DOCSLIB.ORG

Development and Characterization of EST-SSR Markers for Tricyrtissect

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Development and Characterization of EST-SSR Markers for Tricyrtissect ISSN 1346-7565 Acta Phytotax. Geobot. 71 (1): 73–76 (2020) doi: 10.18942/apg.201907 Primer Note Development and Characterization of EST-SSR Markers for Tricyrtis sect. Tricyrtis (Liliaceae) * riku Nakamasu, shota sakaguchi aNd hiroaki setoguchi Graduate School of Human and Environmental Studies, Kyoto University, Yoshida-Nihonmatsu-cho, Sakyo-ku, Kyoto 606-8501, Japan. *[email protected] (author for correspondence) A set of 8 polymorphic EST-SSR markers has been developed to evaluate the genetic diversity and ge- netic structure of the populations of Tricyrtis sect. Tricyrtis (Liliaceae) in Kyushu, which reproduces sexually and asexually by bulbils. The total number of alleles for each locus ranged from 2 to 11 with an average of 5.5, while the values of observed and expected heterozygosity ranged from 0.043 to 0.875 and 0.043 to 0.849, respectively. The combined probabilities of identity (PI = 6.0E-07 and PI-Sib = 2.7E-03) of these markers suggest that they are useful for not only evaluating genetic diversity but also for estimat- ing clonal diversity within populations. Cross-species amplification was evaluated for three phylogenet- ically related species, T. macropoda, T. setouchiensis, and T. affinis, to show that all the EST-SSR mark- ers are transferrable among these species. Key words: EST-SSR, genetic diversity, microsatellite loci, next generation sequencing, population genetics, Tricyrtis Tricyrtis Wall. (Liliaceae) comprises approxi- cable to sect. Tricyrtis. To determine the genetic mately 20 species of perennial herbs in temperate structure and the spatial extent of genets within to subtropical mesic forests of eastern Asia. The populations of the Tricyrtis, additional simple se- species are distributed from the Himalaya to east- quence repeat (SSR) markers that can be stably ern Asia (13 species in Japan) and include many amplified by polymerase chain reaction (PCR) local endemics and endangered species. Tricyrtis were needed. In this study, we developed EST- is divided into 4 sections, Flavae Masam., SSR (expressed sequence tag SSR) markers using Brachycyrtis (Koidz.) Kitag. & T. Koyama, Hir- transcriptome sequencing to evaluate the poly- tae Masam., and Tricyrtis (Takahashi 1980). The morphisms in the Tricyrtis populations produc- largest section Tricyrtis occurs mainly in Japan ing bulbils and in the closely related T. macropo- and China (Takahashi 1987) and includes approx- da, T. setouchiensis Hir. Takah. bis and T. affinis imately 8 species. Recently, populations of Tri- Makino. cyrtis sect. Tricyrtis producing bulbils were dis- covered in northern Kyushu, Japan, while no oth- er species of Tricyrtis that reproduces both sexu- ally and vegetatively via bulbils has previously Materials and Methods been reported. Genetic markers can provide insights into the Fresh leaf tissues of Trichrtis setouchiensis relative contribution of sexual vs. clonal repro- (collected in Wakayama Prefecture, Japan; duction within populations. Although there are voucher accession number OSA60766, represen- genetic markers available for sect. Brachycyrtis tative specimen deposited