1 Harmine Stimulates the Differentiation of Cementoblasts In

Harmine stimulates the differentiation of cementoblasts in vitro

Thesis

Presented in Partial Fulfillment of the Requirements for the Degree of Master of Science

in the Graduate School of The Ohio State University

Li Zheng, DDS, PhD

The Ohio State University

2020

Thesis Committee

Dr. Toru Deguchi, Advisor

Dr. Brian L. Foster

Dr. Do-Gyoon Kim

Copyrighted by

Li Zheng

2020

Abstract

Introduction: One of the major side effects in orthodontic treatment is external apical root resorption (EARR). Recently, a new antiresorptive agent, harmine, was reported to stimulate osteoblast formation, differentiation and function. We hypothesized that harmine can be a potential agent for preventing and even recovering EARR. Therefore, our objective is to examine if harmine stimulates the differentiation of cementoblast in vitro.

Methods: A cementoblast cell line (OCCM-30) was obtained for growth assay and scratch assay to investigate the effects of harmine on cementoblast growth. Real-time

Polymerase Chain Reaction (RT-PCR) was used to examine transcription factors and differentiation markers such as Runx2, Dlx5, ctnnb1, Msx2, Osterix, Ibsp, Col1a1 and

Spp1 in cementoblasts treated with harmine, compared to cells without treatment.

Western blot was used to test if the transcription factors and differentiation markers are stimulated or inhibited on the protein level. Differentiation assays such as alizarin red staining and von Kossa staining are used to examine the effects of harmine on cementoblast differentiation.

ii hours, 5 μM harmine slowed down the migration after 24 hours and 1 μM of harmine treatment decreased the speed after 36 hours, compared to control group. RT-PCR and western blot results indicated that harmine stimulates the expression of transcription factors and differentiation markers on both RNA and protein levels. Expression levels of

Runx2, Dlx5 and Osterix were stimulated after 14 days treatment. Msx2 expression increased 1.5 fold after treatment on day 4. The expressions of Col1a1, Ibsp and Spp1 increased 3, 1.5 and 10 times, respectively on day 4. Von Kossa and alizarin red staining showed more calcium deposition by OCCM-30 cells after 4 days 10 μM harmine treatment.

Conclusions: Harmine stimulates the differentiation of cementoblast in vitro. Therefore, harmine shows potential as a novel candidate for prevention of root resorption during orthodontic treatment and a promote repair cementum after root resorption.

iii

Acknowledgments

This work is supported by the pilot grant from the College of Dentistry, the Ohio State

University to Toru Deguchi.

Vita

Year Degree Major Institution

2017 – 2020 Master Dentistry The Ohio State University

2002 – 2006 Ph.D. Dental Sciences Okayama University, Japan

1995 – 2000 D.D.S. Dentistry Tongji University, China

Publications

Said R, Zheng L, Saunders T, Zeidler M, Papagerakis S, Papagerakis P. Generation of Amelx-iCre Mice Supports Ameloblast-Specific Role for Stim1. J Dent Res. 2019 Aug;98(9):1002-1010

Papagerakis P, Zheng L, Kim D, Said R, Ehlert AA, Chung KKM, Papagerakis S. Saliva and Gingival Crevicular Fluid (GCF) Collection for Biomarker Screening. Methods Mol Biol. 2019;1922:549-562

Hsiao J, Wang Y, Zheng L, Liu R, Said R, Hadjiyski L, Cha H, Botero T, Chatzistavrou X, Dong Q, Papagerakis S, Papagerakis P. In Vivo Rodent Models for Studying Dental Caries and Pulp Disease. Methods Mol Biol. 2019;1922:393-403

Sulaiman Ghandourah B, Lefkelidou A, Said R, Chatzistavrou X, Flannagan S, Gonzáles-Cabezas C, Fenno CJ, Zheng L, Papagerakis S, Papagerakis P. In Vitro Caries Models for the Assessment of Novel Restorative Materials. Methods Mol Biol. 2019;1922:369-377.

Dong Q, Wang Y, Mohabatpour F, Zheng L, Papagerakis S, Chen D, Papagerakis P. Dental Pulp Stem Cells: Isolation, Characterization, Expansion, and Odontoblast Differentiation for Tissue Engineering. Methods Mol Biol. 2019;1922:91-101

Alam MK, Zheng L, Liu R, Papagerakis S, Papagerakis P, Geyer CR. Synthetic antigen-binding fragments (Fabs) against S. mutans and S. sobrinus inhibit caries formation. Sci Rep. 2018 Jul 5;8(1):10173

Zheng L, Zinn V, Lefkelidou A, Taqi N, Chatzistavrou X, Balam T, Nervina J, Papagerakis S, Papagerakis P. Orai1 expression pattern in tooth and craniofacial ectodermal tissues and potential functions during ameloblast differentiation. Dev Dyn. 2015 Oct;244(10):1249-58.

Wang YY, Chatzistavrou X, Faulk D, Badylak S, Zheng L, Papagerakis S, Ge L, Liu H, Papagerakis P. Biological and bactericidal properties of Ag-doped bioactive glass in a natural extracellular matrix hydrogel with potential application in dentistry. Eur Cell Mater. 2015 Jun 20;29:342-55.

Papagerakis P, Pannone G, Zheng L, Athanassiou-Papaefthymiou M, Yamakoshi Y, McGuff HS, Shkeir O, Ghirtis K, Papagerakis S. Clinical significance of kallikrein- related peptidase-4 in oral cancer. Anticancer Res. 2015 Apr;35(4):1861-6.

Matossian M, Vangelderen C, Papagerakis P, Zheng L, Wolf GT, Papagerakis S. In silico modeling of the molecular interactions of antacid medication with the endothelium: novel therapeutic implications in head and neck carcinomas. Int J Immunopathol Pharmacol. 2014 Oct-Dec;27(4):573-83.

Desiderio V, Papagerakis P, Tirino V, Zheng L, Matossian1 M, Prince M, Paino F, Mele L, Montella R, Papaccio G, Papagerakis S. Increased fucosylation h as a pivotal role in invasive and metastatic properties of head and neck cancer stem cells. (2015) Oncotarget. Jan 1;6(1):71-84

Papagerakis S, Pannone G, Zheng L, About I, Taqi N, Nguyen NP, Matossian M, McAlpin B, Santoro A, McHugh J, Prince ME, Papagerakis P. Oral epithelial stem cells-Implications in normal development and cancer metastasis. (2014) Exp Cell Res. Jul ;325(2):111-129

Zheng L, Ehardt L, McAlpin B, About I, Kim D, Papagerakis S, Papagerakis P. The tick tock of odontogenesis. (2014) Exp Cell Res. Jul ;325(2):83-89

Papagerakis S, Zheng L, Schnell S, Sartor MA, Somers E, Marder W, McAlpin B, Kim D, McHugh J, Papagerakis P. The circadian clock in oral health and diseases. (2014) J Dent Res. Jan;93(1):27-35

Czerwinski MJ, Desiderio V, Shkeir O, Papagerakis P, Lapadatescu MC, Owen JH, Athanassiou-Papaefthymiou M, Zheng L, Papaccio G, Prince ME, Papagerakis S. In vitro evaluation of sialyl Lewis X relationship with head and neck cancer stem cells. Otolaryngol Head Neck Surg. 2013 Jul;149(1):97-104.

