Skeletal Muscle Function, Morphology, and Biochemistry in Ts65dn Mice: a Model of Down Syndrome
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
Functional Annotation of Exon Skipping Event in Human Pora Kim1,*,†, Mengyuan Yang1,†,Keyiya2, Weiling Zhao1 and Xiaobo Zhou1,3,4,*
D896–D907 Nucleic Acids Research, 2020, Vol. 48, Database issue Published online 23 October 2019 doi: 10.1093/nar/gkz917 ExonSkipDB: functional annotation of exon skipping event in human Pora Kim1,*,†, Mengyuan Yang1,†,KeYiya2, Weiling Zhao1 and Xiaobo Zhou1,3,4,* 1School of Biomedical Informatics, The University of Texas Health Science Center at Houston, Houston, TX 77030, USA, 2College of Electronics and Information Engineering, Tongji University, Shanghai, China, 3McGovern Medical School, The University of Texas Health Science Center at Houston, Houston, TX 77030, USA and 4School of Dentistry, The University of Texas Health Science Center at Houston, Houston, TX 77030, USA Received August 13, 2019; Revised September 21, 2019; Editorial Decision October 03, 2019; Accepted October 03, 2019 ABSTRACT been used as therapeutic targets (3–8). For example, MET has lost the binding site of E3 ubiquitin ligase CBL through Exon skipping (ES) is reported to be the most com- exon 14 skipping event (9), resulting in an enhanced expres- mon alternative splicing event due to loss of func- sion level of MET. MET amplification drives the prolifera- tional domains/sites or shifting of the open read- tion of tumor cells. Multiple tyrosine kinase inhibitors, such ing frame (ORF), leading to a variety of human dis- as crizotinib, cabozantinib and capmatinib, have been used eases and considered therapeutic targets. To date, to treat patients with MET exon 14 skipping (10). Another systematic and intensive annotations of ES events example is the dystrophin gene (DMD) in Duchenne mus- based on the skipped exon units in cancer and cular dystrophy (DMD), a progressive neuromuscular dis- normal tissues are not available. -
Whole-Genome Microarray Detects Deletions and Loss of Heterozygosity of Chromosome 3 Occurring Exclusively in Metastasizing Uveal Melanoma
Anatomy and Pathology Whole-Genome Microarray Detects Deletions and Loss of Heterozygosity of Chromosome 3 Occurring Exclusively in Metastasizing Uveal Melanoma Sarah L. Lake,1 Sarah E. Coupland,1 Azzam F. G. Taktak,2 and Bertil E. Damato3 PURPOSE. To detect deletions and loss of heterozygosity of disease is fatal in 92% of patients within 2 years of diagnosis. chromosome 3 in a rare subset of fatal, disomy 3 uveal mela- Clinical and histopathologic risk factors for UM metastasis noma (UM), undetectable by fluorescence in situ hybridization include large basal tumor diameter (LBD), ciliary body involve- (FISH). ment, epithelioid cytomorphology, extracellular matrix peri- ϩ ETHODS odic acid-Schiff-positive (PAS ) loops, and high mitotic M . Multiplex ligation-dependent probe amplification 3,4 5 (MLPA) with the P027 UM assay was performed on formalin- count. Prescher et al. showed that a nonrandom genetic fixed, paraffin-embedded (FFPE) whole tumor sections from 19 change, monosomy 3, correlates strongly with metastatic death, and the correlation has since been confirmed by several disomy 3 metastasizing UMs. Whole-genome microarray analy- 3,6–10 ses using a single-nucleotide polymorphism microarray (aSNP) groups. Consequently, fluorescence in situ hybridization were performed on frozen tissue samples from four fatal dis- (FISH) detection of chromosome 3 using a centromeric probe omy 3 metastasizing UMs and three disomy 3 tumors with Ͼ5 became routine practice for UM prognostication; however, 5% years’ metastasis-free survival. to 20% of disomy 3 UM patients unexpectedly develop metas- tases.11 Attempts have therefore been made to identify the RESULTS. Two metastasizing UMs that had been classified as minimal region(s) of deletion on chromosome 3.12–15 Despite disomy 3 by FISH analysis of a small tumor sample were found these studies, little progress has been made in defining the key on MLPA analysis to show monosomy 3. -
Universidade Estadual De Campinas Instituto De Biologia
UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA VERÔNICA APARECIDA MONTEIRO SAIA CEREDA O PROTEOMA DO CORPO CALOSO DA ESQUIZOFRENIA THE PROTEOME OF THE CORPUS CALLOSUM IN SCHIZOPHRENIA CAMPINAS 2016 1 VERÔNICA APARECIDA MONTEIRO SAIA CEREDA O PROTEOMA DO CORPO CALOSO DA ESQUIZOFRENIA THE PROTEOME OF THE CORPUS CALLOSUM IN SCHIZOPHRENIA Dissertação apresentada ao Instituto de Biologia da Universidade Estadual de Campinas como parte dos requisitos exigidos para a obtenção do Título de Mestra em Biologia Funcional e Molecular na área de concentração de Bioquímica. Dissertation presented to the Institute of Biology of the University of Campinas in partial fulfillment of the requirements for the degree of Master in Functional and Molecular Biology, in the area of Biochemistry. ESTE ARQUIVO DIGITAL CORRESPONDE À VERSÃO FINAL DA DISSERTAÇÃO DEFENDIDA PELA ALUNA VERÔNICA APARECIDA MONTEIRO SAIA CEREDA E ORIENTADA PELO DANIEL MARTINS-DE-SOUZA. Orientador: Daniel Martins-de-Souza CAMPINAS 2016 2 Agência(s) de fomento e nº(s) de processo(s): CNPq, 151787/2F2014-0 Ficha catalográfica Universidade Estadual de Campinas Biblioteca do Instituto de Biologia Mara Janaina de Oliveira - CRB 8/6972 Saia-Cereda, Verônica Aparecida Monteiro, 1988- Sa21p O proteoma do corpo caloso da esquizofrenia / Verônica Aparecida Monteiro Saia Cereda. – Campinas, SP : [s.n.], 2016. Orientador: Daniel Martins de Souza. Dissertação (mestrado) – Universidade Estadual de Campinas, Instituto de Biologia. 1. Esquizofrenia. 2. Espectrometria de massas. 3. Corpo caloso. -
The Mineralocorticoid Receptor Leads to Increased Expression of EGFR
www.nature.com/scientificreports OPEN The mineralocorticoid receptor leads to increased expression of EGFR and T‑type calcium channels that support HL‑1 cell hypertrophy Katharina Stroedecke1,2, Sandra Meinel1,2, Fritz Markwardt1, Udo Kloeckner1, Nicole Straetz1, Katja Quarch1, Barbara Schreier1, Michael Kopf1, Michael Gekle1 & Claudia Grossmann1* The EGF receptor (EGFR) has been extensively studied in tumor biology and recently a role in cardiovascular pathophysiology was suggested. The mineralocorticoid receptor (MR) is an important efector of the renin–angiotensin–aldosterone‑system and elicits pathophysiological efects in the cardiovascular system; however, the underlying molecular mechanisms are unclear. Our aim was to investigate the importance of EGFR for MR‑mediated cardiovascular pathophysiology because MR is known to induce EGFR expression. We identifed a SNP within the EGFR promoter that modulates MR‑induced EGFR expression. In RNA‑sequencing and qPCR experiments in heart tissue of EGFR KO and WT mice, changes in EGFR abundance led to diferential expression of cardiac ion channels, especially of the T‑type calcium channel CACNA1H. Accordingly, CACNA1H expression was increased in WT mice after in vivo MR activation by aldosterone but not in respective EGFR KO mice. Aldosterone‑ and EGF‑responsiveness of CACNA1H expression was confrmed in HL‑1 cells by Western blot and by measuring peak current density of T‑type calcium channels. Aldosterone‑induced CACNA1H protein expression could be abrogated by the EGFR inhibitor AG1478. Furthermore, inhibition of T‑type calcium channels with mibefradil or ML218 reduced diameter, volume and BNP levels in HL‑1 cells. In conclusion the MR regulates EGFR and CACNA1H expression, which has an efect on HL‑1 cell diameter, and the extent of this regulation seems to depend on the SNP‑216 (G/T) genotype. -
Methods Mouse Strains and Housing Male Wild-Type Mice