in Osaka Museum of (Ohki & Setoguchi 2013), none have been appli- Natural History) were frozen in liquid nitrogen 74 Acta Phytotax. Geobot. Vol. 71 and total RNA was extracted by using RNeasy condition was as follows; primer size of 18–22 (Qiagen, Hilden, Germany) according to the bp, annealing temperature of 58–62 ºC, GC con- manufacturer’s protocol. The cDNA library was tent of 30–70%, and an expected product size of prepared following the Illumina protocol (Illumi- 100–450 bp. One of three different M13 universal na, San Diego, California, USA) and 100bp sequence (5’-CACGACGTTGTAAAACGAC-3’, paired-end short-read sequencing was conducted 5’-TGTGGAATTGTGAGCGG-3’, or using the Illumina Hiseq 2000 (Illumina; se- 5’-CTATAGGGCACGCGTGGT-3’) was added quencing performed by BGI, Shenzhen, Guang- to all forward primers and the reverse primers dong Province, China). A total of 34,033,518 raw were tagged with PIG-tail sequences reads were generated. After quality assessment (5’-GTTTCTT-3’). In total, 384 primer pairs were and data filtering (ambiguous limit = 2, quality randomly selected to evaluate amplification and limit = 0.03, eighteen numbers from the begin- polymorphism in the genus Tricyrtis. ning of the 5’ terminal nucleotides were re- Twenty-four individuals of Tricyrtis from moved), 34,004,071 clean reads were obtained three populations were used to screen the primers and assembled using CLC Genomics Workbench (Pop. A = 32.978ºN, 130.107ºE; Pop. B = v.7.5.1 software (DLC bio, Aarhus, Denmark) 33.430ºN, 130.249ºE; Pop. C = 32.751ºN, (DRA accession No.; DRA006602), resulting in 130.284ºE). Sixteen individuals of T. macropoda, 44,618 contigs (word size 23, bubble size 50, min- T. setouchiensis and T. affinis other taxa in sect. imum contig length = 200 bp, average length was Tricyrtis were used to check the versatility of the 669). We screened microsatellite regions for ≥ 10 primers. Silica gel-dried leaf material stored in dinucleotide and ≥ 8 trinucleotide repeats. In to- deep freezer (Panasonic, Japan) at -80 ºC were tal, 1,445 SSR motifs were found. Primers for pulverized with a TissueLyser (Qiagen). After the each SSR were designed using MSATCOM- polysaccharides were removed from this powder MANDER (Faircloth 2008). The designed primer with HEPES buffer (pH 8.0) (Setoguchi & Ohba table 1. Characteristics of the 8 microsatellite markers developed for sect. Tricyrtis. Both pigtail and M13 sequences are un- derlined. Only proteins whose E-values were lower than E-05 are shown. Repeat Allele size BLASTX top GenBank Locus name Primer sequence (5'-3') E-value accession motif range (bp) hit description no. F : CACGACGTTGTAAAACGACGAGGATGAGACCCGGATCTG No Tri_885 (AAG)9 276-297 - LC375740 R : GTTTCTTACCGCATCTGTTATCCTCCC significant hit F : TGTGGAATTGTGAGCGGCATCGCCATTGTTGAGGGTC No Tri_3252 (CTT)12 105-135 - LC375741 R : GTTTCTTCGGCGATACTGTTTCGATCG significant hit F : CACGACGTTGTAAAACGACAGCACCCAAAGCAAGACAAC No Tri_4011 (AAG)11 204-222 - LC375742 R : GTTTCTTGTGCACTTCATCTCCGTGTC significant hit PREDICTED: mediator F : CACGACGTTGTAAAACGACAATCAGCAACCCTCTTTGGC of RNA Tri_10106 (AAC)10 285-324 polymerase II 5.00E-05 LC375743 transcription R : GTTTCTTACTTCCTGGAGCCCTCTTTG subunit 15a [Vitis vinifera] uncharacterized F : CTATAGGGCACGCGTGGTAGAGTAAGCGGCGGACTATG protein Tri_4485 (TTC)10 289-328 