Zheng L, Seon YJ, Mourão MA, Schnell S, Kim D, Harada H, Papagerakis S, Papagerakis P. Circadian Rhythms Control Ameloblasts Differentiation. (2013) Bone. Jul;55(1):158-65

Desiderio V, Papagerakis P, Zheng L, Prince M, Czerwinski MJ, Papaccio G, Owen J, Cezar IM, Papagerakis P. In Vitro Evaluation of Sialyl Lewis X Relationship with Head and Neck Cancer Stem Cells. (2013) Otolaryngol Head Neck Surg. Jul;149(1):97-104

Zheng L, Seon YJ, McHugh J, Papagerakis S, Papagerakis P. Clock genes show circadian rhythms in salivary glands. (2012) J Dent Res. Aug;91(8):783-8. Selected for the journal’s cover.

Zheng L, Papagerakis S, Schnellc SD, Hoogerwerfd WA, Papagerakis P. Expression of Clock Proteins in Developing Tooth. (2011) Gene Expr Patterns. Mar-Apr;11(3- 4):202-6.

Simmer JP, Papagerakis P, Smith CE, Fisher DC, Rountrey AN, Zheng L, and Hu J.C.-C. Regulation of Dental Enamel Shape and Hardness. (2010) J Dent Res. Oct;89(10):1024-38.

Zheng L, Amano K, Iohara K, Ito M, Into T, Matsushita K, Nakamura H, Nakashima M. Matrix Metalloproteinase 3 Accelerates Wound Healing Events after Dental Pulp Injury. (2009) Am J Patho. 175(5):1905-14

Iohara K, Zheng L, Ito M, Ishizaka R, Nakamura H, Into T, Matsushita K, Nakashima M. Regeneration of dental pulp after pulpotomy by transplantation of CD31(-)/CD146(-) side population cells from a canine tooth. (2009) Regen Med. 4(3):377-85.

Amano K, Nakashima M, Zheng L, Iohara K, Matsui H, Yamashaki M, Matsushita K, Nakamura H. MMP-3 Regulates Wound Healing Process in Rat Dental Pulp. (2008) The Japanese Society of Conservative Dentistry. 51(6), 602-613 (paper in Japanese)

Iohara K, Zheng L, Wake H, Ito M, Nabekura J, Wakita H, Nakamura H, Into T, Matsushita K, Nakashima M. A novel stem cell source for vasculogenesis in ischemia: subfraction of side population cells from dental pulp. (2008) Stem Cells. 26(9):2408-18. vii

Zheng L, Iohara K, Ishikawa M, Into T, Takano-Yamamoto T, Matsushita K, Nakashima M. Runx3 negatively regulates Osterix expression in dental pulp cells. (2007) Biochem J. 405(1):69-75.

Yamashiro T, Zheng L, Shitaku Y, Saito M, Tsubakimoto T, Takada K, Takano- Yamamoto T, Thesleff I. Wnt10a regulates dentin sialophosphoprotein mRNA expression and possibly links odontoblast differentiation and tooth morphogenesis. (2007) Differentiation. 75(5):452-62.

Nakashima M, Iohara K, Zheng L. Gene therapy for dentin regeneration with bone morphogenetic proteins. (2006) Curr Gene Ther. 6(5):551-60.

Iohara K, Zheng L, Ito M, Tomokiyo A, Matsushita K, Nakashima M. Side population cells isolated from porcine dental pulp tissue with self-renewal and multipotency for dentinogenesis, chondrogenesis, adipogenesis, and neurogenesis. (2006) Stem Cells. 24(11):2493-503.

Zheng L, Yamashiro T, Fukunaga T, Balam TA, Takano-Yamamoto T. Bone morphogenetic protein 3 expression pattern in rat condylar cartilage, femoral cartilage and mandibular fracture callus. (2005) Eur J Oral Sci. 113(4):318-25.

Balam TA, Yamashiro T, Zheng L, Murshid Ahmed S, Fujiyoshi Y, Takano- Yamamoto T. Experimental tooth movement upregulates preproenkephalin mRNA in the rat trigeminal nucleus caudalis and oralis. (2005) Brain Res. 1036(1-2):196-201.

Fujiyama K, Yamashiro T, Fukunaga T, Balam TA, Zheng L, Takano-Yamamoto T. Denervation resulting in dento-alveolar ankylosis associated with decreased Malassez epithelium. (2004), J Dent Res. 83(8):625-9

Fields of Study

Major Field: Dentistry

Specialty: Orthodontics

viii

Table of Contents

Abstract ...... ii Acknowledgments...... iv Vita ...... v List of Tables ...... x List of Figures ...... xi Chapter 1. Introduction ...... 1 Chapter 2. Statement of Purpose ...... 7 Chapter 3. Manuscript ...... 8 Chapter 4. Discussion ...... 22 Chapter 5. Conclusion ...... 26 References ...... 27 Appendix: Table and figures ...... 32

List of Tables

Table 1 Primers sequences for RT-PCR ...... 33

List of Figures

Figure 1. Harmine inhibits cell proliferation rate in OCCM-30 ...... 34

Figure 2. Harmine inhibits cell migration rate in OCCM-30...... 35

Figure 3. Harmine increases cementoblast marker gene expression ...... 37

Figure 4. Harmine increases cementoblast marker protein expression ...... 39

Figure 5. Harmine stimulates the mineralization capacity of cementoblasts in vitro ...... 40

Chapter 1. Introduction

Every year, more than 2 million new malocclusion patients in the United States are treated with braces. One of the major side effects of orthodontic treatment is the external apical root resorption (EARR) [1, 2]. EARR is caused by orthodontic loading resulting in inflammation and resorption of the tooth root. Generally, EARR would be repaired by cellular cementum, but overall may result in permanent loss of the root structure according to the severity of the resorption [3]. The etiologic factors are complex.

Many factors, such as the differences in diet, genetics or immune status of subjects and the effect of mechanical loading, are considered to be etiologic factors in EARR [4-10].

Cementoblasts are responsible for the formation of cementum, which is the thin layer of mineralized tissue covering the root surface [11]. Similar to osteoblasts, cementoblasts express transcription factors such as runt-related gene 2 (Runx2) and osterix (Osx) [12]. The cells also share some differentiation markers and mineralization related factors such as alkaline phosphatase (ALP) [13].

Recently, harmine, also known as telepathine, was reported to have a dramatic effect on bone homeostasis [14-16]. Studies indicate that harmine promotes differentiation of osteoblasts and inhibits osteoclastogenesis. The current study focuses on analyzing whether harmine stimulates the differentiation of cementoblasts in vitro.

External Apical Root Resorption

The orthodontic treatment of malocclusion largely relies on tooth movement.

There is bone resorption on the compression side and modeling on the tension side during orthodontic treatment [17]. However, orthodontic tooth movement may contribute to several adverse effects. These include EARR, periodontal disease, and temporomandibular dysfunction (TMD) as the top three [18]. EARR after orthodontic treatment results in permanent loss of tooth structure at the apex [3]. Unaddressed EARR results an increase of tooth mobility and even tooth loss in the most severe cases [7].

