to Kennedy Leso and Thabang Phago for their support, advice and assisting me with the field work and the identification of plants.

I express my gratitude to Anthony King, Julie Coetzee, Angela Bowens, Matt

Parkison and Grant Martin for providing me with plant material to use for the DNA barcoding.

I value the contribution that Jephris Gere and Bezeng Bezeng have made to this study. I appreciate the training, skill and advice that you have given me.

To the members of the African Centre for DNA Barcoding, especially

Barnabas Daru and Ledile Mankga, thank you for your love and support, and for sharing valuable knowledge with me throughout the study.

To Ronny Kabongo, thank you very much for helping me with the spider analyses.

I am grateful to Les Powrie for providing the occurrence data used in this study.

Finally, I thank my sponsors - the South African National Biodiversity Institute,

Department of Environmental Affairs, the Expanded Public Works Programme, the

Working for Water Programme and the University of Johannesburg - for the financial support that they have provided.

xii

ABSTRACT

In South Africa, controlling and eradicating Azolla filiculoides and Eichhornia crassipes cost annually approximately US$ 60 million to the national budget.

However, the success of these operations is mixed because invasive aquatic plants often spread very rapidly either before they are spotted or before decisions are taken to implement control actions. This limitation is further exacerbated by difficulties in determining the invasion potential of newly introduced or unknown aquatic plants, as well as difficulties inherent to species identification. Resolving these drawbacks requires pre-emptive actions such as identifying areas that are most vulnerable to invasion by alien plants. In this study, I first explore whether molecular technique such as DNA barcoding can be useful to: i) overcome potential limitation of morphology-based identification of invasive aquatic plants; and ii) establish successful control of these invasives. For this purpose, I tested the utility of official

DNA barcodes (rbcLa + matK or core barcodes), trnH-psbA, and the core barcode + trnH-psbA to identify invasive aquatic plants of South Africa’s freshwaters. Second, I use the technique of ecological niche modeling to identify most vulnerable freshwater systems to species invasion under current and climatic conditions.

My analysis indicates that the core barcodes and matK regions perform poorer compared to trnH-psbA, which provides 100% successful identification alone or in combination with the core barcodes. This study therefore validates trnH-psbA as single best DNA barcode for invasive alien aquatic plants of freshwater systems in South Africa. Using this DNA region in BLAST analysis to screen plants species sold in aquarium market in Johannesburg, I found surprisingly that some prohibited species are already in circulation in the market. These include Hydrilla verticillata,

xiii

Egeria densa, Myriophyllum spicatum, and Echinodorus cordifolius. Furthermore, based on climatic parameters, I explored the distribution of the "bad five" aquatic species in South Africa, i.e. the most damaging invaders of freshwater systems. I found distinct distribution potentials for these species under current climatic conditions. Overall, 38% of all South Africa’s dams occur in areas climatically vulnerable to the invasion by the bad five with the Western Cape Province being the most vulnerable. However, under predicted climate change scenario, I found evidence for contrasting shifts in species range: species such as Azolla filiculoides,

Eichhornia crassipes, Salvinia molesta might increase their range by at most 2% whilst the ranges of Myriophyllum aquaticum and Pistia stratiotes might contract by at most 5%. This range contraction and expansion will result in some dams currently vulnerable to invasion becoming resilient whilst others that are currently resilient might become vulnerable owing to climate change. This result demonstrates not only the utility of DNA barcoding in implementing control measures, but also provides ways of prioritising control/management efforts.

xiv

CHAPTER ONE

General introduction and objectives

CHAPTER 1 GENERAL INTRODUCTION AND OBJECTIVES

1.1. A brief summary of plant diversity and threats in South Africa

South Africa, a country harbouring almost 10% of the world’s known plant, bird, and fish species, and more than 6% of mammal and reptile species (Brownlie & Wynberg

2001; Collins 2001) is the world’s third most biologically diverse country (Kepe et al.

2004). Its biological diversity is estimated to be approximately 250 000 to 1 000 000 species, many of which are endemic to the country (Wynberg 2002). South Africa has 19 centres of plant endemism (Van Wyk & Smith 2001) and three global biodiversity hotspots, the Cape Floristic region (CFR), the Succulent Karoo, and

Maputaland-Pondoland-Albany (Meyers et al. 2000). The CFR is the only global plant diversity hotspot confined within the borders of an entire country; CFR is also a centre of diversity and endemism for several mammal, reptile and amphibian species

(Cowling et al. 2003). In addition, South Africa’s flora includes a third of the world’s succulent plant species, which are found in the Succulent Karoo (Brownlie &

Wynberg 2001). In the Maputaland-Pondoland-Albany biodiversity hotspot, there are approximately 1500 endemic vascular plants and region has the highest tree richness of any temperate forest on the planet (Perera et al. 2011).

Nevertheless, South Africa’s rich biodiversity is facing several threats. These threats include inter alia habitat destruction, rapid human population growth, fast urbanization rate, land conversion, and invasive alien plants (IAPs) (Cowling et al.

2003; Turpie 2003; Willis et al. 2010). Indeed, invasive alien plant species are regarded as the second largest threat to biodiversity after direct habitat destruction

(Keane & Crawley 2002; Richardson & Van Wilgen 2004; Pejchar & Mooney 2009).

In general, South Africa has been invaded by approximately 198 plant species with a geographical coverage as vast as 10 million ha of land (Van Wilgen et al. 2001;

Wilson et al. 2013). This successful invasion has in part caused 1 900 species of

South Africa’s 3 435 redlisted species to be threatened with extinction (Wynberg

2002; Richardson & Van Wilgen 2004).

1.2. Species invasion: processes and impacts

1.2.1. Conceptual clarification

In this study, I frequently refer to alien plants, invasive plants and invasive alien plants with a particular focus on aquatic species. I refer to alien plants as plants introduced intentionally or accidentally outside their natural distribution ranges including any parts (gametes, seeds or propagules) that the species might use to reproduce and survive (Richardson et al. 2000; McNeely 2001; Pyšek et al. 2004).

Invasive plants are established plants that have the potential to spread over large distances by reproducing offspring in very large numbers at considerable distances from parental populations (Richardson et al. 2004; Pyšek et al. 2004). Invasive alien plant species are “alien species whose establishment and spread threaten ecosystems, habitats or species with economic harm” (McNeely 2001).

1.2.2. Processes of species invasion

In general, the invasion of a new environment by a species follows three major steps, which include (1) introduction, (2) colonization, and (3) naturalization

(Richardson et al. 2000).

1.2.2.1. Introduction of alien species to new environmnents

The introduction of a plant species into a new environment refers to the arrival of that species from a population of adult plants to an environment beyond their native geographical ranges (Richardson et al. 2000). This introduction may be intentional or accidental (Pyšek et al. 2004). Intentional introduction is the purposeful relocation of a species outside its geographical range to meet a particular human need in its new environment. The purposes of the introduction may be related to agriculture, horticulture, recreation, transportation, and restoration (Van Wilgen et al. 2001).

In most parts of the world, a large number of introduced species are important for human dietary needs. In the United States of America for example, 98% of all food have been introduced from other regions of the world (Pimentel et al. 2005). In

Africa, most staple food such as cassava, maize, goat, and cattle have also been introduced onto the continent. Some of the species that have been introduced as food have now become invasive. An example of such a species includes Mytilus gallaprovincialis Lam., a mussel that was purposely introduced to South Africa in

1979 for mariculture. Today, M. gallaprovincialis is one of the most invasive marine species along the South African coastline (Robinson et al. 2005). Also in South

Africa, 12% of grass species are alien invaders. These grasses were intentionally introduced for agricultural, horticultural, and restoration purposes (Milton 2004). In

1845, Australian Acacia Mill. species were introduced to the Western Cape Province of South Africa for dune stabilization; but today, these species have spread throughout the country (Avis 1989). Furthermore, the free floating aquatic plant,

Eichhornia crassipes (Mart) Solms (water hyacinth), is one of the world’s worst aquatic plants, a noxious invader in South Africa. Eichhornia crassipes was first

recorded in South Africa in 1908 (Stent 1913) after it was introduced in the Cape

Flats as an ornamental plant (Masmane 2007). In addition, a number of submerged invasive aquatic species in South Africa such as Myriophyllum aquaticum (Vell.)

Verdc. (parrot’s feather), Myriophyllum spicatum L. (Eurasian water milfoil), Egeria densa Planch. (Brazilian elodea), and Hydrilla verticillata (L.R.) Royle (Water thyme) have been introduced through the aquarium trade (Martin & Coetzee 2011).

As opposed to intentional introduction, accidental introduction is not driven by any particular purpose or human intention and therefore does not involve any active human involvement. Sources of accidental introductions may be ships, planes, trucks, impure crop seeds, shipping containers, packaging materials, unprocessed logs, and soil surrounding roots of nursery stock (Sakai et al. 2003). For example, the introduction of Ciona intestinalis L. (vase tunicate) is the earliest recorded accidental introduction in South Africa. The species was first recorded in 1955 and distribution patterns indicate that shipping was the dispersal vector for this species

(Robinson et al. 2005). Another species Rattus rattus L. (black rat) was introduced accidentally by trading vessels on their way from the Middle East to South Africa

(Van Wilgen et al. 2008).

Nevertheless, a large number of introduced species do not become permanently established or invasive in their recipient enviroments. Environmental conditions in their new recipient communities might not be conducive for their survival or they might be unable to reproduce successfully. Climatic conditions, competition or predation from native species, diseases, and lack of pollinators are

common drivers for failure of naturalization (Sakai et al. 2003; Van Wilgen et al.

2004).

Alien species that become invasive in a new area are those that have rapid growth, multiple reproductive strategies and are able to self-fertilize, produce multi- seeded fruits, do not require pre-germination seed treatment, have high acclimation potential and high material allocation flexibility (Sakai et al. 2003; Van Wilgen et al.

2004). Generally species with r-selected life history strategies and those that have the ability to shift between r- and K-selected life history strategies are more adaptable to new environments (Sakai et al. 2003). The “r” refers to “rate of reproduction” and “K” refers to “maximum population size”. The r-strategists are organisms that have shorter life spans, fast growth and maturity rate, produce large number of small seeds that are easily dispersed and are usually able to reproduce both asexually and sexually. The K-strategists are organisms that have a long life span, slow growth and large biomass, that produce larger seeds in small quantities and these seeds are not always formed in every growing season (Schulze et al.

2005). An example of an r-strategist is Eichhornia crassipes (water hyacinth), a

South African invasive aquatic plant that is able to reproduce from seed and vegetatively through budding (Henderson & Cilliers 2002). It is also known to self- fertilize (Barrett 1977). Water hyacinth produces an average of 44.2 seeds per fruit

(Barrett 1980). These seeds usually have an average mass of 0.297 mg (Barrett

1988), which favours their dispersal by water. An example of a K-strategist is Zostera marina L., a perennial sea grass that uses a large percentage of its resources for preservation through rhizomes and roots (Harrison 1979) and invests less resources

for reproduction. It reproduces an average of 7.3 seeds per flower annually (Phillips et al. 1983).

1.2.2.2. Colonization

Species that pass through the introduction phase are likely to naturally colonize their new environments (Richardson et al. 2000). The ability to colonize relies, however, on propagule pressure (Theoharides & Dukes 2007), which is the combined measure of the number of individuals introduced in any one release event and the number of discrete release events (Theoharides & Dukes 2007). High propagule pressure is needed for successful colonization of a species since this will probable result in a genetically diverse population of introduced species, and as such increases the potential to adapt to and overcome environmental barriers such as topography, geology, land-use, climate, and biotic interaction (Rouget & Richardson

2003; Lockwood et al. 2005; Theoharides & Dukes 2007).

1.2.2.3. Naturalization

Naturalization is the final stage in the invasion process, where a species becomes established, undertakes widespread dispersal and becomes incorporated within the resident flora (Richardson et al. 2000). For naturalization to take place, invasive alien plant species need to have traits that enhance competitive performance, reduce niche overlap between themselves and native species, and increase resistance to diseases (Theoharides & Dukes 2007). Several hypotheses have been developed to explain the naturalization of alien species in new environments. Such hypotheses include the enemy release hypothesis, the allelopathy hypothesis, the broader tolerance hypothesis, and the hybrid vigour hypothesis.

1.2.2.3.1. The enemy release and Darwin naturalization hypotheses

This hypothesis suggests that, beyond their native environments, alien species are released from their co-evolved predators, pathogens, and herbivores and this relief from enemies promotes species invasion success (Maron & Vila 2001; Zedler &

Kercher 2004). This hypothesis is corroborated by numerous evidence. For example,

Keane & Crawley (2002) demonstrated that alien plants grow larger, reproduce more and live longer in the absence of pathogens. In addition, an earlier study showed that, due to enemy release, 62% of the invasive plants were larger, 56% have higher reproduction rates and 62% were subjected to less damage-induced herbivores in new environments than in its native ranges (Hawkes 2007). Similarly, Buddleja davidii Franch. (butterfly bush) had increased vigour in their introduced ranges, and in new areas, invasive B. davidii plants are taller and have thicker stems, longer inflorescences and larger seeds than in native ranges due to less herbivory and escape from natural enemies (Ebeling et al. 2008). The enemy release hypothesis was also tested for 473 European plant species invasive to the United States. These plants were experimentally contaminated with viruses and fungi. It was found that, on average, 84% less fungi and 24% less virus species successfully infect each plant species in its naturalized range than in its native range (Mitchell & Power 2003). A generally overview of the hypothesis is illustrated in Fig. 1.1.

Darwin’s naturalization hypothesis is similar but not equivalent to the enemy release hypothesis. It predicts that, in new environments, the absence of species that are closely related to introduced species would favour the invasion success of the latter (Darwin 1989). This invasion success is the result of the absence of niche

overlap between native and introduced species, and thus the absence of biotic competition (unlike in native ranges). However, the evidence of Darwin naturalization hypothesis has been mixed: whilst support to the hypothesis has been demonstrated in a number of studies (Ricciardi & Atkinson 2004; Strauss et al. 2006; Jiang et al.

2010; Ordonez et al. 2010; Tecco et al. 2010; Bezeng et al. 2013), some other studies discount its validity (Daehler 2001; Lambdon & Hulme 2006; Ricciardi &

Mottiar 2006; Diez et al. 2009).

B A

Fig. 1.1. An illustration of the enemy release hypothesis. (A) Nymphaea nouchali fails to spread in its native environment where the natural enemies are present; (B)

Nymphaea mexicana spreads very quickly in South Africa where the species is alien and has no co-evolved enemies.

1.2.2.3.2. The allelopathy hypothesis

This hypothesis suggests that some plants form monotypic stands by releasing secondary metabolites that inhibit growth, germination, and other ecophysiological traits of indigenous flora (Zedler & Kercher 2004; Lorenzo et al. 2013). Yaun et al.

(2012) compared the allelochemical products of Solidago canadensis L. (Canada

golden-rod) grown in their native area (USA) to those of species in exotic environments (China). The allepothatic effects were tested on the native Chinese plant, Kummerowia striata (Thunb.) Schindl. (Japanese clover). Their results showed that S. canadensis plants growing in China had more allelopathic compounds than those growing in the USA and had a negative impact on the growth of K. striata

(Yaun et al. 2012). Furthermore, a test of leaf palatability to herbivores in natural vs. new areas in New York, Ontario, and Massachusetts showed that invasive alien plants in new areas are 96% less palatable due to novel phytochemicals with anti- herbivore and antimicrobial properties (Cappuccino & Carpenter 2005).

1.2.2.3.3. The broader tolerance hypothesis

The broader tolerance hypothesis suggests that exotic species have wider tolerance to environmental conditions (Zedler & Kercher 2004). For example, Euphorbia esula

Kotschy ex Boiss. (leafy spurge) is an erect perennial herb with a dense root system that is about 4.5 m long. It invades temperate grasslands in North America where fire is used as a method of ecological management and restoration. This plant is able to resprout from severe fire injuries, making it a threat to native biodiversity (Grace et al. 2001). The European invasive plant, Solidago canadensis, growing on experimental contaminated and uncontaminated soil showed that plants growing in contaminated soils exhibited a complex proteome response when experiencing a multi-contaminated soil and those growing on contaminated soil had similar growth and reproduction rates to plants growing on uncontaminated soil (Immel et al. 2012).

In South Africa, the alien aquatic weed Eichhornia crassipes is able to grow at low, medium and high nitrogen and phosphorus nutrient concentrations. At high nutrient concentrations, the plants produce more than double the amount of leaves and

daughter plants than at low concentrations. These plants also produce more chlorophyll content at higher nutrient concentrations (Coetzee et al. 2009).

1.2.2.3.4. The hybrid vigour hypothesis

Hybridization may lead to broader tolerance through adaptive evolution. The hybridization increases population heterozygosity, which may favour the naturalization of hybrids due to increased adaptation to new environments (Ellstrand

& Schierenbeck 2000). For example, the genus Fallopia Adans. was introduced to the Czech Republic as ornamental plants. Studies on the regeneration rates of the genus showed that the hybrids of Fallopia sachalinensis (F.Schmidt) Ronse Decr.

(Giant Knotweed) and Fallopia japonica (Houtt.) Ronse Decr. (Japanese knotweed), had higher regeneration rates than either parental species (Bailey et al. 2007).

Another study showed that hybridization contributed to the fitness and invasion of F. bohemica (Pyšek et al. 2003). Furthermore, in Belgium, studies on the reproduction of the exotic genus Fallopia showed that hybrids of exotic F. japonica and F. sachalinensis had higher levels of male fertility compared to both parental populations (Bailey et al. 2007; Tiebre et al. 2007). In South Africa, Canna generalis

L.H. Bailey (garden canna), a hybrid of North American, C. flaccida Roscoe

(bandanna of the Everglades), and Indian C. indica L. (Indian shot) (Scheper &

Christman 2003) is now an aquatic invader that threatens native wetlands and river bank species.

1.2.3. Impacts of invasive alien plants

Invasive alien plants represent a significant threat ecologically and economically at global and local scales (Capers et al. 2007) and pose the largest threats to South

Africa’s biodiversity worldwide (Richardson & Van Wilgen 2004). The most concerning ecological impacts of invaders are ecosystem disruption and loss of biodiversity, which could lead to global and local extinction.

1.2.3.1. Ecological impacts of invasive alien plants

The impact of invasive alien plants on biodiversity begins with the alteration of abiotic conditions that are important for the survival of native species. Alien plants alter ecosystems because they have different ecophysiological traits than native species

(Dassonville et al. 2008). According to Richardson & Van Wilgen (2004), a global review on the effects of plant invasion suggests that the most destructive species change ecosystems by using excessive amounts of resources, adding resources, facilitating or suppressing fires, stabilizing sand movements or promoting erosion, accumulating leaf litter or redistributing salts. Also, invasive alien plants modify trophic resources within food webs and alter physical resources such as habitats and niches (Higgins et al. 1999).

Australian Acacia species are known to reduce the abundance and diversity of native plants by reducing soil-stored seed banks, and changing litter dynamics as well as nutrient cycles (Richardson & Van Wilgen 2004). Invasive alien plants usually achieve higher biomass than their native counterparts by either developing larger shoots or fast growth or by increasing ground cover. High biomass results in higher production of leaf litter upon senescence. Soil chemistry is altered when nutrients are returned to the soil as leaf litter (Dassonville et al. 2008). Acacia cyclops A.Cunn. ex

G.Don (red-eyed wattle) and Acacia saligna H.L.Wendl. (Port Jackson willow) are known to alter nutrient cycling regimes in nutrient deficient systems in the Fynbos

due to nitrogen-fixing abilities (Van Wilgen et al. 2001). Research done on the N- cycling ability of A. saligna in the Fynbos showed that it produces four times more litter than Fynbos species. Nitrogen returned to the soil was 10 times greater in

Acacia plots than Fynbos plots (Yelenik et al. 2004). The invasion of trees in the

Fynbos vegetation, which has low tree cover, has drastically altered animal habitats and endangered native plants (Van Wilgen et al. 2001).

Invasive alien plants can change the occurrence frequency and intensity of fires in their environment. Invaders that alter fire regimes are regarded as the most important ecosystem-altering species worldwide (Mooney & Hobbs 2000).

Caesalpinia decapetala (Roth) Alston (cat's claw) and Chromolaena odorata (L.)

R.M.King & H.Rob. (devil weed) are flammable forest and riverine woodland invaders that form ladders for fires to get into crowns of fire-sensitive trees, changing the microclimate and vegetation. The resulting intense fires cause severe damage to soils, resulting in erosion and flooding (Van Wilgen et al. 2001).

Invasive alien plants can also threaten biodiversity by altering the ecological niches of certain species. Of the globally red-listed Odonata Fabricius (dragonflies) species, 7.4% are endemic to South Africa. South African dragonflies are threatened by riverine Acacia species (mainly Acacia mearnsii De Wild. (black wattle) and

Acacia longifolia Paxton (long-leaved wattle). These trees form canopies that shade out the understorey and prevent the growth of grass, which provides oviposition sites for the dragonflies (Samways & Taylor 2004). The invasion of Chromolaena odorata in a riparian area increases shading on river banks. This leads to altered sex ratios of native crocodiles due to temperature reduction in nests (Richardson & Van Wilgen

2004). This altered sex ratio could possibly result in the long term extinction of the species.

Invasive alien plants can also suppress or replace native species. The

Brazilian pepper tree (Schinus terebinthifolius Raddi) is a wetland and riverine invader that is characterized as one of the world’s worst invaders. It is a vigorous invader that replaces native vegetation by shading them out and forming monotypic stands. Other invasive tree species become parasitic on indigenous plants. The umbrella tree, Schefflera actinophylla (Endl.) Harms is an aggressive invader that grows on a native tree, strangling and killing it when it becomes established

(Bromilow 2010).

1.2.3.2. Economic impacts of invasive alien plants in South Africa

Invasive alien plants do not only threaten biodiversity and ecosystem services but also economic development. They reduce agricultural crop yield, forest and fisheries, water availability, increase the spread of diseases, and obstruct transportation routes

(Van Wilgen et al. 2001). Economic losses also occur due to inspection costs to prevent occurrence of unwanted species, eradication programmes, on-going control, and restoration activities (Hoddle 2004).

South Africa is an arid country with a long history of biological invasions dating back as far as the 1970s (Gorgens & Van Wilgen 2004). A large amount of the country’s revenue is spent on controlling alien species that threaten water resources.

South Africa receives an average precipitation of approximately 500 mm/annum, which is well below the 860 mm/annum world average. The alien Acacia, Eucalyptus

L'Hér., Hakea Schrad., Pinus L., and Prosopis L. species take up 3 300 mm of water per annum, which is about 7% of the country’s runoff (Blignaut et al. 2007). Water loss results in limited development, agriculture, and service delivery.

Azolla filiculoides Lam. (red water fern) is one of the most damaging water weeds in South Africa. It is responsible for reducing water quality, increasing water- related pathogens, and the deterioration of aquatic biodiversity (Henderson & Cilliers

2002). Clearing of this species cost the country R628 million (US$ 58 million) before biological control was established (Van Wilgen et al. 2001). High rates of evapotranspiration by large biomasses of aquatic invasive plants also lead to water loss. Another invasive water weed, Eichhornia crassipes (water hyacinth), has invaded a large number of water bodies in South Africa forming dense water mats that can cover entire water surfaces. Plants clog water ways and irrigation equipment, reduce water flow, impede navigation and recreational activities. Invasive aquatic plants also reduce light penetration and oxygen levels resulting in poor water quality. A study by Van Wyk & Van Wilgen (2002), showed that herbicidal control of water hyacinth, which is highly efficient in the short-term cost South Africa R1 481/ha

(US$ 139) while biological control offers a long-term solution and costs only R309/ha

(US$ 28.97). In another study, mechanical control of water hyacinth along Benoni

Lake cost the state R8 million (US$ 750 thousand) (Van Wyk & Van Wilgen 2002).

The South African government established the ‘Working for Water’ (WfW) programme in 1995 with the aim of protecting water supply threatened by invasive alien plants. The programme has had huge success in controlling noxious plants.

The ‘Working for Water’ programme has spent R1.59 billion (US$ 1.49 million) on its

clearing activities from 1995 to 2002 (Van Wilgen 2004). Van Wilgen & Lange (2011) reported that the economic cost of controlling biological invasion has currently risen above R6.5 billion (US$ 610 million), which is 0.3% of the country’s GDP and this amount could rise above 5% if invasive species are allowed to reach their full potential. It is estimated that the country will spend R600 million (US$ 562 000) per year over a period of 20 years to clear biological invasions (Versfeld et al. 1998).

This expenditure to control biological invasions is taxing for a developing country that needs improvement in its infrastructure, education, health, and service delivery.

1.3. Management of invasive aquatic plants in South Africa

Water is the basis of all life forms on earth, which makes it the most valuable natural resource. The management of water bodies is therefore important to sustain normal functions of life. It is imperative for a country to protect its water resources from pollution, disease-carrying organisms, and invasive alien plants. South Africa has some of the most nutrient-enriched rivers in the world due to the growing human population and urbanization, which has made the country susceptible to invasion by fresh water plants (Coetzee et al. 2009).

1.3.1. Classification of invasive aquatic plants

Aquatic plants are classified according to the habitat in which they grow, their size, shape, and habits (Lancar & Krake 2002). There are three categories of aquatic plants namely; emergent, submerged, and floating plantsts.

1.3.1.1. Emergents plants

These are weeds that grow in shallow waters or environments near water such as ponds, drainage ditches, banks of rivers and canals (Lancar & Krake 2002). Plants in this category are rooted in the substrate, with stems, flowers and most leaves above the water surface (Henderson & Cilliers 2002). Fig. 1.2. provides some examples of emergents plants in South Africa.

1.3.1.2 Floating plants

These plants grow and complete their life cycle in water (Lancar & Krake 2002).

Plants in this category may be unattached and float on the surface of the water becoming rooted in mud when water levels drop or may be rooted in the substrate with mature leaves floating on the water surfaces (Gerber et al. 2004). Examples are presented in Fig. 1.3.

1.3.1.3. Submerged plants

These plants grow in and reproduce beneath the water surface (Lancar & Krake

2002). Plants are rooted in the substrate with leaves that are feathery or linear.

Flowers are usually produced above the water surface (Gerber et al. 2004). Fig. 1.4 provides some examples of submerged plants in South Africa.

Fig. 1.2. Emergent aquatic plants. (A) Lythrum salicaria, (B) Ipomoea carnea subsp. fistulosa, (C) Arundo donax, (D) Iris pseudocorous, (E) Pontederia cordata, and (F)

Sagittaria platyphylla. Photographs: by (A) M. Heyde, (B) T. Gerus, (C) C.H. Deff,

(D) M. Ann, (E) M. Harpur, and (F) S. Ryu.

Fig. 1.3. Floating aquatic plants. (A) Eichhornia crassipes, (B) Salvinia molesta, (C)

Nymphaea mexicana, (D) Azolla filiculoides, and (E) Pistia stratiotes. Photographs: by (A) A.F. Morod, (B) C.J. Cilliers, (C) M. Keim, and (D) D. Beaudette.

Fig. 1.4. Submerged aquatic plants. (A) Cabomba caroliniana, (B) Egeria densa, (C)

Myriophyllum spicatum, (D) Myriophyllum aquaticum, and (E) Hydrilla verticillata.

Photographs: by (A) S.A. Nichols, (B) C.J. Cilliers, (C) L. Henderson, and (E) R.

Aguilar.

1.3.2. Management actions

There are three management objectives for invasive alien plants, namely a) prevention, b) early detection and rapid response, and c) control and eradication.

1.3.2.1. Preventive actions

Preventative action includes steps that need to be taken to avoid the introduction of aquatic invasive plants into the country. There are traditionally two approaches to prevent the introduction of aquatic plants, including an Environmental Education

Approach, and a Legislative Approach (Poona 2013). However, these approaches have been shown to be limited over the past years due to the increasing number of invasive alien species recorded in the country (South Africa). As such, additional approaches are required, and this could be provided by DNA barcoding to facilitate and accelerate accurate species identification (Ghahramanzadeh et al. 2013; see details in Section 1.3.2.2 below).

1.3.2.1.1. Environmental education approach

Environmental education is an initiative that increases people’s knowledge and awareness of: i) how the natural environment functions; ii) the services it provide and the need to protect these services (i.e. ecosystem services); and iii) how to protect natural environments to sustain the provision of ecosystem services. It aims to educate people about challenges associated with the ecosystem and natural resource management and encourages them to develop necessary skills and expertise to address challenges and take responsible actions regarding the environment (Poona 2013). The Working for Water Programme, the South African

National Biodiversity Institute (SANBI) and the Wildlife and Environmental Society of

South Africa (WESSA) are three major organizations that diligently carry out environmental education initiatives in the country. The WfW programme is specifically aimed at educating landowners and the general public about impacts regarding aquatic plants. One of the major objectives is to ensure that nurseries do not import and distribute aquatic plants without permits (Poona 2013). WfW also runs the National Teachers’ Conference and the National Weed Buster campaign, which focus on: i) the growing threat of alien invasions of water resources; ii) water related issues; iii) biodiversity; and iv) climate change (Letsebe 2010). SANBI and WESSA run awareness campaigns such as the “Stop the Spread” programme, which encourages public intervention in supporting and managing the spread of aquatic plants (Poona 2013). In 2012 for example, SANBI also launched the Invasive

Species Alert programme, which is an informative series focusing on emerging invasive weeds in the country (South African National Biodiversity Institute 2012).

1.3.2.1.2. Environmental legislative approach

One major advance that the South African government has taken to prevent the introduction of aquatic plants in the country is through quarantine, which is a legislative tool to control the movement or existence of plants or any reproductive material so that the introduction or spread of a weed may be prevented or restricted

(Lancar & Krake 2002). Successful quarantine measures are determined by knowledge and proper guidelines to be followed regarding the import and trade of exotic species.

South Africa under the National Environmental Management: Biodiversity Act

10 of 2004 (NEM:BA) has drafted regulations to prevent the introduction and spread

of invasive aquatic plants or those that are noxious weeds in other countries that share similar invaders as South Africa, such as Australia and New Zealand. Species that fall under section 70 of the Act cannot be propagated, grown, bought or sold without a permit. There are three categories, which explain restricted activities regarding aquatic plants:

 Category 1: Species that fall into this category are prohibited in South Africa and

by law should be eradicated from the environment. No permit should be issued.

 Category 2: Species that fall into this category require a demarcation permit to

be propagated, grown, bought or sold. No permit will be issued for specimens to

be planted in riparian zones.

 Category 3: Species in this category require an individual permit to import,

possess, grow, or breed. No further planting or trade is allowed nor will a permit

be issued for plants to exist in riparian zones (NEM:BA 2004).

South Africa has also signed multilateral agreements and customary international laws with global organizations such as the International Plant Protection

Convention (IPPC), Convention on Biological Diversity (CBD), Weed Risk

Assessment (WRA), International Maritime Organization (IMO), World Trade

Organization (WTO), and the Convention on International Trade in Endangered

Species of Wild Flora and Fauna (CITES), which provide a framework of principles to guide countries in developing measures to reduce the threat from invasive species

(Burgiel et al. 2006; Simons & De Poorter 2009). Such guidelines include pre-border, at-border and post-border measures. Pre-border measures include pest control in production fields, quality control measures in packaging facilities, inspection during production, and pest proof packaging. At-border measures include certification,

treatment, visual inspection, remote inspection, and quarantine in border facilities.

Post-border measures include domestic inspection, monitoring around entry and post entry areas, and tracking movement of certain products (Burgiel et al. 2006).

1.3.2.2. Early detection and rapid response (EDRR)

Preventing the introduction of alien invasive plants is the first step to confining biological invasions. Efficient prevention measures do not completely guarantee that invasive alien plants will not be introduced into the country. The second step to confining biological invasions is through Early Detection and Rapid Response

(EDRR) (Wilson et al. 2013). The national EDRR programme known as SANBI

Invasive Species Programme (SANBI ISP) is implemented by SANBI, which is responsible for management and conservation of biodiversity in South Africa

(NEM:BA 2004). The mission of the SANBI ISP is to protect the country’s biodiversity and ecosystem services from the negative impact of invasive plants. The objectives of the programme include: early detection, identification and verification of alien plants, risk assessment, and response planning (Wilson et al. 2013).

1.3.2.2.1. Early detection

The SANBI ISP programme has a number of official scientists and a voluntary network of ‘spotters and experts’. This network includes farmers involved in stewardship programmes, educators, ecological club members, botanical society members or professional botanists who go into the field to detect alien species (see www.sanbi.org)

1.3.2.2.2. Identification and verification with emphasis on DNA barcoding

SANBI has three national herbaria in the country. Plants collected by ‘spotters and experts’ are sent to herbaria for identification and confirmation by taxonomists.

Positive identification requires: (1) good material and locality information, (2) good identification keys or taxonomic literature, (3) specialist knowledge, and (4) material for comparison. However, invasive species identification is problematic due to: (1) poor herbarium/museum records in South Africa, (2) absence or limited information on identity or origin, (3) regional specific literature, e.g. identification keys or taxonomic literature, (4) taxonomic expertise in other countries, (5) search for expertise that may be cumbersome, time consuming and costly, and (6) poor material (sterile or immature) available and phenology, life cycle etc. (Pyšek et al.

2013). There is thus an urgent need to explore complementary methods to using morphological characters only since action/eradication requires identification to the specific level. DNA barcoding, which is the use of short genetic sequences from a standardized part of the genome to identify a species, could provide such a tool/method particularly for invasive aquatic plants (Ghahramanzadeh et al. 2013).

In 2003, researchers at the University of Guelph, Canada, proposed DNA barcoding as a method for identifying (to species level) living organisms and materials devoid of diagnostic features (Hebert et al. 2003). The purpose of their initiative was to have a single gene region that would differentiate species across all taxa. This was found not to be possible as genomes differ considerably across different taxa. At that time, there was only one official barcode for animals, a portion of the mitochondrial cytochrome c oxidase 1 gene (CO1). This gene is not a good barcode for plants due to generally low levels of variability in the mitochondrial DNA

(Chase et al. 2007). The poor resolution of the (CO1) gene for plant taxa, led to

other biological markers being screened that would provide discrimination amongst plant groups. A Consortium for the Barcode of Life (CBOL Plant Working Group) was established consisting of 52 researchers from 25 institutions. The objectives of the group were to test the performance of seven barcoding loci (rpoC1, rpoB, rbcL, matK, trnH-psbA, atpF-atpH, psbK-psbI) for the identification of flowering plants

(CBOL Plant Working Group 2009) and to create a database of voucher referenced

DNA sequences to assist as a universal library for which comparison of unidentified taxa can be made (Kress et al. 2005).

Genes selected as good barcodes must be universal, easy to sequence, produce sequences that are simple to align, and show high interspecific and low intraspecific divergence (Blaxter 2004; Kress et al. 2005; Pennise 2007; CBOL Plant

Working Group 2009; Vijayan & Tsou 2010; Hollingsworth et al. 2011; De Vere et al.

2012). In 2008, researchers of the African Centre for DNA Barcoding proposed a single region matK as a universal DNA barcode for plants (Lahaye et al. 2008).

However, the CBOL Plant Working Group selected a combination of rbcLa and matK as the core and official DNA barcodes for plant species (CBOL Plant Working Group

2009). Two other regions, trnH-psbA and nrITS were suggested as supplimentary

DNA barcodes for plants (Hollingsworth et al. 2011; Li et al. 2011). In South Africa, much focus has been placed on terrestrial plant species (e.g. Gere et al. 2013;

Mankga et al. 2013) whereas the efficacy of DNA barcodes in identifying invasive aquatic plants has rarely been evaluated. But Ghahramanzadeh et al. (2013) have recently demonstrated the potential contribution of DNA barcoding in identifying and verifying invasive species in the Netherlands.

1.3.2.3. Risk assessment

In South Africa, once an invasive alien plant species has been identified in the country, the ISP then has the responsibility to assess the risk associated with the newly recorded alien plants (South African National Biodiversity Institute 2013). In invasion biology, a risk assessment is conducted to determine the invasive potential of aquatic plants and the threat they pose to biodiversity. The assessment also aims inter alia to determine the origin of alien aquatic plants and evaluate how current aquatic plants might spread throughout the country (Ecological niche modelling).

For example, Iris pseudacorus L. (yellow flag) is an aquatic weed in temperate parts of the world, native to North Africa, Europe, and Asia. It has been recorded in

South Africa along the banks of the Vaal Dam in 2009 (Henderson 2009). Yellow flag reproduces sexually and also vegetatively through rhizome fragmentation. A recent study assessed the invasion potential of yellow flag by investigating the vegetative propagation efficiency of the species (Jaca 2013). For this purpose, rhizome cuttings of four different lengths were studied to determine the ability to form new individuals.

Results showed that rhizome fragments of as small as 2 cm length were able to develop into new individuals and establish sustainable populations, thus indicating that the species has a strong invasion potential (Jaca 2013).

Another important aspect of risk assessment is to determine the origin of an invasive aquatic plant and the entry points into the country. The determination of origin can be achieved by using, for example, molecular biology techniques. Madeira et al. (2007) were able to determine the origin of Hydrilla verticillata after it was introduced into South Africa in 2006. Four Hydrilla species from South Africa and 30

Hydrilla species from around the world were analysed using plastid trnL intron and trnL-F intergenic spacer sequences. Sequences from South African specimens were identical to specimens from Malaysia and Indonesia. Interviews with aquarists indicated that Malaysia was a major source of aquatic plant species trade in South

Africa (Madeira et al. 2007), thus confirming the results of the molecular analysis.

Furthermore, an important but generally overlooked risk assessment approach in the currently defined management strategy of invasive aquatic plants in

South Africa is to pre-emptively identify areas that are currently uninvaded but susceptible to species invasion in the future. Such areas could be identified by applying, for example, ecological niche modelling (ENM). ENM is a method that uses geographical data in conjunction with environmental data to reconstruct a correlative model of a species’ ecological requirements and predict the relative suitability of a habitat (Warren & Seiffert 2011). The combined use of Geographic Information

Systems (GIS) (Chang 2010) and Climate and Population Modelling Software

(CLIMEX) (Senaratne et al. 2006) has become an important tool in the management of aquatic plants in South Africa. GIS is a computer-based system designed to capture, store, retrieve, analyse, and display spatial data acquired primarily through remote sensing and photometry (Skidmore 2002). CLIMEX is a tool used to assist ecologists with the prediction of a species’ potential relative abundance using climatic and biological data, based on known geographical distribution (Sutherst

2003).

In South Africa, ENM has played an important role in the management of invasive aquatic plants such as Hydrilla verticillata and Alternanthera philoxeroides

(Mart.) Griseb. (alligator weed). Hydrilla verticillata is a submerged aquatic weed in

South Africa originating from Australia and Asia, which is also highly invasive in the

United States of America. It was first recorded in South Africa in 2006 and is only known to occur at Pongolapoort Dam in Kwa-Zulu Natal. A recent study aimed to investigate the potential for H. verticillata to spread to other water bodies in South

Africa using CLIMEX and geographical distributions showed that H. verticillata had the potential to spread to 20 water bodies in the country (Coetzee et al. 2009).

Another study used CLIMEX and geographical distribution data for Alternanthera philoxeroides from North and South America to infer areas suitable for the plants to establish elsewhere in the world. Results showed that most of South Africa is a suitable environment for this species (Julien et al. 1995).

Ecological niche modelling has also been used to determine prospective favourable areas for biological control agents of aquatic plants in South Africa. For example, Eccritotarsus catarinensis Carvalho, a sap sucking insect, was introduced to South Africa as a biological control agent for Eichhornia crassipes. Eccritotarsus catarinensis failed to establish permanent populations at a number of sites where water hyacinth was a problem. A CLIMEX model shows that the establishment of E. catarinensis in South Africa was limited by low winter temperatures (Coetzee et al.

2007). Another study by King (2011) also used ENM to show that other biological control agents for water hyacinth, Neochetina eichhorniae Warner (mottled water hyacinth weevil) and Neochetina bruchi Hustache (chevroned water hyacinth weevil), were also limited by low minimum temperatures and high incidences of frost, whereas these species had high success rates elsewhere in the world.

1.3.2.4. Rapid response planning and implementation

The SANBI ISP has an Invasive Plant Assessment panel, which includes a number of scientists that are responsible for compiling recommended actions that should be taken regarding any newly detected invasion. The activities of this panel along with the regional coordinators of the ISP as well as relevant provincial and local government officials would be facilitated and accelerated with the establishment of a

DNA barcode library and the identification of currently non-invaded water bodies more susceptible to species invasion in the future.

1.3.2.5. Control and eradication

Control and eradiation are actions taken against aquatic plants that threaten South

Africa’s biodiversity through their spread and establishment. Control and eradication efforts include mechanical, chemical, and biological control. Mechanical control of aquatic plants involves removal by hands or by specialised machinery (Fig. 1.5). It is only recommended on invasions less than 1 ha as it becomes labour intensive and expensive. Mechanical control of water weeds has not been very successful in South

Africa due to water depths and obstructions (Henderson & Cilliers 2002).

Chemical control is the use of herbicides to control aquatic plants. For floating and emergent plants, herbicides are sprayed onto the leaves, and for submerged plants, the herbicide is injected into the water. South Africa has nine registered herbicides for aquatic plants (Henderson & Cilliers 2002). Chemical control usually works well when integrated with mechanical and biological control. For example, chemical control was instigated against water hyacinth infestation on the

Nseleni/Mposa River system between 1983 and 1995 without any tangible results. In

1995, chemical control was integrated with mechanical and biological control, and from that time, a total of 18.9 km of the river has been cleared.

Biological control is the use of a plant’s natural enemy, generally insects and pathogens, to decrease weeds to manageable levels (Cilliers 1991a; Charudattan

2001; McConnachie et al. 2003). Efficient biological control agents are available for the five most problematic aquatic plant invaders (Henderson & Cilliers 2002) including, Eichhornia crassipes (Fig. 1.6; King 2011), Pistia stratiotes L. (Cilliers

1991b), Azolla filliculoides (McConnachie et al. 2003), Salvinia molesta D.S. Mitch.

(Cilliers 1991a) and Myriophyllum aquaticum (Cilliers 1991c), which are the most damaging aquatic plants in the country. Rigorous screening processes are used to acquire biological control agents from foreign countries. Only host-specific agents are selected, which depend entirely on specific plants and will not move to other plants when host numbers are reduced. The aim of biological control is not to completely eradicate a plant but to maintain its numbers to acceptable levels.

Biological control is the preferred method for controlling large infestations due to it being cost-effective and environmentally friendly (Henderson & Cilliers 2002). Fig.

1.6 is an illustration of the biological control of Eichhornia crassipes by Neochetina eichhorniae.

Fig. 1.5. Mechanical control of water hyacinth by Working for Water employees.

Photograph: by http://recreationafrica.wordpress.com/2011/02/01/59/

Fig. 1.6. Eichhornia crassipes under biological control by Neochetina eichhorniae.

1.4. Aim and objectives of the study

The fight against invasive plants is generally hampered by the lack of efficient at- border and post-border control measures (Wilson et al. 2013). The aim of this study is to provide the SANBI ISP with a complementary tool and knowledge for pre- emptive actions. Two main objectives were envisioned to reach this aim.

These were to explore:

(1) The use of DNA barcoding as a tool for rapid identification of aquatic invasive

plants; and

(2) The potential of the five most damaging invasive aquatic plants to spread

across water bodies of South Africa based on predicted climate change.

Activities conducted to reach these objectives include:

 Test the efficacy of the core DNA barcodes (rbcLa + matK), the

complementary barcode trnH-psbA and the combination of all three regions in

identifying invasive aquatic plants of South Africa’s freshwater systems.

 Identify the best DNA barcode for invasive plants and provide a DNA library

as well as informative taxa templates for all species included in the current

study.

 Determine current and future areas that are climatically suitable for the

establishment of the five most damaging aquatic plants. This will also help

assess the effects of the changing climate (range contraction or reduction) on

species distribution.

 Identify freshwater systems located in climatically suitable areas. This will

assist SANBI ISP to define pre-emptive actions.

CHAPTER TWO

DNA barcoding

CHAPTER 2

DNA BARCODING OF INVASIVE AQUATIC PLANTS OF SOUTH AFRICA'S

FRESHWATER SYSTEMS

2.1. Introduction

Increasing introductions of alien species to new environments raise concern around the globe due to their negative ecological and economic impacts (Mack et al. 2000;

McGeoch et al. 2010; Pyšek et al. 2010; Pyšek et al. 2011; Suetsugu et al. 2012).

This chapter focuses on alien plant species that invade South Africa’s freshwater systems including rivers, dams, lakes, and irrigation canals. From an ecological perspective, the invasion of these systems poses a serious threat to local biological diversity disrupting ecosystem functioning (Hill 2003). Invasive plants also disrupt the navigation of boats, fishing and recreational activities, reduce water flow and damage hydroelectric infrastructures (Henderson & Cilliers 2002). From an economic perspective, the control and management of invasive species is taxing for developing countries. For example, in South Africa, the clearing of water systems invaded by

Azolla filiculoides and Eichhornia crassipes − using a physical removal approach as opposed to biological control − cost the country US$ 58 million (R 562.6 million) and

US$ 78 000 (R 8 million), respectively, before biological control was instigated against these species (Van Wilgens et al. 2001; Van Wyk & Van Wilgen 2002).

One of the factors limiting efficient control of invasive aquatic plants is that these plants often spread very rapidly either before they are spotted or before decisions are taken to implement control actions. This limitation is further

exacerbated by difficulties in determining the invasion potential of newly introduced or unknown aquatic plants, as well as difficulties inherent to species identification

(Henderson & Cilliers 2002). For example, for a non-specialist to identify invasive aquatic plants in South Africa: i) materials have to be sent to specialist taxonomists making sure that roots, stems, flowers and seeds are all sampled; and ii) submerged water plants have to be preserved in a plastic jar conserved in a fridge for no longer than two days − longer storage requires preservation with a special solution (Gerber et al. 2004). In addition, these precautions must be supported by a good description of the locality where the plants grow as well as their morphological characteristics

(Gerber et al. 2004). These details are important because when any single piece of information is lacking, and/or the morphological features are altered, identification of invasive aquatic plants may become challenging even for experts.

In South Africa, an important body of literature has been devoted to the study of terrestrial invasive alien plants, with a specific interest into what drives their invasion success in the country (e.g. Van Wilgen et al. 2001; Richardson & Van

Wilgen 2004; Bezeng et al. 2013). In contrast, there has been relatively less emphasis on aquatic ecosystems especially regarding the development of molecular tools that can help accelerate the process of species identification. To this end, there is a need to establish a concrete pre-emptive action plan such that invasive and potentially invasive species can be identified at an early stage of their introduction or even before they are introduced to freshwater systems. A recent study in the

Netherlands clearly demonstrated the need for and efficacy of DNA barcoding in the identification of invasive aquatic plants (Ghahramanzadeh et al. 2013). This study confirms the establishment of a DNA barcode library as an important step towards a

concrete pre-emptive action plan for the management of invasive aquatic plants.

Such a library (DNA barcoding), which provides a complementary tool to morphology-based species identification is still lacking in South Africa, a country well-known as one of the most inclined to species invasion (Richardson & Van

Wilgen 2004).

In this Chapter, l propose, following Ghahramanzadeh et al. (2013), that a

DNA barcoding approach would also be a valuable tool to accelerate the identification process of invasive aquatic plants in South Africa. The rationale of DNA barcoding technique is that a short DNA sequence of a standardized genome region would be variable enough to distinguish between species (Hebert et al. 2003). The technique has been successfully applied to clarify information about target weeds, such as taxonomy, evidence of hybridization, population structure and species origins, which are important factors for the successful control of alien invasive species (Valentini et al. 2009; Gaskin et al. 2011).

Officially, two regions, known as core DNA barcodes (rbcLa and matK), are identified as DNA barcodes for land plants (CBOL Pant Working Group 2009). The discriminatory power of the core DNA barcodes was estimated at 70-80% (Kress &

Erickson 2007; CBOL Pant Working Group 2009; Fazekas et al. 2009). However, recent studies indicate that the efficacy of the core barcodes has been overestimated

(Hollingsworth et al. 2009; Pettengill & Neel 2010; Roy et al. 2010; Wang et al. 2010;

Clement & Donoghue 2012). Furthermore, barcoding efficacy is rarely evaluated in a phylogenetic context (but see Clement & Donoghue 2012). As a result of the limited

efficacy of the core DNA barcodes, two additional regions, trnH-psbA and nrITS were suggested as complementary barcodes (Hollingsworth et al. 2011; Li et al. 2011).

In this chapter, my objectives are twofold: i) identify the best DNA barcodes for invasive aquatic plants of South Africa’s freshwater systems; and ii) establish a

DNA barcode library for these plants. In particular, I limit the search of best barcode to only the core barcodes (rbcLa + matK), trnH-psbA, and the core barcodes + trnH- psbA.

2.2. Material and Methods

2.2.1. Taxon sampling and taxa templates

Twenty-one (21) species are currently recorded as invasive alien plants of freshwater systems in South Africa. In this study, 19 species (~ 90%) representing

11 plant families were sampled and analysed as explained below. Species were identified using relevant literature (Henderson & Cilliers 2002; Gerber et al. 2004;

Milton 2004; Maderia et al. 2007, Coetzee et al. 2009; Henderson 2009) including the Southern African Plant Invaders Atlas (www.agis.agric.za). In addition, seven species belonging to seven plant families were identified as native opportunistic aquatic plants; these native species become invasive in disturbed aquatic ecosystems (Henderson & Cilliers 2002). All the native and invasive plant species analysed in this Chapter (26 species) were collected from several watercourses in five Provinces of South Africa, including Gauteng, Limpopo, Mpumalanga, Kwazulu

Natal, and the Eastern Cape. Furthermore, I also included an additional seven aquatic plants that I purchased from aquaria in Johannesburg (Gauteng, South

Africa). Of these seven aquarium species, three are found among the 19 invasive

species that I sampled from the field. In total, 30 aquatic plant species are analysed in this study.

The 30 species sampled are presented with a detailed description as "taxa templates" in Appendix. In the taxa templates, the following information are included: field pictures, common names, synonyms, classification, description, native distribution range, distribution range in South Africa, habitat, how the species spreads, invasion category, environmental impacts, and DNA barcodes. Voucher specimens for the taxa used in this study and GenBank accession numbers are listed in Table 2.1.

Table 2.1 List of taxa with voucher information and GenBank accession number (if available) for each DNA region.

Family Plant name Voucher (Herbarium) GenBank Accession Numbers

rbcLa matK trnH-psbA

Acanthaceae Hygrophila polysperma T. Anderson HVK0044a (JRAU) KJ747521 KJ747612 KJ794331

Acanthaceae Hygrophila polysperma T. Anderson HVK0044b (JRAU) KJ747522 KJ747613 KJ794332

Acanthaceae Hygrophila polysperma T. Anderson HVK0044c (JRAU) KJ747523 KJ747614 KJ794333

Alismataceae Sagittaria platyphylla (Engelm.) J.S. Sm. HVK0030a (JRAU) KJ747502 KJ747602 KJ794299

Alismataceae Sagittaria platyphylla (Engelm.) J.S. Sm. HVK0030b (JRAU) KJ747503 KJ747603 KJ794300

Alismataceae Sagittaria platyphylla (Engelm.) J.S. Sm. HVK0030c (JRAU) KJ747504 KJ747604 KJ794301

Alismataceae Sagittaria platyphylla (Engelm.) J.S. Sm. HVK0030d (JRAU) KJ747505 KJ747605 KJ794302

Alismataceae Echinodorus cordifolius (L.) Griseb. HVK0034a (JRAU) KJ747514  KJ794304

Alismataceae Echinodorus cordifolius (L.) Griseb. HVK0034b (JRAU) KJ747515  KJ794305

Table 2.1 continued. List of taxa with voucher information and GenBank accession number (if available) for each DNA region.

Family Plant name Voucher (Herbarium) GenBank Accession Numbers

rbcLa matK trnH-psbA

Alismataceae Echinodorus cordifolius (L.) Griseb. HVK0034c (JRAU) KJ747516  KJ794306

Amaranthaceae Alternantera philoxeroides (Mart.) Griseb. HVK0045a (JRAU) KJ747524 KJ747620 

Amaranthaceae Alternantera philoxeroides (Mart.) Griseb. HVK0045b (JRAU) KJ747525 KJ747621 

Amaranthaceae Alternantera philoxeroides (Mart.) Griseb. HVK0045c (JRAU) KJ747526 KJ747622 

Araceae Pistia stratiotes L. HVK002a (JRAU) KJ747421 KJ747527 KJ794230

Araceae Pistia stratiotes L. HVK002b (JRAU) KJ747422 KJ747528 KJ794231

Araceae Pistia stratiotes L. HVK002c (JRAU) KJ747423 KJ747529 KJ794232

Araceae Pistia stratiotes L. HVK002d (JRAU) KJ747424 KJ747530 KJ794233

Araceae Pistia stratiotes L. HVK002e (JRAU) KJ747425 KJ747531 KJ794234

Family Plant name Voucher (Herbarium) GenBank Accession Numbers

rbcLa matK trnH-psbA

Table 2.1 continued. List of taxa with voucher information and GenBank accession number (if available) for each DNA region.

Family Plant name Voucher (Herbarium) GenBank Accession Numbers

rbcLa matK trnH-psbA

Brassicaceae Nasturtium officinale R.Br. DMP380 (JRAU)   

Brassicaceae Nasturtium officinale R.Br. KMS-0190 (JRAU)   

Brassicaceae Nasturtium officinale R.Br. DMP334 (JRAU)   

Brassicaceae Nasturtium officinale R.Br. DMP299 (JRAU)   

Cannaceae Canna indica L. HVK0028a (JRAU) KJ747497 KJ747598 

Cannaceae Canna indica L. HVK0028b (JRAU) KJ747498 KJ747599 

Cannaceae Canna indica L. HVK0028c (JRAU) KJ747499 KJ747600 

Family Plant name Voucher (Herbarium) GenBank Accession Numbers

rbcLa matK trnH-psbA

Cannaceae Canna indica L. HVK0028d (JRAU) KJ747500 KJ747601 

Cannaceae Canna indica L. HVK0028e (JRAU) KJ747501 

Table 2.1 continued. List of taxa with voucher information and GenBank accession number (if available) for each DNA region.

Family Plant name Voucher (Herbarium) GenBank Accession Numbers

rbcLa matK trnH-psbA

Cannaceae Canna x. generalis HVK0010a (JRAU) KJ747445  KJ794334

Cannaceae Canna x. generalis HVK0010b KJ747446  KJ794335

Cannaceae Canna x. generalis HVK0010c KJ747447  KJ794336

Cannaceae Canna x. generalis HVK0010d KJ747448  KJ794337

Cannaceae Canna x. generalis HVK0010e KJ747449  KJ794338

Family Plant name Voucher (Herbarium) GenBank Accession Numbers

rbcLa matK trnH-psbA

Ceratophyllaceae Ceratophyllum demersum L. HVK0015a (JRAU) KJ747460 KJ747564 KJ794265

Ceratophyllaceae Ceratophyllum demersum L. HVK0015b (JRAU) KJ747461 KJ747565 KJ794266

Ceratophyllaceae Ceratophyllum demersum L. HVK0015c (JRAU) KJ747462 KJ747566 KJ794267

Table 2.1 continued. List of taxa with voucher information and GenBank accession number (if available) for each DNA region.

Family Plant name Voucher (Herbarium) GenBank Accession Numbers

rbcLa matK trnH-psbA

Convolvulaceae Ipomoea carnea Jacq. subsp. fistulosa (Mart. ex HVK0012a (JRAU)  KJ747549 KJ794307 Choisy) D. F. Austin

Convolvulaceae Ipomoea carnea Jacq. subsp. fistulosa (Mart. ex HVK0012b (JRAU)  KJ747550 KJ794308 Choisy) D. F. Austin

Family Plant name Voucher (Herbarium) GenBank Accession Numbers

rbcLa matK trnH-psbA

Convolvulaceae Ipomoea carnea Jacq. subsp. fistulosa (Mart. ex HVK0012c (JRAU)  KJ747551 KJ794309 Choisy) D. F. Austin

Convolvulaceae Ipomoea carnea Jacq. subsp. fistulosa (Mart. ex HVK0012d (JRAU)  KJ747552 KJ794310 Choisy) D. F. Austin

Convolvulaceae Ipomoea carnea Jacq. subsp. fistulosa (Mart. ex HVK0012e (JRAU)  KJ747553 KJ794311 Choisy) D. F. Austin

Haloragaceae Myriophyllum aquaticum (Vell.) Verdc. HVK0025a (JRAU) KJ747488  KJ794312

Table 2.1 continued. List of taxa with voucher information and GenBank accession number (if available) for each DNA region.

Family Plant name Voucher (Herbarium) GenBank Accession Numbers

rbcLa matK trnH-psbA

Haloragaceae Myriophyllum aquaticum (Vell.) Verdc. HVK0025c (JRAU) KJ747489  KJ794314

Family Plant name Voucher (Herbarium) GenBank Accession Numbers

rbcLa matK trnH-psbA

Haloragaceae Myriophyllum aquaticum (Vell.) Verdc. HVK0025d (JRAU) KJ747490  KJ794315

Haloragaceae Myriophyllum aquaticum (Vell.) Verdc. HVK0025e (JRAU) KJ747491  KJ794316

Haloragaceae Myriophyllum spicatum L. HVK0031a (JRAU) KJ747506  KJ794317

Haloragaceae Myriophyllum spicatum L. HVK0031b(JRAU) KJ747507  KJ794318

Haloragaceae Myriophyllum spicatum L. HVK0031c (JRAU) KJ747508  KJ794319

Hydrocharitaceae Lagarosiphon muscoides Harv. HVK0023a (JRAU) KJ747483 KJ747588 KJ794292

Hydrocharitaceae Lagarosiphon muscoides Harv. HVK0023b (JRAU) KJ747484 KJ747589 

Hydrocharitaceae Lagarosiphon muscoides Harv. HVK0023c (JRAU) KJ747485 KJ747590 

Table 2.1 continued. List of taxa with voucher information and GenBank accession number (if available) for each DNA region.

Family Plant name Voucher (Herbarium) GenBank Accession Numbers

rbcLa matK trnH-psbA

Hydrocharitaceae Lagarosiphon muscoides Harv. HVK0023d (JRAU) KJ747486 KJ747591 

Hydrocharitaceae Egeria densa Planch. HVK0032a (JRAU) KJ747510 KJ747607 KJ794294

Hydrocharitaceae Egeria densa Planch. HVK0032b (JRAU) KJ747511 KJ747608 KJ794295

Hydrocharitaceae Egeria densa Planch. HVK0032c (JRAU) KJ747512 KJ747609 KJ794296

Hydrocharitaceae Egeria densa Planch. HVK0032d (JRAU) KJ747513 KJ747610 KJ794297

Hydrocharitaceae Hydrilla verticillata (L.f.) Royle HVK0046a (JRAU) KJ747416  KJ794220

Hydrocharitaceae Hydrilla verticillata (L.f.) Royle HVK0046b (JRAU) KJ747417  KJ794221

Hydrocharitaceae Hydrilla verticillata (L.f.) Royle HVK0046c (JRAU) KJ747418  KJ794222

Hydrocharitaceae Hydrilla verticillata (L.f.) Royle HVK0046d (JRAU) KJ747419  KJ794223

Table 2.1 continued. List of taxa with voucher information and GenBank accession number (if available) for each DNA region.

Family Plant name Voucher (Herbarium) GenBank Accession Numbers

rbcLa matK trnH-psbA

Hydrocharitaceae Hydrilla verticillata (L.f.) Royle HVK0046e (JRAU) KJ747420  KJ794224

Hydrocharitaceae Vallisneria spiralis L. HVK0021a (JRAU) KJ747480  KJ794289

Hydrocharitaceae Vallisneria spiralis L. HVK0021b (JRAU) KJ747481  KJ794290

Hydrocharitaceae Vallisneria spiralis L. HVK0021c (JRAU) KJ747482  KJ794291

Iridaceae Iris pseudacorus L. HVK0038a (JRAU) KJ747517 KJ747615 KJ794326

Iridaceae Iris pseudacorus L. HVK0038b (JRAU) KJ747518 KJ747616 KJ794327

Iridaceae Iris pseudacorus L. HVK0038c (JRAU) KJ747519 KJ747617 KJ794328

Iridaceae Iris pseudacorus L. HVK0038d (JRAU) KJ747520 KJ747618 KJ794329

Iridaceae Iris pseudacorus L. HVK0038e (JRAU)  KJ747619 KJ794330

Table 2.1 continued. List of taxa with voucher information and GenBank accession number (if available) for each DNA region

Family Plant name Voucher (Herbarium) GenBank Accession Numbers

rbcLa matK trnH-psbA

Menyanthaceae Nymphoides brevipedicellata (Vatke) A. Raynal HVK0013a (JRAU) KJ747450 KJ747554 KJ794256

Menyanthaceae Nymphoides brevipedicellata (Vatke) A. Raynal HVK0013b (JRAU) KJ747451 KJ747555 KJ794257

Menyanthaceae Nymphoides brevipedicellata (Vatke) A. Raynal HVK0013c (JRAU) KJ747452 KJ747556 KJ794258

Menyanthaceae Nymphoides brevipedicellata (Vatke) A. Raynal HVK0013d (JRAU) KJ747453 KJ747557 KJ794259

Menyanthaceae Nymphoides brevipedicellata (Vatke) A. Raynal HVK0013e (JRAU) KJ747454 KJ747558 

Menyanthaceae Nymphoides indica (L.) Kuntze HVK0014a (JRAU) KJ747455 KJ747559 KJ794260

Menyanthaceae Nymphoides indica (L.) Kuntze HVK0014b(JRAU) KJ747456 KJ747560 KJ794261

Menyanthaceae Nymphoides indica (L.) Kuntze HVK0014c (JRAU) KJ747457 KJ747561 KJ794262

Menyanthaceae Nymphoides indica (L.) Kuntze HVK0014d (JRAU) KJ747458 KJ747562 KJ794263

Table 2.1 continued. List of taxa with voucher information and GenBank accession number (if available) for each DNA region.

Family Plant name Voucher (Herbarium) GenBank Accession Numbers

rbcLa matK trnH-psbA

Menyanthaceae Nymphoides indica (L.) Kuntze HVK0014e (JRAU) KJ747459 KJ747563 KJ794264

Nymphaeaceae Nymphaea mexicana Zucc. HVK0026b (JRAU) KJ747493 KJ747594 KJ794323

Nymphaeaceae Nymphaea mexicana Zucc. HVK0026c (JRAU) KJ747494 KJ747595 KJ794324

Nymphaeaceae Nymphaea mexicana Zucc. HVK0026d (JRAU) KJ747495 KJ747596 KJ794325

Nymphaeaceae Nymphaea mexicana Zucc. HVK0026e (JRAU) KJ747496 KJ747597 

Nymphaeaceae Nymphaea nouchali Burm.f. var. caerulea HVK007a (JRAU) KJ747436 KJ747540 KJ794247 (Savigny) Verdc.

Nymphaeaceae Nymphaea nouchali Burm.f. var. caerulea HVK007b (JRAU) KJ747437 KJ747541 KJ794248 (Savigny) Verdc.

Nymphaeaceae Nymphaea nouchali Burm.f. var. caerulea HVK007c (JRAU) KJ747438 KJ747542 KJ794249 (Savigny) Verdc.

Table 2.1 continued. List of taxa with voucher information and GenBank accession number (if available) for each DNA region.

Family Plant name Voucher (Herbarium) GenBank Accession Numbers

rbcLa matK trnH-psbA

Nymphaeaceae Nymphaea nouchali Burm.f. var. caerulea HVK007d (JRAU) KJ747439 KJ747543 KJ794250 (Savigny) Verdc.

Onagraceae Ludwigia adscendens subsp. diffusa (Forssk.) HVK0020a (JRAU) KJ747476 KJ747583 KJ794285

P.H. Raven

Onagraceae Ludwigia adscendens subsp. diffusa (Forssk.) HVK0020b (JRAU) KJ747477 KJ747584 KJ794286

P.H. Raven

Onagraceae Ludwigia adscendens subsp. diffusa (Forssk.) HVK0020c (JRAU) KJ747478 KJ747585 KJ794287

P.H. Raven

Onagraceae Ludwigia adscendens subsp. diffusa (Forssk.) HVK0020d (JRAU) KJ747479 KJ747586 KJ794288

P.H. Raven

Table 2.1 continued. List of taxa with voucher information and GenBank accession number (if available) for each DNA region.

Family Plant name Voucher (Herbarium) GenBank Accession Numbers

rbcLa matK trnH-psbA

Poaceae Arundo donax L. HVK009a (JRAU) KJ747440 KJ747544 KJ794251

Poaceae Arundo donax L. HVK009b (JRAU) KJ747441 KJ747545 KJ794252

Poaceae Arundo donax L. HVK009c (JRAU) KJ747442 KJ747546 KJ794253

Poaceae Arundo donax L. HVK009d (JRAU) KJ747443 KJ747547 KJ794254

Poaceae Arundo donax L. HVK009e (JRAU) KJ747444 KJ747548 KJ794255

Polygonaceae Persicaria lapathifolia (L.) H.Gross HVK0016a (JRAU) KJ747463 KJ747569 KJ794270

Polygonaceae Persicaria lapathifolia (L.) H.Gross HVK0016b (JRAU) KJ747464 KJ747570 KJ794271

Polygonaceae Persicaria lapathifolia (L.) H.Gross HVK0016c (JRAU) KJ747465 KJ747571 KJ794272

Polygonaceae Persicaria lapathifolia (L.) H.Gross HVK0016d (JRAU) KJ747466 KJ747572 KJ794273

Table 2.1 continued. List of taxa with voucher information and GenBank accession number (if available) for each DNA region.

Family Plant name Voucher (Herbarium) GenBank Accession Numbers

rbcLa matK trnH-psbA

Pontederiaceae Eichhornia crassipes (Mart.) Solms HVK004a (JRAU) KJ747426 KJ747532 KJ794237

Pontederiaceae Eichhornia crassipes (Mart.) Solms HVK004b (JRAU) KJ747427 KJ747533 KJ794238

Pontederiaceae Eichhornia crassipes (Mart.) Solms HVK004c (JRAU) KJ747428 KJ747534 KJ794239

Pontederiaceae Eichhornia crassipes (Mart.) Solms HVK004d (JRAU) KJ747429 KJ747535 KJ794240

Pontederiaceae Eichhornia crassipes (Mart.) Solms HVK004e (JRAU) KJ747430 KJ747536 KJ794241

Pontederiaceae Pontederia cordata L. HVK0017a (JRAU) KJ747467 KJ747573 KJ794275

Pontederiaceae Pontederia cordata L. HVK0017b (JRAU) KJ747468 KJ747574 KJ794276

Pontederiaceae Pontederia cordata L. HVK0017c (JRAU) KJ747469 KJ747575 KJ794277

Table 2.1 continued. List of taxa with voucher information and GenBank accession number (if available) for each DNA region.

Family Plant name Voucher (Herbarium) GenBank Accession Numbers

rbcLa matK trnH-psbA

Pontederiaceae Pontederia cordata L. HVK0017d (JRAU) KJ747470 KJ747576 KJ794278

Pontederiaceae Pontederia cordata L. HVK0017e (JRAU) KJ747471 KJ747577 KJ794279

Salviniaceae Azolla filiculoides Lam. HVK005a (JRAU) KJ747431 KJ747537 KJ794242

Salviniaceae Azolla filiculoides Lam. HVK005b (JRAU) KJ747432 KJ747538 KJ794243

Salviniaceae Azolla filiculoides Lam. HVK005c (JRAU) KJ747433 KJ747539 KJ794244

Salviniaceae Azolla filiculoides Lam. HVK005d (JRAU) KJ747434  KJ794245

Salviniaceae Azolla filiculoides Lam. HVK005e (JRAU) KJ747435  KJ794246

Salviniaceae Salvinia minima Baker HVK001a (JRAU)   KJ794235

Salviniaceae Salvinia minima Baker HVK001b (JRAU)   KJ794236

Table 2.1 continued. List of taxa with voucher information and GenBank accession number (if available) for each DNA region.

Family Plant name Voucher (Herbarium) GenBank Accession Numbers

rbcLa matK trnH-psbA

Salviniaceae Salvinia minima Baker HVK001c (JRAU)   

Salviniaceae Salvinia minima Baker HVK001d (JRAU)   

Salviniaceae Salvinia minima Baker HVK001e (JRAU)   

Salviniaceae Salvinia molesta D.S. Mitch. HVK003a (JRAU)   KJ794225

Salviniaceae Salvinia molesta D.S. Mitch. HVK003b (JRAU)   KJ794226

Salviniaceae Salvinia molesta D.S. Mitch. HVK003c (JRAU)   KJ794227

Salviniaceae Salvinia molesta D.S. Mitch. HVK003d (JRAU)   KJ794228

Salviniaceae Salvinia molesta D.S. Mitch. HVK003e (JRAU)   KJ794229

Typhaceae Typha capensis Rohrb. HVK0018a (JRAU) KJ747472 KJ747578 KJ794280

Table 2.1 continued. List of taxa with voucher information and GenBank accession number (if available) for each DNA region.

Family Plant name Voucher (Herbarium) GenBank Accession Numbers

rbcLa matK trnH-psbA

Typhaceae Typha capensis Rohrb. HVK0018b (JRAU) KJ747473 KJ747579 KJ794281

Typhaceae Typha capensis Rohrb. HVK0018c (JRAU) KJ747474 KJ747580 KJ794282

Typhaceae Typha capensis Rohrb. HVK0018d (JRAU) KJ747475 KJ747581 KJ794283

Typhaceae Typha capensis Rohrb. HVK0018e (JRAU) KJ747475 KJ747582 KJ794284

2.2.2. DNA extraction, amplification, sequencing and alignment

Total genomic DNA was isolated from 0.5 g of silica dried leaves using the 2x CTAB

(Hexadecylmethylammonium bromide) extraction method of Doyle & Doyle (1987).

Polyvinyl Pyrolidone (2% PVP) was added to reduce the effects of high polysaccharide concentration in the samples. Isolated DNA was precipitated with

100% ethanol and stored at -20 °C for a minimum of two weeks (Fay et al. 1998).

Purification of samples (DNA cleaning) was done using QIAquick silica columns

(Oiagen Inc., Hilden, Germany) following the manufacture instructions. Short fragments of specific regions of the plastid DNA (rbcLa, trnH-psbA, and matK) were amplified from the purified DNA.

The amplification reactions (PCR) were performed using 1 µl of clean DNA template in 24 µl of reaction mixture. This mixture included: Ready Mix Master

(Advanced Biotechnologies, Epson, Surrey, UK), Bovine Serum Albumin (3.2% BSA) and 4.5% dimethyl Sulfoxide (DMSO). DMSO was added only for the amplification of matK to improve PCR efficiency. To amplify rbcLa and trnH-psbA, two primers were used: rbcLa-F and rbcLa-R for rbcLa (Elansary 2013) and trnH-F and psbA-R for trnH-psbA (Sang et al. 1997). Four different primer combinations were, however, used for matK including: 1R Kim-f and 3F-Kim; -390F and -1326R (Cuenound et al.

2002); matK_MALPR 1 - matK X F (Dunning & Savolainen 2010); and 472F -1248R

(Mort et al. 2009). The details of the primers used are presented in Table 2.2.

Table 2.2. Primers used for DNA amplification and sequencing

Locus Primer Sequences (5´ – 3´) matK matK 390F CGATCTATTCATTCAATATTC matK 1326R TCTAGCACACGAAAGTCGAAGT

3F_KIM CGTACAGTACTTTTGTGTTTACGAG 1R_KIM ACCCAGTCCATCTGGAAATCTTGGTTC

matK_1248R GCTRTRATAATGAGAAAGATTTCTGC matK_472F CCCRTYCATCTGGAAATCTTGGTTC

matK_MALPR 1 ACAAGAAAGTCGAAGTAT matK X F TAATTTACGATCAATTCATTC rbcLa rbcLa R GTAAAATCAAGTCCACCYCG rbcLa F ATGTCACCACAAACAGAGACTAAAGC trnH-psbA trnH CGCGCATGGTGGATTCACAATCC psbA GTTATGCATGAACGTAATGCTC

The following DNA amplification protocol was used for the rbcLa region: pre- melting at 94°C for 60 s, denaturation at 94°C for 30 s, annealing at 50°C for 40 s, and extension at 72°C for 40 s. For the matK, the protocol is described as follows: pre-melting at 94°C for 3 min, denaturation at 94°C for 60 s, annealing at 52°C for 60 s, and extension at 72°C for 2.5 min. Finally, the amplification protocol of the trnH- psbA spacer comprises: pre-melting at 94°C for 60 s, denaturation at 94°C for 60 s, annealing at 48°C for 60 s, and extension at 72°C for 60 s.

The resulting PCR products were purified using QIAquick columns following the manufacturer’s instructions. Cycle sequencing was done on purified PCR products using BigDye TM v.3.2 Terminator mix (Applied Biosystems, Inc.,

Warrington, Cheshire, UK), and the same primers used in PCR reactions. Cycle- sequenced products were purified with EtOH-NaCl and sequenced on an ABI

3130X1 Genetic Analyser.

Complementary DNA strands were edited and assembled using Sequencher

3.1. (Gene Code, ANN arbor, Michigan, USA). The rbcLa and matK sequences were aligned manually in PAUP* v.4.0b.10 (Swofford 2002). The trnH-psbA sequences were aligned using Multiple Sequence Comparison by Log-Expectation (MUSCLE v.

3.8.31) (Edgar 2004), followed by manual adjustment also conducted in PAUP* v.40b.10 (Swofford 2002).

Finally, all the DNA sequences generated were combined to form single-locus and combined-locus DNA matrices. These matrices represent a DNA database for the invasive aquatic species of South Africa. The rbcLa matrix is composed of 119 sequences, with sequences having a minimum of 431 base pairs (bp) and a maximum of 579 bp. For the matK region, 96 sequences were generated (584bp–

769 bp) whereas 122 sequences (226bp-632bp) were produced for trnH-psbA matrix. The combined matrix was made up of only species that have sequences for all the regions combined i.e. rbcLa + matK and rbcLa + matK + trnH-psbA. As a result, the matrix of the core barcoding loci (rbcLa + matK) included 84 sequences, with sequences having a minimum of 1015 bp and a maximum of 1348 bp. The

combined matrix of all three regions (rbcLa + matK+ trnH-psbA) included 74 sequences, with sequences having a minimum of 1241 bp and a maximum of 1980 bp. A summary of the sequence statistics is shown in Table 2.3.

Table 2.3. Summary of statistics for the datasets generated

DNA No. of No. of Min. Max. Mean Median region Genera species sequence sequence sequence sequence

matK 20 23 584 769 667 660 rbcLa 24 29 431 579 519 520 matK + 18 20 1062 1275 1181 1187 rbcLa matK + 16 18 1390 1864 1640 1650 rbcLa + trnH-psbA trnH-psbA 23 27 226 632 434 451

2.2.3. Statistical data analysis, species monophyly and BLAST analysis

All statistical analyses were conducted using the R library Spider 1.1-1 (Brown et al.

2012). First, I tested for the best DNA barcode for all invasive aquatic plants of South

Africa’s freshwater systems. Four criteria are used for this test. These criteria include: i) presence of barcode gap; ii) discriminatory power i.e. the proportion of successful species identification for each individual marker and combined markers tested; iii) PCR success rate; and iv) species monophyly examined based on the topology of species along a phylogenetic tree. The search of best DNA barcode

focuses on trnH-psbA and rbcLa + matK (core barcodes), and rbcLa + matK + trnH- psbA.

a) The presence of the barcode gap

The potential of a marker to discriminate between species relies upon the presence of a “barcode gap” (Meyer & Paulay 2005). When, for a marker, the genetic variation is significantly higher between species (interspecific distance) than within species

(intraspecific distance), there is a barcode gap in that particular marker (Meyer &

Paulay 2005). This was tested by calculating and comparing the median of inter- vs. intraspecific genetic distances for the region and combined regions included in this study. The significance of the difference between both distances was assessed based on Wilcoxon ranked sum test.

b) Discriminatory power of candidate DNA barcodes

I determine the discriminatory power of trnH-psbA, the core barcodes and the core barcodes+ trnH-psbA by evaluating the proportion of correct species identifications yielded by each and the combined regions. Prior to the analysis: i) all DNA sequences in a matrix are labeled according to the names of the species from which the sequences are generated; and ii) the optimized threshold for taxon delimitation was determined. The threshold was determined using the function ‘threshOpt’ implemented in Spider. This function calculates the number of true positive, false negative, false positive, and true negative identifications at different potential thresholds, allowing me to determine the cumulative error (i.e. false negative + false positive). The optimized threshold is then identified as the one for which the cumulative error is the lowest (Brown et al. 2012).

The determination of the discriminatory power is conducted as follows. Each

DNA sequence in a matrix is considered a query whereas the remaining sequences are considered as a reference DNA database for species identification. If the identification of a query corresponds to the sequence label, the outcome of the analysis is scored as “correct”, and the overall proportion of correct identification corresponds to the discriminatory power of the region tested. The test of discriminatory power was conducted using three methods, i.e. the “best close match”

(Meier et al. 2006), the “near neighbour” and the BOLD ID methods. These analyses are conducted using the functions bestCloseMatch, nearNeighbour and threshID implemented in the R package Spider, respectively (Brown et al. 2012).

The function bestCloseMatch conducts the “best close match” analysis of

Meier et al. (2006), searching for the closest individual/sequence in the DNA database. If the closest individual is within a given threshold, the outcome is scored as “correct”. If it is further than the given threshold, the result is “no ID” (no identification). If more than one species are tied for closest match, the outcome of the test is “ambiguous” identification. When all matches within the threshold are different species to the query, the result is scored as “incorrect”.

The nearNeighbour function finds the closest individuals and returns the score

“true” (equivalent “correct” with function bestCloseMatch) if their names are the same, but if the names are different, the outcome is scored as “false” (equivalent to

“incorrect”). The function threshID conducts a species delimitation analysis based on a threshold genetic distance of 1% as conducted by the “Identify Specimen” tool provided by the BOLD system (http://www.boldsystems.org/views/idrequest.php).

There are also four possible outcomes for threshID tests, that is, “correct”,

“incorrect”, “ambiguous”, and “no id” similar to the outcomes of the bestCloseMatch function.

c) PCR success rate

PCR success rate is calculated as the percentage of successful amplification and sequencing of each DNA region. The potential best barcode is expected to have the highest PCR success rate.

d) Species monophyly

The test for species monophyly was conducted on a neighbour joining (NJ) and maximum parsimony (MP) phylogenetic tree. The NJ tree was reconstructed using the function “nj” implemented in the R package Spider. The MP tree was reconstructed as implemented in PAUP v.40b10 (Swofford 2002). For the MP tree reconstruction, tree searches are performed for trnH-psbA, core barcode, and core barcode + trnH-psbA using heuristic searches with 1 000 random sequence additions but keeping only 10 trees. Tree bisection-reconnection was performed with all character transformations treated as equally likely i.e. Fitch parsimony (Fitch

1971). Bootstrap values are used to assess node support; bootstrap values greater than 70% are considered as providing strong support (Hillis & Bull 1993; Wilcox et al.

2002). Bootstrap resampling (Felsenstein 1985) was conducted also in PAUP*

4.0b10 (Swofford 2002).

On the tree reconstructed, I considered that a species is monophyletic when all individuals of the same species cluster within the same clade. As such, the best barcode should provide the highest proportion of monophyletic species.

e) BLAST analysis of aquarium samples

The seven aquarium samples are used to test the species identification accuracy of the best DNA barcode identified in this study. This test was conducted using the

BLAST approach. The aquarists were asked to provide common names for the plants sold. Scientific names were provided for each of these plants based on their common names. The identity of the aquarium samples was then verified using the

BLAST identification technique where DNA sequences generated for all aquarium samples were “blasted” against a global DNA database on GenBank/EBI. The maximum identity statistic was used to measure the identification accuracy.

2.3. Results

2.3.1. Barcode gap analysis

The results of this analysis are presented in Fig. 2.1. In these results, interspecific distances are always higher than intraspecific distances (P < 0.001) for all regions tested, indicating the presence of barcode gap.

trnH−psbA Gap Core Barcode Gap Core + Supplimentary Gap trnH-psbA gap 2.5 0.4 2.0 0.3 1.5 K2Pdistance 0.2 K2Pdistance K2Pdistance 1.0 0.1 0.5 0.0 0.0 0.00 0.05 0.10 0.15 0.20 0.25 0.30

inter intra inter intra inter intra

Fig. 2.1. Evaluation of the barcode gap in the core barcode (left), the core barcode + trnH-psbA (centre) and trnh-psbA (right). The evaluation was conducted comparing the medians of inter- vs. intraspecific genetic distances.

2.3.2. Discriminatory power

The result of the search for an optimised genetic threshold for species identification is presented in Fig. 2.2. This result indicates that the genetic distance of 0.002 is a suitable threshold for species delimitation for both the core barcode and the core barcode + trnH-psbA whereas 0.004 is appropriate for trnH-psbA.

Based on the identified threshold, I investigated the discriminatory powers of all regions tested. The results are presented in Table 2.4. The core DNA barcode always provides the lowest discriminatory power irrespective of the methods used:

69% (BOLD method), 87% (Best Close Match method) and 93% (Near Neighbour method). However, the discriminatory power of the core barcodes increases substantially each time trnH-psbA is added: 83% (BOLD method), 91% (Best Close

Match method), and 100% (Near Neighbour method). In contrast, the trnH-psbA alone provides the highest power of discriminating between species, and this power ranges from 94% (BOLD method) to 100% (Best Close Match method and Near

Neighbour method).

Fig. 2.2. Barplot showing the false positive (red) and false negative (grey) rate of

identification of invasive aquatic species as pre-set thresholds change. A: pattern of

cumulative error for rbcLa + matK indicating that a treshold of 0.002 is acceptable for

species delimitation; B: pattern of cummulative error for rbcLa + matK indicating a

threshold of 0.002 is appropriate for species delimitation.

Fig. 2.2 continued. Barplot showing the false positive (red) and false negative (grey) rate of identification of invasive aquatic species as pre-set thresholds change. C: pattern of cumulative error for trnH-psbA indicating a threshold of 0.004 is appropriate for species delimitation.

Table 2.4. Identification efficacy of DNA barcode regions using distance-based methods. DNA regions Near BOLD (1%) Best close match Neighbour False True Ambiguous Correct Incorrect No Ambiguous Correct Incorrect ID (%) (%) (%) (%) (%) (%) (%) (%) (%) rbcLa + matk 7 93 0 69 2 29 12 87 1 rbcLa + matk + trnH- 0 100 0 83 13 4 9 91 0 psbA trnH-psbA 0 100 0 94 6 0 0 100 0

2.3.3 PCR success rate

The highest rate of successful PCR amplification and sequencing is obtained with rbcLa (96%) and trnH-psbA spacer (90%), with the matK locus being the most difficult to amplify and sequence as shown in Fig. 2.3.

