Development and Characterization of EST-SSR Markers for Tricyrtissect

Development and Characterization of EST-SSR Markers for Tricyrtissect

ISSN 1346-7565 Acta Phytotax. Geobot. 71 (1): 73–76 (2020) doi: 10.18942/apg.201907 Primer Note Development and Characterization of EST-SSR Markers for Tricyrtis sect. Tricyrtis (Liliaceae) * riku Nakamasu, shota sakaguchi aNd hiroaki setoguchi Graduate School of Human and Environmental Studies, Kyoto University, Yoshida-Nihonmatsu-cho, Sakyo-ku, Kyoto 606-8501, Japan. *[email protected] (author for correspondence) A set of 8 polymorphic EST-SSR markers has been developed to evaluate the genetic diversity and ge- netic structure of the populations of Tricyrtis sect. Tricyrtis (Liliaceae) in Kyushu, which reproduces sexually and asexually by bulbils. The total number of alleles for each locus ranged from 2 to 11 with an average of 5.5, while the values of observed and expected heterozygosity ranged from 0.043 to 0.875 and 0.043 to 0.849, respectively. The combined probabilities of identity (PI = 6.0E-07 and PI-Sib = 2.7E-03) of these markers suggest that they are useful for not only evaluating genetic diversity but also for estimat- ing clonal diversity within populations. Cross-species amplification was evaluated for three phylogenet- ically related species, T. macropoda, T. setouchiensis, and T. affinis, to show that all the EST-SSR mark- ers are transferrable among these species. Key words: EST-SSR, genetic diversity, microsatellite loci, next generation sequencing, population genetics, Tricyrtis Tricyrtis Wall. (Liliaceae) comprises approxi- cable to sect. Tricyrtis. To determine the genetic mately 20 species of perennial herbs in temperate structure and the spatial extent of genets within to subtropical mesic forests of eastern Asia. The populations of the Tricyrtis, additional simple se- species are distributed from the Himalaya to east- quence repeat (SSR) markers that can be stably ern Asia (13 species in Japan) and include many amplified by polymerase chain reaction (PCR) local endemics and endangered species. Tricyrtis were needed. In this study, we developed EST- is divided into 4 sections, Flavae Masam., SSR (expressed sequence tag SSR) markers using Brachycyrtis (Koidz.) Kitag. & T. Koyama, Hir- transcriptome sequencing to evaluate the poly- tae Masam., and Tricyrtis (Takahashi 1980). The morphisms in the Tricyrtis populations produc- largest section Tricyrtis occurs mainly in Japan ing bulbils and in the closely related T. macropo- and China (Takahashi 1987) and includes approx- da, T. setouchiensis Hir. Takah. bis and T. affinis imately 8 species. Recently, populations of Tri- Makino. cyrtis sect. Tricyrtis producing bulbils were dis- covered in northern Kyushu, Japan, while no oth- er species of Tricyrtis that reproduces both sexu- ally and vegetatively via bulbils has previously Materials and Methods been reported. Genetic markers can provide insights into the Fresh leaf tissues of Trichrtis setouchiensis relative contribution of sexual vs. clonal repro- (collected in Wakayama Prefecture, Japan; duction within populations. Although there are voucher accession number OSA60766, represen- genetic markers available for sect. Brachycyrtis tative specimen deposited in Osaka Museum of (Ohki & Setoguchi 2013), none have been appli- Natural