According to severity, EARR can be classified into 3 categories: mild, which has less than 2 mm apical root resorption; moderate, which has more than 2 mm apical root resorption but less than one-third of root length; and severe, which as more than 4 mm apical root resorption or one-third of root length [19]. The prevalence of EARR varies according to different studies. Most studies agree that EARR occurs in as many as 90% of patients who have orthodontic treatment [1, 2, 7, 17, 20]. However, severe root resorption is rare, only occurring in about 1-5% of teeth [21, 22]. Maxillary incisors and mandibular first molars have reportedly had a higher risk of EARR compared to other teeth [10, 19, 23]. The etiology involved in EARR is still unclear and complex [7]. Many intrinsic factors are believed to relate with the pathogenesis, such as genetic background, individual variable, tooth morphology and initial tooth length [9, 24]. On the other hand, external force also plays roles. Research indicates that heavy force, longer treatment duration, tooth intrusion and large amount of apical movement are associated with a higher risk of EARR [25-29].

Currently, treatment of EARR includes: 1. Early diagnosis. A progress panoramic radiograph will be taken 6 to 12 month after orthodontic treatment started to find out if patient has early sign of EARR; 2. Two to three month pause of treatment if EARR is early detected. This helps reducing further EARR; and 3. Stop treatment if several or uncontrolled EARR is identified. Alternative options such as prosthetics can be used to address malocclusion. It is suggested that radiographic follow-up is necessary for patients exhibiting severe EARR on their final panoramic x-ray after treatment concludes [17, 30,

31].

Cementoblasts

Cementoblasts are highly differentiated cells of ectomesenchymal origin that reside on the root surface within the periodontal ligament (PDL) [32, 33]. The main function of the cementoblast is to form cementum. Although cementum is often described as a “bone-like” tissue, it differs from bone in many aspects. For example, cementum does not have lamellar structure and there is no remodeling activity, just appositional growth [34]. It remains unclear if cementoblasts and osteoblasts share the same precursor

[34], however the two cells share expression of key factors such as transcription factors runt-related gene 2 (Runx2) and osterix (Osx), which transactivate genes encoding for type I collagen, alkaline phosphatase (ALP), and osteocalcin (OCN) [24, 35]. On the other hand, cementoblasts are reported to express some selective genes such as

Cementum-derived attachment protein (CAP) and cementum-derived growth factor (CGF)

[36, 37].

During the process of cementum repair, extracellular matrix proteins such as fibronectin, osteopontin (OPN), and osteocalcin are thought to contribute to the recruitment of cementoblast precursors to the root surface and to their subsequent adhesion, proliferation, and differentiation. Local cytokines and growth factors including insulin-like growth factor 1 (IGF-1), fibroblast growth factor (FGF), epidermal growth factor (EGF), bone morphogenetic proteins (BMPs), and transforming growth factor- ß

(TGF- ß) may also play important roles in cementoblast precursor differentiation and proliferation [38].

Harmine

Harmine, also known as banisterine, is a fluorescent harmala alkaloid. It is a member of beta-carboline family. Harmine can be found in in many organisms, including plants and butterflies. Tobacco, Peganum harmala (widely in Middle Eastern) and lemon balm are listed as natural sources of harmine.

Harmine is an inhibitors of monoamine oxidase (MAOIs) and antagonist of 5- hydroxytryptamine (5-HT) [39-41]. It reversibly binds to MAO-A and inhibits the activity of monoamine oxidase enzymes, increasing the concentration of neurotransmitters norepinephrine, serotonin and dopamine from the brain. Therefore, harmine was used an antidepressant [39-41]. Other studies revealed that harmine has many other functions including anti-cancer effects [42], inducing pancreatic islet cell proliferation [43].

Related to mineralized tissue, harmine promotes the differentiation of osteoblasts and inhibits osteoclastogenesis. Yonezawa et al. investigated BMPs signal pathway in

MC3T3-E1 cell lines, showed direct evidence that harmine regulates bone homeostasis

[15]. In their subsequent work, RANKL signal pathway in RAW264.7 cells was researched [14], providing indirect evidence of the effect of harmine. BMPs play critical roles during osteoblastogenesis. By binding to type I and type II serine/threonine kinase receptors, BMPs activate the transcription factor Smad, which translocates into the nucleus and modulates the expression of many down-stream genes. Furthermore, research showed that BMPs activate many transcription factors such as Runt-related transcription factor 2 (Runx2) and Osx, which are essential for osteoblast differentiation. To confirm whether harmine regulates osteoblast differentiation, Yonezawa et al. tested the RNA expression levels of Bmp2, 4, 6 and 7, as well as Id1, Runx2 and Osx in osteoblast cell line [15]. They found that all BMPs family members and the essential transcription factors were upregulated at 7 days culture with 10 μM harmine, providing direct evidence that harmine regulates osteoblast differentiation via BMPs signal pathway [15]. On the other hand, RANKL signal pathway was studied in their other work to show indirect evidence that harmine inhibits bone resorption [14]. Results in the paper indicated that harmine inhibits the RANKL induced TRAP, a specific marker of osteoclast differentiation, activity. Harmine also showed the ability to down-regulate expression of downstream genes of RANKL such as c-Fos and NFATc1. On the whole, the work by

Yonezawa and colleagues supported the concept that harmine affects can stimulate bone formation and inhibit bone resorption [14, 15]. Fujiwara et al. published a tissue culture

5 study in 2018 that indicated harmine effectively stimulated bifurcation and root elongation as well as periodontal tissue in developing tooth germ in an ex vivo organ culture model [44].

No study to date has been reported to detect whether harmine affects cementoblast differentiation and cementum formation. Because of the similarity of cementoblasts and osteoblasts, we hypothesized that harmine may promote the differentiation of cementoblasts in vitro. Furthermore, we hypothesize that harmine may reduce EARR during tooth movement in vivo.

Chapter 2. Statement of Purpose

Recently, harmine was reported to increase mRNA expression of the osteoblast marker genes ALP and osteocalcin, and it enhanced the mineralization of MC3T3-E1 cells. Because harmine not only increased the function of osteoblastic lineage cells, but also differentiates mesenchymal cells into mineralized tissue forming cells, it is suggested that harmine may play similar role in cementoblast growth and differentiation. This study hypothesized that harmine stimulates cementoblast differentiation. Hence this study may provide a foundation of using harmine as a potential cementum inductive agent to prevent and/or repair loss of cementum caused by EARR.

The specific aims of this investigation are to:

1. Determine if harmine affects cementoblast proliferation.

2. Analyze if harmine alters migration of cementoblasts.

3. Define effects of harmine on cementoblast differentiation.

Null Hypotheses

1. Harmine does not stimulate the proliferation of cementoblasts.

2. Harmine does not alter migration of cementoblasts.

3. Harmine does not affect differentiation of cementoblasts.

Chapter 3. Manuscript

Harmine stimulates the differentiation of cementoblasts in vitro

Li Zheng1, Brian L. Foster2, Do-Gyoon Kim1 and Toru Deguchi1

1. Division of Orthodontics, the Ohio State University College of Dentistry,

Columbus, OH

2. Division of Biosciences, the Ohio State University College of Dentistry,

Columbus, OH

Address correspondence to: Toru Deguchi, Division of Orthodontics, College of

Dentistry, 4088 Postle Hall, Ohio State University, 305 W 12th Ave, Columbus, OH

43210-1267; email, [email protected]

Abstract

Methods: A cementoblast cell line (OCCM-30) was obtained for growth assay and scratch assay to investigate the effects of harmine on cementoblast growth. Real-time

Polymerase Chain Reaction (RT-PCR) was used to examine transcription factors and differentiation markers such as Runx2, Dlx5, ctnnb1, Msx2, Osterix, Ibsp, Col1a1 and

Spp1 in cementoblasts treated with harmine, compared to cells without treatment.