LOC8071232 2.00E-13 LC375744 R : GTTTCTTAGATAGCTACTCGTGCAGGC [Sorghum bicolor] F : TGTGGAATTGTGAGCGGAGGTTCATGCTCCAAGGAAC Tri_13531 (AT)12 294-344 No significant hit - LC375745 R : GTTTCTTTTCAGAGGTGGTGGTTCAGG F : CACGACGTTGTAAAACGACACCCTCACCGACAATACCAC Tri_32962 (ACC)8 103-130 No significant hit - LC375746 R : GTTTCTTTGAGGGATTTGAGGGCTGTG F : TGTGGAATTGTGAGCGGACAATCACGAGAACAGTGCG Tri_37933 (AG)10 260-308 No significant hit - LC375747 R : GTTTCTTTATCGCCCTTTCCCACCTTC February 2020 Nakamasu & al. — Microsatellite Markers for sect. Tricyrtis (Liliaceae) 75 table 2. Genetic diversity statistics for the three populations of Tricyrtis producing bulbils based on newly developed EST- SSR primers. NA, number of alleles; HO, observed heterozygosity [significant deviation from Hardy-Weinberg equilibri- um (P < 0.05) is indicated by *]; HE, expected heterozygosity; PI, probability of identity for two unrelated individuals; PI-Sibs, probability of identity for two siblings; CPI, combined PI; CPI-Sibs, combined PI-Sibs. Geographic coordinates for the populations are; Pop. A = 32.978ºN, 130.107ºE; Pop. B = 33.430ºN, 130.249ºE; Pop. C = 32.751ºN, 130.284ºE. Pop. A (n = 24) Pop. B (n = 24) Pop. C (n = 24) Locus name NA HO He PI PI-Sibs NA HO He PI PI-Sibs NA HO He PI PI-Sibs Tri_885 4 0.609 0.612 2.3E-01 5.0E-01 6 0.750 0.707 1.2E-01 4.3E-01 4 0.708 0.651 1.9E-01 4.7E-01 Tri_3252 2 0.043 0.043 9.2E-01 9.6E-01 3 0.250* 0.497 3.4E-01 5.9E-01 3 0.375 0.378 4.2E-01 6.7E-01 Tri_4011 4 0.522 0.615 2.2E-01 5.0E-01 4 0.667 0.619 2.2E-01 5.0E-01 4 0.333 0.322 4.8E-01 7.1E-01 Tri_10106 6 0.818 0.823 5.6E-02 3.5E-01 4 0.522 0.556 2.4E-01 5.3E-01 7 0.875 0.704 1.2E-01 4.3E-01 Tri_4485 6 0.364* 0.810 6.3E-02 3.6E-01 8 0.609 0.830 5.1E-02 3.5E-01 6 0.625 0.799 7.0E-02 3.7E-01 Tri_13531 3 0.435 0.552 2.8E-01 5.5E-01 5 0.583* 0.613 2.2E-01 5.0E-01 6 0.261* 0.376 4.0E-01 6.6E-01 Tri_32962 6 0.739 0.718 1.2E-01 4.2E-01 6 0.458 0.597 2.1E-01 5.0E-01 5 0.875 0.720 1.2E-01 4.2E-01 Tri_37933 10 0.870 0.849 4.0E-02 3.4E-01 11 0.792 0.839 4.3E-02 3.4E-01 9 0.750* 0.760 8.7E-02 3.9E-01 Average 5.125 0.550 0.628 5.875 0.579 0.657 5.500 0.600 0.589 CPI 2.2E-07 2.2E-07 1.4E-06 CPI-Sibs 2.3E-03 2.0E-03 3.8E-03 table 3. Cross-amplification and genetic diversity statistics of EST-SSR primers in related taxa of Tricyrtis. NA, number of alleles, HO, observed heterozygosity [significant deviation from Hardy-Weinberg equilibrium (P < 0.05) is indicated by *]; HE, expected heterozygosity. Geographic coordinates for the populations are; T. macropoda: 32.530ºN, 131.623ºE; T. setouchiensis: 34.734ºN, 135.117ºE; T. affinis: 35.343ºN, 135.758ºE. T. macropoda (n = 16) T. setouchiensis (n = 16) T. affinis (n = 16) Locus name NA HO He NA HO He NA HO He Tri_885 8 0.625 0.770 4 0.733 0.656 5 0.625 0.711 Tri_3252 4 0.563 0.455 7 0.563* 0.693 2 0.625 0.469 Tri_4011 2 0.063 0.061 4 0.750 0.615 3 0.563 0.486 Tri_10106 3 0.750 0.615 7 0.813 0.770 8 0.938 0.787 Tri_4485 8 0.813 0.789 7 0.938 0.789 5 0.500* 0.693 Tri_13531 4 0.625 0.633 5 0.333* 0.684 2 0.125 0.117 Tri_32962 5 0.750 0.629 5 0.625 0.678 4 0.375 0.363 Tri_37933 8 0.688 0.676 10 0.867* 0.858 7 0.688* 0.641 Average 5.25 0.609 0.578 6.13 0.703 0.718 4.50 0.555 0.533 1995), total DNA was extracted using the CTAB fornia, USA) using the GeneScan LIZ-600 size method (Doyle & Doyle 1987).