PCR Efficiency 120%

96% 100% 90%

80% 72%

60%

40%

20%

0% rbcLa matK trnH-psbA

Fig. 2.3. PCR efficiency for the three DNA regions tested.

2.3.4. Species monophyly

The results of the test of species monophyly are presented as follows. Using the NJ tree, the core barcodes isolate 75% of monophyletic species, followed by trnH-psbA

(84%). However, the combination core barcodes + trnH-psbA results in 100% of monophyletic species. The pattern observed for MP tree mirrors that of NJ tree with trnH-psbA alone and the combined regions isolating 100% of monophyletic tree as indicated in Fig. 2.4.

Fig. 2.4. One of the most parsimonious trees from the combined plastid genes

(rbcLa, matK, and trnH-psbA). Bootstrap percentages above 50% are shown above the branches.

100 Ludwigia adscenden subsp. diffusa HVK0020a Ludwigia adscenden subsp. diffusa HVK0020b Onagraceae 100 Ludwigia adscenden subsp. diffusa HVK0020c 100 Ludwigia adscenden subsp. diffusa HVK0020d Persicaria lapathifolia HVK0016d Persicaria lapathifolia HVK0016a 100 Polygonaceae Persicaria lapathifolia HVK0016d 100 Persicaria lapathifolia HVK0016c Alternanthera philoxeroides HVK0045a 100 Alternanthera philoxeroides HVK0045b Amaranthaceae Alternanthera philoxeroides HVK0045c 54 Nymphoides brevipedicellata HVK0013a 100 Nymphoides brevipedicellata HVK0013b 100 Nymphoides brevipedicellata HVK0013c 100 Nymphoides brevipedicellata HVK0013d Nymphoides brevipedicellata HVK0013e Menyanthaceae 100 Nymphoides indica HVK0014a Nymphoides indica HVK0014b 100 Nymphoides indica HVK0014c Nymphoides indica HVK0014d 100 Nymphoides indica HVK0014e 100 Ipomoea carnea subsp. fistulosa HVK0012e 55 Ipomoea carnea subsp. fistulosa HVK0012b 58 Ipomoea carnea subsp. fistulosa HVK0012c Convolvulaceae 100 100 Ipomoea carnea subsp. fistulosa HVK0012a 100 Ipomoea carnea subsp. fistulosa HVK0012d Hygrophila polysperma HVK0044a 100 Hygrophila polysperma HVK0044b Acanthaceae Hygrophila polysperma HVK0044c Nympheae mexicana HVK0026a Nympheae mexicana HVK0026c Nympheae mexicana HVK0026d 100 Nympheae mexicana HVK0026b Nymphaeaceae 100 Nympheae mexicana HVK0026e Nymphaea nouchali var. caerulea HVK007a 100 Nymphaea nouchali var. caerulea HVK007b 100 100 Nymphaea nouchali var. caerulea HVK007c Nymphaea nouchali var. caerulea HVK007d Ceratophyllum demersum HVK0015a 100 Ceratophyllum demersum HVK0015b Ceratophyllaceae Ceratophyllum demersum HVK0015c Lagarosiphon muscoides HVK0023a Lagarosiphon muscoides HVK0023d 100 Lagarosiphon muscoides HVK0023b Lagarosiphon muscoides HVK0023c 100 Lagarosiphon muscoides HVK0023e 100 Egeria densa HVK0032a Egeria densa HVK0032b 100 Egeria densa HVK0032c Egeria densa HVK0032d 100 Egeria densa HVK0032e Hydrocharitaceae 100 Vallisnera spiralis HVK0021a Vallisnera spiralis HVK0021b Vallisnera spiralis HVK0021c Hydrilla verticillata HVK0046a Hydrilla verticillata HVK0046b Hydrilla verticillata HVK0046c Hydrilla verticillata HVK0046d Hydrilla verticillata HVK0046e

Fig. 2.4 continued. One of the most parsimonious trees from the combined plastid genes (rbcLa, matK, and trnH-psbA). Bootstrap percentages above 50% are shown above the branches.

2.3.5. BLAST results

The BLAST identification test on the aquarium species recovered the following species: Alternantera philoxeroides, Hygrophila polysperma (Roxb.) T. Anderson,

Vallisneria spiralis L., Hydrilla verticillata, Echinodorus cordifolius (L.), Griseb, Egeria densa, and Myriophyllum spicatum as shown in the Table 2.5.

Table 2.5. BLAST analysis of the aquarium plants  indicates that DNA sequences are lacking in my DNA matrix or no possible answer (last column)

Common name Scientific name Blast sequence Do blast results similarity - GenBank match the correct % genus or scientific name? matk rbcLa trnH- matk rbcLa trnH- psbA psbA Brazilian Egeria densa 100 100 100 Yes Yes Yes elodea Planch. Tape grass Vallisneria  100 96  Yes Yes spiralis L.

Amazon sword Echinodorus  99 98  Yes No cordifolius (L.) Griseb Alligator weed Alternantera 96 100 84 Yes Yes No philoxeroides (Mart.) Griseb Hygrophila Hygrophila  99   Yes  polysperma (Roxb.) T. Anderson Spike water Myriophyllum  99 99  Yes Yes milfoil spicatum L.

Water thyme Hydrilla  100 100  Yes Yes verticillata (L.R.) Royle Spade-leaf Echinodorus  98 87  Yes Yes sword cordifolius (L.) Griseb.

2.4. Discussion

In this study, the potential of the official DNA barcodes (rbcLa + matK or core barcodes), trnH-psbA, and the core barcodes + trnH-psbA to identify invasive aquatic plants of South Africa’s freshwaters was tested. The test was based on the following criteria: the presence of the barcoding gap, the discriminatory power of each and combined markers, the amplification success rate and species monophyly.

Although there is evidence of a barcode gap in all regions and combined regions tested, these regions differ in their discriminatory power. For example, the core DNA barcodes provided the lowest discriminatory power (see also

Hollingsworth et al. 2009; Pettengill & Neel 2010; Roy et al. 2010; Wang et al. 2010;

Clement & Donoghue 2012) irrespective of the methods used. However, this power increased substantially each time trnH-psbA was added to the core barcodes, reaching, for example, 100% under the Near Neighbour method. Furthermore, trnH- psbA alone provided the highest power of discriminating between species reaching

100% under the the Best Close Match and Near Neighbour methods. In addition, the amplification rate of the trnH-psbA marker is close to that of the rbcLa, which is known for its easy amplification (Kress & Erickson 2007; Gere et al. 2013). The matK region was the most difficult region to amplify. Ghahramanzadeh et al. (2013) also found matK to be problematic in the barcoding of invasive aquatic plants of the

Netherlands, where 41 primer combinations and five amplification protocols were tested. Another study on the barcoding of aquatic plants from the genus Hydrocotyle found the matK region to be unreliable in the barcoding of aquatic species (Van de

Wiel et al. 2009).

As opposed to the problematic matK, the exceptional performance of trnH- psbA was further confirmed by the test of species monophyly such that, the addition of trnH-psbA to the core barcodes increases the proportion of monophyletic species to 100%. Given the performance of trnH-psbA, it is clear that this region is the best region with which to barcode invasive aquatic plants of South Africa’s freshwater systems. The value of trnH-psbA has also been demonstrated in several studies

(Newmaster & Ragupathy 2009; Petit & Excoffier 2009; Ragupathy et al. 2009;

Wang et al. 2009; Gere et al. 2013) including the barcoding of aquatic macrophytes

(Bleeker et al. 2008; Van de Wiel et al. 2009; Ghahramanzadeh et al. 2013). The discovery of a single best DNA barcode for South Africa’s invasive aquatic plants will ease DNA data accumulation (from economic perspective) as generating a database for a single gene is cheaper than generating a multi-locus database. From taxonomic and management perspectives, the identification of a single marker will ease the establishment of a DNA library for invasive aquatic plants. This library will facilitate species identification each time the morphology-based identification is difficult, time- consuming or doubtful. In so doing, the DNA barcode library provided in this study will facilitate rapid control or management actions before species are spread.

The introduction of alien species to new environments has been facilitated by modern trade, tourism, and technology (Meyerson & Mooney 2007). In South Africa, a number of aquatic macrophytes have invaded a large number of water bodies due to the dumping of ballast water, horticulture and the aquarium trade (Martin &

Coetzee 2011). In particular, there is mounting evidence that aquarium trade is responsible for the global distribution of invasive aquatic plant species (Kay & Hoyle

2001; Henderson & Cilliers 2002; Padilla & Williams 2004; Maderia et al. 2007;

Martin & Coetzee 2011). Seven aquatic plants were purchased from aquaria to assess whether prohibited species are sold in the country. The BLAST analysis revealed that four of the seven plants purchased from the aquarium are prohibited species (NEM:BA 2004). Among these four species, Hydrilla verticillata, Egeria densa, and Myriophyllum spicatum are already invasive in South Africa. The fourth, i.e. Echinodorus cordifolius has not yet been recorded in South African water bodies.

These plants are listed in category 1 on the prohibited species list, meaning that they are not allowed to be propagated or sold in the country unless they are meant for biological control research. The fact that the use of a DNA barcode approach has been able to identify that these prohibited species are already sold in the country demonstrates: i) the utility of DNA barcoding in surveying or controlling invasive species; and ii) strict control are yet to be implemented at the border to prevent introduction of prohibited species in South Africa (Madeira et al. 2007; Martin &

Coetzee 2011).

The three remaining aquarium species are Alternantera philoxeroides,

Hygrophila polysperma, and Vallisneria spiralis. These species are not prohibited in

South Africa, but they are listed on the Global Compendium of Weeds

(http://www.hear.org) and the Global Invasive Species Database

(http://www.issg.org/database) as invasive species in several parts of the world.

There are currently no records of these species on the Southern African Plant

Invaders Atlas (SAPIA) database (Henderson 2011). There is also currently no literature that indicates the presence of these species in the country.

Studies by Madeira et al. (2007) and Martin & Coetzee (2011) have indicated the ease with which aquatic plants are imported and distributed throughout the country. Biosecurity is an important tool in minimizing the global impact of invasive species (Armstrong & Ball 2005). In the current study a DNA barcoding dataset of 24 genera of aquatic invasive plants was created to help biosecurity officials to quickly identify aquatic macrophytes during at-border security assessments. Although this database consists of aquatic invasive plants of South Africa, the dataset can be used globally as all the aquatic species barcoded are also invasive in many parts of the world (http://www.hear.org).

2.5. Conclusions

South Africa has one of the largest problems with invasive plants globally

(Richardson & Van Wilgen 2004). Aquatic plants are generally difficult to identify correctly due to reduced floral structure and convergent vegetative morphology

(Moody et al. 2008). In this study, 24 genera of aquatic invasive plants were barcoded and a DNA barcode database created to assist in the identification of aquatic macrophytes for biosecurity and post-border measures. I recommend the use the trnH-psbA spacer for identifying aquatic plants as it is more informative that rbcLa and matK currently proposed as DNA barcodes for plants.

CHAPTER three

Ecological niche modelling

CHAPTER 3

POTENTIAL EFFECTS OF THE CHANGING CLIMATE ON THE FIVE WORST

INVADERS OF SOUTH AFRICA’S FRESHWATER SYSTEMS

3.1. Introduction

South Africa is a semi-arid country with an average precipitation of approximately

500 mm/annum, which is well below the 860 mm/annum world average (Blignaut et al. 2007). This limited water availability is further compromised by the invasion of aquatic plants, causing important economic losses (see Chapter 1). Indeed, South

Africa has a long history of infestation by aquatic macrophytes, dating as far back as

1865 (Cilliers 1987). The country has some of the most nitrate- and phosphate- enriched freshwater in the world in certain areas as a consequence of a rapid urbanization coupled with intense agricultural and industrial activities (Hill 2003;

Coetzee et al. 2009). In such polluted environments, a large number of water bodies in the country have been predisposed to invasion by aquatic plants (Hill 2003;

Coetzee et al. 2009). The most damaging water weeds in South Africa are of South

American origin and are generally known as the “bad five” (Henderson & Cilliers

2002). These are the water hyacinth (Eichhornia crassipes), water lettuce (Pistia stratiotes), parrot’s feather (Myriophyllum aquaticum), Kariba weed (Salvinia molesta), and red water fern (Azolla filiculoides) (Van Wilgen et al. 2001; Hill 2003;

Richardson & Van Wilgen 2004). In addition to the bad five, a number of alien aquatic plants such as Egeria densa Planch (Brazilian elodea), Myriophyllum spicatum L. (Eurasian milfoil), Pontederia cordata L. (pickerel weed), and Nasturtium officinale R.Br. (watercress) have been introduced into South Africa for so long that

they are now naturalized causing damages to a lesser extent than the bad five (Hill

2003).

These noxious weeds have invaded major rivers, dams, lakes and irrigation canals disrupting navigation, compromising agriculture, hydroelectricity generation, and ecosystem services (Hill 2003). They form dense mats (biomass) that reduce sunlight penetration, oxygen levels and water quality, all of which threatens the biodiversity of aquatic ecosystems (Van Wilgen et al. 2001). The dense mat also creates breeding sites for malaria-carrying mosquitos and bilharzia-carrying snails

(Henderson & Cilliers 2002).

To limit the impacts of the invasive species in general, a number of management actions have to be taken and implemented. These actions are planned within the framework of the SANBI ISP (see details in Section 1.3.2). Such actions include inter alia a rapid detection, identification and verification of invasive plants at an early stage of their introduction (Wilson et al. 2013). These actions can be facilitated by combining morphology and DNA barcoding techniques (see Chapter 2 for the efficacy of DNA barcoding in this regards). After the detection of invasive species, further interventions include two important activities, i.e. risk assessment and response planning (Wilson et al. 2013). Both activities can be facilitated by pre- emptive actions such as the identification of areas most vulnerable to the invasion of the species detected and identified as invasive. Several factors contribute to species invasion success including for example ecosystem disturbance (Hill 2003) but also climate change (Coetzee et al. 2009; Willis et al. 2010).

In South Africa, the focus has largely been on documenting the distribution, abundance, and habitat preferences of the aquatic macrophytes through the South

African Plant Invaders Atlas database (Henderson 2011). In this study, I focus on the potential effects of climate change on the distribution of the bad five. Aquatic species are particularly vulnerable to climate change because water temperature, water physico-chemistry and water availability are, at least partly, climate-dependent

(Woodward et al. 2010). Predicting the potential distributions of invasive species under climate change is therefore important for setting conservation and management priorities (Rouget et al. 2004; Thuiller et al. 2005; Zenni et al. 2009).

The ability of a species to invade an area outside of its native distribution range (alien species) is determined by a set of environmental factors (Peterson &

Vieglais 2001). These environmental factors can be used to predict areas that are potentially suitable, for example, climatically for the occurrence and invasion of alien species. Such areas can be identified through ecological niche modelling (ENM).

Several techniques have been used for species distribution modelling (see Chapter 1 for details). Prevalent and frequently used approaches include: the Generalized

Linear Model (GLM; Guisan & Zimmerman 2000), Genetic Algorithm for Rule-Set

Production (GARP; Stockwell & Peterson 1999), Ecological Niche Factor Analysis

(ENFA; Chefaoui et al. 2005), and Maximum Entropy (MaxEnt; Phillips et al. 2006).

The first three models require both presence and absence data to build species distribution models. MaxEnt, however, is able to estimate the probable distribution when only presence data is available for analysis (Elith et al. 2011) and has been successful in producing ecological niche models for invasive species (Steiner et al.

2008; Wolmarans et al. 2010; Liu et al. 2011). In addition, MaxEnt was also found to

perform better than other models when small sample sizes of occurrence data are available (Hernandez et al. 2006).

Here, I used MaxEnt to examine the potential distributions of the bad five under current and future climate scenarios in South Africa. The objectives were to: i) identify freshwater systems located in areas most vulnerable to the invasion of the bad five under current and future climate, and ii) determine the potential effects of climate change on invasive aquatic plants.

3.2. Material and methods

3.2.1. Occurrence data

Distribution data for the selected species were sourced from the Southern Africa

Plant Invaders Atlas (SAPIA), the National Herbarium Pretoria Computerized

Information System (PRECIS), and SANBI’s Integrated Biodiversity Information

System (SIBIS) databases. The SAPIA database is the largest source of information on the distribution and abundance of invasive plants in South Africa with 70 000 records for more than 600 naturalized species (Henderson 2011). The PRECIS database is an electronic system with more than 900 000 species records for plants occurring in southern Africa (http://posa.sanbi.org/intro_precis.php). The SIBIS database provides occurrence data for over 1.6 million species in South Africa

(http://sibis.sanbi.org). For this study a total of 711 geographic points (GPS coordinates) were obtained for Azolla filiculoides, 649 for Eichhornia crassipes, 180 for Myriophyllum aquaticum, 129 for Pistia stratiotes, and 166 for Salvinia molesta.

Maps of occurrence data for the five species were generated to check for any errors, and coordinates that did not fall within the borders of South Africa were removed.

3.2.2. Predictor variables

Raster-based bioclimatic variables for both the current and future climate change scenarios were downloaded from the WorldClim database

(http://www.worldclim.org/) at a spatial resolution of 2.5 arc minutes. The WorldClim dataset is a high-resolution climatic average of 19 monthly environmental variables for the past, present, and future (Hijmans et al. 2005; Table 3.1). For future climatic predictions, the Commonwealth Scientific and Industrial Research Organization

(CSIRO-Mk3.0) general circulation model (GCM) and the High Carbon Emission

Scenario SRES A1B that assumes maximum energy usage were used.

Environmental variables were interpolated onto ArcGIS grids to ensure that all the spatial data have the same geographic bounds and cell size as the study region. In this study, water-specific variables such as conductivity, pH and dissolved oxygen,

(all important ecological variables for aquatic species) were not included as such data are currently not easily available for all South Africa’s freshwater bodies. The focus was only on the use of climatic data, but it is encouraged that future studies should collect water-specific data for a more comprehensive assessment of the drivers of invasive success of aquatic plants. Several other studies have also adopted this approach of modelling the distribution of aquatic plants based solely on variables that are not water-specific (Julien et al. 1995; Welk 2004; Coetzee et al.

2009; Lehtonen 2009; Mukherjee et al. 2011).

Table 3.1 List of bioclimatic variables from the WorldClim database used for predicting ecological niches.

No. Bioclimatic variables at 2.5 arc-min resolution

BIO 1 Annual Mean Temperature

BIO 2 Mean Diurnal Range

BIO 3 Isothermality

BIO 4 Temperature Seasonality

BIO 5 Maximum temperature of the warmest month

BIO 6 Minimum temperature of the coldest month

BIO 7 Temperature Annual Range

BIO 8 Mean temperature of the wettest quarter

BIO 9 Mean temperature of the driest quarter

BIO 10 Mean temperature of the warmest quarter

BIO 11 Mean temperature of the coldest quarter

BIO 12 Annual Precipitation

BIO 13 Precipitation of the warmest month

BIO 14 Precipitation of the driest month

BIO 15 Precipitation Seasonality

BIO 16 Precipitation of wettest quarter

BIO 17 Precipitation of the driest quarter

BIO 18 Precipitation of the warmest quarter

BIO 19 Precipitation of the coldest quarter

3.2.3. Ecological niche modelling

MaxEnt version 3.3.3K (http://www.cs.princeton.edu/~schapire/maxent/) as used to generate predictive models for current and future distribution of the five species included in this study. The jack-knife technique was used to evaluate the relative significance of each of the 19 predictor variables and the average AUC (Area Under

Curve) value was calculated to assess the performance of the models (Pearson et al. 2007). Based on the AUC values (see section 3.2.4 below), the best predictor variables were identified and the models were re-run using only the best predictor variables. The models were created using the linear, quadratic and hinge function, which are the best combination to avoid over-fitting (Peterson et al. 2007; Phillips &

Dudik 2008). The models were run by assigning 75% of the occurrence data for model training and the remaining 25% for model testing. To measure the variability in the model performance, 15 subsampling replicates were run for each model and the default iteration parameter was changed to 5 000 to ensure convergence. A random seeded procedure was chosen to ensure that for each replicated run, a separate set of training and test points were randomly sampled without replacement. The 10th percentile training presence was selected as a suitability threshold (Phillips & Dudik

2008). All other parameters were kept at their default settings.

3.2.4. Model performance evaluation

The AUC values obtained from the receiver operating characteristic curve (ROC) were used to assess if there is a correlation between each species’ occurrence and its predicted distribution (Liu et al. 2011) by measuring the potential of the model to differentiate the assigned test data from the indiscriminate background points in

MaxEnt (O’Donnell et al. 2012). Models with AUC values less than 0.8 are

considered to be weak and those with values higher or equal to 0.95 are considered to be strong (Trethowan et al. 2011).

3.2.5. Model output

Output maps from MaxEnt for both current and future potentially suitable areas for the five aquatic plants were converted from ASCII to Raster using the ArcGIS software (ESRI ArcGIS version 10). Raster Calculator and Zonal Statistics under the

Spatial Analyst tools extension were used to compare current ranges with future predicted ranges (all ranges estimated as number of pixels covered by species ranges). The change in number of pixels after subtracting the current species ranges from the future ranges was used to assess range variations such that positive values imply a range expansion while negative values imply range contraction. I then converted the number of pixels to surface area (km2) as shown in Table 3.2.

In addition, a shape file of dams of South Africa was downloaded from the website of the Department of Water Affairs (http://www.dwaf.gov.za), imported into

ArcGIS and projected onto the ‘current suitability’ maps to detect, which dams could possibly be at risk of invasion.

Table 3.2. Conversion of pixel cover area in arc minutes to kilometres.

Equivalency Spatial resolution Degrees Kilometres

60 arc minutes 1 110.5647

2.5 arc minutes (pixel 0.042 4.6 size used in this study)

3.3. Results

3.3.1. Best climatic predictors of species distribution of the bad five

The jack-knife analysis revealed that the potentially suitable distribution areas for the five species would be influenced by the minimum temperature of the coldest month, mean temperature of the driest quarter, precipitation of the warmest quarter, precipitation of the coldest quarter, precipitation of the warmest month and mean temperature of the coldest quarter and were the best predictor variables (Fig. 3.1).

Fig. 3.1. Jack-knife analysis indicating the predictor variable based on the AUC values for: (A) Azolla filiculoides and (B) Eichhornia crassipes.

Fig. 3.1 continued. Jack-knife analysis indicating the predictor variable based on the AUC values for: (C) Myriophyllum aquaticum and (D) Pistia stratiotes.

Fig. 3.1 continued. Jack-knife analysis indicating the predictor variable based on the AUC values for: (E) Salvinia molesta.

3.3.2. Model performance

The AUC values of the test data for the models produced by MaxEnt ranged from

0.832 to 0.916, with the average AUC value of 0.874 for the models generated (Fig.

3.2). These results indicate that there is a high correlation between the species occurrence data and the predicted distribution.

Fig. 3.2. ROC curve statistics results for: (A) Azolla filiculoides, (B) Eichhornia crassipes

Fig. 3.2 continued. ROC curve statistics results for: (C) Myriophyllum aquaticum (D) Pistia stratiotes

Fig. 3.2 continued. ROC curve statistics results for: (E) Salvinia molesta.

3.3.3. Model output

Distribution maps indicating areas that are currently suitable for each of the five aquatic plants are shown in Figs. 3.3.A, 3.4.A, 3.5.A, 3.6.A, and 3.7.A. These maps also show the distribution of dams in South Africa. Areas that are climatically suitable for the distribution of Azolla filiculoides are found in six of the nine provinces of South

Africa. These include North West, Gauteng, Mpumalanga, Free State, Eastern Cape and Western Cape Provinces (Fig. 3.3.A). However, Eichhornia crassipes has suitable climatic conditions in all nine provinces (Fig. 3.4.A). In addition, areas that are suitable for the distribution of Myriophyllum aquaticum are found in seven provinces including Limpopo, North West, Gauteng, Mpumalanga, Eastern Cape,

KwaZulu Natal and Western Cape Provinces (Fig. 3.5.A). Furthermore, for Pistia

stratiotes and Salvinia molesta, climatically suitable areas for the distribution of these species are found in Limpopo, Mpumalanga, KwaZulu Natal, Eastern Cape and

Western Cape Provinces (Fig. 3.6.A and 3.7.A, respectively). The dry interior of the country is unsuitable for establishment of both species (blue areas).

In addition, I summarize in Table 3.3, the list of dams that occur in areas that are climatically suitable for the establishment of the bad five. There are currently 612 dams in South Africa and a total of 234 (38%) occur in areas that are climatically suitable for the establishment of at least one of the bad five, with the highest number of vulnerable dams to the invasion of the bad five located in the Western Cape

Province and the lowest number of dams located in the Northern Cape Province.

The area of the current potential distribution was subtracted from the area of the future potential distribution to assess the effects of climate change on species ranges. Table 3.4. gives a summary of the area obtained for each species, currently and in the future (2080). The potentially suitable area for Azolla filiculoides in the future will increase by 432 km2 (which is 1% of the current potential suitable area) as shown in Fig. 3.3.B. Limpopo and the Northern Cape Provinces, which are unsuitable currently for A. filiculoides will become suitable by 2080 unlike

Mapumalanga Province, which will become unsuitable in the future. The potential suitable area for Eichhornia crassipes will also increase by 529 km2 (which is 1.5% of the current potential suitable area) as shown in Fig. 3.4.B. Furthermore, the potential suitable ranges for Myriophyllum aquaticum will decrease by 1 426 km2 (3% of the current ranges). Although there is a general range contraction for this species, the coastal areas may become suitable as indicated in Fig. 3.4B. Provinces that are

currently suitable (North West, Gauteng and Limpopo) become unsuitable by 2080 as shown in Fig. 3.5.B. Also the potentially suitable range for Pistia stratiotes will decrease by 1 633 km2 (which is 5% of the current potential suitable area) as shown in Fig. 3.6.B. The range will decrease in the Limpopo and Mpumalanga Provinces.

Suitable climatic ranges will be along coastal areas. The Northern Cape Province that is currently climatically unsuitable becomes suitable by 2080. The potentially suitable area for Salvinia molesta will increase by 1 035 km2 (2% of the current potentially suitable area) as shown in Fig. 3.7.B with the North West, Gauteng and

Free State Provinces becoming suitable. However, range contraction will occur in

Limpopo and Mpumalanga Provinces by 2080.

Fig. 3.3. Assessment of the effects of climate change on the distribution of Azolla filiculoides. (A) Shows areas that are currently suitable for the distribution of Azolla filiculoides and map (B) shows the pattern of range shift in the future (2080). Areas in red indicate regions that are climatically suitable for species establishment whereas areas in blue indicate region that are climatically unsuitable. The location of dams are also indicated showing dams climatically vulnerable to species invasion.

Fig. 3.4. Assessment of the effects of climate change on the distribution of

Eichhornia crassipes. (A) Shows areas that are currently suitable for the distribution of Eichhornia crassipes and map (B) shows the pattern of range shift in the future

(2080). Areas in red indicate regions that are climatically suitable for species establishment whereas areas in blue indicate region that are climatically unsuitable.

The location of dams are also indicated showing dams climatically vulnerable to species invasion.

Fig. 3.5. Assessment of the effects of climate change on the distribution of

Myriophyllum aquaticum. (A) Shows areas that are currently suitable for the distribution of Myriophyllum aquaticum and map (B) shows the pattern of range shift in the future (2080). Areas in red indicate regions that are climatically suitable for species establishment whereas areas in blue indicate region that are climatically unsuitable. The location of dams are also indicated showing dams climatically vulnerable to species invasion.

Fig. 3.6. Assessment of the effects of climate change on the distribution of Pistia stratiotes. (A) Shows areas that are currently suitable for the distribution of Pistia stratiotes and map (B) shows the pattern of range shift in the future (2080). Areas in red indicate regions that are climatically suitable for species establishment whereas areas in blue indicate region that are climatically unsuitable. The location of dams are also indicated showing dams climatically vulnerable to species invasion.

Fig. 3.7. Assessment of the effects of climate change on the distribution of Pistia stratiotes. (A) Shows areas that are currently suitable for the distribution of Pistia stratiotes and map (B) shows the pattern of range shift in the future (2080). Areas in red indicate regions that are climatically suitable for species establishment whereas areas in blue indicate region that are climatically unsuitable. The location of dams are also indicated showing dams climatically vulnerable to species invasion.

100

Table 3.3. List of dams that are climatically vulnerable to the invasion of at least one of the "bad five" species in each province of

South Africa.

GAUTENG MPUMALANGA NORTH NORTHERN FREE EASTERN KWAZULU WESTERN LIMPOPO WEST CAPE STATE CAPE NATAL CAPE Alexander Bethal Boskop Kriegerspoort Allemanskraal Bonkolo Albert Falls Arieskraal Albasini Bon Accord Blyderivierspoort Bospoort Nooitgedacht13 Armenia Bridle Drift Amanzimnyama Berg River Black Heron Bronkhorstspruit Da Gama Buffelspoort Vaalharts Bellary825 Buffelsvlei120 Amcor Bot River Vlei Buffelspruit443KR Cinderella Doringpoort Elandskuil Vanderkloof Bethulie Cata Bloemveld Brandvlei Cramer Cowles Driekoppies Houwater Bloemhoek Dudley Pringle Driel Barrage Buffeljags Donkerpoort Cullinan Driekoppies Klerksdorp Damplaats190 EJ Smith Dudley Pringle Ceres Dr Neethling Jan Smuts Evander Klerkskraal Fouriespruit Gariep EJ Smith De Bos Ebenezer Leeupan Grootdraai Klipdrif Groothoek Gcuwa Gilbert Eyles De Hoop Vlei Fundudzi Tamboville Peter Wright Grootvlei Klipvoor Kalkfontein Grassridge Goedertrou Duiwenhoks Hans Merensky Rietvlei Inyaka Koster Klipfontein010 Gubu Hazelmere Elandskloof Inyaka Roodeplaat Klipkopjes Kromellenboog Knellpoort Hazelmere Hluhluwe Fortuin083 Jasi Rosherville Kwena Lindleys Poort Koppies Howisons Poort Inanda Garden Route Kanniedood Vanryn Leeupan532IR Little Marico Krugersdrift Impofu Klipfontein Groenvlei Klaserie Poort Longmere Manana026IP Leeukuil Inanda Kosi Estuary Klein River Vlei Lola Montes Loskop Marico-Bosveld Masels Poort Indwe KuHlange Kleinplaas Lornadawn Mapochs Modder Menin Kelly-Patterson KuShengeza Klipheuwel Magoebaskloof Middelburg Olifantsnek Montague547 Klipperif112 KuZilonde Knysna Lagoon Middle Letaba Nooitgedacht Potchefstroom Newbury Kouga Lake Cubhu Korinte-Vet Mutshedzi Nooitgedacht Schweitzer Potsdam645 Krom River Lake Msingazi Lower Langvlei Nsami Reneke Ohrigstad Sout Pan Rolandseck068 Laing Lake Sibayi Noordhoek lagoon Nwanedi Primkop Swartruggens Roodepoort468 Loerie Lake St Lucia Noordhoek Nzhelele Soutpan Roodepoort B Taaibosspruit Rustfontein Magwa Mgobezeleni Nuweberg Palabora Rooikraal Vaalkop Saulspoort Milner Mhlatuze Lagoon Paardevlei Phalaborwa Barrage

101

GAUTENG MPUMALANGA NORTH NORTHERN FREE EASTERN KWAZULU WESTERN LIMPOPO WEST CAPE STATE CAPE NATAL CAPE Shiyalongubo Witpoort394IP Sterkwater189 Mlanga Mzinto Skuifraam Piet Gouws Tonteldoos Strydpoort Nagle Nagle Soetendalsvlei Roodepoort467KR Trichardsfontein Tierpoort Nahoon Nhlabane Steenbras (Lower) Rooibosrand Vlugkraal Tweespruit 90 Toleni Nsezi Steenbras (Upper) Turfloop Vygeboom Vaal Van Stadens – Ntshingwayo Stettynskloof Tzaneen Upper Westoe Vaal Barrage Waterdown Phobane Lake Stompdrift Tzaneen Witklip Welbedacht Xilinxa Pongolapoort Swartvlei Vondo Weltevrede Xonxa Richards Bay Touws River Warmbad Estuary Shongweni Upper Langvlei Spioenkop Vogelvlei Umgababa Wemmershoek Woodstock Zandvlei Zeekoevlei Zwiegelaars

102

Table 3.4.

A summary of range shift for each of the bad five species under climate change conditions (km2).

Species Future Current

Azolla filiculoides 65 237 64 805

Eichhornia crassipes 35 714 35 185

Myriophyllum aquaticum 45 618 47 044

Pistia stratiotes 28 741 30 374

Salvinia molesta 59 510 58 475

103

3.4. Discussion

The identification of a suitable habitat for a species in relation to environmental variables is dependent on the quality of the occurrence data that is used for the modelling. Welk (2004) recommended the use of species native range data for species distribution modelling or that 50% of the occurrence data obtained from a

“species’ exotic range” should have at least 100 years of naturalization to ensure that the model is “trained” on the entire range to which the species is acclimatized to.

In this study, only data from the “species’ exotic range” was used. Occurrence data from a species’ native range requires extensive literature surveys from sources in different languages, sampling in difficult environments, and monetary constraints.

For the species modelled in this study, four of the five species had close to 100 years of naturalization in South Africa. Azolla filiculoides has been in South Africa for

65 years, Eichhornia crassipes for 129 years, Myriophyllum aquaticum for 92 years

(Henderson 2006), Pistia stratiotes for 148 years (Cilliers 1987), and Salivinia molesta for >100 years (Hill 2003). This indicates that the species have had enough time to naturalize in South Africa, and that the occurrence data can be used with confidence to model their distribution ranges. In addition, all the models generated had AUC values greater than 0.8 for the test data, which indicates that there is a high correlation between the species occurrence data and the predicted distribution and that the models were accurate in predicting climatically suitable present and future habitat for the species.

However, Joye et al. (2006) and Thum & Lennon (2010) have shown that water physico-chemical properties are key for predicting suitable habitat for aquatic

104

plants, and, according to Hill (2003), the five aquatic macrophytes studied flourish well in nitrate- and phosphate-enriched waters. In this study, I only use climate data to model current and future species distribution. A similar approach has been used in various studies on aquatic plants globally to predict areas suitable for invasion by aquatic species and these studies have indicated that climate alone can be successfully used to predict the distribution of aquatic plants (Julien et al. 1995; Welk

2004; Coetzee et al. 2009; Lehtonen 2009; Mukherjee et al. 2011).

Using Maximum Entropy modelling, the current and future distribution of the most damaging weeds was determined. The models produced have shown that potentially suitable habitats currently for these species are found in all nine provinces of the country, with the Northern Cape Province being the most unsuitable. The study also indicates dams, which occur in areas that are climatically suitable for the establishment of the ‘bad five’ aquatic invaders.

Ecological niche models provided by this study have proven to be useful for the management of aquatic plants as they indicate water bodies that are at risk of invasion currently and in the future. In South Africa there have been limited studies that use ecological niche models to predict habitat suitability for invasion by aquatic plants. One such study by Coetzee et al. (2009) used climatic conditions to predict potentially suitable areas for the distribution of aquatic invasive plant, Hydrilla verticillata. The results showed that 20 of South Africa’s dams occur in areas that are climatically suitable for the distribution of the species. In this study, results indicate that 234 dams occur in areas that are climatically suitable for the establishment of

105

the bad five, indicating a need for a continued commitment to monitor and eradicate not only the bad five but also those invasives that are less damaging.

Climate change is expected to alter species’ ranges and distribution, and is likely to favour the distribution of invasive species (Dukes & Mooney 1999; Thuiller et al. 2007) because invasive species have traits that enhance rapid range shift such as low seed mass, rapid growth and climatic tolerance (Rejmanek & Richardson

1996; Goodwin et al. 1999). All five species discussed in this study are included in the Global Invasive Species Database (http://www.issg.org/database), which shows that these species are able to adapt to varying climatic conditions globally. Models used to project the distribution of these species under climate change by 2080 have shown that climate change may favour the distribution of Azolla filiculoides,

Eichhornia crassipes and Salvinia molesta. However, the distribution of Pistia stratiotes and Myriophyllum aquaticum may be limited under climate change.

Furthermore, aquatic invasive plants have negative impacts on aquatic biodiversity, ecosystem services and the economy (Henderson & Cilliers 2002; see

Chapter 1 for further details). Pre-emptive actions, such as anticipating areas most vulnerable to invasion currently and in the future, are therefore necessary to limit the negative impacts. This study identifies such areas including dams that are currently not climatically suitable for species invasion but could be in the future based on climate change. The public also needs to be educated about the dangers posed by these aquatic plants. Nurseries and aquaria need to be properly monitored to ensure that these aquatic plants are not sold illegally to the public. As revealed by the DNA barcoding study in Chapter 2, some prohibited species are in the market and sold by

106

aquarists, showing the limitation of current control mechanisms. There is therefore a need for better eradication and control measures. DNA barcoding (Chapter 2) and the identification of potentially vulnerable ecosystems to species invasion (as revealed in this chapter) can assist in the design of such appropriate eradication and control mechanisms. Water bodies that occur in areas that are climatically suitable for the distribution of these weeds need to be adequately surveyed and monitored to prevent new introductions. Overall, further studies are necessary to investigate: i) how water physico-climatic conditions contribute to species invasion; and ii) how biological control agents of each the bad five might be affected by climate change.

3.5. Conclusions

The eradication of established aquatic plants costs the country large sums of money in eradication efforts annually. It is therefore important to predict areas that are suitable for the establishment of noxious weeds to prevent infestations. In this study,

I have constructed models to predict the risk of invasion possessed by the five most damaging weeds in South Africa based on current and future climate scenarios. The results obtained are useful for developing monitoring and management strategies to prevent future invasions. However, future studies need to combine climate change and water physico-chemical data to build stronger predictive models.

107

CHAPTER FOUR

General conclusions

108

CHAPTER FOUR GENERAL CONCLUSIONS

In South Africa, major rivers, dams, lakes and irrigation canals are invaded by alien plants, disrupting navigation, compromising agriculture, hydroelectricity generation, and ecosystem services (Hill 2003). This invasion reduces sunlight penetration, oxygen levels and water quality and threatening the biodiversity of aquatic ecosystems (Van Wilgen et al. 2001). The invaders also create breeding sites for malaria-carrying mosquitos and bilharzia-carrying snails (Henderson & Cilliers 2002).

Controlling and eradicating these noxious alien invasive aquatic plants are costly operations to South Africa’s economy. For example, these operations cost annually US$ 58 million and US$ 78 000 to clear water bodies invaded by Azolla filiculoides and Eichhornia crassipes, respectively (Van Wilgens et al. 2001; Van

Wyk & Van Wilgen 2002). However, the success of these operations is mixed for several reasons. For example, invasive aquatic plants often spread very rapidly either before they are spotted or before decisions are taken to implement control actions. This limitation is further exacerbated by difficulties in determining the invasion potential of newly introduced or unknown aquatic plants, as well as difficulties inherent to species identification (Henderson & Cilliers 2002).

To limit the impacts of the invasive species in general, SANBI ISP designs a number of interventions including a rapid detection of potential invaders, a correct and also rapid identification and verification of invasive plants at early stage of their introduction (Wilson et al. 2013). However, due to difficulties and limitations of morphology-based identifications (e.g. generally time-consuming for a non-

109

specialist), I explore here the utility of DNA barcoding techniques as a complementary method to morphological identification, testing the potential of the official DNA barcodes (rbcLa + matK or core barcodes), trnH-psbA, and the core barcode + trnH-psbA to identify invasive aquatic plants of South Africa’s freshwaters.

The core DNA barcode provided the lowest discriminatory power irrespective of the methods used. However, the use of trnH-psbA alone or in combination with the core barcodes results in 100% successful species identification. In contrast, the matK region was the most difficult region to amplify, and this has been raised in several other studies involving aquatic plants (Van de Wiel et al. 2009; Ghahramanzadeh et al. 2013). This study therefore validates the use of trnH-psbA as single DNA barcode with which one can accelerate identification of invasive aquatic plants in South

Africa.

The finding of a single good DNA barcode has several advantages. It will ease DNA data accumulation as generating a database for single gene is economically cheaper than generating a multi-locus database. It will also ease the establishment of a DNA library for invasive aquatic plants. This library will facilitate species identification each time the morphology-based identification is difficult, time- consuming or doubtful. In so doing, the DNA barcode library provided in this study will facilitate rapid control or management actions before species are spread.

To demonstrate the efficiency of the DNA barcode library, I explore the efficacy of trnH-psbA on seven aquarium species that are sold in the market. There is mounting evidence that aquarium trade contributes significantly to the global distribution of invasive aquatic plant species (Kay & Hoyle 2001; Henderson &

110

Cilliers 2002; Padilla & Williams 2004; Maderia et al. 2007; Martin & Coetzee 2011).

The BLAST analysis that I conducted revealed that four of the seven aquarium plants tested are prohibited species in South Africa: Hydrilla verticillata, Egeria densa, and Myriophyllum spicatum and Echinodorus cordifolius (NEM:BA 2004).

This result demonstrates not only the utility of DNA barcoding in implementing control measures, but also that the existing control at borders is not yet efficient enough to prevent the introduction of prohibited species in the country.

After the detection step of invasive species (Chapter 2), it is important to assess the risks that the species represent to inform response planning (Wilson et al.

2013). Such risk assessment can include the identification of areas most vulnerable to the invasion of identified invasive species (Chapter 3). Several factors contribute to species invasion success; in this study, I focus only on the effects of climate change. Overall, I found that the following parameters are important correlates of the distrbution of invasive aquatic alien species: minimum temperature of the coldest month, mean temperature of the driest quarter, precipitation of the warmest quarter, precipitation of the coldest quarter, precipitation of the warmest month, and mean temperature of the coldest quarter.

Based on these climate parameters, the bad five present distinct distribution potentials. This is described as follows. All South Africa’s nine provinces are climatically suitable for the invasion by Eichhornia crassipes. However, six and seven of the nine provinces might provide favourable climatic conditions for the establisment of Azolla filiculoides and Myriophyllum aquaticum, respectively: Azolla filiculoides (North West, Gauteng, Mpumalanga, Free State, Eastern Cape, and

111

Western Cape Provinces) and Myriophyllum aquaticum (Limpopo, North West,

Gauteng, Mpumalanga, Eastern Cape, KwaZulu Natal, and Western Cape provinces). In addition, I found that Pistia stratiotes and Salvinia molesta share the same distribution patterns under current climatic conditions: Limpopo, Mpumalanga,

KwaZulu Natal, Eastern Cape and Western Cape Provinces. In total, I found that

38% of all dams existing in South Africa (234 out of 612) occur in areas that are climatically suitable for the establishment of at least one of the bad five, with the highest number of vulnerable dams for the invasion of the bad five located in the

Western Cape Province and the lowest number of dams located in the Northern

Cape Province.

Assessing how climate change might affect these distribution ranges in the future (i.e. by 2080), I found contrasting effects such that some species might have their range expand whilst others' ranges might contract. In particular, the range of

Azolla filiculoides, Eichhornia crassipes, Salvinia molesta might increase by 1%,

1.5% and 2%, respectively whilst the ranges of Myriophyllum aquaticum and Pistia stratiotes might decrease by 3% and 5%, respectively based on climate change. This range contraction and expansion will result in some dams currently vulnerable to invasion becoming resilient whilst others that are currently resilient might become vulnerable owing to climate change. As such, this study provides useful information with which to:

 ease identification of invasive aquatic plants of South Africa’s feshwater systems

using molecular data such as DNA barcodes (Chapter 2); and

 prioritise control/eradication efforts based on predicted habitats (dams)

vulnerability to climate change effects in the future.

112

Nonetheless, additional studies that focus on water physico-chemistry are still required for further analysis of water bodies vulnerability to species invasion.

113

CHAPTER FIVE

References

114

CHAPTER 5

REFERENCES

Armstrong, K.F., & Ball, S.L. 2005. DNA barcodes for biosecurity: invasive species

identification. Philosophical Transactions of the Royal Society B: Biological

Sciences 360 (1462): 1813-1823.

Avis, A.M. 1989. A review of costal dune stabilization in the Cape Province of South

Africa. Landscape & Urban Planning 18 (1): 55-68.

Bailey, J.P., Bimova, K., & Mandak, B. 2007. The potential role of polyploidy and

hybridization in further evolution of highly invasive taxa in Europe. Ecological

Research 22: 920-928.

Barrett, S.C.H. 1977. Tristyly in Eichhornia crassipes (Mart.) Solms (water hyacinth).

Biotropica 9 (4): 230-238.

Barrett, S.C.H. 1980. Sexual reproduction in Eichhornia crassipes (water hyacinth)

II. Seed production in natural populations. Journal of Applied Ecology 17 (1):

113-124.

Barrett, S.C.H. 1988. Evolution of breeding systems in Eichhornia (Pontederiaceae):

a review. Annals of the Missouri Botanical Garden 75 (3): 741-760.

Bezeng, B.S., Savolainen, V., Yessoufou, K., Papadopulos, A.S.T., Maurin, O., &

Van Der Bank, M. 2013. A phylogenetic approach towards understanding the

drivers of plant invasiveness on Robben Island, South Africa. Botanical

Journal of the Linnean Society 172 (2): 142-152.

Blaxter, M. 2004. The promise of DNA taxonomy. Philosophical Transactions of the

Royal Society Biological Science 359: 669-679.

115

Bleeker, W., Klausmeyer, S., Peintinger, M., & Dienst, M. 2008. DNA sequences

identify invasive alien Cardamine at Lake Constance. Biological Conservation

141 (3): 692-698.

Blignaut, J.N., Marais, C., & Turpie, J.K. 2007. Determining a charge for clearing

invasive alien plants species (IAPs) to augment water supply in South Africa.

Water South Africa 33 (1): 27-34.

Bromilow, C. 2010. Problem plants of South Africa. Briza Publications, Pretoria.

Brown, S.D.J., Collins, R.A., Boyer, S., Lefort, M.C., Malumbres-Olarte, J., Vink,

C.J., & Cruickshank, R.H. 2012. Spider: An R package for the analysis of

species identity and evolution, with particular reference to DNA barcoding.

Molecular Ecology Resources 12 (3): 562-565.

Brownlie, S., & Wynberg, R. 2001. Integration of biodiversity into National

Environmental Assesment procedures. Available online from:

http:www.cdb.int/impact/casse-studies/csimpact-ibneap-za-en.pdf [Accessed

20 Feb 2013].

Burgiel, S., Foote, G., Orellana, M., & Perrault, A. 2006. Invasive alien species

and trade: integrating prevention measures and international trade rules.

Washington, DC, USA: Center for International Environmental Law and

Defenders of Wildlife.

Capers, R.S., Selsky, R., Bugbee, G.R., & White, J.C. 2007. Aquatic plant

community invisibility and scale-dependent patterns in native and invasive

species richness. Ecology 88 (12): 3135-3143.

Cappuccino, N., & Carpenter, D. 2005. Invasive exotic plants suffer less herbivory

than non-invasive exotic plants. Biology Letters 1: 435-438.

116

CBOL Plant Working Group. 2009. A DNA Barcode for land plants. Proceedings of

the National Academy of Sciences USA 106: 12794-12797.

Chang, K.T. 2010. Introduction to geographic information systems. McGraw-Hill,

New York.

Charudattan, R. 2001. Biological control of weeds by means of plant pathogens:

significance for integrated weed management in modern agro-ecology.

Biological Control 46: 229-260.

Chase, M.W., Cowan, R.S., Hollingsworth, P.M., Van Den Berg, C., Madriñán, S.,

Petersen, G., & Wilkinson, M. 2007. A proposal for a standardised protocol

to barcode all land plants. Taxon 56 (2): 295-299.

Chefaoui, R.M., Hortal, J., & Lobo, J.M. 2005. Potential distribution modelling,

niche characterization and conservation status assessment using GIS tools: a

case study of Iberian Copris species. Biological Conservation 122: 327-338.

Cilliers, C.J. 1987. First attempt at and early results of the biological control of Pistia

stratiotes L. in South Africa. Koedoe-African Protected Area Conservation and

Science 30: 35-40.

Cilliers, C.J. 1991a. Biological control of Salvinia molesta (Salviniaceae), in South

African. Agriculture, Ecosystem and Environment 37: 219-224.

Cilliers, C.J. 1991b. Biological control of water lettuce, Pistia stratiotes (Araceae), in

South Africa. Agriculture, Ecosystem and Environment 37: 225-229.

Cilliers, C.J. 1991c. Biological control of parrot’s feather, Myriophyllum aquaticum

(Vell.) Verd. (Haloragaceae) in South Africa. African Entomology Memoir

1:113-118.

117

Clement, W.L., & Donoghue, M.J. 2012. Barcoding success as a function of

phylogenetic relatedness in Viburnum, a clade of woody angiosperms. BMC

Evolutionary Biology 12: 73.

Coetzee, J.A., Byrne, M.J., & Hill, M.P. 2007. Predicting the distribution of

Eccoritotarsus catarinensis, a natural enemy released on water hyacinth in

South Africa. Entomologia Experimentalis et Applicata 125 (3): 237-247.

Coetzee, J.A, Hill, M.P., & Schlange, D. 2009. Potential spread of the invasive

plant Hydrilla verticillata in South Africa based on anthropogenic spread and

climate suitability. Biological Invasions 11: 801-812.

Collins, J. 2001. Biodiversity in South Africa. Department of Conservation Biology,

University of the Western Cape. Available online from:

http://www.botany.uwc.ac.za/envfacts/biosa.html [Accessed 20 Feb 2013].

Cowling, R.M., Pressey, R.L., Rouget, M., & Lombard, A.T. 2003. A conservation

plan for a global biodiversity hotspot - the Cape Floristic Region, South Africa.

Biological Conservation 112: 191-216.

Cuénoud, P., Savolainen, V., Chatrou, L.W., Powell, M., Grayer, R.J., & Chase,

MW. 2002. Molecular phylogenetics of Caryophyllales based on nuclear 18S

rDNA and plastid rbcL, atpB, and matK DNA sequences. American Journal of

Botany: 89: 132-144.

Daehler, C.C. 2001. Darwin’s naturalisation hypothesis revisited. The American

Naturalist 158: 324-330.

Darwin, C. 1989. The voyage of the Beagle. Hayes Barton Press.

Dassonville, N., Vanderhoeven, S., Vanparys, V., Hayez, W.G., & Meerts, P.

2008. Impact of alien invasive plants on soil nutrients are correlated with initial

site conditions in Europe. Oecologia 157 (11): 131-140.

118

De Vere, N., Rich, T.C.G., Ford, C.R., Trinder, S.A., Long, C., Moore, C.W.,

Satterthwaite, D., Davies, H., Allainguillaume, J., Ronca, S., Tatarinova,

T., Garbett, H., Walker, K., & Wilkinson, M.J. 2012. DNA barcoding the

flowering plants and conifers of Wales. PLoS ONE 7 (6): e37945.

Diez, J.M., Williams, P.A., Randall, R.P., Sullivan, J.J., Hulme, P.E., & Duncan,

R.P. 2009. Learning from failures: testing broad taxonomic hypotheses about

plant naturalization. Ecology Letters 12: 1174-1183.

Doyle, J.J., & Doyle, J.L. 1987. A rapid DNA isolation procedure for small quantities

of fresh leaf tissue. Phytochemical Bulletin 19: 11-15.

Dukes, J.S., & Mooney, H.A. 1999. Does global change increase the success of

biological invaders? Trends in Ecology and Evolution 14: 135-139.

Dunning, L.T., & Savolainen, V. 2010. Broad‐scale amplification of matK for DNA

barcoding plants, a technical note. Botanical Journal of the Linnean Society

164 (1): 1-9.

Ebeling, S.K., Hensen, I., & Auge, H. 2008. The invasive shrub Buddleja davidii

performs better in its introduced range. Diversity and Distribution 14 (2): 225-

233.

Edgar, R. 2004. MUSCLE: Multiple sequence alignment with high accuracy and high

throughput. Nucleic Acids Research 32: 1792-1797.

Elansary, H.O. 2013. Towards a DNA barcode library for Egyptian flora, with a

preliminary focus on ornamental trees and shrubs of two major gardens. DNA

Barcodes 1: 46-55.

Elith, J., Phillips, S.J., Hastie, T., Dudík, M., Chee, Y.E., & Yates, C.J. 2011. A

statistical explanation of MaxEnt for ecologists. Diversity and Distribution 17:

43-57.

119

Ellstrand, N.C., & Schierenbeck, K.A. 2000. Hybridization as a stimulus for

evolution of invasiveness in plants. PNAS 94 (13): 7043-7050.

Fay, M.F., Bayer, C., Alverson, W.S., De Bruijn, A., & Chase, M.W. 1998. Plastid

rbcL sequence data indicate a close affinity between Diegodendron and Bixa.

Taxon 47: 43-50.

Fazekas, A.J., Kesanakurti, P.R., Burgess, K.S., Percy, D.M., Graham, S.W.,

Barrett, S.C., Newmaster, S.G., Hajibabaei, M., & Husband, B.C. 2009. Are

plant species inherently harder to discriminate than animal species using DNA

barcoding markers? Molecular Ecology Resources 9 (1): 130-139.

Felsenstein, J. 1985. Confidence levels on phylogenies: an approach using the

bootstrap. Evolution 39: 783-791.

Fitch, W.M. 1971. Toward defining the course of evolution: minimum change for a

specific tree topology. Systematic Biology 20 (4): 406-416.

Gaskin, J.F., Bon, M., Cock, M.J.W., Cristofaro, M., De Biase, A., De Clerck-

Floate, R., Ellison, C.A., Hinz, H.L., Hufbauer, R.A., Julien, M.H., & Sforza,

R. 2011. Applying molecular-based approaches to classical biological control

of weeds. Biological Control 58 (1): 1-21.

Gerber, A., Cillier, C.J., Van Ginkel, C., & Glen, R. 2004. Easy identification of

aquatic plants: a guide for the identification of water plants in and around

South African impoundments. Departments of Water Affairs, Pretoria.

Gere, J., Yessoufou, K., Daru, B.H., Mankga, L.T., Maurin, O., Van der Bank, M.

2013. Incorporating trnH-psbA to the core DNA barcodes improves

significantly species discrimination within southern African Combretaceae.

ZooKeys 365: 127-147.

120

Ghahramanzadeh, R., Esselink, G., Kodde, L.P., Duistermaat, H., Valkenburg,

J.L.C.H., Marashi, S.H., & Wiel, C.C.M. 2013. Efficient distinction of invasive

aquatic plant species from non‐invasive related species using DNA barcoding.

Molecular Ecology Resources: 13 (1): 21-31.

Goodwin, B.J., McAllister, A.J., & Fahrig, L. 1999. Predicting invasiveness of plant

species based on biological information. Conservation Biology 13: 422-426.

Gorgens, A.H.M., & Van Wilgen, B.W. 2004. Invasive alien plants and water

resources in South Africa: current understanding, predictive ability and

research challenges. South African Journal of Science 100: 27-33.

Grace, J.B., Smith, M.D., Grace, S.L., Collins, S.L., & Stohlgren, T.J. 2001.

Interactions between fire and invasive plants in temperate grasslands of North

America. Pages 40–65 in Galley, K.E.M., & Wilson, T.P., (eds.). Proceedings

of the Invasive Species Workshop: The Role of Fire in the Control and Spread

of Invasive species. Fire Conference 2000: the First National Congress on

Fire. Ecology, Prevention, and Management. Miscellaneous Publication No.

11, Tall Timbers Research Station, Tallahassee, FL.

Guisan, A., & Zimmermann, N.E. 2000. Predictive habitat distribution models in

ecology. Ecological Modelling 135: 147-186.

Harrison, P.G. 1979. Reproductive strategies in intertidal populations of two co-

occurring seagrasses (Zostera spp.). Canadian Journal of Botany 57 (23):

2635-2638.

Hawkes, C. 2007. Are invaders moving targets? The generality and persistence of

advantage in, reproduction, and the enemy release hypothesis in invasive

plant species with time since introduction. American Naturalist 157 (2): 231-

236.

121

Hebert, P.D., Ratnasingham, S., & De Waard, J.R. 2003. Barcoding animal life:

cytochrome c oxidase subunit 1 divergences among closely related species.

Proceedings of the Royal Society of London. Series B: Biological Sciences,

270 (Suppl 1): doi: 10.1098/rsbl.2003.0025.

Henderson, L. 2006. Comparisons of invasive plants in southern Africa originating

from southern temperate, northern temperate and tropical regions. Bothalia 36

(2): 201-222.

Henderson, L. 2009. Are we fighting a losing battle against invasive alien plants?

South Africa Plant Invaders Atlas 10: 1-5.

Henderson, L. 2011. Mapping of invasive alien plants: The contribution of the

southern African plant invaders atlas (SAPIA) to biological weed control.

African Entomology 19: 498-503.

Henderson, L., & Cilliers, C.J. 2002. Invasive aquatic plants: a guide to the

identification of the most important and potentially dangerous invasive aquatic

and wetland plants in South Africa. PPRI Handbook No. 16. Agricultural

Research Council, Pretoria.

Hernandez, P.A., Graham, C.H., Master, L.L., & Albert, D.L. 2006. The effect of

sample size and species characteristics on performance of different species

distribution modelling methods. Ecography 29: 773-785.

Higgins, S.I., Richardson, D.M., Cowling, R.M., & Trinder-Smith, T.H. 1999.

Predicting the landscape-scale distribution of alien plants and their threat to

plant diversity. Conservation Biology 13 (2): 303-313.

Hijmans, R.J., Cameron, S.E., Parr, J.L., Jones, P.G., & Jarvis, A. 2005. Very

high resolution interpolated climate surfaces for global land areas.

International Journal of Climatology 25: 1965-1978.

122

Hill, M.P. 2003. The impact and control of alien aquatic vegetation in South African

aquatic ecosystems. African Journal of Aquatic Science 28: 19-24.

Hillis, D.M., & Bull, J.J. 1993. An empirical test of bootstrapping as a method for

assessing confidence in phylogenetic analysis. Systematic Biology 42: 182-

192.

Hoddle, M.S. 2004. Restoring balance: using exotic species to control invasive

exotic species. Conservation Biology 18 (1): 38-49.

Hollingsworth, M.L., Clark, A., Forrest, L.L., Richardson, J., Pennington, R.T.,

Long, D.G., Cowan, R., Chase, M.W., Gaudeul, M., & Hollingsworth, P.M.

2009 Selecting barcoding loci for plants: evaluation of seven candidate loci

with species-level sampling in three divergent groups of land plants. Molecular

Ecology Resources 9: 439-457.

Hollingsworth, P.M., Graham, S.W., & Little, D.P. 2011. Choosing and using a

plant DNA barcode. PLoS ONE 6 (5): e19254.

Immel, F., Renaut, J., & Masfaraud, J. 2012. Physiological response and

differential leaf proteome pattern in the European invasive Asteraceae

Solidago canadensis colonizing a former cokery soil. Journal of Proteomics 75

(4): 1129-1143.

Jaca, T.P. 2013. Iris pseudacorous L.: an ornamental plant aquatic with invasive

potential in South Africa. South African Journal of Botany 84:

doi:10.1016/j.sajb.2013.02.133.

Jiang, L., Tan, J., & Pu, Z. 2010. An experimental test of Darwin’s naturalization

hypothesis. The American Naturalist 175: 415-423.

123

Joye, D.A., Oertli, B., Lehmann, A., Juge, R., & Lachavanne, J.B. 2006. The

prediction of macrophyte species occurrence in Swiss ponds. Hydrobiologia

570 (1): 175-182.

Julien, M.H., Skarratt, B., & Maywald, G.F. 1995. Potential geographical

distribution of alligator weed and its biological control by Agasicles hydrophila.

Journal of Aquatic Management 35: 55-60.

Kay, S.H., & Hoyle, S.T. 2001. Mail order, the Internet, and invasive aquatic plants.

Journal of Aquatic Plant Management 39: 88-91.

Keane, R.M., & Crawley, M.J. 2002. Exotic plant invasion and the enemy release

hypothesis. Trends in Ecology and Evolution 17 (4): 164-170.

Kepe, T., Saruchera, M., & Whande, W. 2004. Poverty alleviation and biodiversity

conservation: a South African perspective. Oryx 38 (2): 143-145.

King, A.M. 2011. The effect of temperature on biological control of water hyacinth,

Eichhornia crassipes (Pontederiaceae) in South Africa. MSc Dissertation

available online from: http://wiredspace.wits.ac.za/handle/10539/11066

[Accessed 18 May 2013].

Kress, W.J., & Erickson, D.L. 2007. A two-locus global DNA barcode for land

plants: The coding rbcL gene complements the non-coding trnH-psbA spacer

region. PLoS ONE 2 (6):e508.doi:10.1371/journal.pone.0000508.

Kress, W.J., Wurdack, K.J., Zimmer, E.A., Weight, I.A., & Jazen, D.H. 2005. Use

of DNA barcodes to identify flowering plants. Proceedings of the National

Academy of Sciences USA 102: 8369-8374.

Lahaye, R., Van der Bank, M., Bogarin, D., Warner, J., Pupulin, F., Gigot, G.,

Maurin, O., Duthoit, S., Barraclough, T.G., & Savolainen, V. 2008. DNA

124

barcoding the floras of biodiversity hotspots. Proceedings of the National

Academy of Sciences 105 (8): 2923-2928.

Lambdon, P.W., & Hulme, P.E. 2006. How strongly do interactions with closely‐

related native species influence plant invasions? Darwin's naturalization

hypothesis assessed on Mediterranean islands. Journal of Biogeography 33

(6): 1116-1125.

Lancar, L., & Krake, K. 2002. Aquatic plants and their management. International

Commission on Irrigation and Drainage. Available online from:

http:/www.icid.org/ eed_report.pdf [Accessed 13 May 2013].

Lehtonen, S. 2009. On the origin of Echinodorus grandiflorus (Alismataceae) in

Florida (“E. floridanus”), and its estimated potential as an invasive species.

Hydrobiologia 635 (1): 107-112.

Letsebe, K. 2010. Working for Water: National Teacher’s Conference and Weed

Buster Campaign. Available online from:

www.http:www.dwaf.gov.za/wfw/Docs/July-AugE-news.pdf [Accessed 15 May

2013].

Li, D.Z., Liu, J.Q., Chen, Z.D., Wang, H., Ge, X.J., Zhou, S.L., & Chen, S.L. 2011.

Plant DNA barcoding in China. Journal of Systematics and Evolution 49 (3):

165-168.

Liu, X., Gug, Z., Ke, Z., Wang, S., & Li, Y. 2011. Increasing potential risk of a global

aquatic invader in Europe in contrast to other continents under future climate

change. PLOS ONE 6: 3 e18429 doi: 10.37/journal.pone.0018429.

Lockwood, J.L., Cassey, P., & Blackburn, T. 2005. The role of propagule pressure

in explaining species invasion. Ecology and Evolution 20 (5): 223-228.

125

Lorenzo, P., Hussain, M.I., & Gonzalez, L. 2013. Role of allelopathy during

invasion process by alien invasive plants in terrestrial ecosystems.

DOI:10.1007/987-3-642-3059-5_1.

Mack, R.N., Simberloff, D., Lonsdale, W.M., Evans, H., Clout, M., & Bazzaz, F.A.

2000. Biotic invasion: causes, epidemiology, global consequences, and

control. Ecological Applications 10: 689-710.

Madeira, P.T., Coetzee, J.A., Center, T.D., White, E.E., & Tipping, P.W. 2007. The

origin of Hydrilla verticillata recently discovered at a South African dam.

Aquatic Botany doi:10.1016/j.aquabot.2007.04.008.

Mankga, L.T., Yessoufou, K., Moteetee, A.M., Daru, B.H., Van der Bank, M.

2013. Efficacy of the core DNA barcodes in identifying processed and poorly

conserved plant materials commonly used in South African traditional

medicine. ZooKeys 365: 215-233.

Maron, J.L., & Vila, M. 2001. When do herbivores affect plant invasion? Evidence

for the natural enemies and biotic resistance hypotheses. Oikos 95 (3): 361-

373.

Martin, G.D., & Coetzee, J.A. 2011. Pet stores, aquarists and the internet trade as

modes of introduction and spread of invasive macrophytes in South Africa.

Water South Africa 37 (3): 371-380.

Masmane, L. 2007. Water hyacinths threatens South African marine species.

Available online from: http://bcb722.blogspot.com/2007/01/water-hyacinths-

threatens-south.html [Accessed 16 March 2013].

McConnachie, A.J., De Wit, M.P., Hill, M.P., & Byrne, M.J. 2003. Economical

evaluation of the successful biological control of Azolla filiculoides in South

Africa. Biological Control 28: 25-32.

126

McGeoch, M.A., Butchart, S.H.M., Spear, D., Marais, E., Kleynhans, E.J., Symes,

A., Chanson, J., & Hoffmann, M. 2010. Global indicators of biological

invasion: species numbers, biodiversity impact and policy responses. Diversity

and Distributions 16: 95-108.

McNeely, J.A. 2001. The great reshuffling: human dimensions of invasive species.

IUCN Publications, Cambridge.

Meier, R., Shiyang, K., Vaidya, G., Ng, P.K.L. 2006. DNA barcoding and taxonomy

in Diptera: a tale of high intraspecific variability and low identification success.

Systematic Biology 55: 715-728.

Meyer, C.P., & Paulay, G. 2005. DNA barcoding: error rates based on

comprehensive sampling. PLoS Biology 3 (12): e422.

Meyers, N., Mitterneier, R.A., Mitterneier, C.G., da Fonsesca, G.A.B., & Kent, J.

2000. Biodiversity hotspots for conservation priorities. Nature 403: 853-858.

Meyerson, L.A., & Mooney, H.A. 2007. Invasive alien species in an era of

globalization. Frontiers in Ecology and the Environment 5 (4): 199-208.

Milton, S.J. 2004. Grasses as invasive alien species in South Africa. South African

Journal of Science 100: 69-75.

Mitchell, C.E., & Power, A.G. 2003. Release of invasive plants from fungal and viral

pathogens. Nature 421 (6): 625-627.

Moody, M.L., Les, D.H., & Ditomaso, J.M. 2008. The role of plant systematics in

invasive aquatic plant management. Journal of Aquatic Plant Management 46:

7-15.

Mooney, H.A., & Hobbs, R.J. 2000. Invasive species in a changing world. Island

Press, Washington.

127

Mort, M.E., Randle, C.P., Burgoyne, P., Smith, G., Jaarsveld, E., & Hopper, S.D.

2009. Analyses of cpDNA matK sequence data place Tillaea (Crassulaceae)

within Crassula. Plant Systematics and Evolution 283 (3-4): 211-217.

Mukherjee, A., Christman, M.C., Overholt, W.A., & Cuda, J.P. 2011. Prioritizing

areas in the native range of hygrophila for surveys to collect biological control

agents. Biological Control 56: 254-262.

NEM:BA. 2004. National Environmental Management: Biodiversity Act (No. 10 of

2004). Government Gazette No. 32090, 3 April 2009. Department of

Environmental Affairs and Tourism, Pretoria.

Newmaster, S.G., & Ragupathy, S. 2009. Testing plant barcoding in a sister

species complex of pantropical Acacia (Mimosoideae, Fabaceae). Molecular

Ecology Resources 9: 172–180.

O'Donnell, J., Gallagher, R.V., Wilson, P.D., Downey, P.O., Hughes, L., &

Leishman, M.R. 2012. Invasion hotspots for non‐native plants in Australia

under current and future climates. Global Change Biology 18 (2): 617-629.

Ordonez, A., Wright, I.J., & Olff, H. 2010. Functional differences between native

and alien species: a global‐scale comparison. Functional Ecology 24 (6):

1353-1361.

Padilla, D.K., & Williams, S.L. 2004. Beyond ballast water: aquarium and

ornamental trades as sources of invasive species in aquatic ecosystems.

Frontiers in Ecology and the Environment 2 (3): 131-138.

Pearson, R.G., Raxworthy, C.J., Nakamura, M., & Townsend Peterson, A. 2007.

Predicting species distributions from small numbers of occurrence records: a

test case using cryptic geckos in Madagascar. Journal of Biogeography 34

(1): 102-117.

128

Pejchar, L., & Mooney, H.A. 2009. Invasive species, ecosystem services and

human well-being. Ecology and Evolution 24 (9): 498-504.

Pennise, E. 2007. Wanted: a barcode for plants. Science 318: 190-191.

Perera, S.J., Ratnayake-Perera, D., & Proches, S. 2011. Vertebrate distributions

indicate a greater Maputaland-Pondoland-Albany region of endemism. South

African Journal of Science 107 (7 & 8): 1-15.

Peterson, A.T., & Vieglais, D.A. 2001. Predicting species invasions using

ecological niche modelling. BioScience 51: 363-371.

Peterson, A.T., Papeş, M., & Eaton, M. 2007. Transferability and model evaluation

in ecological niche modeling: a comparison of GARP and Maxent. Ecography

30 (4): 550-560.

Petit, R.J., & Excoffier, L. 2009. Gene flow and species delimitation. Trends in

Ecology and Evololution 24: 386-393.

Pettengill, J.B., & Neel, M.C. 2010. An evaluation of candidate plant DNA barcodes

and assignment methods in diagnosing 29 species in the genus Agalinis

(Orobanchaceae). American Journal of Botany 97: 1381-1406.

Phillips, R.C., Grant, S.W., & McRoy, P.C. 1983. Reproductive strategies of

eelgrass (Zostera marina L.). Aquatic Botany 16 (1): 1-20.

Phillips, S.J., Anderson, R.P., & Schapire, R.E. 2006. Maximum entropy modelling

of species geographic distributions. Ecological Modelling 190: 231-259.

Phillips, S.J., & Dudik, M. 2008. Modelling of species distributions with MaxEnt:

new extensions and a comprehensive evaluation. Ecography 31: 161-175.

Pimentel, D., Zuniga, R., & Marrison, D. 2005. Update on the environmental and

economic costs associated with alien-invasive species in the United States.

Ecological Economics 52: 273-388.

129

Poona, N. 2013. Invasive alien plants species in South Africa. Impacts and

management options. Available online from:

http://academia.edu/247322/Invasive_Alien_Plant_Species_In_South_Africa_I

mpacts_and_Management_Options [Accessed 15 May 2013].

Pyšek, P., Brooks, J.H., Bimova, K., Mandak, B., Jarosik, V., Koukolikova, I.,

Pergel, J., & Stepanek, J. 2003. Vegetative reproduction in invasive

Reynoutria (Polygonaceae) taxa: the determinant of invisibility at the genotype

level. American Journal of Botany 90 (10): 1487-1495.

Pyšek, P., Jarošík, V., Chytrý, M., Danihelka, J., Kühn, I., Pergl, J., Tichý, L.,

Biesmeijer, J., Ellis, W.N., Kunin, W.E., & Settele, J. 2011. Successful

invaders co-opt pollinators of native flora and accumulate insect pollinators

with increasing residence time. Ecological Monographs 81: 277-293.

Pyšek, P., Jarošík, V., Hulme, P.E., Kühn, I., Wild, J., Arianoutsou, M., Bacher,

S., Chiron, F., Didžiulis, V., Essl, F., Genovesi, P., Gherardi, F., Hejda, M.,

Kark, S., Lambdon, P.W., Desprez Loustau, A.M., Nentwig, W., Pergl, J.,

Poboljšaj, K., Rabitsch, W., Roques, A., Roy, D.B., Solarz, W., Vila, M., &

Winter, M. 2010. Disentangling the role of environmental and human

pressures on biological invasions across Europe. Proceedings of the National

Academy of Sciences of the United States of America 107 (12): 157-162.

Pyšek, P., Richardson, D.M., Rejmanek, M., Webster, G.L., Williamson, M., &

Kirscher, J. 2004. Alien plants in checklists and floras: towards better

communication between taxonomists and ecologist. Taxon 53 (1): 131-143.

Pyšek, P., Hulme, P.E., Meyerson, L.A., Smith, G.F., Boatwright, J.S., Crouch,

N.R., Figueiredo, E., Foxcroft, L.C., Jarosˇı´k, V., Richardson, D.M., Suda,

130

J., Wilson, J.R.U. 2013. Hitting the right target: taxonomic challenges for, and

of, plant invasions. AoB PLANTS 5: plt042; doi:10.1093/aobpla/plt042

Ragupathy, S., Newmaster, S.G., Murugesan, M., & Balasubramaniam, V. 2009.

DNA barcoding discriminates a new cryptic grass species revealed in an

ethnobotany study by the hill tribes of the Western Ghats in southern India.

Molecular Ecology Resources 9: 164-171.

Rejmanek, M., & Richardson, D.M. 1996. What attributes make some plant species

more invasive? Ecology 77: 1655-1661.

Ricciardi, A. & Atkinson, S.K. 2004. Distinctiveness magnifies the impact of

biological invaders in aquatic ecosystems. Ecological Letters 7: 781-784.

Ricciardi, A., & Mottiar, M. 2006. Does Darwin’s naturalization hypothesis explain

fish invasions? Biological Invasions 8 (6): 1403-1407.

Richardson, D.M., Pyšek, P., Rejmanek, M., Barbour, M.G., Ponnetta, F.D., &

West, C.J. 2000. Naturalization and invasion of alien plants: concepts and

definitions. Diversity and Distributions 6: 93-107.

Richardson, D.M., & Van Wilgen, B.W. 2004. Invasive alien plants in South Africa

how well do we understand the ecological impact? South African Journal of

Science 100: 45-52.

Robinson, T.B., Griffiths, C.L., McQuaid, C.D., & Rius, M. 2005. Marine alien

species of South Africa - status and impacts. African Journal of Marine

Science 27 (1): 297-306.

Roy, S., Tyagi, A., Shulka, V., Kumar, A., Singh, U.M., Chaudhary, L.B., Datt, B.,

Bag, S.K., Singh, P.K., Nair, N.K., Husain, T., & Tuli, R. 2010. Universal

plant DNA barcode loci may not work in complex groups: a case study with

Indian Berberis species. PLoS ONE 5: e13674.

131

Rouget, M., & Richardson, D.M. 2003. Inferring process from pattern in plant

invasions: a semimechanistic model incorporating propagule pressure and

environmental factors. American Naturalist 162 (6): 712-724.

Rouget, M., Richardson, D.M., Nel, J.L., Le Maitre, D.C., Egoh, B., & Mgidi, T.

2004. Mapping the potential ranges of major plant invader in South Africa,

Lesotho and Swaziland using climatic suitability. Diversity and Distributions

10: 475-484.

Sakai, A.K., Allendof, F.W., Holts, J.S., Lodge, D.M., & Molofsky, J. 2003.

Population biology of invasive species. Annual Reviews of Ecology and

Systematics 32: 305-320.

Samways, M.J., & Taylor, S. 2004. Impact of alien invasive plants on Redlist South

African dragonflies (Odonata). South African Journal of Science 100: 78-80.

Sang, T., Crawford, D.J., & Stuessy, T.F. 1997. Chloroplast DNA phylogeny,

reticulate evolution and biogeography of Paeonia (Paeoniaceae). American

Journal of Botany 84: 1120-1136.

Scheper, J., & Christman, S. 2003. Canna x generalis. Available online from:

http://www.floridata.com/ref/c/cann_xge.cfm [Accessed 10 March 2013].

Schulze, E.D., Beck, E., & Müller-Hohenstein, K. 2005. Plant Ecology. Springer,

Heidelberg.

Senaratne, K.A.D., Palmer, W.A., & Sutherst, R.W. 2006. Use of CLIMEX

modelling to identify prospective areas for exploration to find new biological

control agents for prickly acacia. Australian Journal of Entomology 45 (4):

298-302.

Simons, S.A., & De Poorter, M. 2009. Best practice in pre-import risk screening for

species live animals in international trade: proceedings of an expert workshop

132

on preventing biological invasions. University of Notre Dame, Indiana, USA, 9-

11 April 2008. Global Invasive Species Programme, Nairobi, Kenya.

Skidmore, A. 2002. Environmental modelling with GIS and Remote Sensing:

Introduction. In Skidmore, A (ed): Environmental Modelling with GIS and

Remote Sensing. Taylor and Francis, London,

South African National Biodiversity Institute. 2012. Invasive Alien Plant Alert.

Available online from: http://www.sanbi.org/information/infobases/invasive-

alien-plant-alert [Accessed 15 May 2013].

South African National Biodiversity Institute. 2013. Invasive Aliens: Early

Detection, Rapid Response. Available online from:

http://www.sanbi.org/programmes/conservation/invasive-aliens [Accessed 15

May 2013].

Steiner, F.M., Schlick-Steiner, B.C., Van Der Waal, J., Reuther, K.D., Christian,

E., Stauffer, C., Suarez, A.V., Williams, S.E., & Crozier, R.H. 2008.

Combined modelling of distribution and niche in invasion biology: a case study

of two invasive Tetramorium ant species. Diversity and Distributions 14: 538-

545.

Stent, S.M. 1913. Water hyacinth. Publication No. 68. Dept. of Agriculture, Union of

South Africa.

Stockwell, D., & Peterson, D. 1999. The GARP modelling system: problems and

solutions to automated spatial prediction. International Journal of

Geographical Information Science 13: 143-158.

Strauss, S.Y., Webb, C.O., & Salamin, N. 2006. Exotic taxa less related to native

species are more invasive. Proceedings of the National Academy of Sciences

103 (15): 5841-5845.

133

Suetsugu, K., Takeuchi, Y., Futai, K., & Kato, M. 2012. Host selectivity, haustorial

anatomy and impact of the invasive parasite Parentucellia viscosa on

floodplain vegetative communities in Japan. Botanical Journal of the Linnean

Society 170: 69-78.

Sutherst, R.W. 2003. Prediction of species geographical ranges. Journal of

Biogeography 30: 805-816.

Swofford, D.L. 2002. PAUP*: phylogenetic analysis using parsimony (*and other

methods), version 4.0b10. Massachusetts: Sinauer Associates.

Tecco, P.A., Díaz, S., Cabido, M., & Urcelay, C. 2010. Functional traits of alien

plants across contrasting climatic and land‐use regimes: do aliens join the

locals or try harder than them? Journal of Ecology 98 (1): 17-27.

Theoharides, K.A., & Dukes, J.S. 2007. Plant invasion across space and time:

factors affecting non indigenous species during the four stages of invasion.

New Phytologist 176 (2): 256-273.

Thuiller, W., Richardson, D.M., Pyšek, P., Midgley, G.F., Hughes, G.O., &

Rouget, M. 2005. Niche-based modelling as a tool for predicting the risk of

alien plant invasions at a global scale. Global Change Biology 11: 2234-2250.

Thuiller, W., Richardson, D.M., & Midgley, G.F. 2007. Will climate change promote

alien invasions? (ed. by in Nentwig, W.), pp 197-211. Biological invasions.

Springer-Verlag, Berlin.

Thum, R.A., & Lennon, J.T. 2010. Comparative ecological niche models predict the

invasive spread of variable-leaf milfoil (Myriophyllum heterophyllum) and its

potential impact on closely related native species. Biological invasions 12 (1):

133-143.

134

Tiebre, M., Vanderhoeven, S., & Mahy, G. 2007. Hybridization and sexual

reproduction in invasive alien Fallopia (Polyganoceae) complex in Beligium.

Annals of Botany 99: 193-203.

Trethowan, P.D., Robertson, M.P., & McConnachie, A.J. 2011. Ecological niche

modelling of an invasive alien plant and its potential biological control agents.

South African Journal of Botany 77 (1): 137-146.

Turpie, J.K. 2003. The exsistence of value of biodiversity in South Africa: how

interest, experience, knowledge, income and perceived levels of threat

influence local willingness to pay. Ecological Economoic 46: 199-216.

Valentini, A., Pompanon, F., & Taberlet, P. 2009. DNA barcoding for ecologists.

Trends in Ecology and Evolution 24 (2): 110-117.

Van De Wiel, C.C.M., Van Der Schoot, J., Van Valkenburg, J.L.C.H.,

Duistermaat, H., & Smulders, M.J.M. 2009. DNA barcoding discriminates

the noxious invasive plant species, floating pennywort (Hydrocotyle

ranunculoides Lf), from non‐invasive relatives. Molecular Ecology Resources

9 (4): 1086-1091.

Van Wilgen, B.W. 2004. Scientific challenges in the field of invasive alien plant

management. South African Journal of Science 100: 19-20.

Van Wilgen, B.W., & Lange, W.D. 2011. The costs and benefits of biological control

of invasive alien plants in South Africa. African Entomology 19 (2): 504-514.

Van Wilgen, B.W., De Wit, M.P., Anderson, H.J., Le Maitre, D.C., Kotze, I.M.,

Ndala, S., Brown, B., & Rapholo, M.B. 2004. Cost and benefits of biological

control of invasive plants: case study from South Africa. South African Journal

of Science 100: 113-122.

135

Van Wilgen, B.W., Richardson, D.M., Le Maitre, D.C., Marais, C., & Magadlela,

D. 2001. The economic consequences of alien plant invasions: Examples of

impacts and approaches to sustainable management in South Africa.

Environment, Development and Sustainability 3 (2): 145-168.

Van Wilgen, N.J., Richardson, D.M., & Baard, E.H.W. 2008. Alien reptiles and

amphibians in South Africa: Towards a pragmatic management strategy.

South African Journal of Science 104: 13-20.

Van Wyk, A.E., & Smith, G.F. 2001. Regions of floristic endemism in southern

Africa: A review with emphasis on succulents. Umdaus Press, Pretoria.

Van Wyk, E., & Van Wilgen, B.W. 2002. The cost of water hyacinth control in South

Africa: a case study of three options. African Journal of Aquatic Science 27

(2): 141-149.

Versfeld, D.B., Le Maitre, D.C., & Chapman, R.A. 1998. Alien invasive plants in

South Africa: A preliminary assessment, Report TT99/98, Water Research

Commission, Pretoria.

Vijayan, K., & Tsou, C.H. 2010. DNA barcoding in plants: taxonomy in a new

perspective. Current Science 99 (11): 1530-1541.

Wang, W., Wu, Y., Yan, Y., Ermakova, M., Kerstetter, R., & Messing, J. 2010.

DNA barcoding of the Lemnaceae, a family of aquatic monocots. BMC Plant

Biology 10: 205. doi: 10.1186/1471-2229-10-205.

Wang, Y., Tao, X., Liu, H., Chen, X., & Qiu, Y. 2009. A two-locus chloroplast (cp)

DNA barcode for identification of different species in Eucalyptus. Acta

Horticulturae Sinica 36: 1651-1658.

136

Warren, D.L., & Seiffert, S.N. 2011. Ecological Niche Modelling in Maxent: the

importance of model complexity and the performance of model selection

criteria. Ecological Applications 21 (2): 335-342.

Welk, E. 2004. Constraints in range predictions of invasive plant species due to non-

equilibrium distribution patterns: Purple loosestrife (Lythrum salicaria) in North

America. Ecological Modelling 179 (4): 551-567.