Results: The growth rate of OCCM-30 was inhibited by 10 µm harmine after 2 days treatment and more significant on day 3. Furthermore, scratch assay study showed a dose-dependent inhibition manner. Ten μM harmine decreased healing speed after 12 hours, 5 μM harmine slowed down the migration after 24 hours and 1 μM of harmine treatment decreased the speed after 36 hours, compared to control group. RT-PCR and

9 western blot results indicated that harmine stimulates the expression of transcription factors and differentiation markers on both RNA and protein levels. Expression levels of

Introduction

Orthodontic tooth movement may contribute to several adverse effects.. EARR is one of the most common unfavorable outcomes of the orthodontic treatment [1, 2].

EARR after orthodontic treatment results in permanent loss of tooth structure at the apex

[3]. Unaddressed EARR results an increase of tooth mobility and even tooth loss in the most severe cases [7]. The prevalence of EARR varies according to different studies [7,

17, 20]. Most studies agree that EARR occurs in as many as 90% of patients who have orthodontic treatment [1, 2, 7, 17, 20]. However, severe root resorption is only occurring in about 1 - 5% of teeth [21, 22]. The etiology involved in EARR is still unclear and complex [7]. Many intrinsic factors are believed to relate with the pathogenesis, such as genetic background, individual variable, tooth morphology and initial tooth length [9, 24].

External force such as force magnitude, direction and treatment duration also plays roles as well [25-29].

Current treatment of EARR includes early detection and temporary pause of treatment. Stop treatment is recommended if uncontrolled EARR is identified. In that case, alternative options such as prosthetics solution for space and stripping for crowding are suggested [17, 30, 31].

Cementum, which is a thin layer of mineralized tissue on the surface of tooth root, is formed by cementoblasts. Cementoblasts are highly differentiated cells of ectomesenchymal origin that reside on the root surface within the periodontal ligament

(PDL) [32, 33]. It expresses some cementoblast- selective genes such as CAP and CFG

[36, 37]. On the other hand, it also shares expression of key factors with osteoblasts,

11 which forms bone. For example, transcription factors include Runx2 and Osx are expressed in cementoblasts to regulate type I collagen, ALP, and OCN [24, 35].

Cementoblasts also involved in secondary cementum repair after damaged by resorption.

Cementoblast precursors are thought to be recruited by extracellular matrix proteins such as fibronectin, osteopontin (OPN), and osteocalcin [38]. Some other local cytokines and growth factors, for example, IGF-1, FGF, BMPs and TGF-beta, may be involved in cementoblast precursor differentiation and proliferation [38].

Harmine is a beta-carboline. It is a historical traditional medicine in Middle

Eastern. Many studies revealed that harmine is an inhibitor of monoamine oxidase

(MAOIs) and antagonists of 5-hydroxytryptamine (5-HT) [39-41]. It was used as an antidepressant [39-41]. Studies also showed that that harmine has other functions including anti-cancer effects and inducing pancreatic islet cell proliferation [43]. Recent studies proved that harmine promotes the differentiation of osteoblasts via BMPs signal pathway and inhibits osteoclastogenesis via RANKL signal pathway [14, 15]. Fujiwara et al. also showed that harmine helps stimulating postnatal development of tooth [44].

Objects

1. Determine if harmine affects cementoblast proliferation.

2. Analyze if harmine alters migration of cementoblasts.

3. Define effects of harmine on cementoblast differentiation.

Materials and Methods

Cell culture and reagents

The immortalized mouse cementoblast cell line OCCM-30 was a kind gift from Prof.

Brian L. Foster. The cell line OCCM-30 cells were cultured in Dulbecco’s modified

Eagle medium (DMEM) with 10% fetal bovine serum (FBS), 100 U/ml penicillin G, and

100 μg/ml streptomycin (Gibco, Grand Island, NY, USA) in a cell culture chamber with 5%

CO2 at 37 degree. Cells were passaged at 90% confluence. Harmine was purchased from

Sigma (St. Louis, MO USA) and diluted in Dimethyl sulfoxide (DMSO) (Sigma) according to the manufacturer’s protocol. For harmine experiments, OCCM-30 cells were exposed to different concentrations of harmine over different durations. The control group used culture medium containing the same concentration of vehicle (DMSO) without harmine. For cell differentiation experiments, differentiation medium was used.

The differentiation medium was DMEM supplemented with 100 nM of dexamethasone,

10 mM β-glycerophosphate and 200 μM of ascorbic acid. The medium was changed every day until cell collection. Cell Counting Kit-8 was bought from Dojindo (Rockville,

MD, USA) for cell proliferation assay. Rabbit polyclonal antibody to Runx2 (ab23981), rabbit anti-alpha TUBULIN (ab4074) and rabbit polyclonal to Msx2/Hox8 (ab223692) were purchased from Abcam (Cambridge, MA). BSP, COL1A1 and OPN antibodies were gifts from Prof. Brian L. Foster [45-47].

Cell Proliferation Assay

For proliferation assay, OCCM-30 cells were seeded at 1,000 cells/well with 100

μl DMEM in 96-well plate. The culture medium contained +/- 10 μM harmine. Ten μl of the CCK-8 solution was added to each well after the incubation period. The plate then was incubated in a humidified incubator at 37 degree for 4 hours. Absorbance was measured at 450 nm by using a microplate reader. Cell absorbance was measured at 1, 2,

3 and 4 days. Due to high proliferation rate, the cells reached stationary phase after 4 days therefore no measurement was done after that. Wells without cells were used as negative controls.

Scratch Assay

For the scratch assay, OCCM-30 cells were seeded at 30,000 cells/well with 2 ml

DMEM in 6-well plate. Culture medium was changed to FBS-free DMEM after cells were grown to confluence. A 200 μl pipet tip was used to create a scratch by scraping the cell monolayer in a straight line. The debris was washed away by PBS then fresh FBS- free DMEM was added. An amount of 1, 5, or 10 μM harmine was added in culture medium in experimental groups. Dishes were placed in culture incubator at 37˚C. Photos were taken at 0, 12, 24 and 36 hours after the scratch was created. Cell migration was evaluated by measuring the distance between the two scratch edges. For each image, five different distances were measured for each scratch by using ImageJ Software (National

Institute of Health, USA). Distances measured from each concentration of harmine were compared with the control group.

Cell differentiation

Cells were cultured with regular DMEM until they reached confluence, then culture medium was replaced by differentiation medium. The medium was changed every day. Cells were harvested at 4, 10 and 14 days for real time RT-PCR and western blotting.

For von Kossa and alizarin red staining, cells were fixed at 4 and 7 days.

Real time RT-PCR analysis

Cells were harvested at 4, 10 and 14 days after differentiation medium was applied. Total RNA was isolated by RNeasy Mini Kit Print (Qiagen, Germantown, MD,

USA). Two μg of RNA was reverse transcribed with TaqMan reverse transcription reagents (Applied Biosystems, Branchbury, NJ), following the manufacturer’s recommendations. Real-time RT-PCR then was performed at 95°C for 10 seconds, 62°C for 15 seconds, and 72°C for 8 seconds, with DNA Master SYBR Green I kit (Roche,

Mannheim, Germany) by using QuantStudio 3 (Thermo Fisher Scientific, Waltham, MA).

Beta-actin (Actb) was used as a housekeeping gene for target genes normalization. The oligonucleotide primers were designed based on published mouse cDNA sequences

(Table 1). The experiments were repeated at least three times.

Western Blotting

Cells were harvested for western blot at 4 days after differentiation medium was applied.

PBS was used to wash cells twice and cells were being lysed for 20 min on ice in RIPA lysis buffer. Fifty μg of total proteins was added per lane and separated by SDS–PAGE.

Separated proteins were transferred to a polyvinylidene difluoride membrane (Millipore,

Billerica, MA, USA). The membrane was blocked with 5% nonfat milk then incubated with primary antibodies overnight at 4°C. The antibodies used were rabbit anti ALPHA-

TUBULIN, BSP, COL1A1, MSX2, OPN, and RUNX2. Alpha-Tubulin antibody was used as a housekeeping protein to determine the loading. Horseradish peroxidase- conjugated anti-rabbit antibody was used as secondary antibody for 1 hour at room temperature. To visualize the bound antibodies, enhanced chemiluminescence (ECL) detection system was used.

Von Kossa and alizarin red staining

For von Kossa staining, cells in 6-well plate were washed twice with PBS and then fixed with 4% paraformaldehyde for 30 minutes at room temperature. Fixed cells were washed with PBS then incubated with 5% silver nitrate at room temperature under ultraviolet light for 1 hour. Then the cells were washed with water twice and the plate was scanned by a scanner (EPSON V600).

For alizarin red staining, cells in 6-well plate were washed twice with PBS. After that, paraformaldehyde was used to fix the cells for 30 minutes at room temperature. The cells were then stained with 40 mmol/L of Alizarin red solution (pH 4.4) for 30 minutes and washed with deionized water twice. A phase-contrast microscope was used to take images for stained well. The images of stained plate were captured by using a scanner.

Both images of von Kossa and alizarin red staining were measure by densitometry using the ImageJ software.

Statistics

Student’s unpaired t-test was used for statistical analysis of our cells proliferation assay, scratch assay, real time RT-PCR, von Kossa staining and alizarin red staining data.

Each experiment was performed at least three times, and the representative data are presented as means ± S.D. Differences were considered to be statistically significant at the P < 0.05 level.

Results

Harmine inhibits cell proliferation rate in cementoblasts

We examined if harmine affected the proliferation rate of OCCM-30 cells. No difference was found at 1 day after 10 μM harmine added in culture medium (Figure 1).

Proliferation activities were significant decreased at 2 and 3 days with harmine treatment.

The growth rate of cells in control group decreased at 4 days because cells reached the stationary phase and additional cell proliferation was not observed. Therefore, there was no difference between harmine and control group at 4 days.

Harmine inhibits cell migration rate in cementoblasts

We then tested if harmine affected the migration rate of OCCM-30 cells using a dose-response design with 1, 5, and 10 μM harmine. In the control group, the scratch gap was closed by 36 hours. Images of the scratch were analyzed by ImageJ. Compared to the control group, the migration rate of cells receiving 1 μM harmine showed reduced migration at 36 hours after treatment (Figure 2). Cells receiving 5 μM harmine exhibited reduced migration at 24 and 36 hours. Cells receiving the highest dose of 10 μM harmine treatment, exhibited reduced cell migration as early as 12 hours, and this was maintained at 24 and 36 hours.

Harmine stimulates expression of cementoblast markers

Real time RT-PCR was performed to analyze differentiation markers including

Col1a1, Ibsp, Msx2 and Spp1, Runx2, Osterix, Ctnnb1 and Dlx5. RNA expression levels

19 of these genes were measured at 4, 10, and 14 days after addition of differentiation medium. Expression of early differentiation marker Col1a1 mRNA was increased by 3.5- fold at 4 days, but decreased 50% at 10 days. No different expression level was found at

14 days compared with control group. Ibsp, which is a mid-differentiation marker, showed 1.6-fold more expression at 4 days but 70% and 50% decrease at 10 days and 14 days, respectively. Another differentiation marker Msx2 expression level was upregulated about 1.5-fold and 4-fold at 4 days and 14 days, but not at 10 days. Middle to late differentiation marker Spp1 showed similar pattern with Msx2, was upregulated 5 times and 2 times at 4 days and 14 days, respectively, but not at 10 days. For the genes in

Runx2 single pathway, transcription factor Runx2 showed slight increase at 4 days and

1.5-fold higher level at 14 days. RNA expression level of Runx2 wasn’t affected at 10 days. Osx and Dlx5, two other transcription factors involved in Runx2 signaling pathway, were upregulated at 14 days but not 4 days and 10 days. There is no significant difference was detected in Ctnnb1 expression level (Figure 3).

To confirm the effect of harmine on stimulation OCCM-30 differentiation, western blot was performed to assess protein levels in cells after 4 days treatment. The result of western blot showed that COL1A1, BSP, OPN and MSX2 were upregulated at 4 days compared to control group (Figure 4). No differences were noted in RUNX2 protein expression after treatment for 4 days.

Harmine stimulates mineralization by cementoblasts in vitro

The ability of harmine to affect promotion of mineral nodule formation in vitro by

OCCM-30 cells was tested by von Kossa and alizarin red assays. No staining was apparent in the negative control group (differentiation medium and harmine free) at either

4 or 7 days (Figure 5). The cells treated with harmine-free differentiation medium

(positive control) showed mineral nodules at 7 days, indicating calcium salts are precipitated within the extracellular matrix produced by the cells. Compared to positive control, more mineral nodules were found in cells treated with differentiation medium and 10 μM harmine at 7 days. Quantitative analysis showed that the staining density was upregulated to 1.3-fold at 7 days. However, no difference was found at 4 days. The results were also confirmed by alizarin red staining. At 4 days treatment with μM harmine, more alizarin Red S-calcium complex was formed in the wells compared to control group. Quantitative analysis showed that the staining density was increased approximately 1.2-fold.

Chapter 4. Discussion

This is the first study to verify the effects of harmine on cementoblast differentiation in vitro. Our results indicated that harmine reduced the proliferation rate and migration activity of OCCM-30 cementoblasts. Several cementoblast differentiation markers were upregulated with harmine treatment, at both mRNA and protein levels.

Harmine positively affected mineralization capacity of OCCM.30 cells in vitro. Overall, administration of harmine in vitro created effects consistent with increased cementoblast differentiation, suggesting this may be a novel agent for treatment of EARR in vivo.

OCCM-30 is a mouse immortalized cementoblast cell line established by

D’Errico et al. [48]. The immortalized cell line was isolated from tooth root surface of

SV-40 antigen transgenic mice. The SV-40 antigen is controlled by rat osteocalcin gene promoter. OCCM-30 cells express cementoblast markers and promote deposition of mineral nodules in vitro, making them a reliable model for studying cementoblast biology under a variety of treatment regimens [48-55].