Load more

Recommended publications
  • Guide to the Flora of the Carolinas, Virginia, and Georgia, Working Draft of 17 March 2004 -- LILIACEAE
    Guide to the Flora of the Carolinas, Virginia, and Georgia, Working Draft of 17 March 2004 -- LILIACEAE LILIACEAE de Jussieu 1789 (Lily Family) (also see AGAVACEAE, ALLIACEAE, ALSTROEMERIACEAE, AMARYLLIDACEAE, ASPARAGACEAE, COLCHICACEAE, HEMEROCALLIDACEAE, HOSTACEAE, HYACINTHACEAE, HYPOXIDACEAE, MELANTHIACEAE, NARTHECIACEAE, RUSCACEAE, SMILACACEAE, THEMIDACEAE, TOFIELDIACEAE) As here interpreted narrowly, the Liliaceae constitutes about 11 genera and 550 species, of the Northern Hemisphere. There has been much recent investigation and re-interpretation of evidence regarding the upper-level taxonomy of the Liliales, with strong suggestions that the broad Liliaceae recognized by Cronquist (1981) is artificial and polyphyletic. Cronquist (1993) himself concurs, at least to a degree: "we still await a comprehensive reorganization of the lilies into several families more comparable to other recognized families of angiosperms." Dahlgren & Clifford (1982) and Dahlgren, Clifford, & Yeo (1985) synthesized an early phase in the modern revolution of monocot taxonomy. Since then, additional research, especially molecular (Duvall et al. 1993, Chase et al. 1993, Bogler & Simpson 1995, and many others), has strongly validated the general lines (and many details) of Dahlgren's arrangement. The most recent synthesis (Kubitzki 1998a) is followed as the basis for familial and generic taxonomy of the lilies and their relatives (see summary below). References: Angiosperm Phylogeny Group (1998, 2003); Tamura in Kubitzki (1998a). Our “liliaceous” genera (members of orders placed in the Lilianae) are therefore divided as shown below, largely following Kubitzki (1998a) and some more recent molecular analyses. ALISMATALES TOFIELDIACEAE: Pleea, Tofieldia. LILIALES ALSTROEMERIACEAE: Alstroemeria COLCHICACEAE: Colchicum, Uvularia. LILIACEAE: Clintonia, Erythronium, Lilium, Medeola, Prosartes, Streptopus, Tricyrtis, Tulipa. MELANTHIACEAE: Amianthium, Anticlea, Chamaelirium, Helonias, Melanthium, Schoenocaulon, Stenanthium, Veratrum, Toxicoscordion, Trillium, Xerophyllum, Zigadenus.
    [Show full text]
  • Number 35 July-September
    THE BULB NEWSLETTER Number 35 July-September 2001 Amana lives, long live Among! ln the Kew Scientist, Issue 19 (April 2001), Kew's Dr Mike Fay reports on the molecular work that has been carried out on Among. This little tulip«like eastern Asiatic group of Liliaceae that we have long grown and loved as Among (A. edulis, A. latifolla, A. erythroniolde ), but which took a trip into the genus Tulipa, should in fact be treated as a distinct genus. The report notes that "Molecular data have shown this group to be as distinct from Tulipa s.s. [i.e. in the strict sense, excluding Among] as Erythronium, and the three genera should be recognised.” This is good news all round. I need not change the labels on the pots (they still labelled Among), neither will i have to re~|abel all the as Erythronlum species tulips! _ Among edulis is a remarkably persistent little plant. The bulbs of it in the BN garden were acquired in the early 19605 but had been in cultivation well before that, brought back to England by a plant enthusiast participating in the Korean war. Although not as showy as the tulips, they are pleasing little bulbs with starry white flowers striped purplish-brown on the outside. It takes a fair amount of sun to encourage them to open, so in cool temperate gardens where the light intensity is poor in winter and spring, pot cultivation in a glasshouse is the best method of cultivation. With the extra protection and warmth, the flowers will open out almost flat.
    [Show full text]
  • Tricyrtis Hirta Tricyrtis Hirta, the Toad Lily, Or Hairy Toad Lily, Is a Japanese Species of Hardy Perennial Plants in the Lily Family
    Tricyrtis hirta Tricyrtis hirta, the toad lily, or hairy toad lily, is a Japanese species of hardy perennial plants in the lily family. Tricyrtis hirta is found growing on shaded rocky cliffs and stream banks in central and southern Japan. Leaves are large and wide, clasping around the stem. The flowers are whitish to pale purple with dark purple spots. Culture Easily grown in average, medium to wet, well-drained soils in part to full shade. Prefers moist, organically rich, humusy, slightly acidic soils in part shade. Soil must not be allowed to dry out. Non-rhizomatous. May self-seed in optimum growing conditions. Noteworthy Characteristics Tricyrtis hirta, commonly called toad lily, is perhaps best known for its unique flowers, ability to bloom in shade and late summer to early fall bloom time. Features small, lily-like flowers (1 inch long) with six showy tepals (similar appearing sepals and petals). Flowers appear in the upper leaf axils and stem ends either solitary or more often in small clusters (cymes) of 2-3 flowers each. White to pale lilac flowers with heavy purple spotting. Arching, unbranched stems grow upright to 2-3' tall. Sometimes called hairy toad lily because all parts of the plant are hairy. This species of toad lily is not rhizomatous. Oval to oblong leaves (3-6" long) with parallel veins and clasping leaf bases. Genus name comes from the Greek words tri- meaning three and kyrtos meaning humped as the bases of the three outer petals are swollen and sacklike. Specific epithet means hairy. Garden Uses Borders, woodland gardens, shade gardens or naturalized areas.