Willis, C.G., Ruhfel, B.R., Primack, R.B., Miller-Rushing, A.J., Losos, J.B.,

Davis, C.C. 2010. Favourable climate change response explains non-native

species’ success in Thoreau’s Woods. PLoS ONE 5: e8878.

Wilcox, T.P., Zwickl, D.J., Heath, T.A., & Hillis, D.M. 2002. Phylogenetic

relationships of the dwarf boas and a comparison of Bayesian and bootstrap

measures of phylogenetic support. Molecular Phylogenetics and Evolution.

25: 361-37.

Wilson, J.R.U., Ivey, P., Manyama, P., & Nänni, I. 2013. A new national unit for

invasive species detection, assessment and eradication planning. South

African Journal of Science 109 (5/6): doi.org/10.1590/ sajs.2013/20120111

Wolmarans, R., Robertson, M.P., & van Rensberg, B.J. 2010. Predicting invasive

alien distribution: how geographic bias in occurrence records influence model

performance. Journal of Biogeography 37:1797-1810.

Woodward, G., Perkins, D.M., & Brown, L.E. 2010. Climate change and freshwater

ecosystems: impacts across multiple levels of organization. Philosophical

Transactions of the Royal Society B-Biological Sciences 365: 2093-2106.

Wynberg, R. 2002. A decade of biodiversity conservation and use in South Africa:

tracking progress from the Rio Earth Summit to the Johannesburg World

137

Summit on sustainable development. South African Journal of Science 98: 33-

243.

Yelenik, S.G., Stock, W.D., & Richardson, D.M. 2004. Ecosystem level impacts of

invasive Acacia saligna in the South African Fynbos. Restoration Ecology 12

(11): 44-51.

Yuan, Y., Wang, B., Zhang, S., Tang, J., Tu, C., Yong, J.W.H., & Chen, X. 2012.

Enhanced allelopathy and competitive ability of invasive plant Solidago

canadensis in its introduced range. Plant Ecology DOI: 10.1093/jpe/rts003.

Zedler, J.B., & Kercher, S. 2004. Causes and consequences of invasive plants in

wetlands: opportunities, opportunits, and outcomes. Critical reviews in plant

science 23 (5): 431-452.

Zenni, R.D., Wilson, J.R.U., Le Roux, J.J., & Richardson, D.M. 2009. Evaluating

the invasiveness of Acacia paradoxa in South Africa. South African Journal of

Botany 75: 485-496.

138

Appendices

Taxa templates

139

TABLE OF INDEX

Alternantera philoxeroides (Mart.) Griseb……………………………………………...138

Arundo donax L…………………………………………………………………………...141

Azolla filiculoides Lam……………………………………………………………………145

Canna indica L. & Canna x generalis L.H Bailey……………………………………...149

Ceratophyllum demersum L……………………………………………………………..154

Echnodorus cordifolius (L.) Griseb……………………………………………………..158

Egeria densa Planch……………………………………………………………………..161

Eichhornia crassipes (Mart) Solms……………………………………………………..165

Hydrilla verticillata (L.R.) Royle…………………………………………………………169

Hygrophila polysperma (Roxb.) T. Anderson………………………………………….173

Ipomoea carnea Jacq. subsp. fistulosa (Mart. ex Choisy) D. Austin………………..176

Iris pseudacorus L………………………………………………………………………..179

Lagarosiphon muscoides Harv………………………………………………………….183

Ludwigia adscendens subsp. diffusa (Forssk.) P.H. Raven…………………………186

Myriophyllum aquaticum (Vell.) Verdc………………………………………………….189

Myriophyllum spicatum L………………………………………………………………...193

Nasturtium officinale R.Br………………………………………………………………..196

Nymphaea mexicana Zucc………………………………………………………………200

Nymphaea nouchali Burm.f. var. caerulea ( Savigny )……………………………….203

Nymphoides brevipedicellata (Vatke) A. Raynal………………………………………206

Nymphoides indica (L.) Kuntze………………………………………………………….210

Persicaria lapathifolia (L.) H.Gross……………………………………………………..214

140

Pistia stratiotes L………………………………………………………………………….217

Pontederia cordata L……………………………………………………………………..221

Sagittaria platyphylla (Engelm.) J.S. Sm……………………………………………….224

Salvinia minima Baker & Salvinia molesta D. Mitch…………………………………..227

Typha capensis Rohrb…………………………………………………………………...233

Vallisneria spiralis L………………………………………………………………………237

141

Alternantera philoxeroides (Mart.) Griseb.

Common name: Synonyms: Classification: Alligator weed Alternanthera philoxeroides var. acutifolia (Moq.) Hicken Class: Magnoliopsida Alternanthera philoxeroides var. luxurians Suess Order: Caryophyllales Alternanthera philoxeroides f. angustifolia Suess. Family: Amaranthaceae

Description:

Alternanthera philoxeroides is a stoloniferous, mat-forming aquatic herb, growing up to 10 m long. Leaves are shiny, narrowly elliptic or oblanceolate, 35-71 mm long, and 5-20 mm wide with tips acute to obtuse. The inflorescences are terminal flower heads measuring 14-17 mm in diameter. Flowers are white with tepals lanceolate to oblong and tips acute (Clemants 1879).

A B C

Fig.1. (A) Alternantera philoxeroides plants, (B) flower head, and (C) dense infestation. Photographs: (A) & (B) by J. Pippen (http://www.jeffpippen.com) and (C) by A.C. Evans (http://www.hear.org)

Native range:

Alligator weed is native to South America (Henderson & Cilliers 2002).

Distribution in South Africa:

Alternanthera philoxeroides is sold through the aquarium trade. It has not yet been recorded in South African water bodies.

Habitat:

This plant grows in water, wet areas and dry land (Henderson & Cillers 2002).

142

Uses:

Alligator weed is used as a vegetable in rural India (Mandal & Mondal 2011). It is used in the removal of zinc, nickel and copper from waste waters (Wang & Qin 2006). It is also a medicinal plant used in the treatment of acute coughs (Panda & Misra 2011).

How it spreads:

Alternanthera philoxeroides reproduces from seeds and stem fragments, which are dispersed by water currents, animals, machinery, and boats (Henderson & Cilliers 2002).

Invasion category:

This plant is listed on the Global Compendium of Weeds (http://www.hear.org/gcw/) as a weed in many countries. It has not be listed on the CARA and NEM:BA lists of invasive species in South Africa. Henderson & Cilliers (2002) suggested that this plant should be prohibited in South Africa.

Environmental impacts:

Alligator weed produces alleleochemical that inhibit the growth and development of native species. It forms dense mats that completely cover water surfaces and threaten aquatic biodiversity. It can also obstruct rivers and streams, and worsen the effects of flooding (Henderson & Cilliers 2002).

DNA barcodes: matK

AACTCTTCCCGATACTGGGTGAAAGATGCCTCCTTCTTTGCATTTATACGATTCTTTCTTTATGAGTGTCGTAATTGGACTAA CCTTATTACTCTAAAAGAATCCATTTCCTTTTTTTCAAAAAGGAATCGAAGATTATTCTTGTTCCTATATAATTTCTATGTATGT GAATACGAATCCTTTTTTGTTAGTCTCCGCAATCAATCCTCTTATTTAAAATCAACATCTTTTGGAGCTTTTCTTGGACGAATC CATTTCTACGGAAAATTGAACTATCTAGTTAAAGTTAAGGCTTTTGCGGCTATCCTATGGTTTTTCAAAGAACCTTTCCCGCA TTATGTTAGGTATCAAGGAAAATCCCTTCTGGCTTCAAAAGGGACAGCTCTTCTGATGCATAAATGGAAACATTACTTTATCT ATTTCTGGCAATGTTATTTTTCTGTGTGGTCTCAACCAAGAAGAATCTATATCAATCAATTATCAAACCATTCCCTTGACTTTA TGGGTTTTCTTTCAAGTGTGCGATTGAATTCGTCAGTAATACGAAGTCAAATGTTAGAAAATTCATTTCTATTAGAGAATATT CGTAAGAAGTTCGATACCATAGTTCCAATTATTCCTTTAGTTGGTTCGTTAGCTAAAGAAAAATTTTGTAACGTATTAGGACA TCCTATTAGTAAGTCGGTTTGGACGATTTA rbcLa

GATTTAAAGCTGGTGTTAATGATTACAAATTGACTTATTATACTCCGGAGTATGAAACCCTAGATACTGATATCTTGGCAGCA TTCCGAGTAACTCCTCAACCTGGAGTTCCACCCGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATG GACAACTGTATGGACTGACGGGCTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCATATCGAGCCCGTTGCTGGTGA AGAAAACCAATATATTTGTTATGTAGCGTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGT AGGTAACGTATTTGGGTTCAAAGCCCTGCGTGCTCTACGTTTGGAGGATTTGCGAATCCCTGTTGCTTATATAAAAACTTTC CAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGCACTATTAAA CCTAAATTGGGGTTATCCGCTAAAAACTATGGTCGAGCATGTTATGAATGTCTTCG

143

References:

Clemants, S.E. 1897. Alternantera philoxeroides (Martius) Grisebach [family Amaranthaceae]. Flora of North America 4.

Henderson, L., & Cilliers, C.J. 2002. Invasive aquatic plants: a guide to the identification of the most important and potentially dangerous invasive aquatic and wetland plants in South Africa. PPRI Handbook No. 16. Agricultural Research Council, Pretoria.

Mandal, A., & Mondal, A.K. 2011. Taxonomy and ecology of obnoxious weed Alternanthera philoxeroides Grisebach (family Amaranthaceae) on spore germination in Ampelopterisprolifera (Ketz.) Cop. Advances in Bioreseach 2 (1): 103-110.

Panda, A., & Misra, M.K. 2011. Ethnomedical survey of some wetland plants of South Orissa and their conservation. Indian Journal of Traditional Knowledge 10 (2): 296-303.

Wang, X. S., & Qin, Y. 2006. Removal of Ni (II), Zn (II) and Cr (VI) from aqueous solution by Alternanthera philoxeroides biomass. Journal of Hazardous Materials 138 (3): 582-588.

144

Arundo donax L.

Common names: Synonyms Classification Giant reed Arundo donax var. angustifolia Döll Class: Liliopsida Bamboo Arundo donax var. barbigera (Honda) Ohwi Order: Poales Spanish reed Arundo donax var. lanceolata Döll Family: Poaceae Arundo

Description:

Arundo donax is an erect, perennial reed growing up to 6-10 m high (Henderson & Cilliers 2002). Leaves are pale to bluish-green, with basal ear lobes, 300-1 000 mm long and 20-70 mm wide. Stems are hollow and 20-30 mm in diameter (Csurshes 2009). Inflorescence 150-600 mm long, spear- shaped with cream or brown spikelets (Stapf 1990).

A B C

Fig. 2. (A) Arundo donax plants, (B) leaves, and (C) inforescence. Photographs: (A) by H.G. Robertson (http://www.biodiversityexplorer.org), (B) by J.H. Miller (http://www.fs.fed.us), and (C) by C.J. Deff (http://www.flickriver.com).

Native ranges:

Arundo donax is indigenous to Egypt, India, Spain, Nepal, Eurasia, and the Mediteranean (Polunin & Huxley 1987; Fornell 1900; Hickman 1993).

145

Distribution in South Africa:

Fig. 3. Distribution of Arundo donax in South Africa.

Habitat:

Gaint reed occurs along watercourses, roadsids, and other areas away from water (Henderson & Cilliers 2002).

Uses:

Arundo donax has spread intentionally to many regions of the world due to its various uses (Dudley 2000). It is valuable in may rural communites as leaves are woven into mats and baskets, stems are used for building material, fences, fishing poles and brooms (Dukes 1983), and rhizomes are a food source (Coyle & Roberts 1975). It also has ecological significance as it is used in erosion control to stabilizes streams and terraces (Zohary & Willis 1992).

How it spreads:

Giant reed reproduces both sexual and asexually. It does not form viable seeds in most of its introduced ranges (Perdue 1958) and reproduces vegetatively through rhizome fragmentation (Boose & Holt 1999). Fragments are dispersed by water to new areas where they sprout and form new culms.

146

Invasion category:

This plant is listed on the Global Compendium of Weeds (http://www.hear.org/gcw/) as a weed in many countries. In South Africa, it is listed as a category 1b invader (NEM:BA 2004).

Environmental Impacts:

Arundo donax has the ability to reduce native fauna and flora diversity because of its biomass, height and rapid grow rate (Milton 2004). It forms dense masses of vegetation that prevent entry to water bodies and outcompetes native riverbank species.

DNA barcodes: matK

CCAAGATGTTCCATCTTTGCATTTATTGCGATTCTTTCTCAATTATTATTCGAATTGGAATAGTCTTATTACTTCAATGAAATC GATTTTTCTTTTGAAAAAAGAAAATAAAAGACTATTTCGATTCCTATATAACTCTTATGTATCAGAATATGAATTTTTCTTGTTG TTTCTTCGTAAACAATCTTCTTGCTTACGATTAACATCTTCTGGAACCTTTCTGGAACGAATCCACTTTTCTAGGAAGATGGA ACATTTTGGGGTAATGTACCCAGGGTTTTTTCGGAAAACCATATGGTTCTTTATGGATCCTCTTATGCATTATGCTCGATATC AAGGAAAGGCAATTCTTGCATCAAAAGGAACTCTTCTTTTGAAGAAGAAATGGAAATCTTACCTTGTCAATTTCTCGCAATAT TTTTTCTCTTTTTGGACTCAACCGCAAAGGATCCGTATAAACCAATTAACAAACTCTTGCTTCGATTTTCTGGGGTACCTTTC AAGTGTACCAATAAATACCTTGTTAGTAAGGAATCAAATGCTGGAGAATTCTTTTCTAATAGATACTCGAATGAAAAAATTCG ATACTACAGTCCCCGCTACTCCCCTCATTGGATCCTTATCAAAAGCTCAATTTTGTACTGGATCGGGGCATCCTATTAGTAA ACCCGTTTGGACCGATTTATCAGATTGGGATATTCTTGATCGCTTTGATCGGATATGCAGAAA rbcLa

TAAAGCCGGTGTTAAGGATTATAAATTGACTTACTACACCCCGGAGTACGAAACCAAGGATACTGATATCTTGGCAGCATTC CGAGTAACTCCTCAGCCCGGGGTTCCGGCTGAAGAAGCAGGGGCTGCAGTAGCTGCGGAATCTTCTACTGGTACATGGA CAACTGTTTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTATCACATCGAGCCCGTTCCTGGGGACG AGGGTCAATATATCTGTTATGTAGCTTATCCATTAGACCTATTTGAAGAGGGTTCTGTTACTAACATGTTTACTTCCATTGTA GGTAACGTATTTGGTTTCAAAGCCCTACGCGCTCTACGTTTGGAGGATCTACGAATTCCTCCTACTTATTCAAAAACTTTCC AAGGTCCGCCTCATGGTATCCAAGTTGAAAGGGATAAGTTGAACAAGTATGGCCGTCCTTTATTGGGATGTACTATTAAAC CAAAATTGGGATTATCCGC trnH-psbA

TTCGTAATGCTCACAACTTCCTTCTAGACCTAGCTGCTCTTGAAGTCCCATCTCTTAATGGATAAGGTTTTTCTCCTAACATA TAGGAATTTTTAAAGGAAGGAAAGCCAGAAATACCCAATATCTTGTTCCAACAAGATATTGGGTATTTCTTTGTTTATTCTGA ATCTTTCTATTCTGAATTCAGTTAACGACGAGATTTAGTATCCTTTCTTGCACTTTCATAACTCGTGAAATGCCGAGTAGGCA CGAATTCCCCCAATTTGCGACCTACCATAGGATTTGTTATGTAAATAGGTATATGTTCCTTTCCATTATGAATCGCGATTGTA TGGCCAACCATTGCGGGTAGAATGCTAGATGCCCGGGACCACGTTACTATTGTTTCTTTCTCCTCCTTCATATTGACCTTTT CTATTTTTGCCAATAAATGACGAGCTACAAAAGGATTCGTTTTTTTTCGTGTCACAGCTGATTACTCCTTTTTTTCATTTTAAA GAGTGGCATCCTATGTCCACTATCTCGATCGAGGTATGGAGGTCAGAATAAATAGAATAATGATGAATGGAAAAAAGAGAA AATCCTTTAGCTGGATAAGGGGCGGATGTAGCC

References:

Boose, A.B., & Holt, J.S. 1999. Environmental effects on asexual reproduction in Arundodonax. Weed Research 39: 117-127.

147

Coyle, J., & Roberts, N.C. 1975. A field guide to the common and interesting plants of Baja California. Natural History Publishing Co., California.

Csurshes, S. 2009. Weed Risk Assesment: Arundo donax. Available online from: http://www.daff.gld.gov.au [Accessed 09 June 2013].

Dudley, T.L. 2000. Arundo donax. Invasive plants of California’s wildlands. University of California Press, Berkeley.

Duke, J.A. 1983. Handbook of Energy Crops. Available online from: http://www.hort.purdue.edu/newcrop/ [Accessed 09 June 2013].

Fornell, T.C. 1990. Widespread adventive plants in Catalonia. Biological Invasions in Europe and the Mediterranean basin. (eds F. di Castri, A.J. Hansen & M. Debussche), pp. 85-104. Kluwer Academic Publishers, Boston

Hickman, J.C. 1993. The Jepson manual: higher plants of California. University of California Press, Berkeley, California.

Milton, S.J. 2004. Grasses as invasive alien plants in South Africa. South African Journal of Science 100: 69-75.

NEM:BA. 2004. National Environmental Management: Biodiversity Act (No. 10 of 2004). Government Gazette No. 32090, 3 April 2009. Department of Environmental Affairs and Tourism, Pretoria.

Perdue, R.E. 1958. Arundo donax – source of musical reeds and industrial cellulose. Economic Botany 12: 368-404.

Polunin, O. & Huxley, A. 1987. Flowers of the Mediterranean. Hogarth Press, London.

Stapf, O. 1990. Arundo donax Linn. (Family Poaceae). Flora capensis 7: 310.

Zohary, M., & Willis, A.J. 1992. The vegetation of Egypt. Chapman & Hall, London.

148

Azolla filiculoides Lam.

Common names: Synonyms: Classification: Large mosquito fern Azolla arbuscula Desv Class: Pteridophyta Red water fern Azolla caroliniana Willd. Order: Salviniales Azolla magellanica Willd. Family: Salviniaceae Azolla squamosa Molina Description:

Azolla filiculoides is a polygonal or triangular, free-floating, mat-forming perennial fern measuring 25- 35 mm long (Lumpkin & Plucknett 1980). Leaves are 10-15 mm long, broadly ovate to circular, arranged alternately around the stem, with blunt tips. Leaves turn reddish green over winter. Fruiting bodies are minute, and are found in the axils of the leaves (Henderson & Cilliers 2002).

A B

Fig. 4. (A) Azolla filiculiodes, (B) plants turning red over winter, and (C) red fern forming dense mat along watercourse in the Free State Province. Photographs: (A) by C.J. Cilliers (http://www.agis.agric.za), (B) by D. Hoffman (http://www.flickr.com), and (C) by M.J. McConnachie (http://www.agis.agric.za).

149

Native ranges:

Azolla filiculoides is native to warm and temperate regions of North and South America (Hill 1998; Henderson & Cilliers 2002).

Distribution in South Africa:

Fig.5. Distribution of A. filiculoides in South Africa.

Natural habitat:

Red water fern can be found in ponds, ditches, water reservoirs, wetlands, and slow-moving rivers where minimum temperatures remain above 0°C throughout the year (Hussner 2010).

Uses:

Red water fern is used as cattle and pig fodder and as compost (Hill 1998).

How it spreads:

Azolla filiculoides spreads from detached plant fragments and reproduction from spores. Plants are also spread by water fowls and through the aquarium trade (Hussner 2010).

150

Invasion category:

This plant is listed on the Global Compendium of Weeds (http://www.hear.org/gcw/) as a weed in many countries. In South Africa, it is listed as a category 1b invader (NEM:BA 2004).

Environmental impacts:

Azolla filiculoides reduces aquatic biodiversity, causes drowning of livestock, reduces water quality, increases the occurrence of water borne diseases, causes clogging of irrigation pumps, and reduces water flow in irrigation channels. It also increases siltation of dams and rivers (McConnachie et al. 2003).

DNA barcodes: matK

AATCTTGGTTCAAATTCTACAATGCTGGGTACAGGATGTTCCCGCTTTACATTTATTACGATTGCTTTTTCATGACTATCATA ATGGGAGTAATTGCATTACTCCAAAAAAATCTAGTTATGGTTTTTCAAAAGATAATCCAAGACTCTATAGGTTCCTATATAATT CTTATGTAGTCGAATGCGAATCCATATTTGTTTTTCTTCGTAAATCATCCTCTTATTTACGATCAACATCTTTTGGATCCCTTC TTGAGCGAACACACTTCTATGGAAAAATGAAACATATTGGAGTAACTTGTTGTAATGATTTTCAGAAAACCCTATGGTTGTTC AAGGATCCTTTCATGCATTATGTTAGGTATCAAGGAAAATCCATTATGGCTTCAAAAGGGACTCATCTTCTGATGAAGAAAT GGAAATCTTACTTTGTGAATTTATGGCAATGTCATTTTCACTTTTGGTCTCAACCCAGTAGGATACACATAAACCAATTCCCC CATTTTTCTTTCTATTTTTTGGGTTATCTTTCAAGTGTACCAATAAATCCTTCATCCGTGAAGAGTCAAATGCTAGAGAATTCT TTTTTAATAGATACCGTTACTCCAAAATTTGAAACGATGATATCAATTATTCCTATGATTGGGTCATTGGCAAAAGCTAAATTT TGTAATCTATCGGGGAATCCTATTAGCAAGCCAGTTTGGGCCGATTTGTCAGATCCGCAT rbcLa

TATTACACTCCCGATTATGTTACCAAAGATACCGATATTTTGGCAGCTTTCCGAATGACCCCGCAACCCGGAGTCCCACCC GAAGAGGCTGGAGCTGCGGTAGCTGCGGAATCTTCTACAGGTACATGGACCACCGTATGGACAGATGGACTTACCAGTCT TGACCGTTACAAAGGTAGATGCTATGATATCGAACCTGTTGCTGGAGAAGACAACCAATACATCGCATACGTAGCTTACCC CCTAGATTTATTCGAAGAGGGTTCCGTTACCAACATGTTTACCTCCATCGTAGGTAATGTATTCGGATTTAAGGCTCTACGC GCTCTTCGCCTAGAAGATCTTCGAATTCCCCCTGCTTATTCCAAAACTTTCATCGGACCACCCCACGGTATCCAGGTTGAAA GGGACAAACTGAACAAATATGGACGTCCTCTACTAGGATGCACGATAAAGCCAAAATTGGGCTTATCTGCTAAGAATTATG GTAGAGCTGTTTATGAATG trnH-psbA

CTAGACTTAGCTTCTGTTGAAGCTCCTTCTATAAACGGATAATACCCGTTTAGCTATGCAGTGTAACTGGATACCAAACCTT TCCGTTCCGGAAGGTTTGGTGTCCAACGAAGGTTCGTCCCATGGAACAAACAGGAAGAAAGGTAATGGTTTGTCACGATC CTACAACCGTCGGCTCTTGGATTCTGAAGAATATTTAGAATACTCCTGTGTATAGGTATTAAAAAATATTCTGAAAATTCACG GAATGCTTGTAATCTACCAATCGTTTGAATAGATTGGGTTGGGGGTATATCCCTCATTCCACGGATTTCCCACTGTCTCGTT ATATACACAACAAATATGTATGTGTATCAATCGAAGGACCTTAATAGCTATTAATGGCTTGATGGG

References:

Lumpkin, T.A, & Plucknett, D.L. 1980. Azolla, botany, physiology and use as green manure. Economic Botany 34 (2): 111-153.

151

Hill, M.P. 1998. Life history and laboratory host range of Stenopelmus rufinasus, a natural enemy for Azolla filiculoides in South Africa. Biological Control 43: 215-224.

Hussner, A. 2002. NOBANIS-Invasive alien species fact sheet- Azolla filiculoides. Online database of European Network on invasive alien species. Available online from: www.nabanis.org [Accessed 09 June 2013].

McConnachie, A.J., de Wit, M.P., Hill, M.P., & Byrne, M.J. 2003. Economic evaluation of the successful biological control of Azolla filiculoides. Biological Control 28: 25-32.

NEM:BA. 2004. National Environmental Management: Biodiversity Act (No. 10 of 2004). Government Gazette No. 32090, 3 April 2009. Department of Environmental Affairs and Tourism, Pretoria.

152

Canna indica L. & Canna x generalis L.H Bailey

Common names: Synonyms: Classification: Indian shot Canna edulis Ker-Gawl. Class: Liliopsida Garden canna Canna aurantiaca Roscoe Order: Zingiberales Canna bifida Schult. Family: Cannaceae Canna carnea Roscoe

Description:

Canna indica and C. x generalis are perennial rhizomatous herbs growing up to 2.5 m high. Aerial shoots measure 10-30 mm in diameter with 7-11 sheathing ovate leaves measuring up to 550 mm in length and up to 300 mm in diameter, with the tips tapering to a point. Canna indica has smooth leaves that are greenish yellow adaxially and greyish green and dull abaxially, flowers are narrow (70 mm long), red or orange and usually yellow below. Canna x generalis is a hybrid of C. indica and C. flaccida (Scheper & Christman 2003). It has greenish purple leaves and flowers are much larger (80- 90 mm long and 150 mm wide) than those of C. indica. Flowers are also found in various colours. Fruit of both species are spiny, three-valved capsules producing 20 to 28 seeds (Henderson & Cilliers 2002; Ciciarelli 2012).

A B C

Fig. 6. (A) Canna indica, (B) Canna x generalis, and (C) Canna seeds and fruit. Photographs: (A) by R.J. Nichols (http://www.agis.agric.za), (B) & (C) by L. Henderson (http://www.agis.agric.za).

153

Native ranges:

Canna indica is indigenous to Central and South America and the West Indies (Henderson & Cilliers 2002). Canna x generalis is a hybrid of North American C. flaccida and Indian C. indica (Scheper & Christman 2003).

Distribution in South Africa:

Fig. 7. Distribution of Canna indica in South.

154

Fig. 8. Distribution of Canna x generalis in South Africa.

Natural habitat:

Indian short and garden canna grow along roadsides, riverbanks, and wetlands (Henderson & Cillliers 2002; Mass 2006).

Uses:

Canna indica has various uses. The leaves are used in traditional medicine and rhizomes are used in traditional foods. The seeds are used for making jewellery and leaf fibres are used for making paper (Mass 2006). Canna x generalis is a popular garden ornamental in South Africa.

How it spreads:

Canna indica and C. x generalis reproduce by seeds and vegetatively through rhizome fragmentation (Ciciarelli 2012). Seeds are dispersed by water, birds and also spread through dumping of garden waste (Lusweti 2001).

Invasion category:

Canna indica is listed on the Global Compendium of Weeds (http://www.hear.org/gcw/) as a weed in many countries. In South Africa it is listed as a category 1b invader (NEM:BA 2004). Canna x

155

generalis is not list on the Global Compendium of Weeds and its invasion category has not yet be declared in South Africa (AGIS 2007).

Ecological impacts:

Indian short and garden canna grow in dense masses of vegetation where they compete with indigenous wetland and riverbank species reducing aquatic biodiversity (Mass 2006). They can also limit access to water ways and causes flooding by restricting water movement (Lusweti 2011).

DNA barcodes: matK (Canna indica)

TTTATTGCGGTTCCTTCTCCATGACTATTATAATTGGAATAGTCCCATTACTACGAATAAATCTATTTACGTATTTTCAAAAGA AAAAAAAAGATTATTTTTGGTCTTATATAATTCTTATGTATCTGAATGCGAATTTGTATTTGTTTTTCTTCGTAAACAATCTTCT TATTTACGATTAACATCTTCTGGAGTCTTTCTTGAGCGAACATATTTTTATGGAAAAATAGAACATCTTGTAGTGTGCCGAAA TTTTTTTAAGAAAACTCTATGGGTCTTCAAGGATCCTTTCATGCATTATGTTCGATATCAAGAAAAAGTGATTCTGGGTTCAA GGGGAACTCATTTTCTGATGAAGAAATGGAAATGCCATCTTATAAATTTCTGGCAATATTATTTTCATTTTTGGTCTCAACCG TACAGGATCCATATAAACCGGTTATCAAACTATTCCTTCTATTTTCTGGGTTATCTTTCAAGTATACTAATAAATTCTTCGGCC GTAAGGAATCAAATGCTAGATAATTCATTTCTAATAGATATTCTTACTAGGAAATTCGATACCATAGTTCCAATTATTCCTCTT ATTCGATCATTATCTAAAGCTAAATTTTGTACCGTATCCGGACATCCTATTAGTAAGCCAA rbcLa (Canna indica)

TAAAGCAAGTGTTGGATTTAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTACGAAGTCAAAGATACTG ATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCCGAAGAAGCAGGGGCTGCGGTAGCTGCCGAATCT TCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGGCGATGCTATCACATCGAG GCCGTTGTTGGGGAGGATAATCAATATATTGCTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACAT GTTTACTTCCATTGTGGGTAATGTATTTGGTTTCAAAGCCTTACGAGCTCTACGTCTGGAGGATCTGCGAATTCCCCCTGCT TATTCTAAAACTTTCCAAGGTCCGCCTCACGGCATTCAGGTTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCCCTATTGG GATGTACTATTAAACCAAAATTGGGATTATCTGCAA rbcLa (Canna x generalis)

ACTAAAGCAAGTGTTGGATTTAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTACGAAGTCAAAGATAC TGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCCGAAGAAGCAGGGGCTGCGGTAGCTGCCGAAT CTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGGCGATGCTATCACATCG AGGCCGTTGTTGGGGAGGATAATCAATATATTGCTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAAC ATGTTTACTTCCATTGTGGGTAATGTATTTGGTTTCAAAGCCTTACGAGCTCTACGTCTGGAGGATCTGCGAATTCCCCCTG CTTATTCTAAAACTTTCCAAGGTCCGCCTCACGGCATTCAGGTTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCCCTATT GGGATGTACTATTAAACCAAAA trnH-psbA (Canna x generalis)

TCTAGACCTAGCTGCTCTTGAAGTCCCATCTCTTAATGGATAAGGTTTTTCTCCTAACATATAGGAATTTTTAAAGGAAGGAA AGCCAGAAAATACCCAATATCTTGTTCCAACAAGATATTGGGTATTTCTTTGTTTATTCTGAATCTTTCTATTCTGAATTCAGT TAACGACGAGATTTAGTATCCTTTCTTGCACTTTCATAACTCGTGAAATGCCGAGTAGGCACGAATTCCCCCAATTTGCGAC CTACCATAGGATTTGTTATGTAAATAGGTATATGTTCCTTTCCATTATGAATCGCGATTGTATGGCCAACCATTGCGGGTAG AATGCTAGATGCCCGGGACCACGTTACTATTGTTTCTTTCTCCTCCTTCATATTGACCTTTTCTATTTTTGCCAATAAATGAC GAGCTACAAAAGGATTCTTTTTTTTTCGAGTCACAGCTGATTACTCCTTTTTTTCATTTTAAAGAGTGGCATCCTATGTCCAC TATCTCGATCGAGGTATGGAGGTCAGAAT

156

References:

AGIS. 2007. Agricultural Geo-Referenced Information System. Available online: from www.agis.agric.za [Accessed 01 November 2013].

Ciciarelli, M. 2012. Life Cycle in Natural Populations of Canna indica L. from Argentina. Phenology and Climate Change, Dr. Xiaoyang Zhang (Ed.), ISBN: 978-953-51-0336-3, InTech, Available online from: http://www.intechopen.com/books/phenology-and-climate-change/life- cycle-in-natural-argentininianpopulations-of-canna-indica-l [Accessed 15 June 2013].

Lusweti, A. 2001. Keys and factsheet: Canna indica. Available online from: http://keys.lucidcentral.org [Accessed 15 June 2013].

Mass, H. 2006. Canna indica. The Global Invasive Species Database. Available online from: http://www.issg.org [Accessed 15 June 2013].

NEM:BA. 2004. National Environmental Management: Biodiversity Act (No. 10 of 2004). Government Gazette No. 32090, 3 April 2009. Department of Environmental Affairs and Tourism, Pretoria.

Scheper. J., & Christman, S. 2003. Canna x generalis. Available online from: http://www.floridata.com/ref/c/cann_xge.cfm [Accessed 30 November 2013].

157

Ceratophyllum demersum L.

Common names: Synonyms: Classification:

Rigid hornwort Dichotophyllum demersum (L.) Moench Class: Magnoliopsida

Coontail Ceratophyllum cornutum Rich. Ex S.F. Gray Order: Ceratophyllales

Family: Ceratophyllaceae

Description:

Ceratophyllum demersum is a submerged macrophyte with much branched stems growing up to 3 m long. Leave are 1.5-6.0 cm long, dark green, course-textured, and forked into 2 (-4) linear segments with small teeth along one margin. Leaves are arranged in whorls of 5-12 around the stem with whorls becoming dense towards the stem tips. Flowers are greenish brown measuring 2 mm long. Fruits are small, dark green or reddish brown ovoid or ellipsoid nuts, measuring 3.5-6.0 x 2-4 x 1.0-2.5 mm. The fruits may be smooth or sparingly covered with minute tubercles (Skan 1925).

A B

Fig. 9. (A) Ceratophyllum demersum plants and (B) whorled leave arrangement. Photographs: (A) Göttingen University (http://www.flickr.com/) and (B) by M. Menchettii (http://www.flickr.com/).

Native range:

Rigid hornwort is native to all continents and has a cosmopolitan distribution (Zhuang 2013).

Distribution in South Africa:

158

Fig. 10. Distribution of Ceratophyllum demersum in South Africa.

Habitat:

This plant grows in permanent ponds, slow-moving waters and estuaries (Zhuang 2013).

Uses:

Rigid hornwort is used for the removal of heavy metals in waste waters (Keskinkan et al. 2004). It is also a popular plant in the aquarium trade.

How it spreads:

This plant spreads through stem fragmentation and turions (small shoots that develop into new plants) (Fukuhara et al. 1997).

Invasion category:

This plant is listed on the Global Compendium of Weeds (http://www.hear.org/gcw/) as a weed in many countries. In South Africa, it is a native opportunistic fresh water plant. It flourishes in disturbed aquatic ecosystem often becoming a dominant species and threatening other native aquatic plants (Henderson & Cilliers 2002).

159

Environmental impacts:

Dense masses of Ceratophyllum demersum can reduce stream flow and disrupt fishing and boating activities (Henderson & Cilliers 2002).

DNA barcodes: matK

GCTCCTTCTTTGCATTTTTTGAGATTTTTTCTCCAGGAGTATCGTAATTGGAATAGTTTCATTACTCCAAAGAGGGCCAGTTC CTTTTTTTCAAAAGAGAATCAAAGATTGTTCTTGTTCCTATATAATTCTCATGTATATATATGTGAATCTATATTTGTTTTTCTT CATAAACAGTGTTCTTATCATTTCCGATCAACCTCCTTTGGAGCCTTTCTTGAGAGAACACTTTTCTATGGAAAAATAGAGCA TCTTGTAGTCGTAGTAGTGCTGCGTAATGATTTTCAGAAGAGCCTAGGGTTTTACAAGGATCCTTTCATGCATTATGTTAGA TATCAAGGAAAATCCATTCTGGCTGCAAAGGGGACTCATTTTCTGATGAAGAAATGGAAAACGCACCTTATGCATTTCTGGC AATGTAATTTTCACTTGTGGGCTCAACCAGACAGGATTCGTATAAACCAATTTTCTAAACATTCCTTAGATTTGATGGGCTAT CTTTCACGTCTACGATTAAATCGTTTGGTGGTAAGAAATCAAATGCTAGAGCATTTTTTTATAATCGATATCCCTATTAAAAAA TTCGATAGCATAGTTCCCATTCTTCCGCTGATTGGATCATTGGCTAAAGCGAAATTTTGTAACATAGCGGGACATCCCATTA GTAAACCGATCCGGGCAGANTCATCAGATC rbcLa

TTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAAGTCCTCAACCCGGAGTTC CACCTGAGGAAGCAGGTGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACCGTGTGGACCGATGGACTTACC AGCCTTGATCGTTACAAAGGACGATGCTACGACATCGAACCCGTTGCTGGAGAGGAAAATCAATATATTGCTTATGTAGCT TACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTCACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCTCT ACGAGCGCTACGTCTGGAAGATTTACGAATCCCTGTTGCTTATGTCAAAACTTTCCAAGGTCCGCCACATGGTATCCAAGT TGAGAGAGATAAACTGAACAAGTATGGTCGTCCTCTATTGGGATGCACTATTAAACCAAAATTGGGGTTATCCGCTAAGAAC TATG trnH-psbA

GTCGAAGCTCCATCTACAAATGGATAATACTTCAGTGTTAGTGTATACGAGTTGTTGAAGGGGGCAATACCAAATTTCTTGT TCTATCAAGCAAGAGTTTTGGTATTGCTCTGTTATTTTTATTTTTTGTTTTAGTATAGTAAACTTTTTTTTTAGTCTGGATCGAA TTTTTTTTTATTCTGTATCAGGTTTTCTTTTATCAATAGGCTATAGATCCAAAATATTGAGTTCGTTTACCATACCAAACAATAC CTTAAGCGAAAGTCTTGTTTTTATTTTTGTTCTAAAGCATCTTTGTGAAATAGAAAATAAAGAGGAAGTAATAAAAAAA

References:

Fukuhara, H., Tanaka, T., & Izumi, M. 1997. Growth and turions formation in Ceratophyllum demersum in a shallow lake in Japan. Japanese Journal of Limnology 58 (4): 335-347.

Keskinkan, O., Goksu, M.Z.L., Basibuyuk, M., & Forster, C.F. 2004. Heavy metal absorption properties of a submerged aquatic plant (Ceratophyllum demersum). Bioresource Technology 92: 197-200.

160

Skan, S.A. 1925. Ceratophyllum demersum Linnaeus [Family Ceratophyllaceae]. Flora capensis 5 (2): 580.

Zhuang, X. 2013. Ceratophyllum demersum. In: IUCN 2013. IUCN Red List of Threatened Species. Available online from: www.iucnredlist.org [Accessed 22 December 2013].

161

Zhuang, X. 2013. Ceratophyllum demersum. IUCN Red List of Threatened Species Echinodorus cordifolius (L.) Griseb. version2013.1.Available online from: www.iucnredlist.org [Accessed 27 July 2013]

Common names: Synonyms: Classification: Burhead Alisma cordifolium L. Class: Liliopsida Spade leaf sword Echinodorus ovalis C. Wright Order: Alismataceae Amazon sword Echinodorus fluitans Fassett. Family: Alismataceae

Description:

Echnodorus cordifolius is a perennial, rhizomatous aquatic herb growing up to 0.2 m high. Leaves are ovate to oval, 70-300 mm and 40-200 mm wide with tips acute to obtuse and bases attenuate to cordate. Inflorescence racemose to paniculate, of 3-8 whorls, with whorl containing 6-22 flowers that are 20-35 mm in diameter. Fruits are oblanceolate, 3-5 ribbed, 1.3-3.0 mm long and 0.5-1 mm wide and keeled at the tip (Lehtonen 2008).

A B

Fig. 11. (A) Echinodorus cordifolius flowers and (B) leaves. Photographs: (A) by M.A. Joseph (http://www.imagejuicy.com) and (B) by R.H. Mohlenbrock (http://www.phytoimages.siu.edu).

Native range:

This plant is native to North and South America (Lehtonen 2008).

Distribution in South Africa:

This species is prohibited in South Africa (NEM:BA 2004) but it is sold illegally in the aquarium trade. It has not been recorded in South African waters.

162

Habitat:

Amazon sword grows in aquatic environments (Lehtonen 2008).

Uses:

Echinodorus cordifolius is used in a variety of industries to remove ethylene glycol from waste waters (Teamkao & Thiravetyan 2010). It is also a popular aquarium plant.

How it spreads:

Amazon sword reproduces from seeds (Lehtonen 2008).

Invasion category:

This plant is listed on the Global Compendium of Weeds (http://www.hear.org/gcw/) as a weed in many countries. In South Africa, it is listed as a category 1b invader (NEM:BA 2004).

Environmental impacts:

Echinodorus cordifolius blocks navigation channels and chokes propellers of boats (Oyedeji & Abowei 2012).

DNA barcodes: rbcLa

TGTTGGATTCAAAGCAGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAATATCAAACCAAAGATACTGATATCTTGG CAGCATTCCGAGTAACCCCGCAACCCGGAGTTCCACCTGAGGAAGCAGGGGCCGCAGTAGCTGCCGAATCTTCTACTGG TACATGGACAACTGTGTGGACTGATGGACTTACTAGTCTTGATCGTTACAAAGGACGATGCTACCACATTGAACCTGTTATT GGAGAAGAAAATCAATATTTTTGTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCC ATTGTAGGTAATGTATTTGGGTTTAAAGCTCTACGAGCTCTACGCTTGGAGGATTTGCGAATTCCTTCTTCTTATTCCAAAAC TTTCCAAGGTCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAATATGGCCGTCCCCTATTGGGATGTACTATT AAACCAAAATTGGGATTATCCGCAAAAAACTACGGTAGAGCTGTTTATGAATGTCTTCGGG trnH-psbA

CTTATACCAAATCATAATTAAGTTCATTAAATAAAAGGGTTTTCTTTGCCATTATTATCGGAAAAATCCTCCTTTTCTATCTAG ATCTATTTTCTAGATAGATCTAGTTTGACTTTTCTATCGATATCTAAATAGATATCCATTTAGATATCTTATATCTCTATTATTC GTCATACCATCTTATATCTCTATTATTGGTCATACCATAATATATAAGGCTAACTAAATAAATAAGGGTAACTAAATAAAGAAA AATTAAGAAAAGAAAAATATGTGTGAACAAGGTAGTATTGAAGAAAGGCTATTATTGAATAAAATAAAGAGAAATACTAAACC CTCAATTCAATAATTCAATGGGTTTAGTATTTCTCTTTTAACAATTCGTATTCGTATACACCAAAACAGAAGTATTATCCGGTT GTGGATGGCCCTTCAACAGCAGCTAGGTCTA

References:

Lehtonen, S. 2008. An integrative approach to species delimitation in Echinodorous (Alimataceae) and the description of two new species. Kew Bulletin 63: 523-563.

163

NEM:BA. 2004. National Environmental Management: Biodiversity Act (No. 10 of 2004). Government Gazette No. 32090, 3 April 2009. Department of Environmental Affairs and Tourism, Pretoria.

Oyedeji, A.A., & Abowei, J.F.N. 2012. The Classification, Distribution, Control and Economic Importance of Aquatic Plants. International Journal of Fisheries and Aquatic Sciences 1 (2): 18-128.

Teamkao, P. & Thiravetyan, P. 2010. Phytoremediation of ethylene glycol and its derivatives by burhead plant (Echinodorus cordifolius (L.)): effect of molecular size. Chemosphere 81 (9): 1069-1074.

164

Egeria densa Planch.

Common name: Synonyms: Classification: Brazilian elodea Anacharis densa (Planch.) Vict. Class: Liliopsida Brazilian waterweed Elodea densa (Planch.) Casp. Order: Alismatales Leafy elodea Philotria densa (Planch.) Small Family: Hydrocharitaceae Egeria

Description:

Egeria densa is a submerged perennial aquatic plant rooted 1-2 m below the water surface. Stems are irregularly branched and grow over 3 m long and are 1-3 mm in diameter. Leaves are linear and minutely serrated, 10-50 mm long and 1-3 mm wide, and are arranged in whorls of four to 10. Flowers are white with three petals. Flowers grow up to 30 mm above the water surface (Yarrow et al. 2009).

A B

Fig.12. (A) Egeria densa plant and (B) Flowers. Photographs: by C.J. Cilliers (http://www.agis.agric.za/).

Native ranges:

Egeria densa is native to Australia (Mony et al. 2007), Argentina, Brazil, and Uruguay (AGIS 2007).

Distribution in South Africa:

Brazilian water weed is prohibited in South Africa (NEM:BA 2004) but is sold illegally in the aquarium trade. It is invasive in eastern Cape, KwaZulu Natal, Free State, Mpumalang and western Cape Provinces.

165

Fig. 13. Distribution of Egeria densa in South Africa.

Natural habitat:

Egeria densa grows in dams, lakes and rivers (Henderson & Cilliers 2002).

Uses:

This plant is used as an ornamental aquarium plant.

How it spreads:

Dense waterweed spreads mainly through vegetative fragmentation of the stem (Henderson & Cilliers 2002).

Invasion category:

This plant is listed on the Global Compendium of Weeds (http://www.hear.org/gcw/) as a weed in many countries. In South Africa, it is listed as a category 1b invader (NEM:BA 2004).

Environmental impacts:

Egeria densa disrupts navigation of boats, fishing, and other recreational activities, adversely affects water flow, increases the loss of water from storage dams, and poses a serious threat to hydroelectric infrastructures (Berreto et al. 2000).

166

DNA barcodes: matK

TTTATTGCGATTTTTTCTATATGAAAATGGGAATAGTTTCATTACTCTAAAGAAATCTATTTCCCTTTTTTCAAAAGAGAATCA AAGACTATTTCGGTTCCTATATAATTCTTACGTATCTGAATATGAATTAGTATTTTGTTTTCTCCGTAGACATTCCTCTTATTTA CTATCAACATCTTCTGGAGACTTTATTGAGAGAACACATTTCTATGGAAAAATAGGACATCTTGTAGTAGTTTGTCGTAATGA TTTTCAGAAAAGCTTACAGTTGTTCGAGGATCCTTGCATGCATTATGTTAGATATCAAGGAAAATCAATTCTCGCTTCAAAAG GAACCTATCTTCTGATGAACAAATGGAAATGTTACTTTGTCCATTTTTGGCAATCTAATTTTTACTTTTGGTCTCAACCATATA GGATTCATATAAACCAATTATCAAATAATTCTTTCGATTTTTTGGGTTATCTTTCAAGTGTATTAATAAATCCTTTGGCAGTAA GAAGTAAAATGCTAGAGTATTCATTTCTAATAGACATTGGTACTAAGAAATTCGATACTATAGTCCCTGTTATTCTTCTTATTG GCTCGTTGTCTAAAGCTAAATTTTGTAATGTATCTGGGCATCCCATTAGTAAGCCGA rbcLa

GCAGGTGTTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAATATGAAACCAAAGATACTGATAT CTTGGCAGCATTCCGAGTATCTCCACAACCTGGAGTTCCACCTGAAGAAGCAGGGGCCGCAGTAGCTGCCGAATCCTCTA CTGGTACATGGACAACTGTGTGGACTGATGGACTTACTAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCTG TTGCTGGGGAGGAAGATCAATATATTGCTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTT ACTTCCATTGTGGGTAATGTATTTGGATTCAAAGCTCTACGAGCTCTACGCTTGGAGGATCTACGAATTCCTCCTGCTTATT CCAAAACTTTCCAAGGTCCACCTCATGGAATCCAAGTTGAAAGAGATAAATTGAACAAATATGGTCGTCCTCTATTGGGATG TACTATTAAACCAAAATTGGGATTATCTGCGAAAAACT trnH-psbA

GGATGCTTTTTGTACATCCATCATTATTTGATTCAGTTTTTTTGCTTTATACTAAAATTGAGATATTGGACATAATATACTAGT CTTCAAAATGTAAAAATAAAATACAAAATGTAAAAATAAAATACAAATAGAAAAAAAAAATGATACCGTATTGAATTAAATAAA GATAGAAATACTAAACCCATTTAAAATGGGTTTAGTATTTCTATTCTACTTCAACAATTCTTATACACTAAAAAGAAGTCTTAT CCATT

References:

AGIS. 2007. Agricultural Geo-Referenced Information System. Available online from: www.agis.agric.za [Accessed 01 June 2013].

Barreto, R., Charudattan, R., Pomella, A., & Hanada, R. 2000. Biological control of neotropical aquatic plants with fungi. Crop Protection 19: 697-703.

NEM:BA. 2004. National Environmental Management: Biodiversity Act (No. 10 of 2004). Government Gazette No. 32090, 3 April 2009. Department of Environmental Affairs and Tourism, Pretoria.

Mony, C., Koschnick, T.J., Haller, W.T., & Muller, S. 2007. Competition between two invasive Hydrocharitaceae Hydrilla verticillata L.F (Royle) and Egeria densa (Planch) as influenced by sediment fertility and season. Aquatic Botany 86: 236-242.

167

Yarrow, M., Marin, V.H., Finlayson, M., Tironi, A., Delgado, L.E., & Fisher, F. 2009. The ecology of Egeria densa (Planch) (Liliopsida: Alismatales): A wetland engineer? Riasta Chelena de Historia Natural 82: 299-31.

168

Eichhornia crassipes (Mart.) Solms

Common name: Synonyms: Classification: Water hyacinth Eichhornia speciosa Kunth Class: Liliopsida Piaropus crassipes (Mart.) Raf. Order: Commelinales Pontederia crassipes Mart. (basionym) Family: Pontederiaceae

Description:

Eichhornia crassipes is a perennial, free-floating aquatic plant measuring 0.1-0.2 m high, and reaching up to 1 m when growing in dense mats. Leaves are thick, waxy and 40-120 mm wide. The leaves are attached to swollen orbicular petioles and they are arranged in rosettes. Flowers are pale violet, measuring about 50 mm in diameter. The uppermost tepal has a prominent dark purple blotch with a yellow centre. The fruit is a capsule containing very fine seeds. Roots are fibrous and feathery (Crow & Hellquist 2000; Henderson 2001).

A B

169

Fig. 14. (A) Eichhornia crassipes plants, (B) orbicular petioles, and (C) infestation of the Vaal River. Photographs: by C.J. Cilliers (http://www.agis.agric.za/).

Native ranges:

Water hyacinth is indigenous to South America (Masifwa et al. 2001).

Distribution in South Africa:

Fig. 15. Distribution of Eichhornia crassipes in South Africa.

Natural habitat:

Water hyacinth grows in lakes, riparian zones, watercourses and wetlands.

Uses:

This plant has a number of industrial uses. It is used as a biological filter in the treatment of lead contaminated industrial effluents (Dos Santos & Lenzi 2000). It is used for ethanol production in the motor fuel industry (Nigam 2003) and also in the production of biogas (Kivaisi & Mtila 1998).

170

How it spreads

Water hyacinth spreads by producing numerous small seeds that are easily carried away by water and wind. Seeds are also spread by boats, water equipment, and water fowl. Plants also reproduce vegetatively by stolons, which break off and develop into new plants (Henderson & Cilliers 2002).

Invasion category:

This plant is listed on the Global Compendium of Weeds (http://www.hear.org/gcw/) as a weed in many countries. In South Africa, it is listed as a category 1b invader (NEM:BA 2004).

Environmental impacts:

Eichhornia crassipes has major impacts on aquatic ecosystems in South Africa. It forms dense mats that cover watercourses completely, preventing light penetration and lowering water temperatures. This also results in high carbon dioxide and reduced oxygen levels as submerged aquatic plants are unable to photosynthesis. Reduced temperature and oxygen levels alter animal and plant community composition in aquatic ecosystem (Howard & Harley 1997), hence reducing aquatic biodiversity. It also reduces water flow and increase siltation of dams and rivers. Rotting plant material decreases the pH of the water, creating conditions suitable for mosquitos and bilharzia-carrying snails (Henderson & Cilliers 2002).

DNA barcodes: matK

TTTCTTCACCAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCGATTTCTGTTATTTCAAAAGAAAATAAAAGACTA TTTTGGTTCTTATATAATTCTTATATATCTGAATGCGAATTTTTATTAGTGTTTCTTCGTAAACAATCTTCTTATTTACCATTAA CATCTTCTGGAGTCTTTCTTGAGCGAACATATTATTATGGAAAAATACAACGTATTTTAGTGTGGCAGAATTTTTTTCAAAAG ACTCTATGGGTCTTTAAAGACCCTTTCATGCATTATGTTCGATATCAAGGAAAAGTAATTCTAGGTTCAAAGGGGACTAATTT TCTGATGAAAAAATGGAAATTTTACTTTGTCAATTTATGGCAATATTATTTTCACTTTTGGTCCCAACCGTGCAGGATTCATAT AAACCAATTATCAAATTATTCTTTCTATTTTCTGGGTTATTTCTCAAATGTACTAAAAAATCCTTTGTCGGTTAGGAATCAGAT GTTAGAGAATTCTTTTCTAATGGATACTCTTACTAAGAAATTCGATACTCTAGTACCAGTTATTCCTCTTATTAGCTCATTG rbcLa

TTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTC CGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACC AGTCTTGATCGTTACAAAGGACGATGCTACCACATTGAGGCCGTTCCTGGAGAAGATAGTCAATATATCGCTTATGTAGCTT ATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGGTTTCAAAGCCCTA CGAGCTCTACGTTTGGAGGATTTGCGAATTCCTCCTGCCTATTCCAAAACTTTCCAAGGCCCACCTCACGGTATCCAGGTT GAAAGAGATAGGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCTAAATTGGGATTATCTGCAAAGAACT ATGGTAGAGCGGTTTATGAATG trnH-psbA

TCATTATTGTATTTTTTTTGACTGACCTCCATACTTAATAACTTAGATCGAGATATTGGACATAGAATGCCAATCTTTAAAATA AATGTAAAAAAAGGAGTAATCCACTGTGACACGTTCACTTAAAAAAAACCCTTTTGTAGCTAATCATTTATCGAAAAAAATTG AAAAATAAATATAGGTTATAGTCTACTACACAACTTTAATTTATATTCAAATTTTCTTCTATTCTTGTGATATATACTAATTATTA TACTTTCATATTACTTATTATTTAATCTATACTTTAATCTATTAATTTCTATTCTATTTATTTTACGTGTTGTATACAAAAAGCAC

171

TATCGTATCAAACAAATTAGCCATACCCCTTATCTTGTTTTAATTTAATAAGGGGTATGGCCAATTTACCTCAACAATCCGTA TACACTAAAACAAAAGTCTTATCCATTGATAGATGGAACTTCAACAGCAGCTAGGTCTAGAGGGAAGTTGTGAGCA

References:

Crow, G.E., & Hellquist, C.B. 2000. Aquatic and wetland plants of north eastern Northern America. University of Winconsin press, Madison.

Dos Santos, M.C., & Lenzi, E. 2000. The use of aquatic macrophyte (Eichhornia crassipes) as a biological filter in the treatment of lead contaminated effluents. Environmental Technology 21 (6): 615-622.

Henderson, L. 2001. Alien weeds and invasive plants. Agricultural Research Council, Plant Protection Research Institute, Pretoria.

Howard, G.W., & Harley, K.L.S. 1997. How do floating aquatic plants affect wetland conservation and development? How can these effects be minimised?. Wetlands Ecology and Management 5 (3): 215-225.

Kivaisi, A.K., & Mtila, M. 1998. Production of biogas from water hyacinth (Eichhornia crassipes) (Mart) (Solms) in two stage bioreactor. World Journal of Microbiology and Biotechnology 14: 125-131.

Maswifa, W.F., Twongo, T., & Denny, P. 2001. The impact of water hyacinth, Eichhornia crassipes (Mart) Solms on the abundance and diversity of aquatic macro invertebrates along the shores of the northern Lake Victoria, Uganda. Hydrobiological 452: 79-88.

NEM:BA. 2004. National Environmental Management: Biodiversity Act (No. 10 of 2004). Government Gazette No. 32090, 3 April 2009. Department of Environmental Affairs and Tourism, Pretoria.

Nigam, J.N. 2003. Bioconversion of water hyacinth (Eichhornia crassipes) hemicellulose acid hydrolysate to motor fuel ethanol by xylose-fermenting yeast. Journal of Biotechnology 97(2): 107-116.

172

Hydrilla verticillata (L.f.) Royle

Common names: Synonyms: Classifaction:

Hydrilla Hydrilla verticillata var. brevifolia Casp. Class: Liliopsida Water thyme Hydrilla verticillata var. crispa Casp. Order: Alismatales Florida elodea Hydrilla verticillata var. roxburghii Casp. Family: Hydrocharitaceae

Description:

Hydrilla verticillata is a perennial, submerged aquatic herb with heavily branched, slender stems, growing up to 9 m long. Leaves are serrated, strap-shaped with pointed tips, growing in whorls of 4-8 around the stem. Leaves can be green, translucent, yellowish or brown, measuring 6-20 mm long and 2-4 mm wide (Clayton 2006). Specialized buds known as turions, appear as simple, green, compressed shoots, measuring 3-12 mm long, in the axil of leaves (Neatherland 1997). Female flowers are white and male flowers are green in colour (Clayton 2006). Tubers are produced at the bottom of rhizomes, measuring 4-15 mm in length, and vary in colour from off-white to near black (Neatherland 1997).

A B

C 1

173

Fig.16. (A) Hydrilla verticillata plant, (B) serrated leave margins, and (C) (1) tubers and (2) turions of H. verticillata. Photographs: (A) by S.J. Winterton (http://itp.lucidcentral.org), (B) by L. Henderson (http://www.agis.agric.za), and (C) by J. Clayton (http://itp.lucidcentral.org).

Native range:

Hydrilla verticillata is native to Australia, Asia and many Pacific Islands (Madeira et al. 2007).

Distribution in South Africa:

This plant is prohibited in South Africa (NEM:BA 2004) but it is sold illegally in the aquarium trade. It is now invasive in the Kwazulu Natal Province.

Fig.17. Distribution of Hydrilla verticilla in South Africa.

Habitat:

This submerged macrophyte is found in dams, rivers, wetlands and ponds (Hensrson & Cilliers 2002).

Uses:

Hydrilla is traded globally as an aquarium plant (Coetzee et al. 2009).

How it spreads:

This plant reproduces sexually by seeds and asexually by stem fragments, turions and tubers (Clayton 2006). Seeds and fragments are dispersed by boats and anglers (Coetzee et al. 2009).

174

Invasion category:

This plant is listed on the Global Compendium of Weeds (http://www.hear.org/gcw/) as a weed in many countries. In South Africa, it is listed as a category 1a invader (NEM:BA 2004).

Environmental Impacts:

Hydrilla forms thick mats that disrupt recreational activities, navigation, irrigation, and hydroelectricity generation (Madeira et al. 2007).

DNA barcodes: rbcLa

ACTAAAGCAGGGCTTGGATTCAAAGCAGGTGTGAAAGATTATAAATTAACTTATTATACTCCGGAATATGAAACCAAAGATA CTGATATCTTGGCAGCATTCCGAGTAACTCCGCAACCCGGAGTTCCACCTGAAGAAGCGGGGGCCGCAGTAGCTGCTGAA TCCTCTACTGGTACATGGACAACTGTGTGGACTGATGGGCTTACTAGCCTTGATCGTTACAAAGGACGATGCTACCACATT GAGCCCGTTGCCGGAGAGGAAGATCAATACATTGCTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCA ACATGTTTACTTCCATTGTAGGTAATGTATTTGGGTTCAAAGCTCTACGAGCTCTACGCTTAGAGGATCTGCGAATTCCCCC TGCTTATTCCAAAACTTTTCAAGGTCCACCTCATGGAATCCAAGTTGAAAGAGATAGATTAAACAAATATGGCCGTCCTCTA TTGGGATGTACTATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATG trnH-psbA

CACAACTTCCCTTTAGATTTAGCTGCTGTTGAAGTTTTATTTACAAACGGATAAGACTTTTTTTGATGGATACGAAGAAAGTC AAAATAGTAAATCCATTTCATTTCTAAAAAAAATGTGTTTACTATTTTGACTTTCTATTGAAATATTTGATTTCCAGAATATTTT TTGATTTCCTATTTCATAAGGAAGAAGGTGGGTTCACATAACTATTTTTTCATTTGTTTTTCTTTTTTTTTTTTACATTTTTATTC GATTTGTTCGATTTGGTTAGACATAATATACCAACTTTTTGGGTATATAAGGAAAAAGGCTAAATCCAATAGTATATATACTA AATATACTAAATATACTAATGCATGCTAATGAGTGTAACAAAAAATGATAATGAACTTAATGAAAATTTTGTTTCAATCAAAGG GGGCGGATGTACCCAAGTGGATTA

References:

Clayton, J. 2006. Ecology of Hydrilla verticillata. Global Invasive Species Database. Available online from: http://www.issg.org/database/species/ecology.asp?=272&fr=1&sts=sss&lang=EN [Accessed 28 June 2013].

Coetzee, J.A, Hill, M.P., & Schlange, D. 2009. Potential spread of the invasive plant Hydrilla verticillata in South Africa based on anthropogenic spread and climate suitability. Biological Invasions 11: 801-812.

Madeira, P.T., Coetzee, J.A., Center, T.D., White, E.E., & Tipping, P.W. 2007. The origin of Hydrilla verticillata recently discovered at a South African dam. Aquatic Botany doi:10.1016/j.aquabot.2007.04.008.

175

NEM:BA. 2004. National Environmental Management: Biodiversity Act (No. 10 of 2004). Government Gazette No. 32090, 3 April 2009. Department of Environmental Affairs and Tourism, Pretoria.

Netherland, M. D. 1997. Turion ecology of Hydrilla. Journal of Aquatic Plant Management 35: 1-10.

176

Hygrophila polysperma T. Anderson

Common names: Synonyms: Classification:

Dwarf hygrophila Hemiadelphis polysperma (Roxb.) Nees Class: Magnoliopsida Justica polysperma Roxb. Order: Lamiales Family: Acanthaceae

Description:

Hygrophila polysperma is an ascending to creeping aquatic herb with stems square in outline. Leaves are 80 mm long, 20 mm wide, opposite, elliptic to oblong, with the base joined at the node by ciliated tissue. Small, solitary flowers occur in the uppermost leaf axils with sepals green and hairy, and petals blue to white. Fruit are narrow capsules with tiny rounded seeds (Langeland 2008).

A B

Fig. 18. (A) Hygophila polysperma plant and (B) dense infestation. Photographs: (A) by M. Matejasko (http://www.aquapage.eu) and (B) by S. Navie (http://weeds.brisbane.qld.gov.au).

Native range:

Dwarf hygrophila is indigenous to temperate and tropical Asia from China to Thailand, Vietnam and India (Gupta 2011).

Distribution in South Africa:

This plant is sold in the aquarium trade. It has not yet been recorded in South African waters.

Habitat:

This plant occurs in regions of warmer climates and prefers flowing streams and lakes (Ramey 2001).

177

Uses:

Hygrophila polysperma is a plant with various uses. It is an ornamental aquarium and medicinal plant. It is also used as a screening tool for toxicity testing and as a bio-indicator to detect and control algae (Karatas et al. 2013).

Invasion category:

This plant is listed on the Global Compendium of Weeds (http://www.hear.org/gcw/) as a weed in many countries. It has not been listed on the CARA and NEM:BA list of invasive species in South Africa. Henderson & Cilliers (2002) suggested that this plant should be prohibited in South Africa.

Environmental impacts:

Dwarf hygrophila forms dense mats that clog irrigation canals and flood control systems. They become dominant species in their introduced ranges and threaten native aquatic plants (Langeland 2008).

DNA barcodes: matK

CGAGTATTGGAATTGGAATCTTTTTATTAGGCCAAAGAAAGCCAATTACTCTTTTTCAAAAAGAAATCAAAGGTTATTCTTATT CTTAGATAATTCTCTTGTATGGGAATATGAATCCACTTTCTTCTTTTTCCGTAACCAATCCTCTCATTTACGATCAACATCTTC TGGATGTTTTCTTGAACGAATTGATTTCCATGGAAAAATACAACATCTTGTGAACGTCTTTGTTAAGGTTAAGGATTTTCAGG TGAACCTATGGTTGGTCAAGAAACCTTGCATGCATTATATTAGGTATCAAAGAAGATTCCTCTTGGCTTCAAAAGGGACGTT CCTTTTCATGAATAAATGGAAATGTTACCTTGTCACTTTTTGGCAATGGCATTTTTCGCTGTGGTTTCATTCAAGAAGGATTT ATAGAAAGAAATTGTCCAATCATTTCCTTGAATTTGTTGGCTATCTGTCACGTGTGCTGATGAAACCTTCAGTGGTACGGAG CCAAATCCTGGAAAATGCATTTCCAATCAATAATGCCATTAAGAAGTTCGATAATCGTATTCCAGTTAATCCCTCTGATTGCG GCATTGGCAAAAGCAAATTTTGTAACGTAATAAGACATCCGTATTAGGTAAGGCAGTTTGGGGCTGATTTATCAGATCCGAA rbcLa

AAGCAGGTGTTGGATTCAAAGCAGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAATATCAAACCAAAGATACTGAT ATCTTGGCAGCATTCCGAGTAACCCCGCAACCCGGAGTTCCACCTGAGGAAGCAGGGGCCGCAGTAGCTGCCGAATCTT CTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACTAGTCTTGATCGTTACAAAGGACGATGCTACCACATTGAAC CTGTTATTGGAGAAGAAAATCAATATTTTTGTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGT TTACTTCCATTGTAGGTAATGTATTTGGGTTTAAAGCTCTACGAGCTCTACGCTTGGAGGATTTGCGAATTCCTTCTTCTTAT TCCAAAACTTTCCAAGGTCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAATATGGCCGTCCCCTATTGGGA TGTACTATTAAACCAAAATTGGGATTATCCGCAAAAAACTACGGTAGAGCTGTTTATGAATGTCTTCGGG trnH-psbA

AAATGGATAAAATTTCGTTTTTAGTTTAGTGTATATGAGTTATTGAACGTAAAGGGGCAATGATGGTTTCTTGTTCTGGCAAG AAATTGGTTATTGCTCCTTTACTAGTCAGTCTTTTTTTTTATAATATTCTAAAAAGTTTAATATTGTATATTATTATATTAAGTTA ATTATTATTATTATATTTGAACTTATTAAATAAAATATTTTAAATAAAATATTAGAAGTATAGAAGTATATAAGTTAAGTTCTTTT ATTTCTTTACTACAATACTTTCCGAATAACTAAGAAAAGTTTTTCTATTTAAAAACTCAATTAATCGAATATTAATATTAATTAA TTAAGTTTTTTTTTCTAACTTTTTATATGAGATACTTTAATTAAAAAATTAAAAATTAATTCCAATTTTCTTTTTGGTTTTTTCAAT ACCATGAAAAAATTAATAAGATGAATTAAAAATTCATTTAATTCAAGACTTAATAAAAGACAAGTTCAATTAAAGAACTAATTT ATGAATACCGAATTCATAAGTAAATTAGGGGGCGGAT

178

References:

Karataş, M., Aasim, M., Çınar, A., & Dogan, M. 2013. Adventitious Shoot Regeneration from Leaf Explant of Dwarf Hygro (Hygrophila polysperma (Roxb.) T. Anderson). The Scientific World Journal doi.org/10.1155/2013/680425.

Langeland, K.A. 2008. Identification and biology of non-native plants in Florida’s natural areas. University of Florida –IFAS Pub SP 257. Second Edition, Florida.

Gupta, A.K. 2011. Hygrophila polysperma. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. Available online from: www.iucnredlist.org [Accessed 09 August 2013].

Ramey, V. 2001. Hygrophila polysperma (Roxb.) T. Anderson. Non-native aquatic plants in the United States. Centre for aquatic and invasive plants. University of Florida and Sea Grant. Available online from: http://aquat1.ifas.ufl.edu/seagrant/hygpol2.html [Accessed 05 August 2013].

179

Ipomoea carnea Jacq. subsp. fistulosa (Mart. ex Choisy) D. F. Austin

Common name: Synonyms: Classification: Morning glory-bush Ipomoea crassicaulis (Benth.) B.L. Rob. Class: Magnoliopsida Ipomoea fistulosa Mart. ex. Choisy Order: Solanales Family: Convolvulaceae

Description:

Ipomoea carnea subsp. fistulosa is an erect to scrambling shrub measuring up to 3 m high with a hallow stem that is woody at the base. Leaves are dull green, ovate to lanceolate, with long-tapering tips and truncated or heart-shaped bases, 100–200 mm long. Flowers are funnel-shaped, light pink to purple in colour with throats dark mauve, measuring 50-90 mm in length. Flowers cluster at the tips of the branches. Fruits are brown, glabrous capsules containing four hairy seeds measuring 10 mm in length (Henderson & Cilliers 2002; Putnam & Gaskalla 2009; Staples 2010).

A B

Fig. 19. (A) Ipomoea carnea subsp. fistulosa flowers and (B) morning glory bush invading a river in the Kwazulu Natal Province. Photographs: by G.R. Nichols (www.agis.agric.za).

Native ranges:

Morning glory-bush is native to Tropical America ranging from Argentina to Florida and Texas (Putnam & Gaskalla 2009).

180

Distribution in South Africa:

Fig. 20. Distribution of Ipomoea carnea subsp. fistulosa in South Africa.

Habitat:

Ipomoea carnea subsp. fistulosa grows along riverbanks, ditches, edges of dams and roadsides (Shaltout et al. 2006).

Uses:

Morning glory-bush is used as an ornamental (Staples 2010) and hedge plant.

How is spreads:

This emergent macrophyte reproduces both by seeds and vegetatively. Branches break off and form roots while the seeds are dispersed by water (Shaltout et al. 2006).

Invasion category:

This plant is listed on the Global Compendium of Weeds (http://www.hear.org/gcw/) as a weed in many countries. In South Africa, it is listed as a category 1b invader (NEM:BA 2004).

Environmental Impacts:

181

Ipomoea carnea subsp. fistulosa outcompetes indigenous vegetation by forming mono-specific stands (Henderson & Cilliers 2002). The plant is poisonous to livestock (Armien et al. 2007).

DNA barcodes: matK

ATTCTTGGTTCAGGCTTTGTCGCTATGGATAAAAGATGCTTCCTCTTTACATTTATTAAGATTCTTTCTCCATGAGTGTCATA ATTGGGATAGTCTTATTACTTCAAATTCAAAGAAAGCCAGTTCTTCTTTTTCAAAAATAAATAAAAGACTATTCTTCTTCCTAT ATACTTCTCATGTATGTGAATATGAATCTAGCTTCCTATTTCTCCGTAACCAATCTTCTCACTTACGATCAACATCTTCTGGA GCCCTTATTGAACGAATATTTTTCTATGGAAAAATGGAGCATCTTGCAGAAGTCTTTGCCAGGGCTTTTCAAGCGAATTTAT GGTTGTTCAAAGATCCTTTCATGCATTGTGTTAGGTATCAAGGAAAATCAATTATTGCTTCAAAAGGGACGTTTCTTTTGATG AATAAATGGAAATATTACTTTGTCAATTTCTGGAAATCCCATTTTTACCTCTGGTCTCAACCAGGAAGGATTTATATAAACCA ATTATCCAATCATTCCCTTGACTTTCTGGGTTATCGTTCAAGTGTGCGGCTAAAGCCTTCAATGGTACGCAGTCAAATGCTA GAAAATGAATTTATAATTGATAATGCTATTAAGAAGTTTGATACCCTTGTTCCAATTATGCCTCTGATTGGATCATTGGCTAA ATCTAAATTTTGTAACGCAGTGGGGCGTCCTATTGGTAAGGCGATTTGGGCCGATTTCTCAGATTCTGATAATATTGAGCGC TTTGGGCG trnH-psbA

TCCATTTACAAATGGATAAGGACTCGGTTTTAGGGTATTGGAGTTTTTGAAAATTAAGGGAGCAATAACCACTTTCTTGTTCT AAACAAGATGGGGTATTGTTCCTTTATTTCTATTTATTTTTTGATTCAAAAATTGAATCAAAAAATTTAGGTTTTTCTTTGGAAA TTAAGTTAAAATTTAAAATAAGGTAAAGAAGATAATATTGAATGAATGATAATATTGAATTTAATTATCCATATTGAATCTAAAT TTTTTTTCTAATTAGAAAAATAAAATGAAAAAAAAAAAGAACATAGTCTGGGG

References:

Armien, A.G., Tokarnia, C.H., Peixoto, P.V., & Frese, K. 2007. Spontaneous experimental glycoprotein storage disease of goats induced by Ipomoea carnea subsp. fistulosa (Convolvulaceae). Veterinary Pathology 44 (2): 170-184.

NEM:BA. 2004. National Environmental Management: Biodiversity Act (No. 10 of 2004). Government Gazette No. 32090, 3 April 2009. Department of Environmental Affairs and Tourism, Pretoria.

Putnam, A.H., & Gaskalla R.D. 2009. Ipomoea fistulosa (I. carnea subsp. fistulosa), bush morning glory. Available online from: http:www.freshfromflorida.com [Accessed 20 June 2013]

Shaltout, K.H., Al-Sodany, Y.M., & Eid, E.M. 2006. The biology of Egyptian woody perennials 2. Ipomoea carnea Jacq. Assiut University Bulletin for Environmental Researchers 9 (1): 75- 91.

Staples, G. 2010. Convolvulaceae. Flora of Thailand 10 (3): 413.

182

Iris pseudacorus L.

Common names: Synonyms: Classifaction: Pale yellow flag Iris pseudacorus var. acoriformis (Boreau) Nyman Class: Liliopsida Yellow iris Iris pseudacorus var. acoroides (Spach) Baker Order: Asparagales Yellow flag Iris pseudacorus var. bastardii (Boreau) Nyman Family: Iridaceae

Description:

Iris pseudacorus is a perennial, rhizomatous, aquatic plant growing up to 1 m in height. Leaves are erect, sword-shaped with a flattened midrib. Leaves are greenish blue in colour measuring up to 1 m in the length and 30 mm in diameter (Henderson 2009). The flowers are yellow, 80-100 mm in diameter. The fruit is a capsule, 40-80 mm long, with seeds closely packed in three compartments (Sutherland 1990).

A B

Fig. 21. (A) Iris pseudacorus flower and (B) plants. Photographs: by H. Klein (http://www.agis.agric.za).

Native range:

Yellow iris is native to Europe, Northern Africa, and temperate Asia (Henderson 2009).

183

Distribution in South Africa:

Fig. 22. Distribution of Iris pseudacorus in South Africa.

Habitat:

Yellow iris grows along river banks, pond edges and wetlands.

Uses:

Iris pseudacorus is used in wastewater treatment to removes residual heavy metals (Barbolani et al. 986) and chemical compounds such as nitrogen and phosphorous (Yousefi & Mohseni-Bandpei 2010). It is also a popular ornamental pond plant.

How it spreads:

This emergent macrophyte spreads through seeds and rhizome fragments that are carried away by water (Sutherland 1990).

Invasion category:

This plant is listed on the Global Compendium of Weeds (http://www.hear.org/gcw/) as a weed in many countries. In South Africa, it is listed as a category 1a invader (NEM:BA 2004).

184

Ecological impacts:

Iris psuedacorus outcompetes native vegetation and forms mono-specific impenetrable thickets that lessen access to watercourses and reduces aquatic biodiversity (Ramey 2001).

DNA barcodes: matK

TTCTTGCGATTCTTTCTTCATAAATATCATAATTGGAATTGGAATAGTTTTCTCATTACTCCAAAGAAATCTATTTATGTTTTTT CAAAAGAAAATAAAAGACTTTTTCGGTTCCTATACAATTCTTATGTATCTGAATGTGGATTTTTTTTAGTTTTTCTTCGTAAAC AATCTTCTTATTTACGATTAACATCTTTTGGACTTTTTCTTGAGCGAAGACATTTCTATGTAAAAATAAAACGTCTTCAAATGC AACATCTTATACTTATAGTAGTATGTCGTGATTATTTTCAAGGAACCCTATGGTCCTTCAAGGATCCTTTCATGCATTATGTT CGATGCCAAGGAAAAGCAGTTTTGGCTTCAAAAGGGACTCATCTTCTGATGAAAAAATGGAAATATAATTTTGTCAATTTAT GGCAATATTATTTTCACTTTTGGTATCAATCGTACAGGATCCATATAAACCAATTATCAAACTATTCTTTCTATTTTCTGGGTT ATCTTTCAAGTTTACTAAAAAATTCTTCGATGGTAAAGAATCAAATGCTAGAGAATTCATTTCTAGTAGATACTGTTACTAATA AATTTGAAACCCTAGTCCCAGTTATTTTTCTTATTGGATCCTTGTCTAAAGCTCAATTTTGTACCGTATTGGGGCATCCTATT AGTAAGCCAATCTGGGCGGATTACCAGATCT rbcLa

ATTATACTCCTGATTACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCTGCTGA AGAAGCGGGGGCTGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACGGTGTGGACTGATGGACTTACCAGTCTTG ATCGTTACAAAGGACGATGCTACCACATCGAGGCCGTTGTTGGAGAGGAAAATCAATATATTGCTTATGTAGCTTATCCTTT AGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAACGTATTTGGTTTTAAAGCCCTACGAGCTC TACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGCCCGCCTCATGGCATCCAGGTTGAAAGAG ATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACTATTAAACCA trnH-psbA

AATGGATAAGACTTCCGTATTAATGTATACGAATCGTTGAAGGACCCATACCCAATATCTTACTAAAACAAGATATGGGCAT GGGTCCCCCACCAATATTTGTGATCCTCGTTCAAAATTAACGACGAGATTTATTATCGTTTCTCGCATGTCTCGCGAAAGTC AGAGTAGGCGCGAATTCCCCCAATTTGTGACCTACCATACGATCTGTTATATAAATAGGTAAATGTTCCTTTCCATTATGAAT AGCGATTGTATGGCCAATCATTGTGGGTATAATGGTAGATGCCCGAGACCAAGTTACTATTATTTCTTTCTCCTCCCTCATG TTGAGTTTTTCAATTTTTCCCGATAAATGATTGGCTACAAAAGGGTTTTTTTTTAGTGAACGTGTCACAGCTGATTCCTCCTA TTTTAAAGATTGGCATTCTATGTCCAATAGAATATCTCGATCGAAGTATGAAGGTAAGCATAAATACAATAATGATGAATGGA AAAAAGAGAAAATCCTTTAGCTAGATAAGGGGCGGATGTAGCCA

References:

Barbolani, E., Clauser, M., Pantani, F., & Gelleni, R. 1986. Residual heavy metal (Cu and Cd) removal by Iris pseudacorus. Water, Air and Soil Pollution 28: 277-282.

Henderson, L. 2009. Are we fighting a losing battle against invasive alien plants? South Africa Plant Invaders Atlas 10: 1-5.

NEM:BA. 2004. National Environmental Management: Biodiversity Act (No. 10 of 2004). Government Gazette No. 32090, 3 April 2009. Department of Environmental Affairs and Tourism, Pretoria.

185

Ramey, V. 2001. Centre for aquatic and invasive plants: Iris pseudacorus L. Available online from: http://aquat1.ifas.ufl.edu/seagrant/iripse2.html [Accessed 20 June 2013].

Sutherland W.J. 1990. Iris pseudacorus L. Journal of Ecology 78 (3): 833-848.

Yousefi, Z., & Mohseni-Bandpei, A. 2010. Nitrogen and phosphorus removal from wastewater by subsurface wetlands planted with Iris pseudacorus. Ecological Engineering 36 (6): 777-782.

186

Lagarosiphon muscoides Harv.

Common names: Synonyms: Classification:

Fine oxygen weed Hydrilla dregeana C. Presl Class: Magnolipsida

Lagarosiphon schweinfurthii Casp Order: Alismatales

Hydrilla muscoides (Harv.) Planch Family: Hydrocharitaceae

Description:

Lagarosiphon muscoides is a submerged aquatic plant densely covered with linear, alternate, opposite or locally verticillate leaves. Leaves are thin, soft and transparent with attenuate to very acute tips. Leaf margins are covered with 3-6 rows of sclerenchyma fibres, with each fibre bearing 28- 86 teeth. Fruits are white to pink. Fruits are narrowly ovate capsules, 4.3-8.0 (-10) mm long, 1.3-2.2 (- 30) mm wide, and tapered above. Seeds are narrowly ellipsoid, 2.0-2.5 mm long and 0.5 mm wide (Symoens & Triest 1983).

Fig. 23. Lagarosiphon mascoides plant. Photograph: by T. Phago.

Native range:

Fine oxygen weed is native to South Africa (Symoens & Triest 1983).

187

Distribution in South Africa:

Fig.24. Distribution of Lagorosiphon muscoides in South Africa.

Habitat:

Fine oxygen weed grows in fresh water habitats (Cholo & Foden 2006).

Uses:

Lagarosphon muscoides is used as an aquarium plant.

How it spreads:

This plant reproduces sexually and asexually from axillary buds and stem fragments (Symoens & Triest 1983).

Invasion category:

This plant is listed on the Global Compendium of Weeds (http://www.hear.org/gcw/) as a weed in many countries. In South Africa, it is a native opportunistic aquatic plant. It flourishes in disturbed aquatic ecosystem often becoming a dominant species and threatening other native aquatic plants (Henderson & Cilliers 2002).

Environmental impacts:

188

Lagarosiphon muscoides can grow in dense masses in disturbed aquatic environments, choking up shallow dams and rivers (Henderson & Cilliers 2002).

DNA barcodes: matK

TCTTTGCATTTACTGCGATTTTTTCTATATGAATATCATAATGGGAATAGGTCCATTACTCTAAAGAAATCCATTTCCCTTTTT TTAAAAGAGAATCAAAGATTATTTCGGTTCCTATCTAATTCTTATCTATCTGAATATGAATCAGTATTTTGTTTTCTCCGTAGA CATTCCTCTTTTTTACTATCAACATCTTCTCGAGACTTTAGTGAGCGAACACATTTCTATGGAAAAATGGAACATCTTGTAGT AGTTTCTCGTAATGATTTTCAGAGAAGCTTACGGTTCTTCGAGGATCCTTGCATGCATTATGTTAGATATCAAGGAAAATCAA TTCTCGCTTCAAAAGGAACCTATCTTCTGATGAAGAAATGGAAATCTTACCTTGTCCATTTTTGGCAATGTCATTTTTACTTTT GGTCTCAACCATATAGGATTCATATAAACCAATTATCATTATCAAATAATTCTTTTGATTTTTGGGGTTATCTTTCAAGTGTAT TACTAAATTCTTTGGCCGTAAGAAGTAAAATGCTAGAGTATTCATTTCTAATAGACACTGTTACTAAGAAATTCGATACTATA GTCCCAGTTATTCCTCTCATTGGGTCGTTGTCTAAAGCTAAATTTTGTAATGTATCTGGGCATCCCATTAGTAAGCCGA rbcLa

CAGGTGCTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAATATGAAACCAAAGATACTGATATC TTGGCAGCATTCCGAGTAACCCCACAACCTGGCGTTCCACCTGAAGAGGCAGGGGCCGCAGTAGCTGCCGAATCTTCTAC TGGTACATGGACAACTGTGTGGACTGATGGACTTACTAGCCTTGATCGTTACAAAGGACGCTGCTACCACATCGAGCCTGT TGCTGGGGAGGAAGATCAATATATTGCTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTA CTTCCATTGTGGGTAATGTATTTGGATTCAAAGCTCTACGAGCTCTACGCTTGGAGGATCTGCGAATTCCTCCTGCTTATTC CAAAACTTTTCAAGGTCCACCTCATGGAATCCAAGTTGAAAGAGATAAATTGAACAAATATGGGCGTCCTCTATTGGGATGT ACTATTAAACCAAAATTGGGATTATCTGCGAAAAACTACGGTAGAGCGGTTTATGAATG trnH-psbA

CCCTCTAGATCTGGCTGCTGTTGAAGCTCCATTTACAAACGGATAAGACTTCTTTTTAGTATATAGGAATTGTTGAGGTAGA ATAGAAATACCAAAACCTATTTAAAATAGGTTTTGGTATTTCTATTCTACCTTTATTTGACTCACTAAGGTATAATTCTTTTTCT ATTTGTATTTTTTTTTTACATTTTGAAGGTTGGTATATTATGTCCACTATTTCAATTCAGGTATAAAGGAAAAAGACTAAATCA AATAATGACGGGTCTACAAA

References:

Cholo, F., & Foden, W. 2006. Lagarosiphon muscoides Harv. National Assesment. Red List of South African Plants version 2013.1. Available online from http://redlist.sanbi.org/species.php?species=2051-5 [Accessed on 27 July 2013]. Henderson, L., & Cilliers, C.J. 2002. Invasive aquatic plants: a guide to the identification of the most important and potentially dangerous invasive aquatic and wetland plants in South Africa. PPRI Handbook No. 16. Agricultural Research Council, Pretoria.