In the current study, the proliferation rate and migration activity were inhibited by

10 μM harmine (Figure 1 and 2). However, no inhibition effect was found when 10 μM harmine applied to human primary periodontal ligament cells (hPDLCs), indicating cell specific effects [56]. Interestingly, the same study showed that a higher concentration of harmine (20 and 40 μM) inhibited the proliferation of hPDLCs, suggesting sensitivities of 22 cells to effects of harmine may differ [56]. For mineralizing cells, including osteoblasts and cementoblasts, proliferation tends to cease as differentiation proceeds [57], making our proliferation results consistent with previous findings. Currently there is no report on the effects of harmine on migration of osteoblast or cementoblasts, therefore our results are the first to indicate such a dose-dependent effect.

Harmine affected mRNA and protein expression of several cementoblast markers.

It is well documented that type I collagen is the majority part of cementum, comprising around 80-90% of the organic extracellular matrix. The collagen is mainly secreted by cementoblasts [34]. In addition, cementoblasts also secretes SPP1 and IBSP, both of which are major components of cementum [58-60]. D'Errico’s work revealed that Spp1,

Ibsp and osteocalcin (OCN) are highly expressed selectively by cementoblasts both in situ and in vivo [61, 62]. Furthermore, immunohisto-staining data showed that Col1a1 and Spp1 strongly express in the newly differentiated cementoblasts [63]. Col1a1, Ibsp and Spp1 were also upregulated in our in vivo data, which is consistent with previous studies.

Runx2 is a master transcription factor regylating the differentiation of osteoblasts.

Similar to osteoblasts, Runx2 is also expressed in cementoblasts [12]. Pan’s study showed that Runx2 stimulates the differentiation and mineralization of dental follicle cells and up‐regulated cementoblast differentiation markers including COL1A1, alkaline phosphatase (ALP), OPN and BSP [64, 65]. In the present experiment, differentiation markers including COL1A1, BSP, MSX2 and OPN responded to harmine treatment and were largely up-regulated at 4 days (Figure 3 and 4). However, RNA level of Runx2 only

23 slightly increased and protein expression level of RUNX2 was not changed at 4 days

(Figure 3 and 4). These findings suggest that the stimulation effect of harmine may not operate through the Runx2 signal pathway.

Osx is a zinc-finger transcription factor belonging to the specificity protein (Sp) family. It was first identified in osteoblasts [66]. Knocking out Osx results bone forming and osteoblasts specific marker expression defect, indicates that Osx is essential for osteoblast differentiation and bone formation [66]. Osx cooperates with Runx2 and Dlx5 transcriptional network during osteogenic process [67]. Previous studies also showed that Osx, Runx2 and Dlx5 positively regulate each other and p53 negatively control the whole network [67-73]. During tooth development, Osx is expressed in odontoblasts and plays essential role to promote odontoblast differentiation in root. In cementoblasts, Osx also plays important roles. Osx reciprocally interacts with β-catenin during cementogenesis [74]. Osx regulates Wnt/β-catenin activity via Tcf/Lef. Meanwhile, Osx expression is regulated by Wnt/β-catenin signaling during cementoblast differentiation and cementum matrix secretion in root formation [74]. However, we did not detect altered expression levels of Osx or Ctnnb1 when differentiation markers of cementoblasts were upregulated at 4 days (Figure 3). These also suggested that Osx and Wnt/β-catenin signaling pathway may not be involved in mediating effects of harmine in OCCM-30 cells.

Interestingly, RNA expression levels of Runx2, Osx and Dlx5 increased at 14 days (Figure 3). There are two possible explanations. 1) These indicate that Runx2/Dlx5 and Osx signaling pathway may play roles in a late response to harmine treatment. And 2)

24 as a limitation of OCCM-30, the cell line grows in speedy way and detaches easily after

10 days. The morphology and characteristics of the cells could change once cells detached. Therefore, the RNA expression level of Runx2, Osx and Dlx5 may not able to accurately presented. Also the proteins are hard to isolate after cell detached. Therefore, western blot analysis was not able to perform. The problem should be addressed in future experiment.

Regarding to mineralization capacity of cementoblasts, our minelization capacity assay showed that 10 μM stimulates mineralized nodules formation as early as 4 days treatment. Alizarin red staining showed higher sensitivity, detected different staining density earlier than von Kossa staining (Figure 5). Both staining indicate that harmine stimulates the differentiation of OCCM-30 in a fast manner.

Chapter 5. Conclusion

In summary, our results indicate that harmine produces effects in cementoblasts consistent with increased differentiation in vitro. These findings support harmine as a potential candidate to promote cementum repair after EARR associated with orthodontic treatment. Future experiment should be done to determine whether harmine prevent

EARR and/or help cementum repair after EARR in an animal root resorption model.

References

1. Harry, M.R. and M.R. Sims, Root resorption in bicuspid intrusion. A scanning electron microscope study. Angle Orthod, 1982. 52(3): p. 235-58. 2. Kennedy, D.B., et al., The effect of extraction and orthodontic treatment on dentoalveolar support. Am J Orthod, 1983. 84(3): p. 183-90. 3. Brezniak, N. and A. Wasserstein, Root resorption after orthodontic treatment: Part 2. Literature review. Am J Orthod Dentofacial Orthop, 1993. 103(2): p. 138- 46. 4. Roscoe, M.G., J.B. Meira, and P.M. Cattaneo, Association of orthodontic force system and root resorption: A systematic review. Am J Orthod Dentofacial Orthop, 2015. 147(5): p. 610-26. 5. Sharab, L.Y., et al., Genetic and treatment-related risk factors associated with external apical root resorption (EARR) concurrent with orthodontia. Orthod Craniofac Res, 2015. 18 Suppl 1(1601-6343 (Electronic)): p. 71-82. 6. Maues, C.P., R.R. do Nascimento, and V. Vilella Ode, Severe root resorption resulting from orthodontic treatment: prevalence and risk factors. Dental Press J Orthod, 2015. 20(1): p. 52-8. 7. Weltman, B., et al., Root resorption associated with orthodontic tooth movement: a systematic review. Am J Orthod Dentofacial Orthop, 2010. 137(4): p. 462-76; discussion 12A. 8. Mirabella, A.D. and J. Artun, Risk factors for apical root resorption of maxillary anterior teeth in adult orthodontic patients. Am J Orthod Dentofacial Orthop, 1995. 108(1): p. 48-55. 9. Sameshima, G.T. and P.M. Sinclair, Predicting and preventing root resorption: Part I. Diagnostic factors. Am J Orthod Dentofacial Orthop, 2001. 119(5): p. 505-10. 10. Sameshima, G.T. and P.M. Sinclair, Predicting and preventing root resorption: Part II. Treatment factors. Am J Orthod Dentofacial Orthop, 2001. 119(5): p. 511-5. 11. Saygin, N.E., W.V. Giannobile, and M.J. Somerman, Molecular and cell biology of cementum. Periodontol 2000, 2000. 24: p. 73-98. 12. Hirata, A., T. Sugahara, and H. Nakamura, Localization of runx2, osterix, and osteopontin in tooth root formation in rat molars. J Histochem Cytochem, 2009. 57(4): p. 397-403. 13. Jiang, H., et al., Expression of core binding factor Osf2/Cbfa-1 and bone sialoprotein in tooth development. Mech Dev, 1999. 81(1-2): p. 169-73.