    [Show full text]
  • Tricyrtis Ravenii (Liliaceae), a New Species from Taiwan
    Botanical Studies (2007) 48: 357-364. TAXONOMY Tricyrtis ravenii (Liliaceae), a new species from Taiwan Ching-I PENG1,*, Choon-Lin TIANG1, and Tsai-Wen HSU2 1Herbarium (HAST), Research Center for Biodiversity, Academia Sinica, Nangang, Taipei 115, Taiwan 2Endemic Species Research Institute, 1 Ming-Sheng E. Road, Chi-Chi, Nantou 552, Taiwan (Received May 22, 2006; Accepted December 29, 2006) ABSTRACT. Tricyrtis ravenii (Liliaceae) is reported here as a new species endemic to Taiwan. It belongs to sect. Hirtae, which comprises three species heretofore, namely T. hirta (Japan mainland, mainly on the Pacific side), T. formosana (Taiwan and Iriomote, Japan) and T. lasiocarpa (Taiwan). Bearing a superficial resemblance to Tricyrtis formosana, specimens of T. ravenii in most herbaria were nearly always erroneously annotated as the former or its synonyms such as T. stolonifera. Careful morphological studies of these plants both from the field and in the experimental greenhouse reveal that they differ from T. formosana significantly in floral details, habit, occur at higher elevations and deserve recognition of a new species. A taxonomic treatment, line drawings, field and micro-photographs of epidermal characters, karyotype analysis, and a map showing their distribution on this island is provided. A key is prepared to aid in the identification of all four species of Tricyrtis sect. Hirtae. Keywords: Chromosome number; Endemic species; Karyotype; Liliaceae; New species; sect. Hirtae; Taiwan; Taxonomy; Tricyrtis hirta; Tricyrtis formosana; Tricyrtis
    [Show full text]
  • Phylogenetic Relationships of Monocots Based on the Highly Informative Plastid Gene Ndhf Thomas J
    Aliso: A Journal of Systematic and Evolutionary Botany Volume 22 | Issue 1 Article 4 2006 Phylogenetic Relationships of Monocots Based on the Highly Informative Plastid Gene ndhF Thomas J. Givnish University of Wisconsin-Madison J. Chris Pires University of Wisconsin-Madison; University of Missouri Sean W. Graham University of British Columbia Marc A. McPherson University of Alberta; Duke University Linda M. Prince Rancho Santa Ana Botanic Gardens See next page for additional authors Follow this and additional works at: http://scholarship.claremont.edu/aliso Part of the Botany Commons Recommended Citation Givnish, Thomas J.; Pires, J. Chris; Graham, Sean W.; McPherson, Marc A.; Prince, Linda M.; Patterson, Thomas B.; Rai, Hardeep S.; Roalson, Eric H.; Evans, Timothy M.; Hahn, William J.; Millam, Kendra C.; Meerow, Alan W.; Molvray, Mia; Kores, Paul J.; O'Brien, Heath W.; Hall, Jocelyn C.; Kress, W. John; and Sytsma, Kenneth J. (2006) "Phylogenetic Relationships of Monocots Based on the Highly Informative Plastid Gene ndhF," Aliso: A Journal of Systematic and Evolutionary Botany: Vol. 22: Iss. 1, Article 4. Available at: http://scholarship.claremont.edu/aliso/vol22/iss1/4 Phylogenetic Relationships of Monocots Based on the Highly Informative Plastid Gene ndhF Authors Thomas J. Givnish, J. Chris Pires, Sean W. Graham, Marc A. McPherson, Linda M. Prince, Thomas B. Patterson, Hardeep S. Rai, Eric H. Roalson, Timothy M. Evans, William J. Hahn, Kendra C. Millam, Alan W. Meerow, Mia Molvray, Paul J. Kores, Heath W. O'Brien, Jocelyn C. Hall, W. John Kress, and Kenneth J. Sytsma This article is available in Aliso: A Journal of Systematic and Evolutionary Botany: http://scholarship.claremont.edu/aliso/vol22/iss1/ 4 Aliso 22, pp.