Methods Mouse strains and housing Male wild-type mice (C57BL/6J background) and B6.Cg-Tg (APPSwFlLon, PSEN1*M146L*L286V) 6799Vas/Mmjax (5xFAD, JAX 008730) were purchased from the Jackson Laboratory. μMT-/- mice which are deficient in B cells were purchased from Shanghai Model Organisms Center, Inc. Both B6.Cg-Tg and μMT-/- mice were bred on a C57BL/6J background. 5xFAD mice and μMT-/- mice were crossed to generate μMT-/-/5xFAD mice. The mice were used at different ages that are indicated throughout the manuscript. Mice of all strains were specific pathogen free environment with controlled temperature and humidity, on 12 h light: dark cycles (lights on at 7:00), and fed with regular rodent’s chow and sterilized tap water ad libitum. All experiments were approved by the Institutional Animal Care and Use Committee of the Nanjing Medical University. Human samples Frontal cortex tissues were obtained from 4 cases within 4-6 h of death, via informed donation for the Medical Education and Research of Nanjing Medical University, with corresponding written consents prepared by the donors and their families. Cases that were died from brain associated diseases were excluded from this study. The utilization of human tissues was approved by the Ethics Committee of Nanjing Medical University. All obtained samples were fixed in a 4% formalin solution and kept in paraffin blocks until further sectioning. Animal surgery DcLN ligation: The procedure of surgical ligation of the lymphatics afferent to the dcLNs was according to published literature (3, 30). In brief, mice were anaesthetized by i.p. injection with ketamine and xylazine in saline, and fixed on a stereotaxic apparatus in a supine position. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Investigation of Copy Number Variations on Chromosome 21 Detected by Comparative Genomic Hybridization
Li et al. Molecular Cytogenetics (2018) 11:42 https://doi.org/10.1186/s13039-018-0391-3 RESEARCH Open Access Investigation of copy number variations on chromosome 21 detected by comparative genomic hybridization (CGH) microarray in patients with congenital anomalies Wenfu Li, Xianfu Wang and Shibo Li* Abstract Background: The clinical features of Down syndrome vary among individuals, with those most common being congenital heart disease, intellectual disability, developmental abnormity and dysmorphic features. Complex combination of Down syndrome phenotype could be produced by partially copy number variations (CNVs) on chromosome 21 as well. By comparing individual with partial CNVs of chromosome 21 with other patients of known CNVs and clinical phenotypes, we hope to provide a better understanding of the genotype-phenotype correlation of chromosome 21. Methods: A total of 2768 pediatric patients sample collected at the Genetics Laboratory at Oklahoma University Health Science Center were screened using CGH Microarray for CNVs on chromosome 21. Results: We report comprehensive clinical and molecular descriptions of six patients with microduplication and seven patients with microdeletion on the long arm of chromosome 21. Patients with microduplication have varied clinical features including developmental delay, microcephaly, facial dysmorphic features, pulmonary stenosis, autism, preauricular skin tag, eye pterygium, speech delay and pain insensitivity. We found that patients with microdeletion presented with developmental delay, microcephaly, intrauterine fetal demise, epilepsia partialis continua, congenital coronary anomaly and seizures. Conclusion: Three patients from our study combine with four patients in public database suggests an association between 21q21.1 microduplication of CXADR gene and patients with developmental delay. One patient with 21q22.13 microdeletion of DYRK1A shows association with microcephaly and scoliosis. -
Cdk15 Igfals Lingo4 Gjb3 Tpbg Lrrc38 Serpinf1 Apod Trp73 Lama4 Chrnd Col9a1col11a1col5a2 Fgl2 Pitx2 Col2a1 Col3a1 Lamb3 Col24a1
Bnc2 Wdr72 Ptchd1 Abtb2 Spag5 Zfp385a Trim17 Ier2 Il1rapl1 Tpd52l1 Fam20a Car8 Syt5 Plxnc1 Sema3e Ndrg4 Snph St6galnac5 Mcpt2 B3galt2 Sphkap Arhgap24 Prss34 Lhfpl2 Ermap Rnf165 Shroom1 Grm4 Mobp Dock2 Tmem9b Slc35d3 Otud7b Serpinb3a Sh3d19 Syt6 Zan Trim67 Clec18a Mcoln1 Tob1 Slc45a2 Pcdhb9 Pcdh17 Plscr1 Gpr143 Cela1 Frem1 Sema3f Lgi2 Igsf9 Fjx1 Cpne4 Adgb Depdc7 Gzmm C1qtnf5 Capn11 Sema3c H2-T22 Unc5c Sytl4 Galnt5 Sytl2 Arhgap11a Pcdha1 Cdh20 Slc35f2 Trim29 B3gnt5 Dock5 Trim9 Padi4 Pcdh19 Abi2 Cldn11 Slitrk1 Fam13a Nrgn Cpa4 Clmp Il1rap Trpm1 Fat4 Nexn Pmel Mmp15 Fat3 H2-M5 Prss38 Wdr41 Prtg Mlana Mettl22 Tnrc6b Cdh6 Sema3b Ptgfrn Cldn1 Cntn4 Bcl2a1b Capn6 Capn5 Pcdhb19 Tcf15 Bmf Rgs8 Tecrl Tyrp1 Rhot1 Rnf123 Cldn6 Adam9 Hlx Rilpl1 Disp1 Atcay Vwc2 Fat2 Srpx2 Cldn3 Unc13c