14. Yonezawa, T., et al., Harmine, a beta-carboline alkaloid, inhibits osteoclast differentiation and bone resorption in vitro and in vivo. Eur J Pharmacol, 2011. 650(2-3): p. 511-8. 15. Yonezawa, T., et al., Harmine promotes osteoblast differentiation through bone morphogenetic protein signaling. Biochem Biophys Res Commun, 2011. 409(2): p. 260-5. 16. Egusa, H., et al., The small molecule harmine regulates NFATc1 and Id2 expression in osteoclast progenitor cells. Bone, 2011. 49(2): p. 264-74. 17. Proffit, W.R., H.W. Fields, and D.M. Sarver, Contemporary orthodontics. 4th ed. 2007, St. Louis, Mo.: Mosby Elsevier. xii, 751 p. 18. Talic, N.F., Adverse effects of orthodontic treatment: A clinical perspective. Saudi Dent J, 2011. 23(2): p. 55-9. 19. Malmgren, O., et al., Root resorption after orthodontic treatment of traumatized teeth. Am J Orthod, 1982. 82(6): p. 487-91. 20. Levander, E. and O. Malmgren, Long-term follow-up of maxillary incisors with severe apical root resorption. Eur J Orthod, 2000. 22(1): p. 85-92. 21. Killiany, D.M., Root resorption caused by orthodontic treatment: an evidence- based review of literature. Semin Orthod, 1999. 5(2): p. 128-33. 22. Levander, E. and O. Malmgren, Evaluation of the risk of root resorption during orthodontic treatment: a study of upper incisors. Eur J Orthod, 1988. 10(1): p. 30- 8. 23. Kaley, J. and C. Phillips, Factors related to root resorption in edgewise practice. Angle Orthod, 1991. 61(2): p. 125-32. 24. Harris, E.F., S.E. Kineret, and E.A. Tolley, A heritable component for external apical root resorption in patients treated orthodontically. Am J Orthod Dentofacial Orthop, 1997. 111(3): p. 301-9. 25. Barbagallo, L.J., et al., Physical properties of root cementum: Part 10. Comparison of the effects of invisible removable thermoplastic appliances with light and heavy orthodontic forces on premolar cementum. A microcomputed- tomography study. Am J Orthod Dentofacial Orthop, 2008. 133(2): p. 218-27. 26. Chan, E. and M.A. Darendeliler, Physical properties of root cementum: Part 5. Volumetric analysis of root resorption craters after application of light and heavy orthodontic forces. Am J Orthod Dentofacial Orthop, 2005. 127(2): p. 186-95. 27. Feller, L., et al., Apical External Root Resorption and Repair in Orthodontic Tooth Movement: Biological Events. Biomed Res Int, 2016. 2016: p. 4864195. 28. Han, G., et al., Root resorption after orthodontic intrusion and extrusion: an intraindividual study. Angle Orthod, 2005. 75(6): p. 912-8. 29. Harris, D.A., A.S. Jones, and M.A. Darendeliler, Physical properties of root cementum: part 8. Volumetric analysis of root resorption craters after application of controlled intrusive light and heavy orthodontic forces: a microcomputed tomography scan study. Am J Orthod Dentofacial Orthop, 2006. 130(5): p. 639- 47.

30. Levander, E., O. Malmgren, and S. Eliasson, Evaluation of root resorption in relation to two orthodontic treatment regimes. A clinical experimental study. Eur J Orthod, 1994. 16(3): p. 223-8. 31. Lim, E., et al., Physical properties of root cementum: part 15. Analysis of elemental composition by using proton-induced x-ray and gamma-ray emissions in orthodontically induced root resorption craters of rat molar cementum after exposure to systemic fluoride. Am J Orthod Dentofacial Orthop, 2011. 139(2): p. e193-202. 32. Bartold, P.M., et al., Glycosaminoglycans of human cementum. J Periodontal Res, 1988. 23(1): p. 13-7. 33. Fong, C.D., I. Slaby, and L. Hammarstrom, Amelin: an enamel-related protein, transcribed in the cells of epithelial root sheath. J Bone Miner Res, 1996. 11(7): p. 892-8. 34. Bosshardt, D.D., Are cementoblasts a subpopulation of osteoblasts or a unique phenotype? J Dent Res, 2005. 84(5): p. 390-406. 35. Cao, Z., et al., Osterix controls cementoblast differentiation through downregulation of Wnt-signaling via enhancing DKK1 expression. Int J Biol Sci, 2015. 11(3): p. 335-44. 36. Arzate, H., et al., Production of a monoclonal antibody to an attachment protein derived from human cementum. FASEB J, 1992. 6(11): p. 2990-5. 37. Ikezawa, K., et al., Role of cyclin E and cyclin E-dependent kinase in mitogenic stimulation by cementum-derived growth factor in human fibroblasts. FASEB J, 1998. 12(12): p. 1233-9. 38. Jager, A., et al., Cellular and extracellular factors in early root resorption repair in the rat. Eur J Orthod, 2008. 30(4): p. 336-45. 39. Liu, F., et al., Harmine produces antidepressant-like effects via restoration of astrocytic functions. Prog Neuropsychopharmacol Biol Psychiatry, 2017. 79(Pt B): p. 258-267. 40. Liu, X., et al., Harmine is an inflammatory inhibitor through the suppression of NF-kappaB signaling. Biochem Biophys Res Commun, 2017. 489(3): p. 332-338. 41. Sharma, S., et al., Spectroscopic and structural studies on the interaction of an anticancer beta-carboline alkaloid, harmine with GC and AT specific DNA oligonucleotides. Chem Biol Interact, 2016. 260: p. 256-262. 42. Jahaniani, F., et al., Xanthomicrol is the main cytotoxic component of Dracocephalum kotschyii and a potential anti-cancer agent. Phytochemistry, 2005. 66(13): p. 1581-92. 43. Wang, P., et al., A high-throughput chemical screen reveals that harmine- mediated inhibition of DYRK1A increases human pancreatic beta cell replication. Nat Med, 2015. 21(4): p. 383-8. 44. Fujiwara, N., et al., Harmine promotes molar root development via SMAD1/5/8 phosphorylation. Biochem Biophys Res Commun, 2018. 497(3): p. 924-929. 45. Foster, B.L., Methods for studying tooth root cementum by light microscopy. Int J Oral Sci, 2012. 4(3): p. 119-28.

46. Foster, B.L., et al., Tooth root dentin mineralization defects in a mouse model of hypophosphatasia. J Bone Miner Res, 2013. 28(2): p. 271-82. 47. Foster, B.L., et al., Deficiency in acellular cementum and periodontal attachment in bsp null mice. J Dent Res, 2013. 92(2): p. 166-72. 48. D'Errico, J.A., et al., Employing a transgenic animal model to obtain cementoblasts in vitro. J Periodontol, 2000. 71(1): p. 63-72. 49. Liao, J., et al., 17beta-estradiol regulates the differentiation of cementoblasts via Notch signaling cascade. Biochem Biophys Res Commun, 2016. 477(1): p. 109- 114. 50. Mada, Y., et al., Effects of endogenous and exogenous prostaglandin E2 on the proliferation and differentiation of a mouse cementoblast cell line (OCCM-30). J Periodontol, 2006. 77(12): p. 2051-8. 51. Martins, L., et al., Leucine-Rich Amelogenin Peptide (LRAP) Uptake by Cementoblast Requires Flotillin-1 Mediated Endocytosis. J Cell Physiol, 2017. 232(3): p. 556-565. 52. Moon, J.S., et al., The role of Hedgehog signaling in cementoblast differentiation. Arch Oral Biol, 2018. 90: p. 100-107. 53. Moon, J.S., et al., Twist1 Suppresses Cementoblast Differentiation. Dent J (Basel), 2018. 6(4). 54. Ni, J., et al., Sodium fluoride causes oxidative stress and apoptosis in cementoblasts. Chem Biol Interact, 2018. 294: p. 34-39. 55. Wang, L., et al., Inhibition of Stat3 signaling pathway decreases TNF-alpha- induced autophagy in cementoblasts. Cell Tissue Res, 2018. 374(3): p. 567-575. 56. Lim, H.C., et al., Harmine promotes periodontal ligament cell-induced tissue regeneration. Oral Dis, 2018. 24(3): p. 456-464. 57. Kronenberg, H. and R.H. Williams, Williams textbook of endocrinology. 11th ed. 2008, Philadelphia: Saunders/Elsevier. xix, 1911 p. 58. MacNeil, R.L., et al., Expression of bone sialoprotein mRNA by cells lining the mouse tooth root during cementogenesis. Arch Oral Biol, 1996. 41(8-9): p. 827- 35. 59. MacNeil, R.L., et al., Bone sialoprotein is localized to the root surface during cementogenesis. J Bone Miner Res, 1994. 9(10): p. 1597-606. 60. McKee, M.D., S. Zalzal, and A. Nanci, Extracellular matrix in tooth cementum and mantle dentin: localization of osteopontin and other noncollagenous proteins, plasma proteins, and glycoconjugates by electron microscopy. Anat Rec, 1996. 245(2): p. 293-312. 61. D'Errico, J.A., et al., Expression of bone associated markers by tooth root lining cells, in situ and in vitro. Bone, 1997. 20(2): p. 117-26. 62. Kitagawa, M., et al., Characterization of established cementoblast-like cell lines from human cementum-lining cells in vitro and in vivo. Bone, 2006. 39(5): p. 1035-1042. 63. Kim, T.H., et al., Constitutive stabilization of ss-catenin in the dental mesenchyme leads to excessive dentin and cementum formation. Biochem Biophys Res Commun, 2011. 412(4): p. 549-55. 30

64. Pan, K., et al., Multilineage differentiation of dental follicle cells and the roles of Runx2 over-expression in enhancing osteoblast/cementoblast-related gene expression in dental follicle cells. Cell Prolif, 2010. 43(3): p. 219-28. 65. Pan, K., et al., Effects of core binding factor alpha1 or bone morphogenic protein- 2 overexpression on osteoblast/cementoblast-related gene expressions in NIH3T3 mouse cells and dental follicle cells. Cell Prolif, 2009. 42(3): p. 364-72. 66. Nakashima, K., et al., The novel zinc finger-containing transcription factor osterix is required for osteoblast differentiation and bone formation. Cell, 2002. 108(1): p. 17-29. 67. Artigas, N., et al., p53 inhibits SP7/Osterix activity in the transcriptional program of osteoblast differentiation. Cell Death Differ, 2017. 24(12): p. 2022-2031. 68. Artigas, N., et al., Mitogen-activated protein kinase (MAPK)-regulated interactions between Osterix and Runx2 are critical for the transcriptional osteogenic program. J Biol Chem, 2014. 289(39): p. 27105-17. 69. Kawane, T., et al., Dlx5 and mef2 regulate a novel runx2 enhancer for osteoblast- specific expression. J Bone Miner Res, 2014. 29(9): p. 1960-9. 70. Lee, M.H., et al., Dlx5 specifically regulates Runx2 type II expression by binding to homeodomain-response elements in the Runx2 distal promoter. J Biol Chem, 2005. 280(42): p. 35579-87. 71. Nishio, Y., et al., Runx2-mediated regulation of the zinc finger Osterix/Sp7 gene. Gene, 2006. 372: p. 62-70. 72. Roca, H., et al., Cooperative interactions between RUNX2 and homeodomain protein-binding sites are critical for the osteoblast-specific expression of the bone sialoprotein gene. J Biol Chem, 2005. 280(35): p. 30845-55. 73. Ulsamer, A., et al., BMP-2 induces Osterix expression through up-regulation of Dlx5 and its phosphorylation by p38. J Biol Chem, 2008. 283(7): p. 3816-26. 74. Choi, H., et al., A Reciprocal Interaction between beta-Catenin and Osterix in Cementogenesis. Sci Rep, 2017. 7(1): p. 8160.

Appendix: Table and figures

Table 1: Primer sequences for RT-PCR

Gene name 5’- Sequence -3’ GenBank Number Forward AAGTACCCCATTGAACACGG Actb NM_031144 Reverse ATCACAATGCCAGTGGTACG Forward CAGGCTGGTGTGATGGGATT Col1a1 NM_007742 Reverse AAACCTCTCTCGCCTCTTGC Forward GTCAGCTCGTGTCCTGTGAA Ctnnb1 NM_007614 Reverse TTCAGGTACCCTCAGGCCC Forward CTACCAGTACCAGTACCACGG Dlx5 NM_010056 Reverse TTCTTTCTCTGGCTGGCTGGT Forward TGACAGCCGGGAGAACAATC Ibsp NM_008318 Reverse TTTTCATCGAGAAAGCACAGGC Forward GCCTCGGTCAAGTCGGAAAA Msx2 NM_013601 Reverse GGCTCATATGTCTGGGCGG Forward GGTCCAGGCAACACACCTAC Osterix AF184902 Reverse GGTAGGGAGCTGGGTTAAGG Forward CAGACCAGCAGCACTCCATA Runx2 NM_009820 Reverse CAGCGTCAACACCATCATTC Forward CCTGGCTGAATTCTGAGGGAC Spp1 NM_001204201 Reverse ATCAGTCACTTTCACCGGGAG

Figure 1. Harmine inhibits cell proliferation rate in OCCM-30

The proliferation rate of OCCM-30 is inhibited by 10 μM harmine after 2 days and 3 days treatment. (*** P<0.005).

Figure 2. Harmine inhibits cell migration rate in OCCM-30

Scratch assay study shows a dose-dependent inhibition of cell migration. Ten μM harmine decreases migration rate after 12 hours, 5 μM harmine slows down the migration after 24 hours and 1 μM of harmine treatment decreases the speed after 36 hours, compare to control group. (*, P<0.05)

Figure 3. Harmine increases cementoblast marker gene expression

Real time PCR results indicate that 10 μM harmine stimulates the expression of transcription factors and differentiation markers in OCCM-30. Expression levels of

Runx2, Dlx5 and Osx are stimulated after 14 days treatment. The expressions of Msx2 of

Col1a1, Ibsp and Spp1 increase on day 4. No significant expression change was found on

Ctnnb1. (*, P<0.05; **, P<0.01; and ***, P<0.005)

Figure 4. Harmine increases cementoblast marker protein expression

Western blot results showed that protein expression levels of COL1A1, BSP, OPN and

MSX2 increased 4 days after 10 μM harmine stimulation in OCCM-30.

Figure 5. Harmine stimulates the mineralization capacity of cementoblasts in vitro

Von Kossa and alizarin red assays confirmed enhanced mineralization promoted by

OCCM-30 cells treated with 10 μM harmine for 4 and 7 days. Both assays were quantitatively measured (means ± sd; n = 4). AA, ascorbic acid; BGP, β- glycerophosphate. **, p<0.01.