    [Show full text]
  • Toad Lily Free Gift
    Emeral Goddes Garden emeraldgoddessgarden.co A Gift from Our Garden Botanical Name Tricyrtis formosana samurai Common Name Variegated Toad Lily Mature Size 2 ft. Bloom Color Spotted Purple and Yellow Bloom Period Late Summer to Fall Bloom Form Lily/ Orchid like Water Consistent Moisture Light Shade Fragrance None Uses Borders, Mixed Perennials, Pots, Shade Garden Special Features U, nique, Interesting flower and foliage USDA Hardiness, , 4, 5, 6, 7, 8, 9A Tricyrtis is a small genus of the Liliaceae family that contains fewer than a couple of dozen cultivars. These interesting shade perennials are commonly called Toad Lilies. The common name arose from an elaborate hoax perpetrated on the world's scientific and anthropological communities in the 70's regarding the discovery of an aboriginal native tribe in the Philippines. One of the embellishments of this story was that these natives rubbed the crushed leaves of a native tricyrtis species on their hands and arms as an attractant for toads, which were then caught with bare hands and eaten raw. Even though the hoax was later exposed, the common name of Toad Lily for the tricyrtis stuck. Tricyrtis formosana samurari or Variegated Toad Lily is an interesting cultivar that has green leaves with a creamy gold toned variegation along the outer edge. It is perhaps the most widely planted type. It blooms late in the summer and early fall with small, but infinitely interesting, unique, lily like spotted flowers with yellow throats that look somewhat like a lily, or perhaps a bit more like an orchid. It's a great plant for along shady paths or in pots on the porch or patio where the flowers can be admired and appreciated up close.
    [Show full text]
  • Les Tricyrtis (Lis Crapaud)
    Les tricyrtis (lis crapaud) Ni des lis ni d'apparenté aux crapauds, mais une magnifique floraison en fin d'été ou à l'automne, selon les variétés. Malgré leur apparence trompeuse d’orchidée les tricyrtis font partie de la famille des liliaceae et malgré leur aspect exotique ils sont très rustiques, classé zone 5 (donc ils supporteront une température moyenne de -29°c en hiver). On peut donc les planter au jardin sans hésitation si nous respectons, comme pour toute autre plante, ses besoins en type de terre et d’exposition. Originaires de l’orient (la Chine, la Népal, les deux Corées, les Philippines, le Taiwan et le Japon) ils sont cultivés en Europe depuis leur introduction à Kew Tricyrtis ‘Empress’ (Angleterre) dans les années 1850. Mais pendant 140 ans ils sont restés très discrets, leur culture limitée aux jardins botaniques et quelques collectionneurs. A partir de 1990 le Jardin Botanique de Chicago a évalué les tricyrtis au cours d'un essai qui a duré 10 ans. Leur étude a démontré aux jardiniers et pépiniéristes des Etats-Unis et ensuite à ceux de l’Europe la grande valeur décorative du genre. Le développement de nouveaux cultivars aux Etats-Unis et l’introduction de nouvelles espèces, sélections et hybrides venus du Japon a été rapide surtout à partir du début de ce siècle. Heureusement ces belles Tricyrtis ‘Adbane’ nouveautés n’ont pas tardé à traverser l’Atlantique. Comment cultiver les tricyrtis A l’état sauvage les tricyrtis poussent à la lisière des bois et des clairières, dans une terre riche et humifère qui reste fraîche en été.