Symoens, J.J., & Triest, L. 1983. Monograph of African Genus Lagarosiphon Harvey (Hydrocharitaceae). Bulletin van de National Plantentium Belgie 53: 441-488.

189

Ludwigia adscendens subsp. diffusa (Forssk.) P.H. Raven

Common name: Synonyms: Classification: Creeping ludwigia Ludwigia stolonifera (Guil & Perr.) P.H. Raven Class: Magnoliopsida Jussiacea diffusa Forssk Order: Myrtales Family: Onagraceae

Description:

Ludwigia adscendens subsp. diffusa is an aquatic herb with prostate or ascending purple red stems, with roots forming at the nodes. Plants are villous to glabrous. Leaves are dark green, 20-90 mm long and 5-17 (-23) mm wide, narrowly lanceolate to narrowly elliptical, bases narrowly cuneate and tips acute. Yellow flowers are borne in the upper axils of the leaves, with petals measuring 7-18 mm in length and 4-10 mm in diameter. Fruits are glabrous or villous capsules with 10 conspicuous dark brown ribs. Seeds are 1.1-1.3 mm long (Raven 1978).

A B

Fig. 25. (A) Flowers and leaves of creeping ludwigia and (B) fruits. Photographs: by T. Rebelo (http://www.ispot.org.za).

Native range:

Creeping ludwigia is native to Africa (Raven 1978).

190

Distribution in South Africa:

Fig. 26. Distribution of Ludwigia adscendens subsp. diffusa in South Africa.

Habitat:

This plants inhabit dams, ponds, and wetlands.

How is spreads:

Ludwigia adscendens subsp. diffusa spreads by producing seeds (Raven 1978).

Invasion category:

Environmental impacts:

Dense masses of creeping ludwigia can cause silting of shallow dams and disrupt boating and fish activities (Henderson & Cilliers 2002).

191

DNA barcodes: matK

TTTATTACGTTTCTTTCTCCACGAGTGTTGGAATAGTCTTATTACTCCAAAAAAAGATATTTCCTCTTTTTTAAAGGGTAATCC AAGATTATTCTTGTTCCTATATAATTCTCATGCATGTGAATACGAATGCATCTTCCTTTTTCTCCGTAATCAATCTTCTCATTT CCAGTCAACATCTTCTGGAGTCTTTTTTGAGCGAATATATTTCTATGTCAAAATAGAACATCTTGTTGAAGTTTTTTTTGATAA TGATTTTCGGGACATCCGATCCTTCTTCAAGGATCCTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAA AAGATACACCTCTTCTGATGAATAAATGGAAATATTACCTTGTCAATTTATGGCAATATCATTTTTCTGTGTGGTCTCAACCA GGAAGGATCGATATAAACCAATTATGCAAGTATTCTCTTGACTTTTTGGGCTATTTTTCAAACGTGCAACTAAATTCTTCAGT GGTACGAAGTCAAATGCTAGAAAATTCATTTATAATAAATAATGCTATGAAGAAGTTCGAAACAATAGTTCCCATTTTTCCTC TGATTGCATCGTTGTCGCAAGCGAAATTGTGTAATGCATTAGGACATCCCATTAGTAAGCCGACTCGGACTGANTCATCAG AT rbcLa

ATAGACTGACTTATTATACTCCTGAGTATGAAACCAAAGATAGTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGG AGTTCCGCCTGAGGAAGCAGGGGCTGCAGTAGCTGCTGAATCTTCTACTGGTACCTGGACAACTGTGTGGACCGATGGGC TTACCAGCCTTGATCGTTATAAAGGAAGATGCTACCACATCGAGCCTGTTGCTGGAGAAGAAAATCAATATATATGTTATGT AGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAG CCCTGCGCGCTCTACGTCTGGAGGATCTGAGAATCCCTCCTTCATATACTAAAACTTTCCAAGGACCGCCTCATGGTATCC AAGTTGAGAGAGATAAGTTGAACAAGTATGGCCGTCCTCTATTGGGATGTACTATTAAA trnH-psbA

TAACTTCCCTCTAGACCTAGCTGCTGTTGAAGCTCCATCTACAAATGGATAAGACTTCCGTCTTAGTGTAAGTGTATACGAG TTTTTGATTTGAAAATAAAGAAGCAATAATCAATACTCTTAATCTAACAAGAAATTGGTTATTGCTTCTTTATTTAGTCTTCTTT TATTTACATAAATTCGAATTTATTTACTTCAATATAGATATGAAAGTATATTCAGAAATAAATTGGGTTCTGATGAGTATCATA CTTTCGTTCTTATATTTATTTGAAATACTTTATTTTCTAATTGAAATACTTTTTCATTTTTCAAATAAATAATGAAAAAGAAATAT TATTAAATACTTTTCTTTGAATCGAAATATATATATTATATATGAATTGAATCGAAATATATGAATTGAATCGAAATATATTTAT TAAATATATAAACACATTATATAAATCCATGATTTTTAATCATTATTTCTTTTGTTTTGGGAAGGTATTTTAGACATAAAAAATG AGAGTTAAGGGG

References:

Raven, P.H. 1978. Ludwigia stolonifera (Guil. & Perr.) Raven [Family Onagraceae]. Flora of Zambesiaca 4: 329.

192

Myriophyllum aquaticum (Vell.) Verdc.

Common names: Synonyms: Classification: Brazilian water milfoil Enydria aquatica Vell. Class: Magnoliopsida Parrot’s feather Myriophyllum brasiliense Cambess. Order: Saxifragales Thread-of-life Family: Haloragaceae

Description:

Myriophyllum aquaticum is a submerged aquatic plant, rooted in sediment up to 1.5 m below the water surface with emergent shoots protruding 200-500 mm above the water surface (Cilliers 1999). Leaves are oblanceolate, 25-35 mm long with 25 to 30 pairs of linear pinnae, up to 7 mm long. Leaves are arranged in whorls of (4) 5-6. The inflorescence is an intermediate spike with flowers borne in the axils of the upper emergent leaves. Flowers are white, 0.4-0.5 mm long and 0.3 mm wide (Orchard 1979; Aiken 1981).

A B

Fig. 27. (A) Myriophyllum aquaticum plants and (B) dense infestion river in Limpopo Province. Photographs: by C.J. Cilliers (http://www.agis.agric.za).

Native range:

Myriophyllum aquaticum is native to South America (Cilliers 1999).

Distribution in South Africa:

Parrott’s feather is distributed throughout South Africa besides the Northern Cape Province.

193

Fig. 28. Distribution of Myriophyllum aquaticum in South Africa.

Habitat:

This plant grows in lakes, ponds, dams and rivers (Henderson & Cilliers 2002).

Uses:

Parrot’s feather is used in the removal of phosphorus and nitrogen from waste water treatments (Nuttall 1985). It is also an ornamental pond plant.

How it spreads:

In South Africa Myriophyllum aqauticum propagation is entirely vegetative as there are only female plants in the country (Cilliers 1999).

Invasion category:

This plant is listed on the Global Compendium of Weeds (http://www.hear.org/gcw/) as a weed in many countries. In South Africa, it is listed as a category 1b invader (NEM:BA 2004).

Environmental Impacts:

194

Myriophyllum aquaticum forms dense mats that disrupts stream flow, clogs irrigation canals, and interfering with agricultural activities and fishing culture. It also creates a breeding site for disease carrying mosquitos and snails (Guillarmod 1977).

DNA barcodes: rbcLa

TTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATTTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTC CACCCGAGGAAGCAGGGGCTGCTGTAGCAGCTGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACC AGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCTGTTGCTGGAGAAGAAAATCAATTTATTGCTTATGTAGCTT ATCCCTTAGACCTTTTTGAAGAAGGTTCCGTTACTAATATGTTTACTTCCATTGTGGGTAATGTATTTGGATTCAAAGCCCTG CGTGCTCTACGTCTGGAGGATCTGCGAATCCCTGTTGCTTATGTTAAAACTTTCCAAGGGCCGCCTCATGGTATCCAAGTT GAGAGAGATAAATTGAATAAGTATGGCCGCCCCCTATTAGGATGTACTATTAAACCTAAACTGGGGTTATCCGCTAAGAACT ATG trnH-psbA

TAATGCTCACAATTTCCCTCTAGACCTAGCTGCTGTTGAAGCTCCATCTACAAATGGATAAGACTTTTGTCTTAGTGTATACG AGTTAAATAAAATAAAGGAGAAATACCAAAACTCTTGATAAAACAAGAAATTGAGTATTTCTCCTTTATTTTATTTAAAAGCAT TTTTACTTATTAAAAGTATTTTTACTTAGAATTACGTATTCTTATTAGAGAATTACTTAGAATTTTAGTCTTTTCTTAGAATTTTT TATTCTATTTTTTTCTTACAACTAAAGAAAAGTCGTTGTAGTGTTATTACATGATATGGTTTGATTTTTTTCTTGTTTTTGTTAT TTTTATTCCAAAATAACAAAAAGAAAAATTAGGGGCGGATGTAGCCAA

References:

Aiken, S.G. 1981. A conspectus of Myriophyllum (Haloragaceae) in North America. Brittonia 33 (1): 57- 69.

Cilliers, C.J. 1999. Biological control of parrot’s feather, Myriophyllum aquaticum (Vell.) Verdc. (Haloragaceae), in South Africa. African Entomology 1: 113-118.

Guillarmod, J.A. 1977. Myriophyllum, an increasing water menace for South Africa. South African Journal of Science 73: 89-90.

NEM:BA. 2004. National Environmental Management: Biodiversity Act (No. 10 of 2004). Government Gazette No. 32090, 3 April 2009. Department of Environmental Affairs and Tourism, Pretoria.

Nuttall, P. M. 1985. Uptake of phosphorus and nitrogen by Myriophyllum aquaticum (Velloza) Verd. growing in a wastewater treatment system. Marine and Freshwater Research 36 (4): 493- 507.

195

Orchard, A.E. 1979. Myriophyllum (Haloragaceae) in Australia. 1. New Zealand: A revision of the genus and a synopsis of the family. Brunonia 2 (2): 247-287.

196

Myriophyllum spicatum L.

Common names: Synonyms: Classification: Eurasian water milfoil Myriophyllum spicatum var. capillaceum Lange Class: Magnoliopsida Spike water milfoil Myriophyllum spicatum var. muricatum Maxim. Order: Saxifragales Family: Haloragaceae

Description:

Myriophyllum spicatum is a submerged aquatic plant growing up to 7 m long in water that are 1-3 m deep. Leaves are 15-40 mm long, usually in whorls of 4 (-5-6), with 14-24 pairs of linear pinnae. The inflorescence is a terminal spike, 150-200 mm long, held above the water surface. Flowers are reddish pink, arranged in 4-flowered whorls along the spike. Fruit are four-lobed, and splits into four nutlets (Aiken et al. 1979).

A B

Fig. 29. (A) Myriophyllum spicatum plant and (B) leave arrangement in M. spicatum. Photographs: (A) by L. Henderson (http://www.agis.agric.za) and (B) by M.J. Wells (http://www.agis.agric.za).

Native range:

Myriophyllum spicatum is indigenous to Europe, Asia and North Africa (Eiswerth et al. 2000).

Distribution in South Africa:

This plant is prohibited in South Africa (NEM:BA 2004) but is illegally sold in the aquarium trade. It has invaded a number of water bodies in South Africa.

197

Fig. 30. Distribution of Myriophyllum spicatum in South Africa.

Habitat:

Eurasian water milfoil grows in slow-moving rivers streams, dams and ponds (Eiswerth et al. 2000).

Uses:

This submerged macrophyte is used to remove heavy metals such as zinc, copper and lead from wastewater treatments (Keskinkan et al. 2003). It is also a popular aquarium plant.

How it spreads:

Myriophyllum spicatum reproduces sexually and vegetatively through stem fragmentation. Seeds and fragments are dispersed by water (Aiken et al. 1979).

Invasion category:

This plant is listed on the Global Compendium of Weeds (http://www.hear.org/gcw/) as a weed in many countries. In South Africa, it is listed as a category 1b invader (NEM:BA 2004).

198

Environmental Impacts:

This plant reduces water quality by reducing dissolved oxygen, nutrients and water temperature. It increases the prevalence of disease-carrying mosquitos and snails. It also alters native aquatic plant communities and threatens animals, which depend on those communities (Eiswerth et al. 2000).

DNA barcodes: rbcLa

CAAGTGTTGGATTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATT TTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCCGAGGAAGCAGGGGCTGCTGTAGCAGCTGAATCTTCTAC TGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCTGT TGCTGGAGAAGAAAATCAATATATTGCTTATGTAGCTTATCCCTTAGACCTTTTTGAAGAAGGTTCGGTTACTAATATGTTTA CTTCCATTGTGGGTAATGTCTTTGGATTCAAAGCCCTGCGTGCTCTACGTCTGGAGGATCTGCGAATCCCTGTTGCTTATG TTAAAACTTTCCAAGGGCCGCCTCATGGTATCCAAGTTGAGAGAGATAAATTGAATAAGTATGGCCGCCCCCTATTAGGAT GTACTATTAAACCTAAACTGGGGTTATCCGCTAAGAACTAT trnH-psbA

ATGGATAAGACTTTTGTCTTAGTGTATACGAGTTTTTGAAAATAAAGGAGCAATACCAAAACTCTTGATAAAACAAGAAATGG AGTATTGCTCCTTTATTTTATTTAATATTCTTTTTATTTATAAATACGTATTTTATTTAGAATTACTTTTTCTTATTAGAGAATTC ATTCCAATTTTTGTCTATTCTCAGAATTATTTTATTCTATTTTTTTCTTCCAACTAATGAAACGTAGTTGTAGTGTTATTACATG ATATGATTTGATTTTTTTTCTTGTTTTTGTTATTTTTATTCCAAAATAACAAAAAGAAAAATTAGGGGCGGATGTAGCCAA

References:

Aiken, S.G., Nowroth, P.R., & Wille, I. 1979. The biology of Canadian weeds 34. Myriophyllum spicatum L. Canadian Journal of Plant Science 59: 201-215.

Eiswerth, M.E., Donaldson, S.G., & Johnson, W.S. 2000. Potential environmental impacts and economic damages of the Eurasian water milfoil (Myriophyllum) in Western Nevada. Weed Technology 14: 511-518.

Keskinkan, O., Goksu, M.Z.L., Yuceer, A., Basibuyuk, M., & Forster, C.F. 2003. Heavy metal absorption characteristics of a submerged aquatic plant (Myriophyllum spicatum). Process Biochemistry 31(2): 179-183.

NEM:BA. 2004. National Environmental Management: Biodiversity Act (No. 10 of 2004). Government Gazette No. 32090, 3 April 2009. Department of Environmental Affairs and Tourism, Pretoria.

199

Nasturtium officinale R.Br.

Common name: Synonyms: Classification: Watercress Nasturtium nasturtium-aquaticum (L.) H. Karst. Class: Magnoliopsida Rorippa nasturtium-aquaticum (L.) Hayek Order: Brassicales Cardamine nasturtium-aquaticum (L.) Borbás Family: Brassicaceae

Description:

Nasturtium officinale is an erect or creeping aquatic herb with hallow and much branched stems growing up to 1 m long. Leaves are pinnate, glabrous with slightly sinuate margins. Inflorescences are short racemes with small white flowers, 6 mm in diameter. Fruits are cylindrical brown, 2-valved pods that are slightly curved upwards (Howard & Lyon 1952).

Fig. 31. Nasturtium officinale fruit and flowers Photograph: by B. Di Gregorio (http://www.plant- identification.co.uk).

Native range:

Nasturtium officinale is native to Western Asia, India, Europe, and Africa (Baker 2009).

Distribution in South Africa:

Watercress is distributed throughout South Africa, except for the Northern Cape Province.

200

Fig. 32. Distribution of Nasturtium officinale in South Africa.

Habitat:

Watercress grows in fast flowing, nutrient rich but clear streams and rivers (Henderson & Cilliers 2002).

Uses:

Nasturtium officinale is used as a medicinal plant for the treatment of colds, bronchitis, anaemia, and thyroid disturbances (Di Stasi et al. 2002). It is edible as a salad rich in carotenoids, glucosinolates, vitamins and minerals (Di Stasi et al. 2002; Kopsell et al. 2007; Baker 2009).

How it spreads:

Watercress reproduces sexually and vegetatively through stem fragmentation. Seeds are dispersed by water, snails, insects, birds, and cows (Baker 2009).

Invasion category:

This plant is listed on the Global Compendium of Weeds (http://www.hear.org/gcw/) as a weed in many countries. In South Africa, it is listed as a category 2 invader (NEM:BA 2004).

Environmental Impacts:

201

Watercress is an ecosystem engineer that alters water flow, which might result in flooding (Baker 2009). It also outcompetes native riverbank species, obstructs access to water ways, and threatens aquatic biodiversity (Henderson & Cilliers 2002).

DNA barcodes: matK

TTGGTTCAAATCCTACGTTACCGGGTAAAAGATGCCTCTTCTTTGCATTTTTTTCGGTTCTGTCTATACGAGTATTGCAATTG TAAGAATTTTTATATTAAAAAAAAATCAATTTTGAATCCAAGATTTTTCTTGTTCTTATATAATTCTCATGTATGTGAATACGAA TCCATCTTTTTTTTTCTACGCAAGCGGTCTTCGCATTTACGATCGATATCTTATAAAGTCCTTTTTGAGCGAATTTTATTCTAT GGAAAAATACAACATTTTTTTAAAGTCTTTGTTAATAACTTTCCGGCAATCCTAGGGTTGCTCAAGGATCCTTTCATACATTA TGTTAGATATCACGGAAGATCCATTCTGGCAACAAAGGATACGCCGCTTCTGATGAATAAATGGAAATATTATTTTGTTAATT TATGGCAATGTTATTTTTCCGTATGGTTTCAATCGCAAAAGGTGAATATAAATCAATTATCTAAAGATAATTTAGAGTTTCTGG GTTATCTGTCAAGTTTACGATTAAACCCTTTAGTGGTACGTAGTCAAATGCTAGAAAACGCATTTCTAATACATAATGTTAGA ATCAAATTGGATAGCATAATTCCAATGTCTTCTATTATTGGATCATTGGCTAAAGATAAATTTTGTAATGTATTAGGGCATCC CATTAGTAAAGCGATCTGGACGGATTCATCAGATTCTGATATTCTCAACCGATTTGTGCGTATATGCAGAAATATTTCTCATT ATTACAGCGGATCTTCACAAAAAAAAAATTTGTATCGAATAAAATATATACTTCGTCTTT rbcLa

AATGTTGGATTCAAAGCTGGTGTTAAAGAGTATAAATTGACTTATTATACTCCTGAATATGAAACCAAGGATACTGATATCTT GGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCTGAAGAAGCAGGGGCTGCGGTAGCTGCTGAATCTTCTACTG GTACATGGACAACTGTGTGGACCGACGGGCTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTT CCAGGAGAAGAAACTCAATTTATTGCGTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCGGTTACTAACATGTTTA CCTCGATTGTGGGTAATGTATTTGGGTTCAAAGCCCTGGCTGCTCTACGTCTAGAGGATCTGCGAATCCCTCCTGCTTATA CTAAAACTTTCCAGGGACCACCTCATGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGACGTCCCCTATTAGGATG TACTATTAAACCAAAATTGGGGTTATCCGCGAAGAACTATGGTAGAGCAGTTTATGAATGTCTA

References:

Barker, D.J. 2009. Pacific Northwest Aquatic Invasive Species Profile: Nasturtium officinale (watercress). Available online from: http://depts.washington.edu/oldenlab/wordpress/wp- content/uploads/2013/03/Nasturtium-officinale_Barker.pdf [Accessed 20 June 2013].

Di Stasi, L.C., Oliveira, G.P., Garvelhaes, M.A., Queiroz-Junior, M., Tien, O.S., Kakinam, S.H., & Reis, M.S. 2002. Medicinal plants popularly used in Brazil. Tropical Atlantic Forest Fitoterapia 7 (1): 69-91.

Howard, H.W., & Lyon, A.G. 1952. Nasturtium officinale R. Br. (Rorripa nasturtium-aquaticum (L.) Hayek). Journal of Ecology 40 (1): 228-245.

202

Kopsell, D.A., Barickma, T.C., Sams, C.E., & McElroy, J.S. 2007. Influence of nitrogen and sulfur on biomass production and carotenoid and glucosinolate concentration in watercress (Nasturtium officinale R. Br.). Journal of Agriculture and Food Chemistry 55: 10628-10634.

NEM:BA. 2004. National Environmental Management: Biodiversity Act (No. 10 of 2004). Government Gazette No. 32090, 3 April 2009. Department of Environmental Affairs and Tourism, Pretoria.

203

Nymphaea mexicana Zucc.

Common names: Synonyms: Classification: Mexican water lily Castalia mexicana (Zucc.) J.M.Coult. Class: Magnoliopsida Banana water lily Nymphaea flava Leitn. Order: Nymphaeales Yellow water lily Family: Nymphaeaceae

Description:

Nymphaea mexicana is a perennial aquatic herb rooted to the sediment, with leaf blades and flowers above the water surface (Henderson & Cilliers 2002). Rhizomes are erect, banana-shaped and uniformly covered with hairs. Leaves are ovate to elliptic, with margins entire or sinute. Leaves are 70- 180 (-270) mm long, 70-180 mm wide, green adaxially, with dark blotches when young, and purplish with dark blotches abaxially. Flowers are yellow and 60-110 mm in diameter. Seeds are 5x5 mm and covered with hair-like papillae (Capperino & Schneides 1985).

A B

Fig. 33. (A) Nymphaea mexicana flower and (B) dense infestation of watercourse in Gauteng Province. Photographs: (A) by K. Qvist (http://www.flickr.com).

Native range:

Nymphaea mexicana is native to Mexico and Northern America (Henderson & Cilliers 2002).

204

Distribution in South Africa:

Fig. 34. Distribution of Nymphaea mexicana in South Africa.

Habitat:

Yellow water lily grows in rivers, streams, ponds and dams (Henderson & Cilliers 2002).

Uses:

Nymphaea mexicana is a medicinal plant with anti-inflammatory properties (Hsu et al. 2013). It is also used as an ornamental pond plant.

How it spreads

This floating macrophyte reproduces only vegetatively by stolons. Young plants are easily detached and dispersed elsewhere by water currents (Henderson & Cilliers 2002).

Invasion category:

This plant is listed on the Global Compendium of Weeds (http://www.hear.org/gcw/) as a weed in many countries. In South Africa, it is listed as a category 1b invader (NEM:BA 2004).

Environmental Impacts:

205

Nymphaea mexicana causes silting of shallow dams and blocks waterways (Henderson & Cilliers 2002).

DNA barcodes: matK

TTCTTTGCATTTATTGAGATGTTTTCTACACGAGCATCATAATTGGAATAGCCTTATTACTTCAAATAAATCCATTTCCAATTT TTCAAAGGAAAATCAAAGATTATTCTTGTTCTTGTATAATTCTCATGTATATGAATGCGAATCCGTATTAGTTTTCCTTCGTAA ACAATCCTCTCATTTACGGTCAATATCTTCTCTAGCCTTTCTTGAGAGAACACATTTTTATGGAAAAATAAAACATCTTGTAGT GACGCCTCGTAATGATTCTCAAAGGACCCTGCCCCTCTGGTTCTTCAAGGAACCCTTGATGCATTATGTTAGGTATCAAGG AAAATCAATTATGGCTTCAAGGTGTACTAATTTACTGATGAAGAAATGGAAATATTACCTTGTCAATTTCTGGCAATGTCATT TTCACTTATGGTCTCAACCGGGTAGGATCCATATAAATGAATTATCCAATCATTCTTTCTATTTTCTGGGCTATCTTTCAGGT GTACGACTAACGCCTTGGGTGATAAGGAGTCAAATGCTAGAGAGTTCATTTATGATCGATACTGCTATTAAGAGATTCGATA CAATAGTCCCAATTTTTCCTCTGATTGGATCGTTGGTTAAAGCTAAATTCTGTAACGTATCAGGGTATCCTATTAGTAAGTCA GTCTGGGCCGATTCGTCGGATTCTGATATTATTGCTCGATTCGGGTGG rbcLa

AAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGATTACAGATTGACTTATTACACTCCTGAGTATGAAACCCTTGCTACTG ATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAGGAAGCAGGAGCTGCGGTGGCTGCCGAATCT TCCACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAG CCTGTTGCTGGGGAAGAAAATCAATATATTGCTTATGTAGCTTACCCTTTGGACCTTTTTGAAGAAGGTTCTGTTACTAACAT GTTTACTTCCATCGTGGGTAATGTATTTGGGTTCAAAGCCCTACGAGCTCTACGTCTGGAGGATCTGAGAATTCCTCCTGC TTATTCTAAAACTTTCCAGGGCCCACCTCATGGAATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTG GGATGTACTATTAAACCAAAATTGGGGTTATCTGCAAAGAACTA trnH-psbA

AATACTTTGATGTCAGTGTATACGAGTCGTTGAAGGAACAATACCCAACCTCTTGGTTGGGTATTGTTCCGTTCTATTCAGT CACGTTTTACTCACATGATGATTCCATCCTAATCTCTTTCCTTCACAAAAATAGAATCTAAATAAATAAATAAATACAGCAAGC AGCATTTCCGCTGCGTGGTTCATCGTTGCCGAGTGACCTATTTTCGCTATGTACTAATTATGTACTAATATTAATATATATGT ACTAAACTCATATATAATTATAATCAATTCCACAACCACAAAATCGTTTTACTTCTTTATTGTTAATTGTTACGGGGTTGGCCT CTTATGACAAGGGATATAAGATAGAAATAATTCTATCTCGGCGCAAAGAAAAAGAGAGTAAGAAAGAAGAGTCTATGATGAA GGCTAAAACGAAATATGACATGACTCTTAATTGAGTCAGAGTAGGGGCGGATGTAGCCAAG

References:

Capperino, M.E., & Schneides, E.L. 1985. Floral biology of Nymphaea mexicana Zucc. Aquatic Botany 23: 83-93.

Hsu, C.L., Fang, S.G., & Yen, G.C. 2013. Anti-inflamatory effects of phenolic compound isolated from flowers of Nymphaea mexicana Zucc. Food Function. DOI: 10.1039/03F060041F.

NEM:BA. 2004. National Environmental Management: Biodiversity Act (No. 10 of 2004). Government Gazette No. 32090, 3 April 2009. Department of Environmental Affairs and Tourism.

206

Nymphaea nouchali caerulea Burm.f. var. (Savigny) Verdc.

Common names: Synonyms: classification: Blue water lily Nymphaea caerulea Savigny Class: Magnoliopsida Blue lotus Nymphaea calliantha Conrad Order: Nymphaeales Nymphaea mildbraedii Ciilg Family: Nymphaeaceae Nymphaea nelsonii Burtt Davy

Description:

Nymphaea nouchali var. caerulea is a perennial aquatic herb with floating leaves growing from a 1 m long tuberous rhizome. Leaves are round or oval with crenate margins, slightly rolled upwards and up to 400 mm in diameter. Flowers are star-like with four sepals that are green on the outside and white to blue on the inside. Petal are numerous, blue and 150-200 mm in diameter when open. Fruits are green, ovate to pear-shaped with numerous ellipsoidal seeds, 1.2 x 0.8 mm, with each seed covered by a membranous aril (Viljoen & Notten 2002).

Fig. 35. Nymphaea nouchali var. caerulea. Photograph: by M. Hyde (http://www.zimbabweflora.co.zw).

Native range:

This plant is native to Africa (Hyde et al. 2013).

207

Distribution in South Africa:

Nymphaea nouchali var. caerulea

Fig. 36. Distribution of Nymphaea nouchali var. caerulea in South Africa.

Habitat:

Blue lotus grows in still to slow moving waters in ponds, dams and rivers (Henderson & Cilliers 2002).

Uses:

This plant is used as an ornamental pond plant.

How it spreads:

Blue lotus reproduces by seeds and rhizome fragments (Viljoen & Notten 2002).

Invasion category:

Environmental Impacts:

208

Dense mats of blue lotus can result in silting of shallow dams and also disrupt boating and fishing activities (Henderson & Cilliers 2002).

DNA barcodes: matK

TTTATTGAGATGTTTTCTACACGAGCATCATAATTGGAATAGCCTTATTACTTCAAATAAATCCATTTCCATTTTTTCAAAGGA AAATCAAAGATTATTCTTGTTCTTGTATAATTCTCATGTATATGAATGCGAATCCGTATTAGTTTTCCTTCGTAAACAATCCTC TCATTTACGGTCAATATCTTCTCTAGCCTTTCTTGAGAGAACACATTTTTATGGAAAAATAAAACATCTTGTAGTGACGCCTC GTAATGATTCTCAAAGGACCCTGCCCCTCTGGTTCTTCAAGGAACCTTTGATGCATTATGTTAGGTATCAAGGAAAATCAAT TATGGCTTCAAGGTGTACTAATTTACTGATGAAGAAATGGAAATATTATCTTGTCAATTTCTGGCAATGTCATTTTCACTTAT GGTCTCAACCGGGTAGGATCCATATAAATGAATTATCCAATCATTCTTTCTCTTTTCTGGGCTATCTTTCAGGTGTACGACTA ACGCCTTGGGTGATAAGGAGTCAAATGCTAGAGAATTCATTTATGATCGATACTGCTATTAAGAGATTCGATACAATAGTCC CAATTTTTCCTCTGATTGGATCGTTGGTTAAAGCAAAATTCTGTAACGTATCAGGGTATCCTATTAGTAAGTCAGTCT rbcLa

CCGACAGAGACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGATTACAGATTGACTTATTACACTCCTGATTATGAAA CCCTTGCTACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAGGAAGCAGGAGCTGCGGTG GCTGCCGAATCTTCCACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGACGATG CTACCACATCGAGCCTGTTGCTGGGGAGGAAAATCAATATATTGCTTATGTAGCTTATCCTTTGGACCTTTTTGAAGAAGGT TCTGTTACTAACATGTTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCCCTACGAGCTCTACGTCTGGAGGATCTGA GAATTCCTCCTGCTTATTCTAAAACTTTCCAGGGCCCACCTCATGGAATCCAAGTTGAGAGAGATAAATTGAACAAGTATGG TCGTCCCCTATTGGGATGTACTATTAAACCAAAATTGGGGTTATCCGCAAAGAACTATGGGAGAGCGGTTTATGAGT trnH-psbA

TGGATAATACTTTGATGTCAGTGTATACGAGTCGTTGAAGGAACAATACCCAACCAAGAGGTTGGGTATTGTTCCGTTCTAT TCAGTCACGTTTTACTCATATGATGATTCCATTCTAATCTCTTTCCTTCACAAAAATCTAATCTAAATAAATACAGCAAGCAGC ATTTCCGCTGCGTGGTTCATTGTTGCCGAGTGACCTATTTTCACTATGTACTATGTACTAAACTCATATATAATTATAATAAAT TCCACAAAATCGTTTGACTTCTTTATTGTGAATTGTTAGTGTTACGGGGTTGGCCTCTTATGACAAGGGATATAACAGATAAA TAATTATCTCTCGGCCTCGGCGCAAAGAAAAGGAGAGTCAGAAAGAAGAGTCTATGATGAAGGCTAAAACGAAATA

References:

Hyde, M.A., Wursten, B.T. & Ballings, P. 2013. Flora of Zimbabwe: Species information: Nymphaea nouchali var. caerulea. Available online from: http://www.zimbabweflora.co.zw/speciesdata/species.php?species_id=123460 [Acccessed 28 July 2013].

Viljoen, C. & Notten, A. 2002. Nymphaea nouchali var. caerulea. Available online from: http://www.plantzafrica.com/plantnop/nouch.htm [Accessed 28 July 2013].

209

Nymphoides brevipedicellata (Vatke) A. Raynal

Common name: Synomyms: Classification:

Water snowflake Limnanthemum brevipedicellatum Vatke Class: Magnoliopsida

Order: Asterales

Family: Menyanthaceae

Description:

Nymphoides brevipedicellata is an aquatic, floating herb that is glabrous but covered with stellate hairs in certain parts of the plant depending on the depth of the water. Leaves are orbicular to ovate- orbicular, 20-60 mm in diameter, with margins entire, crenate or denute, and petioles up to 50 mm long. Flowers are white with yellow tubes and feathery margins. Fruit are capsules with seeds densely to minutely tuberculate (Roux 2003).

A B

Fig. 37. (A) Nymphoides brevipedicellata flower and (B) plants. Photographs: by R. Pipiens (http://www.flickriver.com).

Native range:

This plant is native to tropical Africa, India, south-east Asia, Australia, New Zealand and South Africa (Roux 2003).

210

Distribution in South Africa:

Fig. 38. Distribution of Nymphoides brevipedicellata in South Africa.

Habitat:

Water snowflake grows in rivers, wetlands, and pools.

Uses:

Nymphoides brevipedicellata is a medicinal plant used in the treatment of headaches, rheumatism, and scabies (Panda & Misra 2011). It is also an ornamental pond plant.

How it spreads:

This plant reproduces by seed and vegetatively from tursions (Shibayama & Kadono 2007).

Invasion category:

Environmental Impacts:

211

Dense mats of Nymphoides brevipedicellata can result in silting of shallow dams and also disrupt boating and fishing activities (Henderson & Cilliers 2002).

DNA barcodes: matK

TTTCTTACGAGTATCATAATTGGAATAGTCTTATTACTTCAAAGAAAGCTTTTTTAAATTCAAAAACAAATCAAAGACTGTTTT TTTTCCTATATAATTTTCATGTATGTGAATACGAATCCATCTTTGTCTTTCTCCGTAATCAATCTTCTTATTTACGATCAACATC TTCTGGAGCCCTTCTTGCACGAATATATTTCTATAGAAAAATAGAACATCTTGTAGAAGTTTTTCCCAGGCCTTTTCAAGTCA GTCTATGGTTATTTAAGGATCCTTTCATGCATTATGTTAGGTATCAAGGAAAATCGATTCTTGCATCAAAAGGAACGTCTCTT TTGATAACTAAATGGAAATCTTTTTTTGTAAATTTCTGTCAATGTTATTTTTACCTGTGGTCTCAACCAGGAAGGATTCATATA AACCAATTATCCAACCATTCGGTTGACTTTATGGGTTATCGTTCAGGTGTGCGGCTAAAGCCTTCAATGATACGTAGTCAAA TGCTACAAAATTCATTTCTAATTGATAATACTATTACGAAGTTTGATATTATTGTTCCAATTATGCCAATCATTAGATCATTGG CTAAAGCGAAATTTTGTAACGTATTAGGGCATCCGATTGGTAAGTCGG rbcLa

AGAGACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAATATGAAACCAAG GAGACTGATATCTTAGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAGCAGGGGCCGCAGTAGCAGC CGAATCTTCTACCGGTACATGGACAACTGTGTGGACCGATGGACTTACAAGCCTTGATCGTTACAAAGGGCGATGCTATTT CATCGAGCCCGTTCCTGGAGAAGACAATCAATATATATGTTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTT ACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGGGTTCAAAGCCCTGCGTGCTCTACGTTTGGAAGATTTGCGAATTC CGATTGCGTATGTTAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTC CGCTGTTGGGATGTACTATTAAACCTAAATTAGGTTTATCTGCTAAAAACTACGGTAGAGCTGTTTATGAATGTCT trnH-psbA

TCTTAGTGTATATGAGTTTTTGAACTAAATCAAAATTCAATTTAAATAAAGGAGCAATAGCCTCTTTCTTGTTCTATCAAGAGG GCGTTATTGCTCCTTTATTTATTTAGTAGTATTTGATCTTAGTATTTAACTTTATTTAACTTCCATAGTTTTTTTATTATAAAAAT AATATTTTTATAGATTGTTTCGATTCTTGTGCTTTCGTTTCATAATAATTTTTATTTTATATTATAGGTTTATTATATATTTATATA TACTCTTCTCAATCTTTTGTGAAGTTTTATTTTCTTTTCAATATAAAATTCAATATAAAATATATATATAATATAAATAAATATTT TTAAATATTTTTCTTACTTATATTTTATAAAATAAAATAGAAATAAATCGTATATTTTTTATTTGATATATTTTATATAAAAATATA CTACTTATTATTTATATCTATTTATATATA

References:

Panda, A., & Misra, M.K. 2011. Ethnomedical survey of some wetland plants of South Orissa and their conservation. Indian Journal of Traditional Knowledge 10 (2): 296-303.

Roux, J.P. 2003. Nymphoides indica (L.) Kruntze. [Family Menyanthacea]. Flora of South Africa. Available online from: http://plants.jstor.org/taxon/specimens/Nymphoides.indica [22 July 2013].

212

Shibayama, Y., & Kadono, Y. 2007. Reproductive success and genetic structure of population of heterosylous aquatic plant Nymphoides indica (L.) Kuntze (Menyantaceae). Aquatic Botany 86 (1): 1-8.

213

Nymphoides indica (L.) Kuntze

Common name: Synonym: Classification: Floating heart Nymphoides thunbergiana Kuntze Class: Magnoliopsida Order: Asterales Family: Menyanthaceae

Description:

Nymphoides indica is a perennial, free-floating, stoloniferous aquatic herb. Leaves are subcircular, and 30-100 mm in diameter. Flowers are yellow, on erect pedicles that are 25-80 mm long. Petals have feathery margins. Fruits are ovoid capsules that are about 5 mm in diameter. Seed are 1.6-2.2 mm long (Mackinder 1990; Hyde et al. 2013).

A B

Fig. 39. (A) Nymphoides indica flower and (B) plants covering water surface. Photographs: by T. Phago

Native ranges:

Floating heart is native to southern Africa and Madagascar (Mackinder 1990).

214

Distribution in South Africa:

Nymphoides indica

Fig. 40. Distribution of Nymphoides indica in South Africa.

Habitat:

This plant grows in pools, wetlands, streams and rivers.

Uses:

Nymphoides indica is an ornamental pond plant.

How it spreads:

Floating hearts reproduce by seed and stolon fragments (Aubrey & Dlamini 2003).

Invasion category:

Environmental Impacts:

215

Floating hearts can cover water surfaces, disrupting fishing and boating activities (Henderson & Cilliers 2002).

DNA barcodes: matK

TATTACTTCAAAGAAAGCTTTTTTAAATTCAAAAAAAAATCAAAGACTGTTTTTTTTCCTATATAATTTTCATGTATGTGAATAC GAATCCATCTTTGTCTTTCTCCGTAATCAATCTTCTTATTTACGATCAACATCTTCTGGTGCCCTTCTTGCACGAATATATTTC TATAGAAAAATAGAACATCTTGTAGAAGTTTTTCCCAGGCCTTTTCAAGTCAGTCTATGGTTATTTAAGGATCCTTTCATGCA TTATGTTAGGTATCAAGGAAAATCGATTCTTGCATCAAAAGGAACGTCTCTTTTGATAACTAAATGGAAATCTTTTTTTGTAAA TTTCTGTCAATGTTATTTTTACCTGTGGTCTCAACCAGGAAGGATTCATATAAACCAATTATCCAACCATTCGGTTGACTTTA TGGGTTATCGTTCAGGTGTGCGGCTAAAGCCTTCAATGATACGTAGTCAAATGCTACAAAATTCATTTCTAATTGATAATACT ATTACGAAGTTTGATATTATTGTTCCAATTATGCCAATCATTAGATCATTGGCTAAAGCGAAATTTTGTAACGTATTAGGGCA TCCGATTGGTAAGTCGG rbcLa

CTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAATATGAAACCAAGGAGACT GATATCTTAGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAGCAGGGGCCGCAGTAGCAGCCGAATC TTCTACCGGTACATGGACAACTGTGTGGACCGATGGACTTACAAGCCTTGATCGTTACAAAGGGCGATGCTATTTCATCGA GCCCGTTCCTGGAGAAGACAATCAATATATATGTTATGTAGCTTACCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACA TGTTTACTTCCATTGTAGGTAATGTATTTGGGTTCAAAGCCCTGCGTGCTCTACGTTTGGAAGATTTGCGAATTCCGATTGC GTATGTTAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGTCGTCCGCTGTT GGGATGTACTATTAAACCTAAATTAGGTTTATCTGCTAAAAACTACGGTAGAGCTGTTTATGAATGTCTTCGAGG trnH-psbA

AATTTCCCTCTAGACTTAGCTGCTATCGAAGCTCCATCTACAAATGGATAAGATAAGACTTGGGTCTTAGTGTATATGAGTTT TTGAACTAAATCAAAATTCAATTTAAATAAAGGAGCAATAGCCTCTTTCTTGTTCTATCAAGAGGGCGTTATTGCTCCTTTATT TATTTAGTAGTATTTGATCTTAGTATTTAACTTTATTTAACTTCCATCGTTTTTTTATTATAAAAATAATATTTTTATAGATTGTT TCGATTCTTGGGCTTTCGTTTCATAATAATTTTTATTTTATATTATAGGTTTATTATAGGTTTATATATACTCTTCTCAATCTTTT GTGAAGTTTTATTTTCTTTTCAATATAAAATTCAATATAAAATATATATATAATATAAATAAATATTTTTAAATATTTTTCTTACTT ATATTTTATAAAATAAAACAGAAATAAATCGTATATTTTTTATTTGATATATTTTATATAAAAATATACTACTTATTATTTATATCT ATTTATATATACTAAATAAGTATATAGTAGATATATAG

References:

Aubrey, A., & Dlamini, M.D. 2003. Nymphoides thunbergiana (Griseb.) Kuntze. Available online from: http://www.plantzafrica.com/plantnop/nymphthunber.htm [Accessed 19 June 2013].

Hyde, M.A., Wursten, B.T. & Ballings, P. 2013. Flora of Zimbabwe: Species information: Nymphoides thunbergiana. Available online from: http://www.zimbabweflora.co.zw/speciesdata/species.php?species_id=144890 [Accessed 28 July 2013].

216

Mackinder B. 1990. Nymphoides thunbergiana Griseb. Kuntze [Family Menyantheacea]. Flora Zambesiaca 7 (4): 51.

217

Persicaria lapathifolia (L.) H.Gross

Common names: Synonyms: Classification: Pale knotweed Dioctis maculatum Raf Class: Magnoliopsida Pale smart weed Persicaria lapathifolia (L.) Gray Order: Caryophyllales Polygonum lapathifolia L. Family: Polygonaceae

Description:

Persicaria lapathifolia is an erect, emergent aquatic plant, growing up to 1 m tall. Stems are often reddish, usually glabrous and often with scattered sessile glands. Leaves are 60-120 mm long, 10-45 mm wide, with glands dense on the lowers surface and scattered on the upper surface. Leaves are ovate to narrow-elliptic in shape with the veins and margins pubescent and occasionally tomentose. Inflorescences are elongate-cylindrical spikes, measuring 25-60 mm in length and 4-7 mm in diameter, with dense and overlapping flowers. Perianth segments are greenish white to pink, 1.5-2.7 mm long. Fruits are brown, 1.5-2 mm long and 1.2-1.7 mm in diameter (Wilson 1990).

Fig. 41. Persicaria lapathifolia. Photograph: by T. Phago

Native range:

This species has a more or less cosmopolitan distribution (Lansdow 2013).

218

Distribution in South Africa:

Fig. 42. Distribution of Persicaria lapathifolia in South Africa.

Habitat:

Pale knotweed inhabits muddy habitats, lakes, reservoirs and rivers (Lansdown 2013).

Uses:

Persicaria lapatifolia is a medicinal plant with anti-compliment activities (Park et al. 1999).

Invasion category:

This plant is listed on the Global Compendium of Weeds (http://www.hear.org/gcw/) as a weed in many countries. In South Africa, its invasion category has not yet been declared (AGIS 2007).

How it spreads:

Persicaria lapathifolia spreads by seeds (Wilson 1990).

DNA barcodes: matK

GCATTTATTGCGATTCTTTCTTTATGAGTATTGTAATAGTGTTATTACTCTAGAGAGATCTGTTTCACAAAATCCGAATAAAAG ATTCTTTTTGTTCTTATATAATTCCTATGTGTGGGAATGCGAATCCATCTTCGTTTTTCTCCGGAACCAATCCTCTCATTTACG ATCAACATCTTACGGCGCCCTTCTTGCACGAGTCTATTTCTACCGAAAGTCAGAAGATTTTGTAAAAGTATTTACTAAGCATT

219

TTCGGGTTATACTTTGGTTCTTCAAAGATCCTTTTCTGCATTATGTTAGGTATCAAGGAAAATGGATTCTGGCTTCAAGGGG TACATTTTTTCTGATGACTAAATGGAAATATTACTTTGTCAATCTCTGGCAATGTACTTTTTCTCTATGGTTGCAACCAAGAAG AATCTATATCAATCGATCACCAAATCAGCCCATTGACTTTTTGGGTTTTCTTTTAAGTGTGCGACTAAATACGTGCGTGGTAC GAAGTCAAATGTTAGAAAATGCATTCTTAATAGATAATGGTATAAAGAAGTTTGAGACCCTAGTTCCAATTATGCCTCTGGTT GGATCATTGGCTAAAGCGAAATTTTGTAACGTATTAGGACATCCCATTAGTAAACCGGCCTGGGCAGATTCTCGGA rbcLa

TGACTATGAACCCCACGCACATGATATCTTGGCAGCATTTCGAGTAACTCCTCAACCTGGAGTTCCACCAGAAGAAGCAGG GGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCGTTACA AAGGACGATGCTACGGCATCGAGCCTGTTGCTGGAGAAGAAAATCAATATATTGCTTATGTAGCTTACCCATTAGACCTTTT TGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGGGTTCAAAGCCCTGCGTGCTCTACGTTTG GAGGATTTGCGAATCCCTCCTGCTTATACGAAAACTTTCCAAGGCCCACCTCACGGTATCCAAGTTGAGAGAGACAAATTA TACAAATACGGACGTCCCCTATTGGGATGTACTATTAAACCTAAATTGGGATTGTCCGCTAAGAACTACGGTCGAGCAGTTT A trnH-psbA

TTAATGGATAAGATTTTGGTCTTAGTGTAGTCGAGTTTTAAAAAAGAAAGGAGCAATACCCCAATTCTTGCTCTATTGGGCG GGTTTGTATTGCTCCTTTCTTTCTTATTAGTTGACTTATTCGAATTCCTTACCTTCCTTTTTTAAAAACAAAAGTGGGTTTTTC CATTTAAGTTATCATGGGTTCTTGTATTTTTTTTTTTTTATGTACGCATTCTCATTTTTGTAATTTTGGTCCTCTAAGCTTTCTT TTGTTTTTGGATCCATTTTTTTTACATTCAAGCGAGAAAGATTTCCAATTTGTCTTAAAAAAAAAGAATAACAAAATAATGAAT AATGAGTTAGTGAATGGAATTTCAATCATTTGCAA

References:

AGIS. 2007. Agricultural Geo-Referenced Information System. Available online from: www.agis.agric.za [Accessed 01 June 2013].

Lansdown, R.V. 2013. Persicaria lapathifolia. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. available online from: www.iucnredlist.org [Accessed 04 August 2013].

Park, S.H., Oh, S.R., Juk, K.J., Lee, I.S., Kim, J.H., Lee, J.J., & Lee, H. 1999. Acylated favonol glycoides with anti-complement activity from Persicaria lapathifolia. Chemical and Pharmaceutical Bulletin 47 (10): 1484-1486.

Wilson, K.L. 1990. Flora of New South Wales. Some wide spread species of Persicaria (Polygonaceae) and their allies. Kew Bulletin 45 (4): 621-636.

220

Pistia stratiotes L.

Common names: Synonyms: Classification: Water lettuce Pistia aegyptiaca Schleid. Class: Magnoliopsida Water cabbage Pistia amazonica C.Presl Order: Alismatales Pistia brasiliensis Klotzsch Family: Araceae

Description:

Pistia stratiotes is a perennial, mat-forming free-floating, stoloniferous aquatic herb, measuring up to 15 cm wide. Plants are arranged in rosettes. Leaves are light to yellowish green in colour, with velvety hairs and prominent longitudinal veins. The leaves are obovate to spathulate-oblong, truncate to emerginate at the apex and long-cuneate at the base. The flowers are inconspicuous, pale green or white, enclosed in a leaf-like spathe (Glazier 1996). Fruits are small green capsules.

A B

Fig. 43. (A) Pistia stratiotes and (B) Pistia stratiotes forming dense mats along a river in Mpumalanga Province. Photograph: (B) by C.J. Cilliers (http://www.agis.agric.za).

Native ranges:

Pistia stratiotes is indigenous to South America (Henderson & Cilliers 2002).

221

Distribution in South Africa:

Fig. 44. Distribution of Pistia stratiotes in South Africa.

Habitat:

Pistia stratiotes grows in streams, rivers and wetlands. It can also survive in mud (Rivers 2002).

Uses:

It is a medicinal plant with antidiabetic, antimicrobial and antifungal activities (Tripathi et al. 2010). It is also used in the phytoremediation industry to remove nitrogen, phosphorus (Lu et al. 2010) and trace elements from wastewaters (Odjegba & Fasidi 2004).

How it spreads:

Water lettuce spreads through vegetative fragmentation and seeds (Henderson & Cilliers 2002). Whole plants and fragments can be moved by boats, fishing equipment and water current (Rivers 2002).

Invasion category:

This plant is listed on the Global Compendium of Weeds (http://www.hear.org/gcw/) as a weed in many countries. In South Africa, it is listed as a category 1b invader (NEM:BA 2004).

222

Ecological Impacts:

Water lettuce plants form dense mats that block waterways, impede navigation and prevent sunlight from reaching underlying waters. Dense mats create a breeding site for mosquitos (Rivers 2002).

DNA barcodes: matK

CTTTTTTCACGAATATCATAATTGGGGTAATCCCATTACTCCAAGGAAATCCAACTATTATGGTCTTTCGAAAGAGAATCCAA GACTTTTTTTGTTCCTATATAATTCTTATGTAGTTGAATGCGAATCCATATTAATTTTTCTCCGTAAACAATCCTCTTATTTACG ATCAACATTTTATGGAACCTTTCTTGAGCGAACACATTTCTATGAAAAAATAGAACAACATCTTGTAGTACTTTGTTGTAATG ATTTTCAGAAAACCTTATGGTTGTTCAAGGATCCTTTCATACATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAA GGGACTCATCTTCTGATGAAGAAATGGAAATCTTACTTTGTCAATTTTTGGCAATGTCATTTTCGCTTTTGGTCTCAACCTGG TAGGATCCACATAAGCCAATTCTCAAAATTTTCGTTCTATTTTCTAGGTTATCTTTCAAGTGTACCAATAAATCCTTCAGCGG TAAAGAGTCAAATGCTAGAGAGTTCTTTTTTAATAGATATTGTTACTAAAAAATTCGAAACTATAGTTCCAATTATTCCAATAA TTGGATCATTGTCAAAAGCGAAATTTTGTAACGTATCGGGGAATCCCATTAGTAAGCC rbcLa

AAACAGAGACTAAAGCAACTGTCGGATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAGTATGAGAC AAAGGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCAGGGGTTCCACCTGAAGAAGCAGGGGCTGCAGTAG CTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCT ACCACATCGAACCTGTTCCTGGAGAAGAAAGTCAATTTATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTC CGTTACCAACATGTTTACTTCCATTGTAGGTAATGTTTTTGGGTTTAAAGCTTTACGAGCTCTGCGTCTAGAGGATTTGCGA ATTCCTCCCGCGTATTCCAAAACTTTCCAAGGCCCGCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGT CGTCCCCTATTGGGATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCAGTTTATGAATGTCTTC GGGGTGGAT trnH-psbA

CAAGAATAGCTAAAGGATTTCCCTTTTTTTATTTCATTTATTATTTATTTAAAATAAATGATTTTTTTGATTTCAAAGACTAAGA AGTCCATTAATTAAATTACGGATTGAGAAAAGTCAAAGCAAAGTATGCAAAAATAAAAAAAAAAGTGAAAATGTCAAAACTGC TTATGTCGACAAAATCCCCGCGAATCAAAAAAAAAGGAGTAATACCAAACCTCTTATGAGGAGGTTTGGTATTATTCCTTCA TCAATTCCTATACACTAAGACAAAATGTCTTATCCATTTGTAGATGGAACTTCAACAGCAG

References:

Glazier, K. 1996. Pistia stratiotes L. Ecology and Evolutionary Biology Conservatory. Available online from: http://florawww. eeb. uconn. edu/acc_num/199600001. html [Accesssed 30 June 2013].

Lu, Q., He, Z.L., Graetz, D.A., Stoffella, P.J. & Yang, X. 2010. Phytoremediation to remove nutrients and improve eutrophic storm waters using water lettuce (Pistia stratiotes L.). Environmental Science and Pollution Reseach 17 (1): 84-96.

223

NEM:BA. 2004. National Environmental Management: Biodiversity Act (No. 10 of 2004). Government Gazette No. 32090, 3 April 2009. Department of Environmental Affairs and Tourism, Pretoria.

Odjegba, V.J., & Fasidi, I.O. 2004. Accumulation of trace elements by Pistia stratiotes: implications for phytoremediation. Exotoxicology 13 (7): 637-646.

Rivers, L. 2002. Water lettuce (Pistia stratiotes). University of Florida and Sea Grant. Available online from: http://www.iisgcp.org/EXOTICSP/waterlettuce.hml [Accessed 22 June 2013].

Tripathi, P., Kumar, R., Sharma, A.K., Mishra, A., & Gupta, R. 2010. Pistia stratiotes (Jalkumbi). Pharmacological Reviews 4 (8): 153-160.

224

Pontederia cordata L.

Common name: Synonyms: Classification: Pickerel weed Pontederia angustifolia Pursh Class: Liliopsida Pontederia cordata f. albiflora House Order: Commelinales Pontederia cordata f. bernardii Lepage Family: Pontederiaceae

Description:

Pontederia cordata is a rooted, perennial aquatic plant measuring 1-2 m high. Leaves are light green, up to 230 mm long, 150 mm wide and cordate with long clasping petioles. Inflorescences are spikes, 50-150 mm long with numerous flowers. Flowers are mauve, about 15 mm long, with a yellow blotch in the centre (Henderson & Cilliers 2002).

A B

Fig. 44. (A) Pontederia cordata flowers and (B) and plants. Photograph: (A) by C.J. Cilliers (http://www.agis.agric.za).

Native range:

Pontederia cordata is native eastern North America, Central and South America (Lusweti 2011).

225

Distribution in South Africa:

Fig. 45. Distribution of Pontederia cordata in South Africa.

Habitat:

This emergent macrophyte grows on riverbanks, and in ponds and dams (Henderson & Cilliers 2002).

How it spreads:

Pontederia cordata spreads through rhizome fragmentation. There are no viable seeds of the species in South Africa (Henderson & Cilliers 2002).

Invasion category:

This plant is listed on the Global Compendium of Weeds (http://www.hear.org/gcw/) as a weed in many countries. In South Africa, it is listed as a category 1b invader (NEM:BA 2004).

Environmental impacts:

Pickerel weed outcompetes native river bank species and threats aquatic biodiversity (Henderson & Cilliers 2002).

226

DNA barcodes: matK

GCGGCTCTTTCTTCACCAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCTATTTCTGTTATTTCAAAAGAAAATAA AAGACTATTTTGGTTCTTATATAATTCTTATATATCTGAATGCGAATTTTTATTAGTGTTTCTTCGTAAACAATCTTCTTATTTA CCATTAACATCTTCTGGAGTCTTTCTTGAGCGAACATATTATTATGGAAAAATACAACGTATTTTAGTGTGGCAGAATTTTTTT CAAAAGACTCTATGGGTCTTTAAAGACCCTTTCATGCATTATGTTCGATATCAAGGAAAAGTAGTTCTAGGTTCAAAGGGAA CTCATTTTTTGACGAAAAAATGGAAATTTTACTTTGTCAATTTATGGCAATATTATTTTCACTTTTGGTCCCAACCGTGCAGGA TTCATATAAACCAATTATCAAATTATTTTTTCTATTTTCTGGGTTATTTTTCAAATGTACTAAAAAATCCTTTGTCGGTTAGGAA TCAGATGTTAGAGAATTCTTTTCTAATAGATACTCTTACTAAGAAATTCGATACTCTAGTACCAGTTATTCCTCTTATTAGTTC ATTGTCTAAAGCTAAATTTTGTACT rbcLa

GCAAGTGTTGGATTCAAAGCAGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATAT CTTGGCAGCATTCCGAGTAACTCCTCAACCCGGTGTTCCGCCTGAAGAAGCAGGGGCTGCGGTAGCTGCGGAATCTTCTA CTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATTGAGTCCG TTCCTGGGGAGGATAATCAATATATTGCTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTT ACTTCCATTGTAGGTAATGTATTTGGTTTCAAAGCCCTACGAGCTCTGCGTTTGGAAGATTTGCGAATTCCCCCTGCTTATT CCAAAACTTTCCAAGGCCCACCTCACGGTATCCAGGTTGAAAGAGATAGGTTGAACAAGTATGGTCGTCCTCTATTGGGAT GTACTATTAAACCTAAATTGGGATTATCTGCAAAGAACTAT trnH-psbA

ACTTTTGTTTTAGTGTATACGAATTGTTGAGGTAAATTGGCCATACCCCTTATCTTGTTTTAATTTAATAAGGGGTATGGCTA ATTTGTTTGATACGATAATGCTTTTTGTATACAACACGTAAAATAAATAGAAATTCAAATTAATAATTAATAGATTAAGTATATA TAGAGTATATATAGATTAAATAAATAATAAGTAATATGAAAGTATAAAAATTAGTATATATCACAAGAATATGAGAAAGAAGAA TAGAAGAAAAATAAATTTAATATAAATTAAAGTTGTGTATTGTGTAGTAGACTATAACCTATATATATATATTTTTTATATATTC TAATATTCTATTTATATTTATATATTCTATTTATATTTATATATTCTATTTATATTTTATATTTATTTCTTTCTCCTCCTTCGTGTT GAGTTTTTCAATTTTTTTCGATAAATGATTAGCTACAAAAGGGTTTTTTTTAAGTGAACGTGTCACAGTGGATTACTCCTTTTT TTACATTTATTTTAAAGATTGGCATTCTATGTCCAATATCTCGATCTAAGTTATTAAGTATGGAGGTCAGTCAAAAAAAATACA ATAATGATGAA

References:

Lusweti, A. 2011. Pontederia cordata (Pickerel Weed). Available online from: http://keys.lucidcentral.org/keys/v3/eafrinet/weeds/key/weeds/Media/Html/Pontederia_cordat a_(Pickerel_Weed).htm [Accessed 25 July 2013].

NEM:BA. 2004. National Environmental Management: Biodiversity Act (No. 10 of 2004). Government Gazette No. 32090, 3 April 2009. Department of Environmental Affairs and Tourism, Pretoria.

227

Sagittaria platyphylla (Engelm.) J.S. Sm.

Common name: Synonyms: Classification: Delta arrowhead Sagittaria recurva Engelm. ex Patt. Class: Liliopsida Sagittaria mohrii J.G.Sm Order: Alismatales Family: Alismataceae

Description:

Sagittaria platyphylla is an emergent, stoloniferous, perennial aquatic herb, measuring 1.5 m high, with submerged and emergent leaves. Submerged leaves are strap-shaped, narrow and up to 500 mm long. Emergent leaves are arrow-shaped, 280 mm long and 100 mm wide, tapering to a point. Inflorescence a raceme, bearing 2-12 whorls of flowers occurring below the leave height. Flowers are 3-petalled, measuring up to 18 mm in diameter. Male flowers white, occurring above small, green, petal-less female flowers. Fruits are 7-12 mm in diameter (Jacobs 2006; Henderson 2010).

A B

Fig. 49. (A) Sagittaria platyphylla flowers and (B) leaves. Photographs: (A) by S. Navie and (B) by R. Whyte.

Native range:

Delta arrowhead is native to Central and North America (Henderson 2010).

228

Distribution in South Africa:

Fig. 50. Distribution of Sagittaria platyphylla in South Africa.

Habitat:

This plant inhabits rivers and stream bank of slow moving rivers and pond margins (Jacobs 2006).

Uses:

Slender arrow head is used an ornamental aquarium and pond plant.

How it spreads:

Sagittaria platyphylla is spread by seeds, stolon fragments, corms and entire plants that are carried away by water currents (Henderson 2010).

Invasion category:

This plant is listed on the Global Compendium of Weeds (http://www.hear.org/gcw/) as a weed in many countries. In South Africa, its invasion category has not yet been declared.

229

Ecological Impacts:

Slender arrowhead restricts water flow, increases sedimentation and intensifies flooding of rivers (Jacobs 2006)

DNA barcodes: matK

TTTTTTGCGGCTCTTTCTTCACCAATATCATAATTGGAATAGTCTCATTACTCCGAAGAAATCTATTTCTGTTATTTCAAAAGA AAATAAAAGACTATTTTGGTTCTTATATAATTCTTATATATCTGAATGCGAATTTTTATTAGTGTTTCTTCGTAAACAATCTTCT TATTTACCATTAACATCTTCTGGAGTCTTTCTTGAGCGAACATATTATTATGGAAAAATACAACGTATTTTAGTGTGGCAGAA TTTTTTTCAAAAGACTCTATGGGTCTTTAAAGACCCTTTCATGCATTATGTTCGATATCAAGGAAAAGTAGTTCTAGGTTCAA AGGGAACTCATTTTTTGACGAAAAAATGGAAATTTTACTTTGTCAATTTATGGCAATATTATTTTCACTTTTGGTCCCAACCGT GCAGGATTCATATAAACCAATTATCAAATTATTTTTTCTATTTTCTGGGTTATTTTTCAAATGTACTAAAAAATCCTTTGTCGGT TAGGAATCAGATGTTAGAGAATTCTTTTCTAATAGATACTCTTACTAAGAAATTCGATACTCTAGTACCAGTTATTCCTCTTAT TAGTTCATTGTCTAAAGCTAAATTTTGTACTGTATCCGGACATCCTATTAGTAAGCCC rbcLa

TTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGTGTTC CGCCTGAAGAAGCAGGGGCTGCGGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACC AGTCTTGATCGTTACAAAGGACGATGCTACCACATTGAGTCCGTTCCTGGGGAGGATAATCAATATATTGCTTATGTAGCTT ATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGGTTTCAAAGCCCTA CGAGCTCTGCGTTTGGAAGATTTGCGAATTCCCCCTGCTTATTCCAAAACTTTCCAAGGCCCACCTCACGGTATCCAGGTT GAAAGAGATAGGTTGAACAAGTATGGTCGTCCTCTATTGGGATGTACTATTAAACCTAAATTGGGATTATCTGC trnH-psbA

TTTTTTTTGACTGACCTCCATACTTAATAACTTAGATCGAGATATTGGACATAGAATGCCAATCTTTAAAATAAATGTAAAAAA AGGAGTAATCCACTGTGACACGTTCACTTAAAAAAAACCCTTTTGTAGCTAATCATTTATCGAAAAAAATTGAAGAACTCGG CACGAAGGAGGAGAAAGAAATAAATATAAAATATAAATAGAATATATAAATATAAATAGAATATATAAATATAAATAGAATATT AGAATATATAAAAAATATATATATATAGGTTATAGTCTACTACACAATACACAACTTTAATTTATATTAAATTTATTTTTCTTCTA TTCTTCTTTCTCATATTCTTGTGATATATACTAATTTTTATACTTTCATATTACTTATTATTTATTTAATCTATATATACTCTATAT ATACTTAATCTATTAATTATTAATTTGAATTTCTATTTATTTTACGTGTTGTATACAAAAAGCATTATCGTATCAAACAAATTAG CCATACCCCTTATTAAATTAAAACAAGATAAGGGGTATGGCCAATTTACCTCAACAATTCGTATACACTAAAACAAAA

References:

Jacob, S. 2006. Sagittaria platyphylla (aquatic plant). Global Invasive Species Database. Available online from: http://www.issg.org/database/species/ecology.asp?si=855 [Accesssed 28 June 2013].

Henderson, L. 2010. SAPIA- the past 5 years and the next 5 years. Southern African Plant Invaders Atlas 15: 1-6.

230

231

Salvinia minima Baker & Salvinia molesta D.S. Mitch.

Common names: Classification: Common salvinia (S. minima) Class: Monilophyta Gaint salvinia (S. molesta) Order: Salviiniales Kariba weed (S. molesta) Family: Salviniaceae

Description:

Salvinia minima and S. molesta are rhizomatous, free-floating aquatic herbs with buoyant and submerged fronds. The fronds are in whorls of three, two floating and one submerged. The submerged fronds act as roots. Floating fronds are round to oblong, positioned opposite to each other, covered with stiff long, water repellent hairs. The fronds are 15-60 mm wide, light green to green, often with brown edges. Mature leaves are thick and folded at the mid rib (Kay & Hoyle 1999; Pieterse et al. 2003). Salvinia minima and S. molesta can be distinguish from each based on the type of hair on the upper leaf surfaces. Salvinia minima has hairs that branches into four fingers that are free at the tips, hairs of S. molesta branch into four fingers that are fused at the top (Julien et al. 2003; Henderson 2012).

A B

232

C D

E 1 2

Fig. 46. (A) Salvinia minima, (B) Salvinia molesta, (C) leaf hairs of S. minima, (D) leaf hairs of S. molesta, and (E) comparison of S. minima and S. molesta leave hairs: 1) S. minima, 2) S. molesta. Photographs: (A) by R., Moran (http://www.flickr.com/), (B) by C.J. Cilliers (http://www.agis.agric.za), (C) by D. Ted (http://www.flickr.com/), and (D) & (E) by C.J. Cilliers, (http://www.agis.agric.za).

Native range:

Salivinia minima and S. molesta are native to South America (Henderson & Cilliers 2002; Henderson 2012).

233

Distribution in South Africa:

Fig. 47. Distribution of Salvinia minima in South Africa.

234

Fig. 48. Distribution of Salvinia molesta in South Africa.

Natural habitat:

These plants grow in rivers, streams and wetlands.

Uses:

Salvinia molesta is used for mulch, compost, fodder, paper making, and biogas generation (Howard & Harvely 1998). Salvinia minima is an ornamental pond plant.

How it spreads:

These plants reproduce vegetatively through rhizome fragmentation (Henderson & Cilliers 2002; Henderson 2012). Fragments are spread by boats, water currents, recreational activities, and fishing equipment.

Invasion category:

Salvinia minima and Salvinia molesta are both listed on the Global Compendium of Weeds (http://www.hear.org/gcw/) as a weed in many countries. In South Africa, Salvinia molesta is listed as a category 1b invader (NEM:BA 2004) and the invasion category of Salvinia minima has not yet been declared.

235

Environmental Impacts:

Salvinia minima and S. molesta reduce water temperatures and oxygen levels, negatively affecting aquatic biodiversity. Plants block irrigation canals and disrupt agricultural development. They also interrupt water flow and disrupt hydroelectricity generation (Henderson & Cilliers 2002; Henderson 2012).

DNA barcodes: rbcLa (Salvinia minima)

CTTATTATACTCCTGANTATGAANCCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCC TGAAGAAGCAGGCGCTGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGTC TTGATCGTTACAAAGGACGATGCTACCACATCGAGCCTGTTGCTGGAGAAGAAAATCAATTTATTGCNTATGTAGCTTATCC CTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGGGTTCAAAGCCCTGCGC GCTCTACGTCTGGAAGATTTGCGAATCCCTCCTGCTTATGTTAAAACTTTCCAAGGTCCTCCTCACGGAATCCAAGTTGAGA GAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGGATGTACTATTAAACCTAAATTGGGATTATA rbcLa (Salvinia molesta)

TGACTTATTATACTCCTGAATATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCC GCCTGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGGCTTACC AGCCTTGATCGTTACAAAGGGCGATGCTACCACATCGAGGCCGTTCCTGGAGAAGAAAATCAATATATATGTTATGTAGCT TACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTGGGTTCAAAGCCCT GCGCGCTCTACGTCTGGAAGATCTGCGAATCCCTACTGCTTATGTTAAAACTTTCCAAGGTCCGCCTCATGGCATCCAAGT TGAAAGAGATAAATTGAACAAGTACGGCCGTCCCCTATTGGGATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAAC TACGGTAGAGCGGTTTA trnH-psbA (Salvinia minima)

TCCGCCCCCTCTGCTACTCGGCCCTCCGAGCGGGGAAGGGAACAGGATCTACCCATCAAGCCATTAATAGCTATTAAGGT CTAAGGTCCTTCAATTGATACATATACATATTTGTTGTGTATATAATGAGACAACGAACGGGAAATCCATGGAATGAGGGAT GTATTCTCAATCCAATCTATTCAAACGATTGGTAGATTACAAGCATTCCGTGAATTGTAATAAGAAGGTTTTTCATACCTATG GAGTATTCTAAATATTCTTCAGAATCCAAGAACCGACGGTTGTAGGATCGTGACAAACCATTATCTTTCTTTCTATTTGTTCC ATCGGACGAACCTTCGTTGGACACCAAACCTTAACGGAAAGGTTTGGTATCCAGTTACACTGCATAGCTAAACGGG trnH-psbA (Salvinia molesta)

CCTCCGAGCGGGGAAGGGAACAGGATCTACCCATCAAGCCATTAATAGCTATTAAGGTCTAAGGTCCTTCAATTAATACAT ATACATATTTGTTGTGTATATAACGAGACAACGAACGGGAAATCCATGGAATGAGGGATGTATTCTCAATCCAATCTATTCA AACGATTGGTAGATTACAAGCATTCCGTGAATTGTAAGAAGAAGATTTTTCATACCTATGGAGTATTCTAAATATTCTTCAGA ATCCAAGAACCGACGGTTGTAGGATCGTGACAAACCATTCTATTTCTTTCTATTTTTTCCATCGGACGAACCTTCGTTGGAC ACCAAACCTTCCAGAACGGAAAGGTTTGGTATCCAGTTACACTGCATAGCTAAACGGGTATTATCCGTTTATAGAAGGAGC TTCAACAGAAGCTAAGTCTAGAGGGAAGTTATGAGCATTAC

References:

236

Henderson, L. 2012. New aquatic invader in South Africa. Southern African Plant Invaders Atlas 24: 1-5.

Howard, G.W., & Harley, K.L.S. 1998. How do floating aquatic plants affect wetland conservation and development? How can these effects be minimised? Wetland Ecology and Management 5: 215-225.

Julien, M.H., Centre, T.J., & Tiping, D.W. 2003. Floating fern (Salvinia). Invasive plants of the Eastern U.S. Available online from: http://dnr.state.il.us/stewardship/cd/biocontrol/2floatingfern.html [Accessed 28 june 2013].

Kay, S., & Hoyle, S. 1999. Aquatic weed factsheet, North Carolina State University. Available online from: http://www.weedscience.ncsu.edu/aquaticweeds/facts/apfs001-99.pdf [Accessed 28 June 2013].

NEM:BA. 2004. National Environmental Management: Biodiversity Act (No. 10 of 2004). Government Gazette No. 32090, 3 April 2009. Department of Environmental Affairs and Tourism, Pretoria.

Pieterse, A.H., Kettunen, M., Diouf, S., Ndao, I, Tarvainen, A, Kloff, S, & Hellsten, S. 2003. Effective biocontrol of Salvinia molesta in the Senegal River by means of the weevil, Cyrtobagous salviniae. Ambio 32 (7): 458-46.

237

Typha capensis Rohrb.

Common name: Synonym: Classification: Bulrush Typha latifolia subsp. capensis Rohrb. Class: Liliopsida Order: Poales Family: Typhaceae Description:

Typha capensis is a robust, rhizomatous perennial aquatic herb that grows up to 2 m high. Leaves are linear, up to 2 m long and 10-15 (-20) mm wide with obtuse tips. The inflorescences are terminal spikes with male flowers narrower than densely packed female flowers. Male spikes are reddish brown, 80-110 (-150) mm long and 10-12 mm wide. Female spikes are bright chestnut or reddish brown (120- ) 140-320 mm long and 14-18 (-23) mm wide (Napper 1971). Fruits are minute, hairy and 1-seeded (Voigot 2007).

Fig. 51.Typha capensis plants. Photograph: by C. Wahlberg.

Native range:

This species is native to East Africa, the Democratic Republic of Congo, Zanzibar, and throughout southern Africa (Ghogue 2010).

238

Distribution in South Africa:

Fig. 52. Distribution of Typha capensis in South Africa.

Habitat:

Typha capensis grows in marshes, along stream banks, in dams and lakes (Masoko et al. 2008).

Uses:

Bulrush is a medicinal plant used for the treatment of venereal disease, diarrhoea, and dysentery. Spongy rhizomes also used as a form of starch (Masoko et al. 2008). It is an ornamental pond plant.

How it spreads:

Typha capensis reproduces from seeds and rhizome fragments. Seeds are wind dispersed (Voigot 2007) and rhizomes are water dispersed.

Invasion category:

239

Environmental impacts:

Typha capensis can completely fill up small dams, and wetlands (Henderson & Cillers 2002) and reduces aquatic biodiversity.

DNA barcodes: matK

TTTGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTGGAATAGTCTCATTACTTCGAAGAAATCTATTTACGTTTTTTC AAAAGAAAATAAAAGACTATTTAGATTACTATATAATTTTTATGTATTCGAATGTGAATTTGTATTCGTTTTTCTTCGTAAACAA TCTTCTTATTTACGATTAACATCTTTTGGAACTTTTCTTGAGCGAATACATTTCTATGGAAAAATAGAACATTTTCTAGTAGTG TATCGTAATTTTTTTAATAAAACCTTATGGTTCTTCACAGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGCAATTCTG GCATCAAAAGGGACTCATCTTTTTATGAAGAAATGGAAATGTTACCTTGTCAATTTCTGGCAATATTATTTTCATTTTTGGTCT CAACCGCACAGGATCCATATAAACCAATTATCAAACTATTCCTTCCATTTTCTGGGTTATCTTTCAAGTTTACTAAGAAATCC TTTGGTGGTAAGGAATCAAATGCTGGAAAATTCATATCTAATAGATACTGTTATGACAAAATTCGATACCATAGTACCAGTTG ATCCTCTCATAGGATCATTGTCTAAAGCTAAATTTTGTACCCTATTAGGACATCCTATTAGTAAGCCGATCTGGACCGA rbcLa

ATTTAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAATACGAAACCAAGGATACTGATATCTTGGCAGCAT TTCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCTGCGGTAGCTGCCGAATCTTCTACTGGTACATGG ACAACTGTTTGGACTGATGGACTTACGAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCTGTTGTTGGGGAA GAAAATCAATATATTGCTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTA GGTAATGTATTTGGGTTCAAAGCCCTACGAGCTCTACGTCTGGAGGATCTGCGAATTCCCCCTGCTTATTCAAAAACTTTCC AGGGCCCGCCTCATGGTATCCAAGTTGAAAGAGATAAGTTGAACAAGTATGGTCGTCCCCTATTGGGA trnH-psbA

ATCTATCATGGATAAGATTTCTGTCTTAATGTATATGAATCGCTGAACGAAAGGAACAATACCCAATATCTTGTTTTAACAAG ATATTGGGTATTTTTTGTTTTGTGTGATTCACATCTATTTTTTTTATTCGAAATTTTTCTATTCTTAATTAACTTAAATATATATA AGTTAATATTAATTCAAATTAACTTAACGACGAGATTTATTATCGTTTCTTGCATGTCTCGCGAAAGTCAGAGTAGGGGCGAA TTCTCCCAATTTGTGACCTACCATACGATCTGTTATATAAATAGGTAAATGTTCCTTTCCATTATGAATAGCGATTGTATGGC CAATCATTGTGGGTATAATGGTAGATGCCCGAGACCAAGTTACTATTATTTCTTTCTCCTCCCTCATGTTGAGTTTTTCAATT TTTCCCGATAAATGATTAGCTACAAAAGGATTTTTTTTTAGTGAACGTGTCACAGCTGATTACTCCTTTTTTTTACATTTTAAA GATTGGCATTCTATGTACAATATCTCGATCTAAGTATGGAGGTCAGAATAAATACAATAATGATGAATGGAAAAAA

References:

Ghogue, J.P. 2010. Typha capensis. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. Available online from: www.iucnredlist.org [Accessed 09 August 2013].

Masoko, P., Mokgotho, M.P., Mbazima, V.G., & Mampuru, L.J. 2008. Biological activities of Typha capensis (Typhaceae) from Limpopo Province (South Africa). African Journal of Biotechnology 7 (20): 3743-3748.

240

Napper, D.W. 1971. Typha capensis (Rohrb.) N.E. Br. [Family Typhaceae]. Flora of Tropical East Africa 1.

Voigot, W. 2007. Typha capensis (Rohrb.) N.E. Br. Available online from: http:www.plantzafrica.com/planttuv/typhacapen.htm [Accessed 28 July 2013].

241

Vallisneria spiralis L.

Common names: Synonyms: Classification: Coiled vallisneria Vallisneria aethiopica Fenzl Class: Magnoliopsida Tape grass Vallisneria jacquiniana Spreng. Order: Alismatales Eel grass Vallisneria linnet Brecht. & J. Presl Family: Hydrocharitaceae

Description:

Vallisneria spiralis is a submerged aquatic herb with leaves and flowering stalks arising from the roots. Leaves are linear, obtuse, measuring 100-460 mm in length and 4-10 mm in width. Flowers are three lobed. Male flowers are numerous and covered by a 2-lobed ovate spathe. Female flowers are covered by a tubular spathe. Capsules are 25-10 mm long (Witmer 1937).

A B

Fig. 53. (A) Vallisneria spiralis growing in an aquarium and (B) stream. Photographs: (A) by N. Meijer (http://www.flickr.com) and (B) by D.F. Farrari (http://www.actaplantarum.org/).

Native range:

Tape grass is native to Southern Europe through to Indochina and Africa (Gupta 2011).

Distribution in South Africa:

Vallisneria spiralis is sold as an ornamental aquarium plant in South Africa. It has not been recorded in South African waters, nor is it prohibited, but the plant is invasive in other parts of the world and is listed on the Global Invasive Species Database (Jacobs 2006).

242

Habitat:

This plant inhabits wetlands, rivers and lakes (Gupta 2011).

Uses:

Tape grass produces allelochemicals that are used to inhibit the growth of blue-green algae (Xian et al. 2006). Plants are also used in the phytoremediation industry to remove to chromium from waste waters (Vajpayee et al. 2001). It is also an ornamental aquarium plant.

How it spreads:

This plant reproduces vegetatively and fragments are dispersed by water fowl and currents (Jacobs 2006).

Invasion category:

This plant is listed on the Global Compendium of Weeds (http://www.hear.org/gcw/) as a weed in many countries. It has not be listed on the CARA and NEM:BA list of invasive species in South Africa. Henderson & Cilliers (2002) suggested that this plant should be prohibited in South Africa.

Environmental impacts:

Vallisneria spiralis disrupts recreational activities, causes flooding, silting of dams and reduces the aesthetic appeal of water bodies (Jacobs 2006).

DNA barcodes: rbcLa

AAAGCAGGTCTTGGGTTCAAAGCTGGCGTGAAAGATTACAAATTGACTTATTATACGCCTGAATATGAAACCAAAGATACTG ATATCTTGGCAGCATTCCGAGTCACTCCGCAACCTGGAGTTCCACCTGAAGAAGCGGGGGCCGCAGTAGCTGCCGAATCC TCTACTGGTACATGGACAACTGTGTGGACTGATGGGCTTACTAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAG CCCGTTGCCGGAGAGGAAGATCAATATATTGCTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACA TGTTTACTTCCATTGTAGGTAATGTATTTGGGTTCAAAGCTCTACGAGCTTTACGCTTAGAGGATCTACGAATTCCTGCTGC TTATTCCAAAACTTTTCAAGGTCCACCTCATGGAATTCAAGTTGAGAGAGATAGATTGAACAAATATGGTCGTCCTCTATTG GGATGTACTATTAAACCCAAACTGGGATTATCC trnH-psbA

GCCCCTTTTATTTAGAAAATTTTTCAGTTACTTTCAGTTCAGTTAAAGAAGAATTTCTTTTTTTTTTTTTTATGGATAGGGAAGA AAATACAATACAGGAAAAGTAGAAATACTAACCCCATTCCAAATAAGTTTAGTATTTCCTTTCACTTTAGTAAGTCTTTCAACT TTCAACTTCAAATTCAAAAAAAAAATCCAAAGAAGTCTTACCCATTTGGAGAGGGGG

References:

Gupta, A.K. 2011. Vallisneria spiralis. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. Available online from: www.iucnredlist.org [Accessed 09 August 2013].

243

Jacobs, S. 2006. Vallisneria spiralis L. Global Invasive Species Database. Available online from: http://www.issg.org/database/species/ecology.asp?fr=1&si=878 [Accessed 09 August 2013].

Vajpayee, P., Rai, U.N., Ali, M.B., Tripathi, R.D., Yaclav, V., Sinha, S., & Singh, S.N. 2001.Chromium-induced physiological changes in Vallisnera spiralis L. and its role in phytoremediation of tannery effluents. Bulletin of Environmental Contamination and Toxicity 67 (2): 246-256.

Witmer, S. W. 1937. Morphology and Cytology of Vallisneria spiralis L. American Midland Naturalist 18 (3): 309-333.

Xian, Q., Chen, H., Lui, H., Zou, H., & Yin, D. 2006. Isolation and identification of anti-algal compound from leaves of Vallinseria spiralis L. by activity-guided fractionation (5pp). Environmental Science and Pollution Research 13 (4): 233-237.

244