History) were frozen in liquid nitrogen 74 Acta Phytotax. Geobot. Vol. 71 and total RNA was extracted by using RNeasy condition was as follows; primer size of 18–22 (Qiagen, Hilden, Germany) according to the bp, annealing temperature of 58–62 ºC, GC con- manufacturer’s protocol. The cDNA library was tent of 30–70%, and an expected product size of prepared following the Illumina protocol (Illumi- 100–450 bp. One of three different M13 universal na, San Diego, California, USA) and 100bp sequence (5’-CACGACGTTGTAAAACGAC-3’, paired-end short-read sequencing was conducted 5’-TGTGGAATTGTGAGCGG-3’, or using the Illumina Hiseq 2000 (Illumina; se- 5’-CTATAGGGCACGCGTGGT-3’) was added quencing performed by BGI, Shenzhen, Guang- to all forward primers and the reverse primers dong Province, China). A total of 34,033,518 raw were tagged with PIG-tail sequences reads were generated. After quality assessment (5’-GTTTCTT-3’). In total, 384 primer pairs were and data filtering (ambiguous limit = 2, quality randomly selected to evaluate amplification and limit = 0.03, eighteen numbers from the begin- polymorphism in the genus Tricyrtis. ning of the 5’ terminal nucleotides were re- Twenty-four individuals of Tricyrtis from moved), 34,004,071 clean reads were obtained three populations were used to screen the primers and assembled using CLC Genomics Workbench (Pop. A = 32.978ºN, 130.107ºE; Pop. B = v.7.5.1 software (DLC bio, Aarhus, Denmark) 33.430ºN, 130.249ºE; Pop. C = 32.751ºN, (DRA accession No.; DRA006602), resulting in 130.284ºE). Sixteen individuals of T. macropoda, 44,618 contigs (word size 23, bubble size 50, min- T. setouchiensis and T. affinis other taxa in sect. imum contig length = 200 bp, average length was Tricyrtis were used to check the versatility of the 669). We screened microsatellite regions for ≥ 10 primers. Silica gel-dried leaf material stored in dinucleotide and ≥ 8 trinucleotide repeats. In to- deep freezer (Panasonic, Japan) at -80 ºC were tal, 1,445 SSR motifs were found. Primers for pulverized with a TissueLyser (Qiagen). After the each SSR were designed using MSATCOM- polysaccharides were removed from this powder MANDER (Faircloth 2008). The designed primer with HEPES buffer (pH 8.0) (Setoguchi & Ohba table 1. Characteristics of the 8 microsatellite markers developed for sect. Tricyrtis. Both pigtail and M13 sequences are un- derlined. Only proteins whose E-values were lower than E-05 are shown. Repeat Allele size BLASTX top GenBank Locus name Primer sequence (5'-3') E-value accession motif range (bp) hit description no. F : CACGACGTTGTAAAACGACGAGGATGAGACCCGGATCTG No Tri_885 (AAG)9 276-297 - LC375740 R : GTTTCTTACCGCATCTGTTATCCTCCC significant hit F : TGTGGAATTGTGAGCGGCATCGCCATTGTTGAGGGTC No Tri_3252 (CTT)12 105-135 - LC375741 R : GTTTCTTCGGCGATACTGTTTCGATCG significant hit F : CACGACGTTGTAAAACGACAGCACCCAAAGCAAGACAAC No Tri_4011 (AAG)11 204-222 - LC375742 R : GTTTCTTGTGCACTTCATCTCCGTGTC significant hit PREDICTED: mediator F : CACGACGTTGTAAAACGACAATCAGCAACCCTCTTTGGC of RNA Tri_10106 (AAC)10 285-324 polymerase II 5.00E-05 LC375743 transcription R : GTTTCTTACTTCCTGGAGCCCTCTTTG subunit 15a [Vitis vinifera] uncharacterized F : CTATAGGGCACGCGTGGTAGAGTAAGCGGCGGACTATG protein Tri_4485 (TTC)10 289-328 LOC8071232 2.00E-13 LC375744 R : GTTTCTTAGATAGCTACTCGTGCAGGC [Sorghum bicolor] F : TGTGGAATTGTGAGCGGAGGTTCATGCTCCAAGGAAC Tri_13531 (AT)12 294-344 No significant hit - LC375745 R : GTTTCTTTTCAGAGGTGGTGGTTCAGG F : CACGACGTTGTAAAACGACACCCTCACCGACAATACCAC Tri_32962 (ACC)8 103-130 No significant hit - LC375746 R : GTTTCTTTGAGGGATTTGAGGGCTGTG F : TGTGGAATTGTGAGCGGACAATCACGAGAACAGTGCG Tri_37933 (AG)10 260-308 No significant hit - LC375747 R : GTTTCTTTATCGCCCTTTCCCACCTTC February 2020 Nakamasu & al. — Microsatellite Markers for sect. Tricyrtis (Liliaceae) 75 table 2. Genetic diversity statistics for the three populations of Tricyrtis producing bulbils based on newly developed EST- SSR primers. NA, number of alleles; HO, observed heterozygosity [significant deviation from Hardy-Weinberg equilibri- um (P < 0.05) is indicated by *]; HE, expected heterozygosity; PI, probability of identity for two unrelated individuals; PI-Sibs, probability of identity for two siblings; CPI, combined PI; CPI-Sibs, combined PI-Sibs. Geographic coordinates for the populations are; Pop. A = 32.978ºN, 130.107ºE; Pop. B = 33.430ºN, 130.249ºE; Pop. C = 32.751ºN, 130.284ºE. Pop. A (n = 24) Pop. B (n = 24) Pop. C (n = 24) Locus name NA HO He PI PI-Sibs NA HO He PI PI-Sibs NA HO He PI PI-Sibs Tri_885 4 0.609 0.612 2.3E-01 5.0E-01 6 0.750 0.707 1.2E-01 4.3E-01 4 0.708 0.651 1.9E-01 4.7E-01 Tri_3252 2 0.043 0.043 9.2E-01 9.6E-01 3 0.250* 0.497 3.4E-01 5.9E-01 3 0.375 0.378 4.2E-01 6.7E-01 Tri_4011 4 0.522 0.615 2.2E-01 5.0E-01 4 0.667 0.619 2.2E-01 5.0E-01 4 0.333 0.322 4.8E-01 7.1E-01 Tri_10106 6 0.818 0.823 5.6E-02 3.5E-01 4 0.522 0.556 2.4E-01 5.3E-01 7 0.875 0.704 1.2E-01 4.3E-01 Tri_4485 6 0.364* 0.810 6.3E-02 3.6E-01 8 0.609 0.830 5.1E-02 3.5E-01 6 0.625 0.799 7.0E-02 3.7E-01 Tri_13531 3 0.435 0.552 2.8E-01 5.5E-01 5 0.583* 0.613 2.2E-01 5.0E-01 6 0.261* 0.376 4.0E-01 6.6E-01 Tri_32962 6 0.739 0.718 1.2E-01 4.2E-01 6 0.458 0.597 2.1E-01 5.0E-01 5 0.875 0.720 1.2E-01 4.2E-01 Tri_37933 10 0.870 0.849 4.0E-02 3.4E-01 11 0.792 0.839 4.3E-02 3.4E-01 9 0.750* 0.760 8.7E-02 3.9E-01 Average 5.125 0.550 0.628 5.875 0.579 0.657 5.500 0.600 0.589 CPI 2.2E-07 2.2E-07 1.4E-06 CPI-Sibs 2.3E-03 2.0E-03 3.8E-03 table 3. Cross-amplification and genetic diversity statistics of EST-SSR primers in related taxa of Tricyrtis. NA, number of alleles, HO, observed heterozygosity [significant deviation from Hardy-Weinberg equilibrium (P < 0.05) is indicated by *]; HE, expected heterozygosity. Geographic coordinates for the populations are; T. macropoda: 32.530ºN, 131.623ºE; T. setouchiensis: 34.734ºN, 135.117ºE; T. affinis: 35.343ºN, 135.758ºE. T. macropoda (n = 16) T. setouchiensis (n = 16) T. affinis (n = 16) Locus name NA HO He NA HO He NA HO He Tri_885 8 0.625 0.770 4 0.733 0.656 5 0.625 0.711 Tri_3252 4 0.563 0.455 7 0.563* 0.693 2 0.625 0.469 Tri_4011 2 0.063 0.061 4 0.750 0.615 3 0.563 0.486 Tri_10106 3 0.750 0.615 7 0.813 0.770 8 0.938 0.787 Tri_4485 8 0.813 0.789 7 0.938 0.789 5 0.500* 0.693 Tri_13531 4 0.625 0.633 5 0.333* 0.684 2 0.125 0.117 Tri_32962 5 0.750 0.629 5 0.625 0.678 4 0.375 0.363 Tri_37933 8 0.688 0.676 10 0.867* 0.858 7 0.688* 0.641 Average 5.25 0.609 0.578 6.13 0.703 0.718 4.50 0.555 0.533 1995), total DNA was extracted using the CTAB fornia, USA) using the GeneScan LIZ-600 size method (Doyle & Doyle 1987).

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    4 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us