    [Show full text]
  • Molecular Systematics of the Genus Uvularia and Selected Liliales Based Upon Matk and Rbcl Gene Sequence Data
    Plant Species Biol, 13 : 129-146, 1998 PLANT SPECIES BIOLOGY > by the Society for the Study of Species Biology Molecular Systematics of the Genus Uvularia and Selected Liliales Based upon matK and rbcL Gene Sequence Data KAZUHIKO HAYASHI1' 2), SEIJI YOSHIDA3", HIDETOSHI KATO41, FREDERICK H. UTECH51, DENNIS F. WHIGHAM61 and SHOICHI KAWANO11 1) Department of Botany, Graduate School of Science, Kyoto University, Kyoto 606-8502, Japan 21 Biology Laboratory, Osaka Gakuin University, Suita, Osaka 564-8511, Japan 31 Taishi Senior High School, Taishi, Ibo, Hyogo 671-1532, Japan 41 Makino Herbarium, Department of Biology, Faculty of Science, Tokyo Meteropolitan University, Hachioji, Tokyo 192-0397, Japan 5) Carnegie Museum of Natural History, Pittsburgh, PA 15213, U.S.A. 61 Smithsonian Environmental Research Center, Edgewater, MD 21037, U.S.A. Abstract To elucidate the affinity and phylogeny of the endemic North American genus Uvularia, two chloroplast genes, matK and rbcL, were sequenced for all five species of the genus {Uvularia floridana, U. grandifolia, U. per- foliata, U. puberula, and U. sessilifolia) and four selected members of the Liliales (Erythronium japonicum, Disporum sessile, Medeola virginiana, and Clintonia borealis). Sequence data of both matK and rbcL genes support an Uvularia which consist of two clades, section Oakesiella and section Uvularia. Though sessile-leaved and associated with sec- tion Oakesiella, U. puberula exhibits several intermediate characteristics between the sections. However, the overall molecular results correspond to an earlier sub-grouping based upon gross morphology, karyology and ecological life history traits. These two cpDNA genes, notably matK tree, proved to be informative in reaffirming relationships with- in Uvularia.
    [Show full text]
  • Short Botanical List of Non-Bulbous Plant Families and Genera
    SHORT BOTANICAL LIST OF NON-BULBOUS PLANT FAMILIES AND GENERA Apiaceae ​(was ​Umbelliferae​): Aciphylla, Astrantia, Azorella, Bolax, Hacquetia, etc. Asparagaceae​: Anthericum, Arthropodium, Disporopsis, Hosta, Maianthemum, Ophiopogon, Polygonatum, Speirantha, etc Berberidaceae​: Berberis, Bongardia, Dysosma, Epimedium, Gymnospermium, Jeffersonia, Leontice, Mahonia, Podophyllum, Ranzania, Sinopodophyllum, Vancouveria, etc. Boraginaceae: ​Alkanna, Anchusa, Eritrichium, Hesperochiron, Lithodora, Mertensia, Moltkia, Myosotis, Omphalodes, Onosma, Phacelia, Pulmonaria, Romanzoffia, etc Brassicaceae: ​Aethionema, Alyssum, Arabis, Aubrieta, Cardamine, Chorispora, Clausia, Degenia, Draba, Erysimum, Fibigia, Iberis, Matthiola, Morisia, Notothlaspi, Petrocallis, Thlaspi, Xerodraba, etc Cactaceae​: Echinocereus, Lobivia, Maihuenia, Mammilaria, Opuntia, Pediocactus, Rebutia, Sclerocactus, etc Calceolariaceae​: Calceolaria , Jovellana Campanulaceae​: Adenophora, Asyneuma, Campanula ( inc. Diosphaera), Codonopsis, Cyananthus, Edraianthus, Favratia, Isotoma, Lobelia (inc. Hypsella and Pratia), Physoplexis, Phyteuma, Platycodon,Trachelium, Wahlenbergia, etc. Caryophyllaceae​: Arenaria, Cerastium, Dianthus, Gypsophila, Lychnis, Minuartia, Petrorhagia (was Tunica), Saponaria, Silene, Vaccaria (was Melandrium) etc. Celastraceae: ​Euonymus, Parnassia Colchicaceae:​ Disporum, Uvularia Commelinaceae​: Weldenia. Compositae ​(was ​Asteraceae​): Achillea, Anacyclus, Anaphalis, Antennaria, Anthemis, Artemisia, Aster, Brachyclados, Brachyglottis, Carduncellus, Celmisia,
    [Show full text]
  • Phylogenetics of Liliales
    Aliso: A Journal of Systematic and Floristic Botany Volume 22 Issue 1 Article 43 2006 Phylogenetics of Liliales Michael F. Fay Royal Botanic Gardens, Kew Mark W. Chase Royal Botanic Gardens, Kew Nina Rønsted Royal Botanic Gardens, Kew Dion S. Devey Royal Botanic Gardens, Kew Yohan Pillon Royal Botanic Gardens, Kew See next page for additional authors Follow this and additional works at: https://scholarship.claremont.edu/aliso Part of the Botany Commons Recommended Citation Fay, Michael F.; Chase, Mark W.; Rønsted, Nina; Devey, Dion S.; Pillon, Yohan; Pires, J. Chris; Peterson, Gitte; Seberg, Ole; and Davis, Jerrold I. (2006) "Phylogenetics of Liliales," Aliso: A Journal of Systematic and Floristic Botany: Vol. 22: Iss. 1, Article 43. Available at: https://scholarship.claremont.edu/aliso/vol22/iss1/43 Phylogenetics of Liliales Authors Michael F. Fay, Mark W. Chase, Nina Rønsted, Dion S. Devey, Yohan Pillon, J. Chris Pires, Gitte Peterson, Ole Seberg, and Jerrold I. Davis This article is available in Aliso: A Journal of Systematic and Floristic Botany: https://scholarship.claremont.edu/ aliso/vol22/iss1/43 Liliales MONOCOTS Comparative Biology and Evolution Excluding Poales Aliso 22, pp. 559-565 © 2006, Rancho Santa Ana Botanic Garden PHYLOGENETICS OF LILIALES: SUMMARIZED EVIDENCE FROM COMBINED ANALYSES OF FIVE PLASTID AND ONE MITOCHONDRIAL LOCI 1 5 1 1 1 1 2 6 MICHAEL F. FAY, • MARK W. CHASE, NINA R0NSTED, DION S. DEVEY, YOHAN PILLON, J. CHRIS PIRES, • GITTE PETERSEN,3·7 OLE SEBERG,3·7 AND JERROLD I DAVIS4 1lodrell Laboratory, Royal Botanic Gardens, Kew, Richmond, Surrey TW9 3DS, UK; 2Department of Agronomy, University of Wisconsin, Madison, Wisconsin 53706, USA; 3Botanical Institute, University of Copenhagen, Gothersgade 140, DK-1123 Copenhagen K, Denmark; 4L.
    [Show full text]
  • Plant Evaluation Notes an Evaluation Study of Tricyrtis Richard G
    Issue 16, 2001 Plant Evaluation Notes An Evaluation Study of Tricyrtis Richard G. Hawke, Manager of Plant Evaluation Programs he subtle blossoms of Tricyrtis, or toad three outer tepals. The tepals usually form an and hybrids being introduced from Japan and lily, bloom in late summer and autumn, upward- or downward-facing funnel, and the United States, including forms with var- Ta time of year when color is rare in pouch-like appendages are located at the base iegated foliage and dwarf habits. Many are shade and woodland gardens. Uncommon of each outer tepal. available only from specialty nurseries, or beauty, late-season blooms and adaptability to Toad lilies are perfect plants for moist in limited quantities, but several species shade give the toad lilies exceptional garden woodlands or shady gardens. In cultivation, have become common in garden centers and merit. they grow best in a moist, humus-rich soil, in nurseries everywhere. Tricyrtis is no longer a There are 16 herbaceous perennial light to moderate shade. Foliage may scorch botanical curiosity or specialty plant, but is species of Tricyrtis, native from the eastern in full sun, but plants will tolerate more sun- recognized as an outstanding perennial for Himalayas to China, Japan, Taiwan and the light if given adequate soil moisture. Leaves late-season interest in shade and woodland Philippines, growing in tall grass near the edge emerge in late spring, usually avoiding frost, gardens. but flowers and leaves can be damaged by of mountain woodlands or in damp, shady The Evaluation Project early autumn frost. The flowers open late in ravines.
    [Show full text]
  • Studies in the Genus Fritillaria L. (Liliaceae)
    Studies in the genus Fritillaria L. (Liliaceae) Peter D. Day, BSc. October 2017 Submitted in partial fulfilment of the requirements of the Degree of Doctor of Philosophy Supervisors: Prof. Andrew R. Leitch Dr Ilia J. Leitch Statement of Originality I, Peter Donal Day, confirm that the research included within this thesis is my own work or that where it has been carried out in collaboration with, or supported by others, that this is duly acknowledged below and my contribution indicated. Previously published material is also acknowledged below. I attest that I have exercised reasonable care to ensure that the work is original, and does not to the best of my knowledge break any UK law, infringe any third party’s copyright or other Intellectual Property Right, or contain any confidential material. I accept that the College has the right to use plagiarism detection software to check the electronic version of the thesis. I confirm that this thesis has not been previously submitted for the award of a degree by this or any other university. The copyright of this thesis rests with the author and no quotation from it or information derived from it may be published without the prior written consent of the author. Signature: Date: October 31st 2017 Details of collaboration and publications. Chapter 2 is published in Day et al. (2014): Day PD, Berger M, Hill L, Fay MF, Leitch AR, Leitch IJ, Kelly LJ (2014). Evolutionary relationships in the medicinally important genus Fritillaria L. (Liliaceae). Molecular Phylogenetics and Evolution, 80: 11-19. Martyn
    [Show full text]