Creb3l1 Rab39b Robo3 Gpnmb Bves Orai2 Slc22a2 Prss8 Cdh10 Scg3 Adam33 Nyx Dchs1 Chmp4c Syt9 Ap1m2 Megf10 Cthrc1 Penk Igsf9b Akap2 Ltbp3 Dnmbp Tff2 Pnoc Vldlr Cpa3 Snx18 Capn3 Btla Htr1b Gm17231 Pcdh9Rab27a Grm8 Cnih2 Scube2 Id2 Reep1 Cpeb3 Mmp16 Slc18b1 Snx33 Clcn5 Cckbr Pkp2 Drp2 Mapk8ip1 Lrrc3b Cxcl14 Zfhx3 Esrp1 Prx Dock3 Sec14l1 Prokr1 Pstpip2 Usp2 Cpvl Syn2 Ntn1 Ptger1 Rxfp3 Tyr Snap91 Htr1d Mtnr1a Gadd45g Mlph Drd4 Foxc2 Cldn4 Birc7 Cdh17 Twist2 Scnn1b Abcc4 Pkp1 Dlk2 Rab3b Amph Mreg Il33 Slit2 Hpse Micu1 Creb3l2 Dsp Lifr S1pr5 Krt15 Svep1 Ahnak Kcnh1 Sphk1 Vwce Clcf1 Ptch2 Pmp22 Sfrp1 Sema6a Lfng Hs3st5 Efcab1 Tlr5 Muc5acKalrn Vwa2 Fzd8 Lpar6 Bmp5 Slc16a9 Cacng4 Arvcf Igfbp2 Mrvi1 Dusp15 Krt5 Atp13a5 Dsg1a Kcnj14 Edn3Memo1 Ngef Prickle2 Cma1 Alx4 Bmp3 Blnk GastAgtr2 -
Noelia Díaz Blanco
Effects of environmental factors on the gonadal transcriptome of European sea bass (Dicentrarchus labrax), juvenile growth and sex ratios Noelia Díaz Blanco Ph.D. thesis 2014 Submitted in partial fulfillment of the requirements for the Ph.D. degree from the Universitat Pompeu Fabra (UPF). This work has been carried out at the Group of Biology of Reproduction (GBR), at the Department of Renewable Marine Resources of the Institute of Marine Sciences (ICM-CSIC). Thesis supervisor: Dr. Francesc Piferrer Professor d’Investigació Institut de Ciències del Mar (ICM-CSIC) i ii A mis padres A Xavi iii iv Acknowledgements This thesis has been made possible by the support of many people who in one way or another, many times unknowingly, gave me the strength to overcome this "long and winding road". First of all, I would like to thank my supervisor, Dr. Francesc Piferrer, for his patience, guidance and wise advice throughout all this Ph.D. experience. But above all, for the trust he placed on me almost seven years ago when he offered me the opportunity to be part of his team. Thanks also for teaching me how to question always everything, for sharing with me your enthusiasm for science and for giving me the opportunity of learning from you by participating in many projects, collaborations and scientific meetings. I am also thankful to my colleagues (former and present Group of Biology of Reproduction members) for your support and encouragement throughout this journey. To the “exGBRs”, thanks for helping me with my first steps into this world. Working as an undergrad with you Dr. -
Molecular Mechanism of the MORC4 Atpase Activation
ARTICLE https://doi.org/10.1038/s41467-020-19278-8 OPEN Molecular mechanism of the MORC4 ATPase activation Adam H. Tencer1, Khan L. Cox2, Gregory M. Wright1, Yi Zhang 1, Christopher J. Petell3, Brianna J. Klein1, ✉ Brian D. Strahl 3, Joshua C. Black1, Michael G. Poirier2 & Tatiana G. Kutateladze 1 Human Microrchidia 4 (MORC4) is associated with acute and chronic pancreatitis, inflam- matory disorders and cancer but it remains largely uncharacterized. Here, we describe the 1234567890():,; structure–function relationship of MORC4 and define the molecular mechanism for MORC4 activation. Enzymatic and binding assays reveal that MORC4 has ATPase activity, which is dependent on DNA-binding functions of both the ATPase domain and CW domain of MORC4. The crystal structure of the ATPaseCW cassette of MORC4 and mutagenesis studies show that the DNA-binding site and the histone/ATPase binding site of CW are located on the opposite sides of the domain. The ATPase and CW domains cooperate in binding of MORC4 to the nucleosome core particle (NCP), enhancing the DNA wrapping around the histone core and impeding binding of DNA-associated proteins, such as tran- scription factors, to the NCP. In cells, MORC4 mediates formation of nuclear bodies in the nucleus and has a role in the progression of S-phase of the cell cycle, and both these functions require CW and catalytic activity of MORC4. Our findings highlight the mechanism for MORC4 activation, which is distinctly different from the mechanisms of action observed in other MORC family members. 1 Department of Pharmacology, University of Colorado School of Medicine, Aurora, CO 80045, USA. -
Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase