1 2 ´ÉÉʹÉÇEò |ÉÊiÉ´ÉänùxÉ ANNUAL REPORT 2018-2019
CSIR-National Institute for Interdisciplinary Science & Technology (NIIST)
3 Fig.1.SEM micrograph of acid digested diatom frustules isolated from marine backwaters which is having radially symmetric ordered porous structure, Fig.2. AFM images of A549 cells after treatment with RhB-cathB@anti-EGFR.
Fig. 3. SEM micrograph of the densified La0.67Sr0.33MnO3 perovskite compounds, Fig. 4. SEM micrograph of carbon fiber electrodeposited with nickel for microwave invisible fabrics, Fig. 5: Fluorescence microscopy images RhB-cathB@anti-EGFR in A549 cells, Fig. 6. AFM image of helical and superhelical fibers formed by a self-assembly of amide functionalized chiral phenyleneethynylene derivative, Fig. 7. TEM image of helical and superhelical fibers formed by a self-assembly of amide functionalized chiral phenyleneethynylene derivative, Fig. 8. SEM micrograph of the aerial mycelium of Streptomyces isolated from a forest soil
´ÉÉʹÉÇEò |ÉÊiÉ´ÉänùxÉ 2018-2019 ANNUAL REPORT Published by : The Director National Institute for Interdisciplinary Science & Technology, Thiruvananthapuram
Editorial Committee : Dr. Nishy P Dr. Manoj Raama Varma Mr. Chandrakanth.C.K Dr. Narayanan Unni K Dr. Rajeev K. Sukumaran Dr. Satyajit Vishnu Shukla Mr. Praveen Raj R.S Mr. Moni. V Mr. Abdul Haleem B Dr. Sasidhar B.S Dr. Indu Sharma Mr. Raj Kumar Mr. Vishnu Gurjar Dr. Deepa Balan
Hindi Translation : Mrs K S Lathidevi Mr Vishnu Gurjar
Photography : Mr G Nagasrinivasu
Design & Printing : Akshara Offset Thiruvananthapuram
ºÉÒ BºÉ +É<Ç +É®ú - ®úɹ]ÅõÒªÉ +ÆiÉ̴ɹɪÉÒ Ê´ÉYÉÉxÉ iÉlÉÉ |ÉÉètÉäÊMÉEòÒ ºÉƺlÉÉxÉ
CSIR–National Institute for Interdisciplinary Science and Technology (NIIST)
4 contents
05 | Foreword
09 | Significant Achievements
15 | Agro Processing & Technology Division
29 | Chemical Sciences & Technology Division
49 | Environmental Technology Division
63 | Materials Science & Technology Division
75 | Microbial Processes & Technology Division
89 | S & T Services
149 | General Information
5 अनुसधानं समिति RESEARCH COUNCIL अध㔯क्ष CHAIRMAN ꥍ셋 पद्मनाभन Prof Padmanabhan प्रख्봾त व्啍鄿 प्र셋 Professor of Eminence तकनीकी इजीं नियरिंग विभाग और सलाहकार, Department of Technical Engineering प्र셌饍योगकी के लिए कᴂद्र विकास और स्थनांतरणकॉलेज ऑफ इजीं नियरिंग गइु डीं , and Advisor, Centre for Technology अन्न विश्ववि饍봾लय Development and Transfer,College of Engineering Guindy, चेन्ई 600,025 Anna University, Chennai-600025 सदस㔯ⴂ MEMBERS डॉ के सी गुꥍत Dr K C Gupta परू 㔵 निदेशक, आईआईटीआर, 233, धरमकंु ज अपार्मᴂट, Formerly Director, IITR 233, Dharamkunj Apartment, Sector-9, Robini, Delhi 110085 सेक्ट -9, रोबिनी, दिल्ल 110085 Dr G N Qazi डॉ जी एन क़ज़ Director General महानिदेशक Hamdart Institute of Medical, हमदार् इसं ्टट्यटू ऑफ मेडिकल साइसं और Science and Research (HIMSR) अनसु ंधान (एचआईएमएसआर) Prof A Ramanan ꥍ셋 ए रमणन Department of Chemistry रसायनिकी विभाग Indian Institute of Technology, Hauzkhas, भारतीय प्र셌饍योगकी संस्थन, हौजखास, नई दिल्ल -110016 New Delhi-110016
ꥍ셋 यू राममूर्鄿 Prof U Ramamurthy साम嵍र इजीं नियरिंग विभाग Department of Materials Engineering भारतीय वि煍ञन संस्थन,बंगलौर 560,012 Indian Institute of Science, Bangalore-560012 डॉ पी जी राव Dr P G Rao कु लपति, Vice Chancellor, University of Science & Technology वि煍ञन और प्र셌饍योगकी विश्ववि饍봾लय,मेघालय -793101 Meghalaya -793101 ꥍ셋 डी नरसिम्हाराव Prof D Narasimha Rao जैव रसायन विभाग Department of Biochemistry भारतीय वि煍ञन संस्थन,बंगलौर 560012 Indian Institute of Science, Bangalore-560012 ꥍ셋 अनिल के त섿पाठी Prof Anil K Tripathi निदेशक Director CSIR-Central Institute of Medical & सीएसआईआर- के न्द्री औषधीय एव सगध पौधा सस्थन ं ं Aromatic Plants, P O CIMAP, Near Kukrail Picnic Spot पी ओ सीआईएमएपी, कु करैल पिकनिक स्पट के पास, लखनऊ-226 015 Lucknow-226015
अश픿नी कु मार नांगिया, ꥍ셋 Prof Ashwini Kumar Nangia निदेशक Director सीएसआईआर-रा�絍री रासायनिक प्रयोगशाला, CSIR-National Chemical Laboratory, डॉ होमीभाभा रोड, पणेु -411008 Dr Homi Bhabha Road, Pune-411008
निदेशक DIRECTOR डॉ ए अजयघोष Dr A Ajayaghosh निदेशक, रा�絍री अतःं विषय वि煍ञन और प्र셌饍योगकी संस्थन Director, National Institute for औ饍योगक एस्टट पीओ,ति셁वनंतपरु म -695019 Interdisciplinary Science & Technology, Industrial Estate PO, Thiruvananthapuram -695019 स्थाी निवेश महानिदेशक, PERMANENT INVITEE सीएसआईआर या उनके नामित व्啍鄿 DG, CSIR or His Nominee सीएसआईआर-मख्봾लु य, आनंद भवन, 2, रफी मार्, नई दिल्ल -110001 CSIR-HQ, Anusandhan Bhavan,2, Rafi Marg, New Delhi-110001 सचिव डॉ के हरिकृ ष्न भट SECRETARY मखु ् वै煍ञानक, Dr. K Harikrishna Bhat सीएसआईआर-एनआईआईएसटी Chief Scientist, CSIR-NIIST
6 पस्तवना
2018-19 अवधि के लिए सीएसआईआर-एनआईआईएसटी की वार्षक रिपोर् पेश करना पर्यावण प्रभाव आकलन और डाइऑक्सन निगरानी पर्यावण संरकण और संबंधित मेरे लिए खशीु और सौभाग् की बात है। रिपोर् मᴂ सीएसआईआर - एनआईआईएसटी 饍वार गतिवि啍ध्रों मᴂ मदद कर रहे हℂ।इस रिपोर् की अवधि के दौरान चार अतं ररा�絍री सहयोगी अतं र्वषयी अनसु ंधान एवं विकास के सीमांत 啍ष配रोंमᴂ कि ए गए महत्पर्ू योगदानरों के समर्न परियोजनाए ं सीएसआईआर-एनआईआईएसटी को प्रदान किया गया जो वर्मान मᴂ प्रगति पर के साथ, सीएसआईआर और कᴂद्र और राज् सरक봾िरों, सार㔵जनिक और निजी 啍षे के उ饍यगरों हℂ, नामतः ऑस絍रेलिय और भारत के लिए बड़ 啍षे ऑप्ट-इलेक絍रॉनक्: साम嵍र से उन्त ग अवधि के दौरान उपकरणरों पर, ऑटोमोटिव और एयरोस्पस अनप्रु योगरों के लिए स्क्ज तकनीक 饍वार हल्कﴂऔर शि啍षािदरों सहित अन् हितधारकरों के विवरण शामिल है। रिपोर् प्राप्तर पु स्का और उपलब्धियों, उच् प्रभाव प्रकाशन और आईपी जनरेशन, मानव संसाधन वजन उच् श啍鄿 एल्मीय नियम मिश섿त और इजीं नियरिंग घटकरों के लिए उन्त उपकरणरों के का विकास, प्रमखु गतिवि啍ध्रों और आयोजित कार्क्रमरों का ब्यौर प्रस्त किया हℂ। लिए साम嵍र का डिजाइन और निकट शदु आकार निर्मण प्र啍क्र्봾 का विकास। अभिनव सीएसआईआर के मिशन और विजन को पराू करने वाले विभिन् विष्रों के तहत कार्क्रम नैनो फास्फोस पर आधारित नैनोवायर व्हइट एलईडी, कागज मिल कचरे को रासायनिक संस्थन 饍वार किए जा रहे हℂ, जो नॉलेज जनरेशन और ट्रसलेशनल अनसु ंधान के बीच एक संपदा मᴂ परिवर्तत करने के लिए एकीकृ त बायोरिफाइनरी। समान संतलनु बनाए रखते हℂ। सीएसआईआर के समर्न से, हमारे संस्थन ने निम्नलिखत इस दौरान आयोजित इडं स絍र मीट, स्कल डेवलपमᴂट प्र셋嵍रम्, जि煍ञसा, वि煍ञन दिवस, विष्रों के तहत कई महत्पर्ू परियोजनाओ ं को सफलतापरू 㔵क कार्यान्त किया: निचे प्र셌饍योगकी दिवस, सीएसआईआर स्थपना दिवस, सीएसआईआर-एनआईआईएसटी 啍क्रएटिंग प्र셋जेक्स, फोकस् बेसिक रिसर्, फास् 絍रक ट्रसलेशनल और फास् 絍रक स्थपना दिवस आदि पर सार㔵जनिक और निजी 啍षे के उ饍यगरों, अकाद啍म्रों और आम व्봾वसायीकरण परियोजनाऍ।ं जनता से भारी प्रति啍क्र्봾एँ आई।ं इस अवधि के दौरान संस्थन की प्रमखु उपलब्धियों मᴂ से एक डाई सᴂसिटाइ焼् सोलर सेल फै ब섿केशन उपकरण का कमीशनिंग है। डीएसएससी सवु िधा विदेशी विकल्पों की तलनु ा मᴂ के रल राज् का बड़ हिस्स बड़ पैमाने पर बा褼 से तबाह हो गया, जिससे जान-माल की डीएसएससी सौर सेल निर्मण की लागत को 60 से 70% तक कम करने के लिए अपार व्봾पक क्ष हुई। सीएसआईआर-एनआईआईएसटी के संकटपर्ू कॉल का जवाब देते हुए, संभावनाए ं हℂ। सीएसआईआर-एनआईआईएसटी सौर फोटोवोल्टक के आगामी 啍ष配रोंमᴂ संपर्ू सीएसआईआर ने खड़ होकर नकदी और संवेदना का बड़ योगदान दिया। हमारी व्봾वसायिक हित के साथ अन् सीएसआईआर- प्रयोगशालाओ,ं आर एडं डी संस्थनरों और सिस्ट प्रयोगशालाओ ं ने प्रभावित 啍ष配रोंमᴂ ताज़ स्च㔛 पेयजल उपलब् कराने के लिए उ饍यगरों के लिए निर्मण प्र啍क्र्봾ओ ंसे संबंधित बौद鴿क संपदा के हस्तातरण के लिए अपनी विशेषजता के अपने 啍षे के आधार पर मदद की पेशकश की, उच् पोषक मलू ् और विशेषजता का लाभ उठाने के लिए तैयार है। भारतीय विमानपत्तनप्राधि करण की सहायता से बड़ शेल् लाइफ, दवाओ ं और कीट रिपलℂटस आदि के साथ खाद साम嵍र पैक किया। त्रᴂद्रम हवाई अड्डे पर 500 किलो嵍रम / दिन जैव-अपशिष्ट उपचार संयंत की स्थपना एक सीएसआईआर-एनआईआईएसटी ने कई दिनरों तक चौबीसरों घटें काम करने वाले अपने अन् उपलब्ध थी। संयंत प्रति दिन पर्ू लोडिंग पर 80m3 बायोगैस का उत्पदन करता है कर्चारि्रों और छा配रों की मदद से इन प्रयासरों को समन्वत किया ताकि यह सनिशु 椿त किया जो बिजली मᴂ परिवर्तत हो जाता है। जा सके कि मदद और साम嵍र ज셂रतमदं रों तक पहुँचे। मℂ उन सभी को धन्यवद देता हू ं जिन्होंने 嵍रहकरों की संतष्टिु के लिए कई महत्पर्ू संस्थगत परामर् परियोजनाओ ंको सफलतापरू 㔵क मदद की है, खासकर सीएसआईआर-एनआईआईएसटी के छात समदु ाय ने। पराू किया गया है, जिसमᴂ मैसर् अवंति फीड्स लिमिटेड के लिए गंध नियंतण, मैसर् वैपकोस मℂ, सभी सीएसआईआर-एनआईआईएसटी को धन्यवद देने का अवसर लेता हू ं जिन्होंने लिमिटेड के लिए गंध नियंतण और प्रवाह परू 㔵 उपचार, बीपीसीएल – कोच्च रिफाइनरी के अपने समर्पत समर्न के माध्म से संस्थन की प्रगति मᴂ योगदान दिया है। मℂ सीएसआईआर, लिए इटीपी डिज़इन, टाटा कै मिकल् के लिए स्वटनर् के प्र셋बायोटिक गतिविधि और कᴂद्रर औ राज् सरक봾िरों, सार㔵जनिक और निजी 啍ष配रों के हितधारकरों, हमारे विभिन् पोषण संबंधी इन्व絍셋 मल्ू याकन, मैसर् आदित् बि蔼ला लि. के लिए पोर्सलेन इन्लेटस र 嵍रहकरों, शभु चितकं रों और मीडिया का भी धन्यवद करता हू ं जिन्होंने सीएसआईआर- हाइ蕍셋फोबिक ग्लज का विकास शामिल है। एनआईआईएसटी को एक जीवंत संगठन मᴂ बदलने मᴂ योगदान दिया है। यह हमारा प्रयास गेल इडियां लिमिटेड के साथ थर륋इले啍ट्क सामग्रियो मᴂ एक परियोजना सफलतापरू 㔵क परू ी रहेगा कि हम प्रतिबद रहᴂ और उच् ल啍ष्यो को प्राप्त करने के लिए प्रयास करᴂ। हो गई है। गेल इडियां लिमिटेड के सहयोग से परियोजना का दसू रा चरण 2019 मᴂ श셂ु होगा। महानिदेशक सीएसआईआर, सीएसआईआर – मख्봾लय और आर सी सदस्यों को उनके मद्राु के लिए सरु 啍ष साम嵍र का विकास, निदान और गणु वत्ता जांच के लिए हℂडहेल् रामन ु स्पे絍셋फोटोमीटर, निस्पदन और शोधन के लिए सिरेमिक झिल्ल और 2 जी जैव- जैसी परू े समर्न के लिए सराहना का एक विशेष शब् महत्पर्ू गतिविधियां इथेनॉल उत्पदन प्रगति पर है। ए. अजयघोष
7 Indigenous Development of Semi-Automatic Equipment for Large Area Dye-Sensitized Solar Module Fabrication
Installed and commissioned at CSIR-NIIST in November 2018 funded by DST-SERI.
Indigenization of the process - Semi-automatic production line indigenously manufactured for the first time in the country in association with the industrial partner Elixir Technologies, Bangalore.
60-70% Cost reduction in module fabrication equipment in comparison with the imported ones by indigenization of technology.
Capable of producing modules in 5×5, 10×10, 15×15 and 30×30 cm2 sizes.
Presently involved in integration of these indoor PV modules with self- powered IoTs.
Selected by PMO on high priority implementation category.
8 Foreword
It is my pleasure and privilege to present the Annual Another achievement was the installation of a 500 Kg/ Report of CSIR-NIIST for the period 2018-19. The report day bio-waste treatment plant at the Trivandrum airport encompasses the details of significant contributions with the help of the Airport Authority of India. The plant made by CSIR-NIIST on frontier areas of interdisciplinary produces 80m3 biogas on full loading per day which is R&D, with the support of CSIR and other stake holders converted to electricity. comprising of Central and State Governments, Public and Several important institutional consultancy projects have Private Sector Industries and academia. Achievements been successfully completed to the satisfaction of the and accolades received, details of high impact customers, which includes odour control for M/s. Avanti publications and IP generation, development of human Feeds Limited, odour control and effluent pretreatment resources, major activities and programs organized for M/s. WAPCOS Ltd., ETP design for BPCL -Kochi during reporting period are presented. refinery, In vitro evaluation of nutritional and probiotic Programs under various themes, meeting the mission activity of sweeteners for TATA chemicals, Development and vision of CSIR are being carried out by the Institute of hydrophobic glaze for porcelain insulator M/s. Adithya maintaining a uniform balance between knowledge Birla Ltd. generation and translational research. With the support A project in the thermoelectric materials with GAIL India of CSIR, our Institute successfully implemented several Limited has been successfully completed. The second important projects under the following themes: Niche phase of the project with the support of the GAIL India Ltd Creating Projects, Focused Basic Research, Fast Track will be commencing in 2019. Important activities such as Translational and Fast Track Commercialization Projects. development of security materials for currency, handheld One of the major achievements of the Institute during Raman Spectrophotometer for diagnostics and quality the period is the commissioning of the Dye Sensitized check, ceramic membranes for filtration and purification Solar Cell Fabrication equipment. The DSSC facility has and 2G bio-ethanol production are in progress. immense potential for bringing down the cost of DSSC Environmental Impact Assessment (EIA) and Dioxin solar cell fabrication by 60 to 70% when compared to the monitoring are helping in the environment protection foreign alternatives. CSIR-NIIST is all poised to leverage and related activities. During the period of this report its expertise for the transfer of intellectual property four international collaborative projects on Large area related to the fabrication processes to other CSIR-Labs, Opto-electronics for Australia and India: From materials R&D institutions and industries with business interest in to advanced devices, Design and development of near the upcoming areas of solar photovoltaics. net shape manufacturing process for light weight
9 high strength aluminium composite and engineering to the affected areas, packed food materials with high components by squeeze infiltration technique for nutritive value and large shelf life, medicines and insect automotive and aerospace applications, Nanowire white repellants etc. CSIR-NIIST coordinated these efforts with LEDs based on innovative nano phosphors, Integrated the help of its staff and students working round the clock biorefinary for converting paper mill waste into chemical for several days ensuring that the help and materials wealth were awarded to CSIR-NIIST which are currently reached the needy. I thank all those who have helped, in progress. particularly the student community of CSIR-NIIST. The Industry Meet, Skill Development Programs, Jigyasa, I take this opportunity to thank one and all of CSIR-NIIST Science Day, Technology Day, CSIR Foundation Day, CSIR- who had contributed to the progress of the Institute NIIST Foundation Day etc conducted during this period through their dedicated support. I also thank CSIR, had overwhelming responses from public and private Central and State Governments, stake holders from Public sector Industries, Academia and also from the common and Private sectors, our various clients, well-wishers and public. media who have all contributed in transforming CSIR- NIIST into a vibrant organization. It will be our endeavor Major part of the State of Kerala was devastated by massive to remain committed and strive for achieving higher flood causing extensive damage to life and property. goals. Responding to the distress call of CSIR-NIIST, the entire CSIR stood by and made massive contribution in cash and A special word of appreciation to DG CSIR, CSIR-Head kind. Our sister laboratories offered help based on their Quarters and RC members for their wholehearted area of expertise providing fresh clean drinking water support A. Ajayaghosh
10 महत्पूर्णउपलब्धिां 2018-2019
सी एस आई आर-रा�絍री अतं र्वषयी वि煍ञन तथा प्र셌饍योगकी संस्थन समी啍षधीन अवधि के दौरान प्रमखु सफलता की कह봾啍न्रों मᴂ से एक डाई- (एनआईआईएसटी) मलू 셂प से के रल सरकार के तहत औ饍योगक परीकण और सᴂसिटाइ焼् सोलर सेल (DSSC) मॉड्यलू फै ब섿केशन उपकरण का स्देशीकरण अनसु ंधान प्रयोगशाला था जो 1975 मᴂ सीएसआईआर परिवार मᴂ प्रवेश किया, हℂ। देश मᴂ पहली बार यह कमता हासिल की गई हℂ, जिससे 60-70% की भारी जिसका नाम 1978 मᴂ 啍ष配री अनसु ंधान प्रयोगशाला रखा गया। यह देश के द啍षणी लागत मᴂ कमी हℂ। सीएसआईआर-एनआईआईएसटी, अपनी विशेषजता का 啍षे के समदृ संसाधनरों के प्रभावी उपयोग के लिए आवश्क वि煍ञन और प्र셌饍योगकी लाभ उठाने के लिए इस निर्मण संबंधी प्र啍क्र्봾ओ ं से संबंधित बौद鴿क संपदा को प्रदान करने के लिए अनिवार् था । इन वरषोंमᴂ, प्रयोगशाला वास्त मᴂ अतःं विषय स्थनांतरित करने तैयार जो सौर फोटोवोल्टक के आगामी 啍ष配रोंमᴂ 셁चि रखते हℂ, अनसु ंधान प्रयोगशाला के 셂प मᴂ विकसित हुई है जो अनसु ंधान 啍ष配रों,र्थ अ त ् रसायन अन् सीएसआईआर-लबरोटरी, आरएडडीं संस्थनरों और उ饍यगरों । अधिक पर्यावण वि煍ञन, साम嵍र वि煍ञन, कृ षि-प्रसंस्कण, माइक्र셋बियल और पर्यावण प्र셌饍योगिकियों के अनकु ू ल तरीके से स्मार कृ षि, ऊर्ज, शहरी और जल प्रबंधन की दिशा मᴂ योगदान के व्봾पक स्पेकम पर काम कर रही है। सीएसआईआर-एनआईआईएसटी को करके, सीएसआईआर-एनआईआईएसटी भारत के जीओआई मिशनरों मᴂ, इनोवेट उ饍यग और समाज की ज셂रतरों को पराू करने के लिए उच् गणु वत्ता वाले बनियाु दी इन इडियां , क्लन एडं रिन्एय बल एनर्, स्कल इडियां और स्मार सिटीज एडं अनसु ंधान और अभिनव समाधान के लिए जाना जाता है। संस्थन के अतःं विषय विलेजेज के अन셂पु आर्थक और औ饍योगक विकास के साथ-साथ जीवन की अनसु ंधान गतिविधि के प्रमखु 啍ष配रों को मोटे तौर पर चार 啍ष配रोंमᴂ वर 嵀कृ त किया गया है गणवत्ता मᴂ सधार के लिए पहल करने के लिए प्रतिबद है। । 1. प्राकृ तिक संसाधन 2. अपशिष्ट और पर्यावण 3. ऊर्ज 4. अण,ु साम嵍र और ु ु उपकरण। प्राकृ तिक संसाधनरों के अतं र्त गतिविधियाँ समद्रु तट खनिज प्रसंस्कण, सीएसआईआर-एनआईआईएसटी को एन ए बी एल मान्ता प्राप्तहै र औ के रल मᴂ दर्ु भ पथृ ्व पिगमᴂट, हल्क धात ु मिश धात,ु ए嵍셋प्र셋सेसिंग, कार्यत्क खाद पदार्, एक परामर्दाता संगठन है, जो दो 啍ष配रोंमᴂ खनन और बंदरगाहरों और हार्ब मᴂ मान्ता न्絍य रस्ूटय कल्, फाइटोके मिकल्, औषधीय पौधरों, रोगाणओु ं और एजं ाइमरों प्राप्तहै। र स कारी और निजी 啍षे 饍वार ईआईए सेवाओ ंका उपयोग परियोजनाओ ंकी के 啍षे मᴂ हℂ। अपशिष्ट और पर्यावण के अतं र्त अनसु ंधान 啍ष配रोंमᴂ अपशिष्ट / वैधानिक मजं रू ी के लिए किया जाता है। परीकण और वि�लषण प्रयोगशाला को जल, अपशिष्ट उपचार, अपशिष्ट उपयोग, प्र啍क्र्봾 मॉडलिग, पर्यावण प्रभाव मल्यकन ं ू ा अपशिष्ट जल, डाइअॉॉक्सन, फु रान और पॉली क्लोीनयकु बाइफिनाइल (पीसीबी) और निगरानी शामिल हℂ। ऊर्ज 啍ष配रों केत अं र्त आने वाले 啍ष配रोंमᴂ जैव ईधन, सौर ं के वि�लषण के लिए आईएसओ / आईईसी 17025: 2005 के अनसु ार एनएबीएल ऊर्ज और ऊर्ज की बचत साम嵍र शामिल है। सीएसआईआर - एनआईआईएसटी 饍वार मान्ता प्राप्तहै। इसके ावाअल , हम पर्यावण, वन और जलवाय ु परिवर्न सरु 啍ष स्봾ही, स्मार कोटिंग्, नैदानिक जांच, रासायनिक मध्यवर और संगणना म配रलय (MoEFCC), भारत सरकार 饍वार अनशु सित पर्यावणीय मजरू ी के लिए और मॉडलिंग विकसित करने वाले रणनीतिक 啍ष配रों पर उच् मलू ् वि煍ञन मᴂ शामिल ं ं ं है। चौदह यवाु और प्रतिभाशाली नए वै煍ञानकरों को जैव प्र셌饍योगकी, रासायनिक डाइऑक्सन वि�लषण के लिए एक रेफरल प्रयोगशाला भी हℂ। कॉम्पक् फू ड वेस् ग अवधि के दौरान बायोगैस संयंत को मौजदू ा 50 किलो嵍रम / दिन के स्त से 500 किलो嵍रम / दिनﴂप्र셌饍योगकी और प्र啍क्र्봾 इजीं 啍न्िरों की विशेषजता के साथ रिपोर् प्रणाली मᴂ शामिल किया गया था जो कि अनवाु दकीय अनसु ंधान की कमता को की कमता तक बढ़ाय गया था। ति셁वनंतपरु म अतं ररा�絍री हवाई अड्डे पर निजी मजबतू करेगा। उ饍यग, स्वच फ्चय र एनर् सॉल्शनय (NIIST प्र셌饍योगकी लाइसᴂसधारी) के साथ संयकु 셂प से 500 किलो嵍रम खाद अपशिष्ट-बायोगैस-बिजली इकाई स्थापत की 2018-19 की अवधि के दौरान, सीएसआईआर-एनआईआईएसटी ने कᴂद्र, राज् गई थी। इस संयंत से हर दिन लगभग 90-100 क्ूय िक मीटर बायोगैस उत्न् होने सरकार की एजᴂ啍स्रों, शै啍षक सस्थनरों, सार㔵जनिक और निजी 啍ष配रों केहि तधारकरों से ं की उम्मद है, जिसे ~ 110-120 kWh बिजली मᴂ परिवर्तत किया जाएगा। संयंत निरतर निवेश के साथ वै煍ञानक, तकनीकी और जनश啍鄿 विकास पर अपने विकास ं दिसंबर 2018 मᴂ स्थापत किया गया था और परीकण रन अभी चल रहे हℂ। की प्रवत्तिृ को बनाए रखा। औ饍योगक, निजी और सार㔵जनिक 啍ष配रों और प्र셌饍योगकी हस्तातरण से जड़ु नए सहयोगरों मᴂ होने वाली वदृ 鴿 से बाहरी 셋तरों से राजस् मᴂ पर्यप्त संस्थन के पास एक उत्क ष्ट वि�लषणात्क सवु िधा है जो उच् गणु वत्ता वाले ,ग अवधि के दौरान सीएसआईआर से निरंतर फं डिंग के बनियाु दी और अनवाु द अनसु ंधान के लिए परू ी कमता के साथ उपयोग की जाती हैﴂवदृ 鴿 होती है। इस रिपोर् साथ-साथ बाहरी फं डिंग मᴂ लगातार बढ़तरी ने सीएसआईआर-एनआईआईएसटी इसके अलावा यह उ饍यग और शि啍ष से नमनू रों के परीकण से राजस् उत्न् करता को उच् गणु वत्ता वाले प्रकाशनरों से समझौता किए बिना ट्रसलेशनल रिसर् और है। सीएसआईआर-एनआईआईएसटी ने सीएसआईआर कौशल पहल कार्क्रम के टेक्नलॉजी डेवलपमᴂट पर ध्봾न कᴂ द्रित करने मᴂ मदद की है। तहत विभिन् खडं रों के तहत लघ ु अवधि के पाठ्यक्रम पेश किए। संस्थन उच् गणु वत्ता वाले मानव संसाधनरों का पोषण करना जारी रखता है, हर साल 30 से अधिक वर् 2018-2019 मᴂ सीएसआईआर के 饍वार दिए गए परियोजनाओ के सफल ं पीएचडी प्रदान करता है। एनआईआईएसटी उच् प्रभाव कारक पत्काओ ं मᴂ हर कार्यन्वन को भी चिन्हत किया है निच बनाने वाली परियोजनाए, फोकस् ं साल 200 से अधिक पत प्रकाशित करता है और एक मजबतू पेटᴂट पोर्फोलियो है। बेसिक रिसर्, फास् 絍रक ट्रसलेशनल, फास् 絍रक व्봾वसायीकरण और मिशन मोड योजनाएँ निम्नलिखत विष्रों के तहत 1. खनन, खनिज, धात ु और साम嵍र 2. के रल राज् का बड़ हिस्स बड़ पैमाने पर बा褼 से तबाह हो गया, जिससे जान- रसायन (चमड़ और पे絍셋के मिकल् सहित) 3. ऊर्ज (पारंपरिक और गैर-पारंपरिक) माल की व्봾पक क्ष हुई। सीएसआईआर-एनआईआईएसटी के संकटपर्ू कॉल और ऊर्ज उपकरण 4. पारिस्थितकी, पर्यावण, पथृ ्व वि煍ञन और जल 5. कृ षि का जवाब देते हुए, संपर्ू सीएसआईआर ने खड़ होकर नकदी और संवेदना का बड़ पोषण और जैव प्र셌饍योगकी 6. हेल्के यर । योगदान दिया। हमारी सिस्ट प्रयोगशालाओ ंने प्रभावित 啍ष配रोंमᴂ ताज़ स्च㔛 पेयजल
11 उपलब् कराने के लिए विशेषजता के अपने 啍षे के आधार पर मदद की पेशकश जांच और अल絍रफास् कैनेटीक्); (3) फाइटोफार्मस्ुटय कल् एडं डग की, उच् पोषक मलू ् और बड़ शेल् लाइफ, दवाओ ं और कीट रिपलℂटस इटं रमीडिएट (औषधीय पौधरों और उन्त दवा मध्यवर का जैव मल्ू याकन)। आदि के साथ खाद साम嵍र पैक किया। सीएसआईआर-एनआईआईएसटी ने प्रभाग संस्थन स्त पर सीएसआईआर की विभिन् विषयगत गतिवि啍ध्रों का कई दिनरों तक चौबीसरों घटें काम करने वाले अपने कर्चारि्रों और छा配रों की समन्व करता है, अर्थत ् ऊर्ज (पारंपरिक और गैर-पारंपरिक) साम嵍र और ऊर्ज मदद से इन प्रयासरों को समन्वत किया ताकि यह सनिशु 椿त किया जा सके कि उपकरण, हेल्के यर और रसायन। इसके अलावा, डिवीजन दो सीएसआईआर मदद और साम嵍र ज셂रतमदं रों तक पहुँचे। मℂ उन सभी को धन्यवद देता हू ं जिन्होंने मिशन मोड परियोजनाओ ं मᴂ एक प्रमखु भमिू का निभाता है - (1) स्वस्थ मदद की है, खासकर सीएसआईआर-एनआईआईएसटी के छात समदु ाय ने। देखभाल अनप्रु योगरों और (2) न्絍य रस्ुटय कल् मिशन के लिए नैनोबायोजर् और माइक्र셋फ्इल डिक्। यह प्रभाग विभिन् सरकारी एजᴂ啍स्रों और उ饍यगरों 饍वार इस पष्ठभृ मिू के खिलाफ, 2018-2019 की अवधि के लिए वार्षक रिपोर् वित्त पोषित महत्पर् परियोजनाओ का सचालन भी करता है। सीएसआईआर-एनआईआईएसटी 饍वार नवाचार, उपलब्धियों, प्रगति और ू ं ं प्रभाव को निर्धरित करती है, जो कि सामने की ओर अनसु ंधान के अतःं विषय पर्यावण प्र셌饍योगकी प्रभाग 啍षे के प्राकृ तिक संसाधनरों के प्रदषणू नियंतण वातावरण मᴂ एक सख् और चनु ौतीपर्ू वातावरण मᴂ अपनी योजनाओ ंके साथ और मलू ् संवर्न के लिए स्देशी प्र셌饍योगिकियं बनाने मᴂ स啍क्र् 셂प से संरेखित करती है। लगा हुआ है। पर्यावणीय प्र셌饍योगकी प्रभाग की संपर्ू गतिवि啍ध्रों को इन दो विष्रों के अतं र्त रखा जा सकता है, 1. अपशिष्ट प्रबंधन के लिए सफाई आर एडं डी कार्क्रमⴂ मᴂ पगति और पदर्न समाधान और 2. पर्यावण निगरानी, प्रभाव मल्ू याकन और प्रबंधन। संभागीय 2018-19 मᴂ, प्रत्यक विभाग ने उत्पद विकास, प्र啍क्र्봾 निर्मण, शैक्षक गतिविधियाँ अपशिष्टब प्र ंधन, डाइऑक्सन अनसु ंधान और पर्यावण प्रभाव उत्क ष्टता, और अनसु ंधान सहयोग के 啍षे मᴂ कᴂ द्रित अनसु ंधान गतिवि啍ध्रों के आकलन (ईआईए) के 啍ष配रोंमᴂ परिवर्तत होती हℂ। अपशिष्ट प्रबंधन के समाधान, माध्म से महत्पर्ू प्रगति की। प्रमखु रिपोर् और रसायन, साम嵍र, माइक्र셋बियल अपशिष्ट उपचार, मि絍ट के शोधन आदि मᴂ विकसित विशेषजता से, विभाजन ने प्र啍क्र्봾ओ,ं कृ षि-प्रसंस्कण और पर्यावण प्र셌饍योगिकियों के 啍ष配रोंमᴂ वर्मान अत्봾धनिु क तकनीकी समाधान और शमन उप봾्रों की स्थित मᴂ एक जगह बनाई अनसु ंधान गतिवि啍ध्रों को इस रिपोर् मᴂ सं啍षेपत किया गया है। है। प्रभाग के अधिकांश आरएडडीं परिणाम सफल, नवीन और लागत प्रभावी ए嵍셋-प्र셋सेसिंग एडं टेक्नलॉजी डिवीजन एक बहु-विषयक कᴂद्रहै जि समᴂ प्र啍क्र्봾 प्र셌饍योगिकियों के 셂प मᴂ हℂ, जो "विनाश के बिना विकास" का एक पारिस्थितकी पर मखु ् फोकस (शेल् लाइफ एन्हासमᴂट, स्टोेज, वैल् य एडिशन) और उत्पद तंत बनाने के लिए प्रयासरत हℂ। विकास (न्絍य रस्ुटय कल्, कार्यत्क खाद पदार्, आहार परू क, फाइटो साम嵍र वि煍ञन और प्र셌饍योगकी प्रभाग स啍क्र् 셂प से खनिज, धात ु साम嵍र, फार्मस्ूटय कल्, जैव-उर㔵रक और जैव कीटनाशक) शामिल हℂ। प्रभाग के मखु ् चीनी मि絍ट की चीजᴂ, पॉलिमर और कं पोजिट, इलेक絍रॉनक और चबंु कीय साम嵍र उ饍शद ्यों मᴂ से एक कृ षि उत्पदन और संयंत संसाधनरों पर जोर देना और वै煍ञानक के 啍ष配रोंमᴂ उच् वि煍ञन और प्रासंगिक प्र셌饍योगिकियों के लिए अगणी अनसु ंधान और तकनीकी हस्啍षप और नवाचार के माध्म से अपनी उपज के उच् रिटर् और विकास गतिवि啍ध्रों को काटने मᴂ शामिल है। इसके अलावा, अतःं विषय के माध्म से किसानरों के सामान् कल्봾ण मᴂ सधु ार लाना है। डिवीजन मᴂ प्रकृ ति का मौलिक अनसु ंधान इस प्रभाग के वै煍ञानकरों 饍वार किया जा रहा है और कृ षि प्रसंस्कण के 啍षे मᴂ प्रमखु पायलट संयंत सवु िधाए ं और एक प्र셌饍योगकी इस तरह उच् गणु वत्ता वाले प्रकाशनरों और पेटᴂट के लिए अगणी है। डिवीजन व्यसाय ऊष्मान कᴂद्रहै। िए प टि डि भी इस 啍षे मᴂ प्रचरु मा配र मᴂ पारंपरिक 煍ञन मᴂ रा�絍री और अतं र्र�絍री संगठनरों के साथ बड़ संख्봾 मᴂ इडं ो-जर्न साइसं की उपलब्ता और प्रभाग मᴂ उपलब् जैव विविधता की खोज, न्絍य रस्ूटय कल् एडं टेक्नलॉजी सᴂटर की वित्त पोषित सहयोग परियोजना है, जो एल्ुमिनिय म और फाइटो फार्मस्ूटय कल् के विकास और सत्봾पन मᴂ शामिल है। ए िप टि कं पोजिट के 'नियर नेट मैन्फैकय ्रिंग' पर है और इडं ो-굍र च सᴂटर फॉर प्रमोशन डि एडं ोफाइटिक रोगाणओु ंसे जैव-उर㔵रकरों और जैव-कीटनाशकरों के विकास पर ऑ괼 एडवांस् रिसर् के तहत एक प्र셋जेक् है। डिवीजन मᴂ नेशनल कॉयर रिसर् भी काम कर रहा है, मसाले और फलरों से स啍क्र् साम嵍र के अलगाव के लिए एडं मैनेजमᴂट इसं ्टट्यटू से पॉलिमर और कं पोजिट का एक बड़ प्र셋जेक् है। औ饍योगक 셂प से महत्पर्ू कई एजं ाइमरों का उत्पदन करने मᴂ सकम उपन्봾स माइक्र셋बियल प्र啍क्र्봾ओ और प्र셌饍योगकी प्रभाग डिवीजन स啍क्र् 셂प से स्देशी माइक्र셋बियल उपभेदरों का खनन। डिवीजन भी यौगिकरों के इन-वि絍셋 ं माइक्र셋बियल संसाधनरों की खोज और दोहन करके ि봾्셋प्र셋सेस और उत्पदरों स्क्रीनंग और मधमेह,ु दय, सजन,ू कℂसर और गैर-अल्कहल फैटी लिवर रोगरों के विकास के लिए फोकस् 啍ष配रोंमᴂ सअनु ंधान मᴂ शामिल है। अनसु ंधान का के लिए तंत आधारित अध्यन के लिए सवु िधाओ ंसे लैस है। वर्मान फोकस (i) औ饍योगक एजं ाइमरों और मलू ् वर्धत रसायनरों (ii) जैव रासायनिक वि煍ञन और प्र셌饍योगकी प्रभाग अणओु ं और कार्यत्क सामग्रियो ईधनं (iii) जैव स啍क्र् अण ु iv) स्वस्थ और जीनोमिक् (v) पादप-स啍ू ष जीव के विकास और विभिन् डिवाइस प्लटफार्मो मᴂ उनके अनप्रु योग पर ध्봾न अतः啍ं क्र्봾 और (vi) प्र셋बायोटिक और पौष्टिक-औषधीय अल्ल पदार्थो के कᴂ द्रित कर रहा है। संस्थन के तीन प्राथमिकता वाले 啍ष配रों का नेततृ ् प्रभाग 啍ष配रोंमᴂ है। स दू री पीढ़ के बायोटेनॉल पर विशेष अनसु ंधान और विकास के लिए 饍वार किया जाता है - (1) ऑर嵇निक और हाइब섿ड इलेक絍रॉनक् (ऊर्ज उत्पदन डिवीजन के पास एक समर्पत "बायोफ्लय के लिए कᴂद्र"है। लि ग्नसेल्लय ोसिक और भडं ारण, क्र셋मोजेनिक कोटिंग्, ठोस राज् प्रकाश व्यस्थ, कम््टेशनलय बायोएथेनॉल के उत्पदन के लिए पायलट प्लाट को अब साइट-सॉलिड-स्टट रसायन वि煍ञन); (2) फ्लोरसᴂट साम嵍र (सरु 啍ष अनप्रु योगरों, निदान और इमेजिंग किण्न एजं ाइम उत्पदन पायलट प्लाट 饍वार समर्थत किया गया है, जिससे
12 बेहतर लागत-प्रभावी और हℂडलिंग अवसर प्राप्तुए ह हℂ। 9 सीएसआईआर रा�絍री स्त पर मनाया जाने वाले दिन / सप्ताह आयोजित किए। हमारे कई प्रयोगशाला से भागीदारी के साथ 2G इथेनॉल पर एक PANCSIR कार्क्रम वै煍ञानक और अनसु ंधान फेलो ने कई प्रतिष्ठित परु स्कारों, सम्मनरों और पहचानरों और एनआईआईएसटी 饍वार समन्वत 2G इथेनॉल उत्पदन की लागत को कम के माध्म से संस्थन के लिए कई प्रशसं ाए ं हासिल कĂ। अनसु ंधान वि饍वनरों ने ( बजट/ ईसीएफ/ एलआर(लाखⴂ मᴂ) कर्मारियⴂ की सखं ्य STAFF STRENGTH BUDGET/ECF/LR (in lakhs) वै煍ञानकⴂ की स्थित पकाशनⴂ SCIENTIST POSITION PUBLICATIONS 13 SIGNIFICANT ACHIEVEMENTS 2018-2019 CSIR- National Institute for Interdisciplinary Science from stakeholders comprising of Central, State & Technology (NIIST) originally Industrial Testing and Government agencies, educational institutes, public Resesarch Laboratory under Govt. of Kerala entered and private sectors. The upsurge in new collaborations the CSIR family in 1975 was renamed as Regional involving industrial, private and public sectors and Research Laboratory in 1978. It is mandated to provide technology transfers lead to an substantial increase in the Science & Technology needed for the effective revenue from external sources. The sustained funding utilization of the rich resources of the southernmost from CSIR during this reporting period along with a region of the country. Over the years, the laboratory has steady rise in external funding, have helped CSIR-NIIST grown into a truly interdisciplinary research laboratory in focusing on translational research and technology working on broad spectrum of research areas, namely development without compromising on high-quality chemistry, materials science, agro-processing, publications. microbial, and environmental technologies. CSIR- The year 2018-2019 also marked the successful NIIST is known for its high-quality basic research and implementation of projects from CSIR under NCP innovative solutions to meet the needs of the industry (Niche creating projects), FBR (Focused Basic and society. The niche areas of interdisciplinary Research), FTT (Fast Track Translational), FTC (Fast research activity of the Institute is broadly classified Track Commercialization) and mission mode schemes into four sectors namely 1. Natural resources 2. Waste under the following themes: 1. Mining, Minerals, and Environment 3. Energy 4. Molecules, Materials Metals and Materials 2. Chemicals (including leather & Devices. The activities under natural resources and Petrochemicals) 3. Energy (Conventional and are in the field of beach mineral processing, rare non-conventional) and Energy devices 4. Ecology, earth pigments, light metal alloys, agroprocessing, Environment, Earth Sciences and Water 5. Agri. functional foods, nutraceuticals, phytochemicals, Nutrition and Biotechnology 6. Healthcare. medicinal plants, microbes and ezymes. The research One of the major success stories during the reporting areas under Waste and Environment comprises of period was the indigenization of the Dye-Sensitized waste/ effluent treatment, waste utilization, process Solar Cell (DSSC) Module Fabrication Equipment modelling, Environmental Impact Assessment (EIA) For the first time in the country this capability was and monitoring. The niche areas under energy sectors achieved thereby paving way for huge cost reduction encompasses biofuels, solar energy and energy saving of 60-70% with respect to the imported ones. CSIR- materials. CSIR-NIIST is involved in high value science NIIST, is all poised to leverage its expertise to transfer on strategic sectors developing security inks, smart intellectual property related to the fabrication coatings, diagnostic probes, chemical intermediates processes to other CSIR-Labarotary, R&D institutions and computation and modelling. Fourteen young and industries who are interested in upcoming areas and talented new Scientists were inducted into the of solar photovoltaics. By contributing towards smart system during the reporting period with expertise agriculture, energy, urban and water management ranging biotechnology, chemical technology and in a more environmentally friendly way, CSIR-NIIST process engineers which will strengthen the potential is committed to the initiative for the improvement of translational research. in quality of life along with economic and industrial During the period 2018-19, CSIR-NIIST sustained growth in line with the GOI missions such as ″Make its growth trend on Scientific, Technological and in India″, ″Innovate in India″, ″Clean & Renewable manpower development with continued investment Energy″,″Skill India″ and ″Smart Cities & Villages″. 14 CSIR-NIIST is a NABET accredited, Category A help in cash and kind from its sister concerns ensuring consultant organisation in Kerala with accreditation the correct delivery in required areas. in two areas i.e Mining and Ports & Harbour. The EIA Against this backdrop, the Annual Report for the period services are used by government and private sector 2018-2019 sets out the innovation, achievements, for statutory clearance of projects. The Testing and progress, and impact made by CSIR-NIIST aligning Analysis Laboratory is accredited by NABL as per ISO/ with its plans in a vigorously changing and challenging IEC 17025: 2005 for analysis of Water, Wastewater, interdisciplinary environment of frontier research. Dioxins, Furans and Poly Chlorinated Biphenyls (PCBs). In addition, we are also a referral laboratory Progress and Performance in R&D Programs for Dioxin analysis for environmental clearances In 2018-19, each division made significant progress recommended by Ministry of Environment, Forest through focused research activities in the field and Climate Change (MoEFCC), Govt. of India. The of product development, process formulations, compact food waste biogas plant was scaled up from academic excellence, and research collaborations. the existing 50 kg/day level to 500 kg/day capacity. A Major achievements and current research activities in 500 kg food waste-biogas-power unit was installed at the areas of chemicals, materials, microbial processes, Thiruvananthapuram International Airport jointly with agro-processing, and environmental technologies private industry, Swatch Future Energy Solution (the summarized in this report. NIIST technology licensee). The plant is expected to Agroprocessing and Technology Division (APTD) is a generate around 90-100 cubic meter biogas every day, multidisciplinary centre with main focus on process that will be converted into ~110-120 kWh of electricity. (shelf life enhancement, storage, value addition) and The plant was installed in December 2018 and trial product development (nutraceuticals, functional runs are currently in progress. foods, dietary supplements, phyto pharmaceuticals, Institute has an excellent analytical facility which is bio-fertilizers & bio pesticides) emphasizing agri utilized with full capacity for high quality basic and produce & plant resources. One of the main objectives translation research, besides generating revenue from of the division is improvement of general welfare testing of samples from industry and academia. CSIR- of farmers through high returns of their produce NIIST introduced short term courses under various via scientific and technological intervention and segments under CSIR Skill Initiative programme. The innovation. Division has major pilot plant facilities Institute continues to nurture high quality human and a technology business incubation centre (TBIC) resources, awarding over 30 Ph.D.s every year. NIIST in the area of agro-processing. APTD is also involved publishes over 200 papers every year in high impact in the development and validation of nutraceuticals factor journals and has a robust patent portfolio. and phyto pharmaceuticals exploring rich biodiversity, During the reporting period, the State of Kerala was availability of abundant traditional knowledge in this severly affected by flood calamity. The entire southern region and available expertise in the division. APTD is part was enundated causing damage to life and also working on development of bio-fertilizers & bio- property. CSIR-NIIST rose to the occasion and with pesticides from endophytic microbes, mining of novel conceited effort involving staff students and sister indigenous microbial strains capable of producing laboratories from all over the country contributed in a industrially important multiple enzymes for isolation significant way dealing with food, water and medical of active ingredients from spices and fruits. Division problems arising out of the situation. During this is also equipped with facilities for in-vitro screening hour of emergency, CSIR-NIIST played a pivotal role of compounds and mechanism based studies for functioning for 24 hours for several days as the nodal diabetes, cardiovascular, inflammation, cancer and laboratory coordinating and channelizing the flow of non-alcoholic fatty liver diseases. 15 The Chemical Sciences and Technology Division has in the areas of Minerals, Metallic materials, been focusing on the development of molecules Ceramics, Polymers and composites, Electronic and and functional materials and their application in Magnetic materials. Also, fundamental research of various device platforms. The three priority areas interdisciplinary nature is being carried out by the of the Institute are led by the division – (1) Organic scientists of this division thus leading to high quality and Hybrid Electronics (Energy generation and publications and patents. The Division has a large storage, chromogenic coatings, solid state lighting, number of projects with national and international computational chemistry); (2) Fluorescent Materials organizations Indo-German Science and Technology (Security applications, diagnostics and imaging probes centre (IGSTC) funded collaborative project on ‘Near and ultrafast kinetics); (3) Phytopharmaceuticals and Net Manufacturing’ of aluminium composites and a Drug Intermediates (Bio-evaluation of medicinal project under Indo-French Centre for Promotion of plants and advanced pharmaceutical intermediates). Advanced Research (CEFIPRA). The Division also has The division coordinates various thematic activities of a major ongoing project from National Coir Research CSIR at the institute level, namely Energy (conventional and Management Institute (NCRMI) on polymers and and non-conventional) Materials and Energy Devices, composites. Healthcare, and Chemicals. Besides, the division Microbial Processes and Technology Division (MPTD) plays a major role in two CSIR Mission Mode projects division is actively involved in research in the focussed – (1) Nanobiosensors and microfluidics for healthcare areas for bioprocesses and products development by applications and (2) Nutraceuticals Mission. The exploring and exploiting the microbial resources. The Division also undertakes a large number of important current focus of research is in the areas of (i) Industrial projects funded by various government agencies and enzymes and value-added chemicals (ii) Biofuels industries. and biorefinery (iii) bioactive molecules iv) Health The Environmental Technology Division (ETD) is and genomics (v) plant-microbe interactions and actively engaged in creating indigenous technologies (vi) probiotic and algal nutraceuticals. The Division for pollution control and value addition to the region’s has a dedicated “Centre for Biofuels” for exclusive natural resources. The entire activities of Environmental R&D on 2nd generation bioethanol. The pilot plant Technology Division can be put under these two topics for the production of lignocellulosic bioethanol is viz. 1. Clean-up solutions for waste management and now supported by on-site solid-state fermentation 2. Environmental monitoring, impact assessment and enzymes production pilot plant, bringing better cost- management. The divisional activities converge into effective and handling opportunities. A PANCSIR the areas of waste management, dioxin research and program on 2G ethanol with participation from 9 CSIR Environmental Impact Assessment (EIA). From the labs and coordinated by NIIST was kick started with a expertise developed in waste management solutions, target of reducing the cost of 2G ethanol production to effluent treatment, soil remediation etc., the division < Rs 100/L. has made a niche in state of the art technological Institute organized various important national and solutions and mitigation measures. Most of the R&D international events and other nationally observed outcomes of the division are in the form of successful, days/weeks. Several of our scientists and research innovative and cost-effective technologies striving fellows brought many laurels to the institute through to create an ecosystem of “development without several prestigious awards, honours, and recognitions. destruction”. The research scholars continued their winning streak Materials Science and Technology Division of CSIR- by achieving the best poster, best oral presentation, NIIST is actively involved in cutting edge R&D activities and paper awards in prestigious seminars and leading to high science and relevant technologies symposia. 16 Agro Processing and Technology Division Expertise Post-Harvest Technologies, Nutraceuticals and Functional Foods, Value addition of Agro Produces, Phytopharmaceuticals, Metabolic syndrome and Cancer biology. Scientist : 10 Technical staff : 3 Students : 45 Facilities Pilot Plant Facilities for Evaporation, Distillation and Drying, HPLC, GC-MS, Flow Cytometer, RT PCR, Lyophiliser, Multi mode Plate Reader, High content bioimager - BD Pathway TM 855 Ongoing projects : 22 (Grant-in-aid, Sponsored, Consultancy and Technical Services, In-house) Publications (SCI+non SCI) : 13 Ph. D. awarded : 2 17 Annual Report 2018-19 कृ षि पससं ्रण तथा ꥍ셌饍योगकी पभाग कृ षि प्रसंस्कण तथा प्र셌饍योगकी प्रभाग एक बहु-विषयक कᴂद्रहै, जो कृ षि उपज और पादप संसाधनरों पर जोर देते हुए प्र啍क्र्봾 (शेल् लाइफ एन्हासमᴂट, भडं ारण, मलू ्यवरन) तथा उत्पद विकास (न्絍य रस्ूटय कल्, कार्यत्क खाद पदार्, आहारीय परू क, फाइटोफार्मस्ूटय कल्, बायो-उर㔵रक और बायो-कीटनाशक) पर मखु ् ध्봾न देता है । प्रभाग के मखु ् उ饍शद ्यों मᴂ से एक है- वै煍ञानक तथा तकनीकी नवाचार के माध्म से अपने उपज के लिए उच् लाभ प्रदान कराते हुए किसानरों के सामान् कल्봾ण मᴂ सधु ार । प्रभाग मᴂ कृ षि प्रसंस्कण के 啍षे मᴂ प्रमखु पायलट संयंत सवु िधाए ं और एक तकनीकी व्봾पार ऊष्मान कᴂद्र (टीबीआईसी) वर्मान है । प्रभाग की गतिवि啍ध्रों मᴂ समदृ जैव विविधता की खोज तथा इस 啍षे मᴂ प्रचरु मा配र मᴂ उपलब् पारंपरिक 煍ञन और प्रभाग की विशेषजता का उपयोग करते हुए न्絍य रस्ूटय कल् और फाइटो फार्मस्ूटय कल् के विकास और सत्봾पन शामिल हℂ । एडं ोफे टिक स啍ू ष जीिरों से जैव उर㔵रक और जैव कीटनाशकरों का विकास तथा मसालरों और फलरों से स啍क्र् तत् के अलगाव के लिए औ饍योगक 셂प से महत्पर्ू एजं ाइमरों के उत्पदन मᴂ सकम नतनू स्देशी माइक्र셋बियल उपभेदरों के खनन पर प्रभाग स啍क्र् है । यौगिकरों के इन वि絍셋 स्क्रीनंग के लिए तथा मधमेह,ु दय रोग, कℂसर और गैर- एल्कहॉलिक फैटी यकृ त रोगरों के लिए मैके निजम आधारित अध्यन के लिए प्रभाग मᴂ सवु िधाए ं उपलब् है । प्रभाग मᴂ मानव संसाधन विकास के लिए अकादमिक कार्क्रम है (पीएचडी) और उ饍यगरों और अकादमिक संस्थनरों की आवश्कता के लिए खाद वि煍ञन और जैव चिकित्स वि煍ञन के तहत भी कार्क्रमहै । हाइलाइट $ उत्पद और प्र啍क्र्봾 विकास, प्र셌饍योगकी उन्नन और स्वस्थ लाभ के वै煍ञानक सत्봾पन के लिए आर एडं डी, उ饍यग इटं रफेस कार्क्रम (प्रायोजित और परामर्) $ विटामिन ए की कमी के लिए रेड पामओलेन (आरपीओ) आधारित कार्यत्क खाद उत्पद (कार्यत्क वनस्पत तेल और मलु ायम जेल) $ चयापचय विक봾िरों और कℂसर के लिए पौधरों से बायोएक्टि यौगिकरों का फार्मकोलॉजिकल मल्ू याकन $ देशी स啍ू षजीव से औ饍योगक 셂प से महत्पर्ू एजं ाइमरों के माध्म से स啍क्र् घटकरों के निष्करण के लिए वानस्पतकरों का जैव प्रसंस्कण $ एडं ोफाइटिक जीिरों पर विशेष जोर देने के साथ स啍ू षजीव से जैव उर㔵रक और जैव कीटनाशक $ प्राकृ तिक उत्पदरों के साथ 絍रइफिनाइल फॉस्फोनिम के संयोग के माध्म स माइटोकॉन्ड्ल एटीऑकं ्सडᴂट का विकास $ चयापचय वर्क के 셂प मᴂ कृ षि / खाद प्रसंस्कण अवशेष साम嵍र से आहार फाइबर $ खाद पदार्थो मᴂ ए啍क्रलमाइड और शमन रणनी啍त्रों $ पोषण और बायोएक्टि घटकरों के लिए गैर-डेयरी पेय पदार् और वितरण प्रणाली $ जराचिकित्स स्वस्थ देखभाल अनप्रु योगरों के लिए शाकाहारी प्र셋टीन की 셋त पहचान और सत्봾पन। $ पारंपरिक अनाज और कम फल और सब्जियों से मलू ् वर्धत उत्पद। $ आयर्ु द मᴂ नियोजित विशिष्ट उपचार के जैव रासायनिक, सेललु र और आणविक स्त सत्봾पन अध्यन। 18 National Institute for Interdisciplinary Science & Technology 18 Annual Report 2018-19 Agroprocessing and Technology Division (APTD) is a multidisciplinary centre with main focus on process (shelf life enhancement, storage, value addition) and product development (nutraceuticals, functional foods, dietary supplements, phyto pharmaceuticals, bio-fertilizers & bio pesticides) emphasizing agri produce & plant resources. One of the main objectives of the division is improvement of general welfare of farmers through high returns of their produce via scientific and technological intervention and innovation. Division has major pilot plant facilities and a technology business incubation centre (TBIC) in the area of agro-processing. APTD is also involved in the development and validation of nutraceuticals and phyto pharmaceuticals exploring rich biodiversity, availability of abundant traditional knowledge in this region and available expertise in the division. APTD is also working on development of bio-fertilizers & bio- pesticides from endophytic microbes, mining of novel indigenous microbial strains capable of producing industrially important multiple enzymes for isolation of active ingredients from spices and fruits. Division is also equipped with facilities for in-vitro screening of compounds and mechanism based studies for diabetes, cardiovascular, inflammation, cancer and non-alcoholic fatty liver diseases. The division has academic programmes (PhD) for human resource development in the field of food science and biomedical sciences for meeting the needs of industries and academics institutes. Highlights • R&D, Industry interface programmes (sponsored & consultancy) for product and process development, technology up-gradation and scientific validation of health benefits • Red palm olein (RPO) based functional food products (functional vegetable oil & soft gel) for vitamin A deficiency • Pharmacological evolution of bioactive compounds from plants for metabolic disorder and Cancer • Bio-Processing of botanicals for active ingredient extraction through industrially important enzymes from native microbes • Bio-fertilizers and bio-pesticides from microbes with special emphasis on endophytic organisms • Development of mitochondrial antioxidant micronutrients through conjugation of triphenyl phosphonium with natural products • Dietary fibre from agri/food processing spent materials as metabolic enhancers • Acrylamide in foods and its mitigation strategies • Non-dairy beverages and delivery systems for nutritional and bioactive components • Source identification and validation of vegetarian proteins for geriatric health care applications. • Value added products from traditional grains and underutilised fruits and vegetables. • Biochemical, cellular and molecular level validation studies of specific treatment regimens employed in Ayurveda. National Institute for Interdisciplinary Science & Technology 19 19 Annual Report 2018-19 FOOD SCIENCES AND TECHNOLOGIES Occurrence of acrylamide in traditional deep Post-Harvest Technologies and Processing of fried snack products and use of spices as Agri Produces mitigating agents against acrylamide formation Post-harvest operations for value addition of Acrylamide is a induced toxicant formed in foods indigenous Agri crops- Jackfruit when exposed to high temperature processing e.g., Govt. of Kerala had sponsored a project for the benefit baking, roasting, frying etc. Long-term exposure to of agri entrepreneurs and MSME’s of the State, the acrylamide is reported to cause health risks such primary focus of which is to develop and commercialize as diabetes, cardiovascular diseases and cancer. In the technologies for value addition of various agri view of this, the occurrences of acrylamide in various crops of the State. As a part of this ongoing project food products have been investigated and mitigation technologies were developed in pilot scale level for strategies have been recommended by various making various dehydrated and ready to use agri& regulatory authorities like European Food Safety and food products based on indigenous agri produces. Standards Authority (ESFA) and U. S. Food and Drugs This include millet based ready to eat breakfast Administration (U. S.FDA). As part of the initiative mixes, soups and porridges, dehydrated ready to by Food Safety and Safety Standards Authority of use vegetables/vegetable mixes for various culinary India (FSSAI)’ to survey the occurrence of acrylamide applications, dehydrated ready to constitute coconut in traditional Indian foods, a study was conducted based chutneys and gravy and dehydrated fruits. The with the support of FSSAI to find out the acrylamide products and the process were optimized based on content in deep fried snack products. The samples nutritional &sensory analysis and shelf life evaluation. included namkeen (sev, mixtures and dal products), The nutritional composition and health benefits of traditional deep fried snacks (samosa, vada, murukku, the indigenous produce were also evaluated. Studies achappam, pakkavada) and sweets (halwa, jalebi, were also undertaken to establish the nutritional laddoo, Mysore pak). The presence of acrylamide was and health benefits of jackfruit, the official fruit of detected in all the samples studied. The occurrence Kerala. Preliminary studies indicated that the raw of acrylamide followed the pattern Navrathan jackfruit is a very good source of bio actives and dietary polysaccharides with interesting functional properties. mixture>Aloobhujia>Tasty Nuts> cutlet. Acrylamide The technologies will be transferred as part of the content in the samples under evaluation was found to programme to interested entrepreneurs / MSME’s for be within the safe limit as suggested by ESFA. However, commercialization. further population exposure studies are required to confirm the safe use of the food products. Further to this, in order to formulate mitigation strategies to reduce the acrylamide formation in namkeens, preliminary studies were conducted to evaluate the effect of various spices viz., turmeric, chilly and pepper powder, that are traditionally being incorporated in the namkeen preparation. Namkeen samples were prepared as gram flour as the main ingredient. Turmeric, chilly and pepper were incorporated in to the dough separately and the namkeens were prepared by deep frying. The amount of acrylamide formed in the samples was analysed using HPLC with Diode Array Detector and compared with the control, without any spices. Colour, texture profile, moisture content and crude fat of the 20 National Institute for Interdisciplinary Science & Technology 20 Annual Report 2018-19 samples were also analysed. Addition of spices was fibre soluble & insoluble and prebiotic dietary fibre found to decrease the acrylamide formation. Among are gaining lots of importance in modulation of many the 4 samples, the control sample was found to be metabolic activities in the management of lifestyle high in acrylamide (430 µg /kg). The samples with associated diseases. spices incorporated showed significant reduction in The collaborating industry generates a huge amount acrylamide content when compared to the control, of industrial residue, which consists of spices, fruits and the one with turmeric exhibited minimum acrylamide other agri crops. On preliminary evaluation, we found content (14.03 µg/kg). The study indicates reduction in acrylamide formation when spices were incorporated that these spent materials are rich source of dietary in the preparation of deep fried mixtures. This may be fibre and bioactive phytochemicals. Subsequently, a correlated with the higher bioactive components of Proof of Concept (POC) at bench level was developed spices, which is under investigation. for the extraction of dietary fibre and bioactivities from As a part of CSIR mission project FOCUS, further spent turmeric, amla and red spinach generated from studies are initiated to find out the acrylamide content the industry. Based on the POC, Biotechnology Industry in various baked products and its mitigation strategies. Research Assistance Council (BIRAC) has recently sanctioned a project to develop process for extraction of dietary fibre and bioactivities from spent turmeric generated from M/s Arjuna Naturals, extraction of dietary fibre and its prebiotic efficacy as well as the metabolic enhancing properties. The in vitro studies will be carried out at CSIR-NIIST followed by the in vivo efficacy studies at M/s Arjuna Naturals. The present work is of great significance to food/nutraceutical/ Ayurveda industries in terms of better utilization of Figure 2: Concentration of Acryl amide in various samples natural resources for sustainable development and to Value addition of spent turmeric: BIRAC- address the issue of environmental pollution by better ARJUNA Naturals and CSIR-NIIST management of industrial waste. The development of novel processed products and Technology development for preservation & value chain for agri and food by-products for higher value addition of matured coconut water economic returns had always attracted scientific The parts of its fruit like coconut kernel and tender interventions. These by products/agriculture-food coconut water have very wide global market through processing residues are rich source of dietary fibre and different levels of product manufacture and export. bioactive compounds and studies reveal that there is Matured Coconut water (MCW) is a by-product in all immense potential to develop value added products in coconut related industries, which is rich in energy the form of functional foods with metabolic enhancing sources and can be consumed as a drink. It is one of properties such as dietary fibre and its prebiotic nature’s perfect packages as a health drink, particularly activities are reported to improve the ADME of dietary to overcome problems related to body dehydration, carbohydrates and fats. The bioactive molecules bound but unfortunately in India the coconut water is seldom to dietary fibre, which are released during digestion used by the industries for product making while in along with the fermentation metabolites by probiotic many foreign countries matured coconut water is bacteria, are reported to act as metabolic enhancers. more exploited commercially through different types Modulation of gut micro biomass has been reported of drinks, concentrates, formulated products etc. The to play important role in ADME. In this respect, dietary market of coconut water in India has all long suffered National Institute for Interdisciplinary Science & Technology 21 21 Annual Report 2018-19 a handicap as the water’s shelf life lasts barely a few this process by inhibiting the secretion of VEGF and hours once decanted from the harvested coconut. thus inhibiting the tumour cells from growing their Moreover, many coconut producing companies are own blood vessels. Anti-angiogenesis has become facing environmental issues to address the disposal of the focus of study for controlling cancer recurrence coconut water which is disposed currently as industrial and metastasis. Malignant cells possess the ability to effluent. Hence Proper technology development is invade and metastasize in addition to uncontrolled needed for the value addition of the MCW which can proliferation and inhibition of this process also have lead to better income generation through the by- potential in cancer drug discovery. The activity of many product utilization and also to solve the environmental anticancer drugs is achieved through the activation issues related to pollution. In this scenario a project of MAPK pathway and p38 MAPK has a major role in sponsored by Coconut development Board has been the activation of Bax translocated to the mitochondria initiated, which is focused on (a) the development and can interact with p53 to trigger apoptosis or of a need based technology for preservation of induce cell cycle arrest. The effects of two potential coconut water by suitable in situ processing and (b) diindolyl methane compounds (DIM-1 and DIM-4) in value addition of coconut water through product reducing the cell migration, inhibiting angiogenesis diversification. The project is in progress and the and activation of p38 MAPK in cervical cancer cells design and fabrication of the prototype processing have been studied. The results indicated that DIM unit is in completion stage which will be demonstrated derivatives have the potential to reduce cell migration before user industries for commercialization. as revealed by scratch wound assay, reduced VEGR and Industrial linkages for sponsored projects phosphorylation p38 MAPK expression by western During the last year many industrial projects were blot analysis. Thus the compounds have promising undertaken for need based collaborative research in potential to be developed as anticancer compounds. identified thrust areas. The services offered for the industry were product development & validation, quality and processing related issues, fine tuning of the newly developed formulations etc. Some of the major beneficiaries were: M/s. Tata chemicals, M/s. Pankajakasthuri Herbals India Limited, M/s. KSE Limited etc. Collaborative research projects were also initiated on identified areas with manufacturing industries. Figure 3: Anticancer effects of two dindolyl methane derivatives BIOACTIVES AND ITS APPLICATION IN HEALTH Antidiabetic potential of two resveratrol Diindolylmethane derivatives inhibit the cervical oligomers isolated from the stem bark of cancer cells growth by inhibiting cell migration, Hopeaponga in skeletal muscles cell lines. angiogenesis and p38 Mitogen-activated protein kinases (MAPK) activation The oxidative stress stimulated pathways is Cancer cells needs a good blood supply to provide itself recognized to be related with the onset of diabetes with food and oxygen and to remove waste products. and its complications, which is the actual cause of the Angiogenesis means the growth of new blood vessels morbidity and mortality connected with diabetes. and cancer cells initiate this process by producing In diabetic conditions, along with other factors, the initiator Vascular Endothelial Growth Factor oxidative stress is also stated to be accountable for the (VEGF). Anti angiogenic compounds help to block impaired insulin secretion and glucose consumption 22 National Institute for Interdisciplinary Science & Technology 22 Annual Report 2018-19 in peripheral tissues. It is reported that diabetic Hypoglycemic Potential of Acylphenols Isolated from complications can be prevented by the inhibition of the Stem Bark of Myristicafatua in rat myobalsts ROS production or its neutralization. Antioxidant Phytochemical investigation on the stem bark of treatments have established favourable effects Myristicafatua led to the isolation of new compounds in animal models of diabetes. Conversely, these that enhances 2-deoxyglucose uptake in L6 myotubes effects were not deciphered in larger clinical trials and demonstrated some acylphenols isolated from proposing the necessity for new and more proficient Myristicafatua as a natural lead scaffold for the treatment antioxidants, aiming multiple factors of diabetes and of type II diabetes mellitus. The skeletal muscle is a key its complications. Therefore, an effective antioxidant player of glucose exploitation in the body and more having antidiabetic properties will be an assuring than 70 % insulin stimulated glucose uptake appears remedy for the treatment of both diabetes and its here. Impaired glucose uptake results in an imbalance complications. There has been an upsurge in the usage of glucose homeostasis that leads to T2DM. To study of plant extracts or their active components for care the effect of the isolated natural products on the and wellbeing requirements over the last few years. utilization of glucose in skeletal muscles, MTT assay to The current study had screened two resveratrol based evaluate their cytotoxicity in L6 myocytes was primarily compounds (α-Viniferin and THPG) isolated from the carried out. Results revealed that up to 50 μM for 24 stem bark of Hopea ponga from Dipterocarpaceae h did not produce any sign of cytotoxicity; therefore, family for their antioxidant as well as antidiabetic 50 μM concentrations of all the isolates were selected potential. Both the compounds were showing for further 2-NBDG uptake studies. Compounds 1 to 5 decreased TBHP induced ROS production in skeletal showed a significant stimulation of glucose uptake by muscle cell lines (Fig 1). The effect of glucose uptake 1.52 ± 0.13, 1.62 ± 0.04, 1.65 ± 0.02, 1.65 ± 0.56 and 1.71 ± performed by 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4- 0.78 fold, respectively, whereas compound 6 enhanced yl) amino)-2-deoxyglucose (2-NBDG) in L6 myoblast the uptake by 2.6 ± 0.35 compared with the control. were measured by fluorescent microscopy and Metformin, as a positive control, showed 1.69 ± 0.02 flow cytometry. The compounds Viniferin and , α- - fold stimulation of glucose uptake at 100 μM under THPG showed 2-NBDG uptake of 49.6% and 38.8% identical experimental conditions. Further studies respectively. By examining the molecular pathway are in progress to establish the therapeutic efficacy through which the compounds elicit their glucose and safety of isolated molecules, as a promising uptake potential, it was observed that both the antihyperglycemic agent from M. fatua. compounds mainly Figure 5: Fluorescence analysis of 2-NBDG uptake by flow Figure 4: MTT cytotoxicity assay cytometry National Institute for Interdisciplinary Science & Technology 23 23 Annual Report 2018-19 Antidiabetic potential of Promalabaricone analysis (Fig 2(B)). The results revealed that PMB B from Myristicafatua Houtt. seeds through promoted the glucose uptake in myocytes by the modulation of glucose uptake via the stimulating the translocation and expression of upregulation of AMPK in L6 myotubes GLUT4. Promalabaricone B (PMB), an acylphenol was isolated from dichloromethane-soluble extract of the seeds of Myrisiticafatua Houtt. There is no detailed phytochemical and pharmacological evaluation of the seeds of M. fatua. Incidentally, in the present study, the phytochemical investigation of the seeds of M. Fatua have been carried out and resulted in the isolation of six major compounds. Among the isolates, the Figure 7: Western blot analysis antidiabetic potential of Promalabaricone B (PMB) has never been investigated. Hence, the detailed From this, it is clear that PMB can acts as a potential investigation on antidiabetic potential of PMB and therapeutic option for diabetes treatment, and its its underlying molecular mechanisms, leading to hypoglycaemic effect may be mediated by AMPK improved glucose uptake in L6 skeletal muscle cells upregulation and induction of GLUT4 translocation. have been carried out. The results clearly indicate that PMB is a potential therapeutic option for diabetes treatment, and its MTT assay was carried out to check the toxicity of PMB hypoglycaemic effect may be mediated by a main in L6 cell lines (Fig1(A)). Potential of PMB to uptake mechanism that includes AMPK upregulation and NDDG (a glucose analogue) was carried out by flow induction of GLUT4 translocation. cytoimetry analysis. PMB exhibited an enhanced glucose uptake in L6 myotubes with 46.3 % in 2.5 µM, Palm Neera syrups and immunomodulation (Fig1(B)). Encouraged with these results, the molecular Borassus flabellifer Linn. (Palmyra palm) belonging to mechanism of PMB through the upregulation of AMPK Arecaceae family grows ubiquitously throughout India was also investigated. and widely distributed in tropical Asian countries. It produces a sweet sap which is called “neera” in local language, and this is taken as a drink or it is processed into palm gur. A process for developing shelf stable neera syrup has already been optimized. Under the objectives of the present project, two formulations based on spices have been developed; one of them is a product prepared from decoction out of dry ginger, long pepper and pepper, which is called as Trikatu in classical preparation; the decoction was made into a Figure 6: Cytotoxicity of PMB syrup using palm neera. Another product was prepared To gain further insight into the mechanisms, GLUT4 from decoction prepared out of ajwain, jeera and black upregulation in L6 myotubes were examined by pepper and made into syrup using palm neera similar immunoblot analysis (Fig2(A)). Further to elucidate to Trikatu syrup preparation. the mechanism by which PMB exerts its antidiabetic Immunomodulatory and toxicity studies of plain potential, involvement of AMPK signalling in PMB palm syrup, Trikatu syrup and ajwain syrup was treated myotubes were examined by immunoblot done on Wistar albino male rats and Swiss albino 24 National Institute for Interdisciplinary Science & Technology 24 Annual Report 2018-19 mice. Palm sap enriched syrups were used to draw IL-6) and anti-inflammatory mediators (IL-10) were immunomodulatory effect they had on selectively investigated using ELISA. Effect of the extracts on LPS immune compromised/challenged animals. Trikatu induced expression of MMPs was investigated using enriched syrup exhibited critical protective role in zymography. The AGE and TCE at concentrations of 50, tests like CTX induced myelosuppression, neutrophil 100 and 200 µg/ml demonstrated anti-inflammatory adhesion test, SRBC induced DTH reaction and carbon activity through the inhibition of NO (Fig 1a and 1b), clearance assay along with Ajwain syrup. Alongside TNF-α and IL-6 (Fig 2a and 2b) expression and promoted cell mediated immunity, another aspect of the test the expression of IL-10 (Fig 3a, 3b) in a concentration treatment was the tests that were carried out to find dependant manner. Zymographic analysis also the endurance capacity of the groups. Elevated levels showed a significant decrease in MMP activity in of chemical indicators (lactate and urea nitrogen) of treated groups in a concentration dependent manner. Pre-treatment with AGE and TCE exerted blocking exhaustion in the blood of treatment groups were effect on LPS induced expression of JAK2 as well as the seen to be lesser than control groups. Trikatu syrup downstream elements of the pathway including STAT- outperformed other test formulations and hence 3 and p-STAT3 analysed using western blotting (Fig 4). toxicity study was done only for trikatu syrup. Studies The anti-inflammatory action of AGE and TCE can be showed no signs of cellular damage or depositions. attributed to its role in JAK-STAT pathway modulation Normal cellular architecture was seen in treatment since most of the proinflammatory mediators (IL-6 groups in oral toxicity studies (sub chronic and and MC chronic). These findings show the potential of using Inflammatory signaling in cardiomyocytes usually trikatu based formulations as immunomodualators. occurs as an early response to myocardial injury Generation of potential VEGF, JAK1/JAK2 and and entails cytosolic and mainly mitochondrial IL-17 modulators for rheumatoid arthritis from reactive oxygen species overproduction. Apoptosis traditional medicinal plants of cardiomyocytes is one of the important outcomes The study is aimed at investigating the of hyperglycemia-induced inflammation and immunomodulatory effect of hydroalcoholic extract oxidative stress in the heart. Diabetic hyperglycemia of three traditional medicinal plants Alpinia galanga is accompanied by the increased expression of (AGE), Tinospora cordifolia (TCE) and Boerhavia diffusa cytokines in local cardiac myocytes. Activation of Toll- (BDE) in LPS (1 µg/ml) stimulated RAW 264.7 like receptors (TLRs) and the inflammasome complex macrophage cell line. Polyphenols in the extracts were has recently been proposed to be central in cardiac first identified by retention time and reconfirmed inflammation and likely in the pathogenesis of DCM. by spiking with the individual standards. The HPLC The following steps mainly involve increased activation profile showed that the hydroalcoholic extracts of of the proinflammatory nuclear transcription factor- all three plants (TCE, AGE and BDE) were rich source κB (NF-κB), and the related expression of cytokines of polyphenols (chromatogram not shown). The like tumour necrosis factor-α (TNFα). TLRs elicit prepared extracts were investigated for cell viability conserved inflammatory pathways culminate in the using MTT assay. The extracts ranging from 6.25 to 200 activation of NF-κB and activating protein-1 (AP-1). µg/ml (6.25, 12.5, 25, 50, 100 and 200 µg/ml) yielded TLR2 and TLR4 have a central role in the pathogenesis greater than 90% viability. Various concentrations (25, of diverse heart disorders. Both are strongly 50, 100 and 200 µg/ml) were used to study the anti- upregulated in chronic dilated cardiomyopathy and inflammatory effect of the extracts. The inhibition of heart failure, serving as upstream inducers of a large NO production was investigated using Griess assay and variety of proinflammatory molecules including ICAM- the expression of inflammatory mediators (TNF-α and 1, chemokines, TNFα, interleukins, HSPs, interferon National Institute for Interdisciplinary Science & Technology 25 25 Annual Report 2018-19 γ (IFNγ), and inducible nitric oxide synthase (iNOS). peptide (BNP), atrial natriuretic peptide (ANP) and The inflammasome is a group of multimeric protein lactate dehydrogenase (LDH) release were assessed. complexes composed of a cytoplasmic receptor of the HG caused significant [Ca2+]i overload through down Nod-Like Receptor (NLR) family, an adaptor protein regulation of SERCA2/1, pPLN and pPKA C-α; and termed ASC (Apoptosis-associated Speck-like protein upregulation of PLN and PKA C-α and alteration in containing an N-terminal caspase recruitment domain the integrity of mitochondria with HG. The [Ca2+]i CARD), and procaspase-1. The best characterized overload in turn caused oxidative stress via generation complex is the NLRP3 inflammasome, which has of reactive oxygen species, lipid peroxidation and been identified in a wide range of cells including protein carbonylation. This resulted in cell injury macrophages, cardiofibroblasts, and cardiomyocytes. which was evident with significant release of BNP, ANP The cJun-N-terminal kinases JNKs are members and LDH. FA co-treatment was effective to mitigate all of the mitogen-activated protein kinases (MAPK) pathological changes caused by HG. From the overall family which are activated under conditions of stress. results, it is concluded that [Ca2+]i overload via SERCA Likewise, under diabetic conditions, oxidative stress is pathway and altered mitochondrial integrity are the induced and the JNK pathway is activated. main causes for oxidative stress during HG. Based on the results it is reported that FA could be an attractive nutraceutical for DC. Ferulic acid, a common bioactive from fruits ameliorates hyperglycemia induced alteration Anti-obesity effects of 7- methoxy-3-methyl-5- in H9c2 cells via SERCA/PLN pathway ((E)-prop-1-enyl)-2(3,4, trimethoxyphenyl)-2,3- Oxidative stress and associated complications dihydrobenzofuran from Myristica fragrans are the major pathological concerns of diabetic Myristica fragrans Houtt (nutmeg) is an aromatic cardiomyopathy (DC). We aim to elucidate the evergreen tree of the family Myristicaceae. Nutmeg, the mechanisms by which high glucose (HG) induced actual seed of the tree, is an important nutraceutical, alteration in calcium homeostasis and evaluation used to treat cold, fever, catarrh, general respiratory of the beneficial effect of two concentrations (10 ailments, digestion and skin diseases (Iyer et al., 2009). and 25 µM) of ferulic acid (FA). HG was induced in The anti-obesity effect of the bioactive compound, H9c2 cardiomyoblast by treating with glucose (33 7- methoxy-3-methyl-5-((E)-prop-1-enyl)-2-(3,4,5- mM) for 48 h, and FA was co-treated. [Ca2+]i overload trimethoxyphenyl)-2,3-dihydrobenzofuran (TM) was was found increased significantly with HG. For first identified in our screening of compounds isolated elucidation of mechanism, the SERCA pathway and from the mace nutmeg against adipogenesis. To mitochondrial integrity (transmembrane potential further characterize its anti-obesity activity in detail, a and permeability transition pore) were explored. Then series of in vitro obesity-related assays were conducted. oxidative stress, and cell injury with brain natriuretic In adipogenesis assay, TM blocked the differentiation 26 National Institute for Interdisciplinary Science & Technology 26 Annual Report 2018-19 of 3T3-L1 preadipocyte in a dose-dependent manner Hyperinsulinemia (HI) is known to be a risk factor for at concentrations 1, 5, and 10 µM. Treatment with TM IR. Increased insulin induces glycation and creates reduced triglyceride content and enhanced glycerol IR in HepG2 cells. These effects were paralleled by secretion in a dose-dependent manner. Also, TM an increase in oxidative stress and mitochondrial suppressed the expression of lipogenic genes, while dysfunctions. Vanillic acid (VA) was selected to check increasing the expression of lipolytic genes in vitro its potential against HI induced complications due with maximum effect at 10 μM concentration. The to its acceptance as a food additive and its biological anti-adipogenic and anti-lipogenic effect of TM seems safety. HepG2 cells were incubated with 1µM insulin to be mediated by the inhibition of PPARγ and C/EBPα for 24 hrs for developing a model of HI. The test expression as shown in in vitro, and by the suppression material was incubated simultaneously. The effect of of PPARγ transcription factor activity. Moreover, TM VA against high insulin induced glycation, oxidative stimulated fatty acid oxidation in an AMPK-dependent stress, mitochondrial dysfunctions and impaired manner. Treatment of TM also greatly improved levels redox status in HepG2 cells were studied. VA of obesity-related biomarkers such as glucose uptake prevented glycation through decreased Receptor for in the differentiated adipocytes, and secretion of Advanced Glycation End-products (RAGE) expression adipocytokines such as adiponectin, and resistin. and increased dolichyl-diphosphooligosaccharide Altogether, these results showed anti-obesity effects (DDOST) levels. Further, VA significantly decreased of TM on adipogenesis and lipid metabolism in vitro the Reactive Oxygen Species (ROS), Malondialdehyde and opened the possibility of developing TM as anti- (MDA) and protein carbonyls level. High insulin also obesity agent. affected the mitochondrial membrane potential and Hyperinsulinemia induced alterations in redox its metabolism through reduced oxygen consumption status, bioenergetics and glucose metabolism in HepG2 cells and amelioration with vanillic acid rates and up-regulation of the energy status of the cells and these effects were reverted by the VA. The role of Insulin resistance (IR) is a crucial factor in the VA on up-regulation of MFN1 protein and activation development of type 2 diabetes mellitus (T2DM) and of AMPK-sirt1- PGC1-α axis revealed its mitochondrial associated complications. The role of hyperinsulinemia protection ability during abnormal insulin behaviour. on insulin-sensitive target tissues like skeletal muscle, Overall results reveal that HI in insulin sensitive fat, liver explain why IR has this much importance cell alters basic biology and VA is effective against in the pathogenesis of many metabolic disorders. complications arising from HI. National Institute for Interdisciplinary Science & Technology 27 27 Annual Report 2018-19 High fructose and palmitate induced surplus 3 activities. The protein expression of Cyt.C and TG accumulation leads to mitochondrial mitochondrial fission proteins like Drp1 and Fis1 also dysfunction reveals the possible significance of elevated markedly. The mitochondrial membrane bioenergetics in the genesis of liver diseases potential deviates from its normal drastically with the Non-alcoholic fatty liver disease (NAFLD) is one down regulation of mitochondrial complex activities, of the most common chronic liver diseases. Liver expression of fusion proteins like Mfn2 and Opa1 and plays a pivotal role in metabolic homeostasis and marker genes involved in mitobiogenesis. This reveals both metabolic inflexibility and insulin resistance the significance of bioenergetics in the genesis of are the major factors behind the development of NAFLD. Development and optimization of tea bags NAFLD, so most of the patients typically have obesity, based on spices with antidiabetic properties insulin resistance and diabetes. Genetics, lifestyle As a part of the project ‘development of spice based and diet are the major driving forces behind the functional foods’ supported by Spices Board, spice progression. NAFLD is characterized by increased based tea bags were developed by blending green lipid accumulation in hepatocytes and alteration in tea with spices and the process was optimized using bioenergetics. The aim of the study was to validate the resonance surface methodology (RSM) for prevention potential role of high fructose and palmitate, similar and management of diabetes. The spices that are to the modern dietary pattern and validate whether reported for antidiabetic activity were chosen for the consumption of high fat and carbohydrate could the study, and the activity was affirmed by in vitro contribute hepatic steatosis, and the molecular antidiabetic studies. The spices that demonstrated mechanism behind the alteration in bioenergetics promising activity were blended with green tea after that leads to the progression of NAFLD. size reduction in different proportions and combination The findings of the study suggested that the presence based on RSM and packed in tea bags. The products were analyzed for its phytochemical and antioxidant potential using total phenolic and flavonoid content (TPC & TFC) and DPPH radical scavenging activity. Tea decoction was prepared and was analysed for sensory properties and antidiabetic activity in terms of inhibition of intestinal α-glucosidase, pancreatic α-amylase and anti-glycation properties. Further to this, cytotoxicity of the extracts and its ability to enhance the uptake of glucose by the cells were studied by glucose uptake assay in L6 muscle cells. It was found that the spice based green tea-mix infusions possess good antidiabetic potential in terms of inhibition of amylase, glucosidase and glycation with inhibition of high fructose and palmitate caused a significant of 45 μg/mL, 72 μg/mL and 121 μg/mL, and enhanced rise in intracellular triglyceride accumulation glucose uptake in cells from 3.1% (control cells) to and expression of lipogenic proteins in HepG2 24%. cells. Detailed investigation on vital parameters of mitochondria revealed that the production of mitochondrial superoxide was increased significantly together with increased calcium overload and caspase 28 National Institute for Interdisciplinary Science & Technology 28 Annual Report 2018-19 Effect of morin, a flavonoid, on Warburg effect inhibition of GLUT 1 expression represents an effective (SW480 colorectal cancer cells) way of preventing cancer progression by blocking its The potential of morin, a flavonoid found mainly in major nutrient supply, resulting in reduction of the members of the Moraceae family was investigated glycolytic flux that further sensitizes cells to undergo for its nutraceutical potential in prevention and mitochondria dependent apoptosis. Further studies management of life style associated diseases, as a by western blotting as well as docking suggested part of the ongoing activity on functional foods and that alteration of Warburg effect in SW480 colorectal nutraceuticals. Studies suggest that diet play a major cancer cells by morin is mediated through blocking role in the onset of colorectal cancer. Preliminary PI3K/Akt signaling pathway. The study suggests that studies indicated that morin possess excellent morin may be a promising nutraceutical agent against anticancer potential against colorectal cancer (CRC) colorectal cancer. Further in vitro and in vivo studies are and inhibit Warburg effect (the high rates of glucose ongoing to confirm the results and to understand the uptake and lactate production, even in the presence of other mechanisms by which morin exhibits anticancer oxygen, rather than metabolizing pyruvate through the properties. TCA cycle) in cancer cells. Warburg effect happens at a Molecular characterization of functional domain faster rate resulting in quicker rate of ATP production, in CC2D2A associated with ciliopathy which in turn helps in the rapid proliferation of cancer Cilia are microtubule-based hair-like organelles cells and greater dependency on glycolysis by cancer that extend from the surface of almost all cell types cells offers a number of potential therapeutic targets of the human body. They are involved in numerous for eliminating cancer cells, very selectively and physiological and developmental processes. Many effectively. Therefore, further studies were carried proteins are involved in biogenesis of cilia. Mutations out to understand the mechanism by which morin in genes encoding these proteins cause multi system interfere with Warburg effect. The treatment of SW480 disorders called ciliopathies. CC2D2A is a gene colon cancer cells with morin could limit the entry of localized in basal body. It is required for the cilia glucose into the cells by decreasing GLUT 1 expression, assembly. CC2D2A contains 2 coiled coil domains and resulting in a decline in cellular ATP level. The a C2 domain. Mutations in the gene encoding CC2D2A cause ciliopathies like Meckel and Joubert syndromes. Null mutations in CC2D2A result in lack of protein, thereby lack of cilia, as in Meckel Gruber syndrome (MKS), a lethal ciliopathy. Missense mutations in CC2D2A result in abnormal cilia and are associated with Joubert syndrome (JBS).The patients with JBS survive with blindness and mental retardation. Most of the mutations in C2 domain of CC2D2A are known to affect the function of photoreceptors and brain. However, the role of C2 domain of CC2D2A is not clear. So, the present study analysed the role of C2 domain in CC2D2A in cilia forming cells IMCD-3. Mutations in human are simulated by gene knockdown, using custom made shRNA, in cilia forming IMCD3cells. The effect of gene knockdown is analysed by immunofluorescence and western National Institute for Interdisciplinary Science & Technology 29 29 Annual Report 2018-19 blot using antibodies specific to cilia and CC2D2A. below sea level (about 4 to 10 feet). Several microbes The preliminary research indicates that C2 domain is associate inside rice plant parts such as root, stem necessary for cilia function. Further, molecular studies and leaves, known as endophytes that are confirmed to elucidate the role of C2 domain is under progress. as biomass and yield enhancers. In the present study, endophytic bacterial strains were isolated from rice KNOCKDOWN OF C2 DOMAIN SHOWS ABNORMAL CILIA plants of Kuttanad region and screened for plant growth promotion and disease control against sheath blight disease caused by Rhizoctonia solani. The strains were selected based on the in vitro antagonism against R.solani (Fig 1). Among the strains isolated, Bacillus subtilis NIIST B616, Bacillus subtilis NIIST B627 in individual and their combination exhibited best plant growth promotion (Fig 2) and yield. The strains also exhibited management of sheath blight disease and induction of systemic resistance against this disease individually and in combination is in progress. As on 28th day, treatment with NIIST B 627 recorded maximum increment of 46.54, 124.49, 196.67 and 283.33 times respectively for shoot length, root length, fresh weight and dry weight over control followed by combination NIIST B 616 + NIIST B 627 (37.42, 105.54, 115.56 and 225 percentage). C2 Domain knockdown cells (Absence of cilia in C2 domain knockdown cells) MICROBIAL BASED PLANT TONIC Endophytic bacterial strains mediated plant growth promotion and disease management in rice plants Rice (Oryza sativa) is a major food crop for the people of the world in general and Asians in particular; nearly 90% of the world's rice is produced and consumed in this region. Even though food habits of the people of Kerala had remarkedly changed over the last few decades, but still rice continues to be their staple food. Kuttanad ‘The rice bowl of Kerala’ is one of the most fertile regions of the world where rice is cultivated 30 National Institute for Interdisciplinary Science & Technology 30 Chemical sciences and technology division Expertise Energy: Materials and devices for Photovoltaics, Thermoelectric and piezoelectric generators, Electroluminescent devices, Storage materials, chromogenic materials and smart windows, nanomaterial synthesis and applications, Photoprocesses: Ultrafast spectroscopy, photo- catalysis, computational chemistry, Synthetic Organic Chemistry: Phytopharmaceuticals, active pharma intermediates, Sensors: Anti-counterfeiting, diagnostics, nano-bio sensors, Raman spectroscopy, chemical sensors Scientist : 18 Technical staff : 5 Students : 134 Facilities HRTEM (High resolution transmission Electron Microscopy), NMR (Nuclear Magnetic Resonance), AFM (Atomic force Microscopy), MALDI-ToF, Confocal Raman Spectroscopy, Femtosecond Pump- Probe Spectroscopy, Device Fabrication Facility Ongoing projects : 42 (Grant-in-aid, Sponsored, Consultancy and Technical Services, In-house) Publications (SCI+non SCI) : 123 Ph. D. awarded 30 31 Annual Report 2018-19 रसायन वि煍ञन तथा ꥍ셌饍योगकी पभाग रासायनिक वि煍ञन और प्र셌饍योगकी प्रभाग अणओु ंऔर कार्यत्क सामग्रियो के विकास और विभिन् डिवाइस प्लटफार्मो मᴂ उनके अनप्रु योग पर ध्봾न कᴂ द्रित कर रहा है। संस्थन के तीन प्राथमिकता वाले 啍ष配रों का नेततृ ् डिवीजन 饍वार किया जाता है - (1) ऑर嵇निक और हाइब섿ड इलेक絍रॉनक् (ऊर्ज उत्पदन और भडं ारण, क्र셋मोजेनिक कोटिंग्, ठोस राज् प्रकाश व्यस्थ, कम््टेशनलय रसायन वि煍ञन); (2) फ्लोरसᴂट साम嵍र (सरु 啍ष अनप्रु योगरों, निदान और इमेजिंग जांच और अल絍रफास् कैनेटीक्); (3) फाइटोफार्मस्ुटय कल् एडं डग इटं रमीडिएट (औषधीय पौधरों और उन्त दवा मध्यवर का जैव मल्ू याकन)। डिवीजन संस्थन स्त पर सीएसआईआर की विभिन् विषयगत गतिवि啍ध्रों का समन्व करता है, जिसका नाम ऊर्ज (पारंपरिक और गैर-पारंपरिक) साम嵍र और ऊर्ज उपकरण, हेल्के यर और रसायन हℂ। इसके अलावा, डिवीजन दो सीएसआईआर मिशन मोड परियोजनाओ ं मᴂ एक प्रमखु भमिू का निभाता है - (1) स्वस्थ देखभाल अनप्रु योगरों और (2) न्絍य रस्ुटय कल् मिशन के लिए नैनोबायोसᴂसर् और माइक्र셋फ्इल डिक्। यह प्रभाग विभिन् सरकारी एजᴂ啍स्रों और उ饍यगरों 饍वार वित्तोषि प त महत्पर्ू परियोजनाओ ंका संचालन भी करता है। उच् प्रभाव कारक वाले अतं ररा�絍री स्त पर प्रतिष्ठित पीयर-रिव् य पत्काओ ंमᴂ 2018-19 मᴂ डिवीजन से 100 से अधिक प्रकाशन हुए हℂ। वर् 2018-19 के दौरान प्रभाग की गतिवि啍ध्रों और उपलब्धियों पर प्रकाश डाला गया है, साथ ही साथ महत्पर्ू घटनाक्रमरों के सं啍षप्तार स नीचे दिए गए हℂ। हाइलाइट्स • डी एस डी एन ए के लेबल-मकु पता लगाने के लिए डी एन ए की सहायता की स्-एक्सफलीएटेड आयनिक सहसंयोजक कार्बनक नैनो शीट्स की पन:ु असᴂबली। • कℂसर कोशिकाओ ं मᴂ एकीकृ त इमेजिंग और चिकित्स के लिए एक लाइसोसोम-ल啍षत फोटोडायनामिक चिकित्सी एजᴂट के 셂प मᴂ चक्रवाती इरेटा परिसर। • सेल्-रिकवरिंग मेकोन셋क्र셋म चिरल जैलेटर्। • डायकेटोपीरोलोपिरोले-आधारित कम बℂड गैप अर्चालक मᴂ चार् वाहक 鵍ुर ीयता मॉड्यलेशन।ू • सपु रमॉलेक्लय र जेल चरण नियंत्त [4+2] इलेक絍셋प्लक् की श्वेत इलेक絍셋ल्ूमय नᴂस की मध्स्ता के लिए डायल्-एल्ड फोटोकैक्लडडिशन। • समाधान प्र啍क्र्봾 योग्, ZnO पतली फिल्मों पर आधारित 饃ष्टिहीन यवू ी डिटेक्ट। • ऑप्टइलेक絍셋निक अनप्रु योगरों के लिए परोव्कीट उपन्봾स लीड-굍र हाइब섿ड पेरोसाइट साम嵍र। • थियोफिन ऑलिगोमर् का डिजाइन और सं�लषण और उनके आत्-विधानसभा गणु रों का अध्यन। • विलायक की 鵍ुर ीयता 饍वार शासित इ絍ं रमोल्लय र चार् और ऊर्ज हस्तातरण प्र啍क्र्봾ए।ं • हाइब섿ड पेरोसाइट नैनोसे啍क्रस्ल असᴂबली मᴂ फोटोल्ूमय नेशन वदृ 鴿। • कार्न आधारित हाइब섿ड नैनोकं पोजिट्स का उपयोग करके सपु रकैपेसिटर के लिए इलेक絍셋ड साम嵍र। • विषम हाइ蕍셋थर्ल / सॉल्वोथरल सं�लषण 饍वार 3 डी सब्絍रट पर नैनोसंरचित ऑक्सइड। • MoS2 और MnO2 का उपयोग कर उच् ग셁तु ्वकर्ण ऊर्ज और श啍鄿 घनत् के साथ सिक्क सेल कैपेसिटर नेनो साम嵍र। • डाई-सᴂसिटिव सोलर सेल (DSCs) के लिए कॉपर (Cu) आधारित इलेक絍셋लाइट्स, कम प्रकाश तीव्रता (CFL / LED) मᴂ उच् वोल्टज प्राप्त करने मᴂ सकम। • स्देशी डाई सौर मॉड्यलू निर्मण सवु िधा और 30 सेमी × 30 सेमी आकार के प्र셋टोटाइप मॉड्यल।ू • पोर्टल रामन स्पे絍셋मीटर का विकास • प्रकाश प्रेरित स्पन-स्टट स्विचगं एजं ाइम मᴂ जैसे आयरन (III) । • इलेक絍셋क्र셋मिक डिवाइस अनप्रु योगरों के लिए 絍रइफे निलमाइन आधारित जैविक साम嵍र। • सीटी-डीएनए टेम्प्ट पर फु लरीन समहू रों के चिरल स्-संयोजन। • एटीकℂसं र, एटीडं ायबिटिक और एटीं बायोटिक लीड के 셂प मᴂ प्रासंगिक 셂प से प्रासंगिक अण।ु • प्रचरु मा配र मᴂ प्राकृ तिक संसाधनरों का चेम셋प्र셋फाइलिंग और स्थाी उपयोग: औषधीय पौधरों से रासायनिक 셂प से विविध मचानरों के लिए अलगाव और अर्स配ू रीिभाजन संशोधन। • जीवन शैली से संबंधित विक봾िरों जैसे मधमेह,ु कℂसर और दय संबंधी विक봾िरों के लिए फाइटोमोलेक्लय र की जैविक जांच। • कℂसर स्क्रीनंग के लिए- SERS-प्रतिदीप्ति आधारित डायग्नोस्क नैनो-कॉकटेल। • ल啍षत दवा वितरण प्रणाली (टीडीडीएस) और चिकित्सी नैन셋प्र셋ब विकास। 32 National Institute for Interdisciplinary Science & Technology 32 Annual Report 2018-19 The Chemical Sciences and Technology Division has been focusing on the development of molecules and functional materials and their application in various device platforms. The three priority areas of the Institute are led by the Division – (1) Organic and Hybrid Electronics (Energy generation and storage, chromogenic coatings, solid state lighting, computational chemistry); (2) Fluorescent Materials (Security applications, diagnostics and imaging probes and ultrafast kinetics); (3) Phytopharmaceuticals and Drug Intermediates (Bio-evaluation of medicinal plants and advanced pharmaceutical intermediates). The Division coordinates various thematic activities of CSIR at the institute level, namely Energy (conventional and non-conventional) Materials and Energy Devices, Healthcare and Chemicals. In addition, the division plays a major role in two CSIR Mission Mode projects – (1) Nanobiosensors and microfluidics for healthcare applications and (2) Nutraceuticals Mission. The Division also undertakes a large number of important projects funded by various government agencies and industries. There have been more than 100 publications from the division in 2018-19 in internationally reputed peer-reviewed journals with high impact factor. The highlights of the activities and achievements of the Division during the year 2018-19 along with brief abstracts of important developments are given below. HIGHLIGHTS DNA assisted re-assembly of self-exfoliated ionic covalent organic nano sheets for label-free detection of dsDNA. Cyclometalated IrIII complex as a lysosome-targeted photodynamic therapeutic agent for integrated imaging and therapy in cancer cells. Self-recovering mechanochromic chiral π-gelators. Charge carrier polarity modulation in diketopyrrolopyrrole-based low band gap semiconductors by terminal functionalization. Supramolecular gel phase controlled [4+2] Diels-Alder photocycloaddition for Electroplex mediated white electroluminescence. Solution processable, visible blind UV detector based on ZnO thin films. Novel lead-free hybrid perovskite materials for optoelectronic applications. Design and synthesis of Thiophene oligomers and study of their self-assembly properties. Photoinduced intramolecular charge and energy transfer processes governed by polarity of the solvent. Photoluminescence enhancement in hybrid perovskite nanocrystal assemblies. Electrode materials for supercapacitors using Carbon based hybrid nanocomposites. Nanostructured oxides over 3D substrates by heterogeneous hydrothermal/solvothermal synthesis. Coin-cell capacitors with high gravimetric energy and power densities using MoS2 and MnO2 nanomaterials. National Institute for Interdisciplinary Science & Technology 33 33 Annual Report 2018-19 Copper (Cu) based electrolytes for dye-sensitized solar cell (DSCs), capable of achieving higher voltages in low light intensities (CFL/LED). Indigenous dye solar module fabrication facility and prototype modules of size up to 30 cm × 30 cm. Development of a portable Raman spectrometer Light induced spin-state switching in an enzyme like iron (III) complex. Triphenylamine based organic materials for electrochromic device applications. Chiral self-assembly of fullerene clusters on CT-DNA templates. Pharmaceutically relevant molecules as anticancer, antidiabetic and antibiotic leads. Chemoprofiling and sustainable utilization of abundant natural resources: Isolation and semisynthetic modifications for chemically diverse scaffolds from medicinal plants. Biological screening of phytomolecules for life style related disorders such as diabetes, cancer and cardiovascular disorders. SERS-Fluorescence based Diagnostic Nano-cocktail for cancer screening. Targeted drug delivery system (TDDS) and theranostic nanoprobe development. 34 National Institute for Interdisciplinary Science & Technology 34 Annual Report 2018-19 ORGANIC AND HYBRID ELECTRONICS Photovoltaics & Lighting Indigenous Development of Semi-Automatic Equipment for Dye-Sensitized Solar Module Fabrication CSIR-NIIST succeeded in indigenizing dye-sensitized solar cell (DSSC) module fabrication equipment for the first time in the country through industry collaboration achieving a cost reduction of 60- 70% with respect to the imported ones. CSIR-NIIST, leveraging this expertise, can now transfer intellectual properties related to the fabrication processes to other Modules of various sizes fabricated using the system CSIR-Labs, R&D institutions and industries who are Resurgence of DSCs with Copper Electrolyte: interested in upcoming areas of solar photovoltaics. A Detailed Investigation of Interfacial Charge By contributing towards smart agriculture, energy, Dynamics with Cobalt and Iodine Based urban and water management in a more environment Electrolytes friendly way, we strongly believe our initiative will Deploying earth abundant copper as redox lead to the improvement in quality of life along with mediators in DSCs is found to be a very promising economic and industrial growth in line with the GOI strategy to achieve higher photovoltage and power missions such as ″Make in India″, ″Innovate in India″, conversion efficiencies in full sun (100 mW cm-2) and ″Clean & Renewable Energy″, ″Skill India″ and ″Smart in low/diffused light conditions. Achieving higher Cities & Villages″. photovoltage without compromising the photocurrent Status of the Development helped copper electrolyte to attract much attention a) Indigenously built an entire DSSC module among the alternate electrolytes currently employed fabrication line for the first time in the country. in DSC. With a very small reorganization energy b) Installed and commissioned at CSIR-NIIST in between Cu(I) and Cu(II) and small molecular November 2018. size helped copper in achieving unit regeneration c) More than 60-70 % cost reduction was successfully efficiency with a driving force as low as 100 mV and achieved through indigenization. a high diffusion coefficient (Dn) leading to a better d) Successfully demonstrated the production of 5 cm diffusion length (Ln) and charge collection efficiency × 5 cm, 10 cm × 10 cm, 15 cm × 15 cm and 30 cm × 30 (ηcc). The mass transport issues were also found to cm DSC modules. be better in comparison with the cobalt electrolytes. e) Project funded by DST-SERI initiative included in Being inert to silver (Ag) and other electrical contacts PMOs high priority implementation category. used in DSCs, with higher mobilities even in solid state make copper based electrolyte a promising candidate to spearhead the commercialization of dye solar technology. In this regard, a detailed evaluation of the internal electron transfer dynamics is highly essential to understand the limiting processes in these devices. We carried out a one-on-one comparison between copper, cobalt and iodine electrolyte using same dye Indigenous DSSC Module Fabrication Facility at CSIR-NIIST (LEG4), semiconductor (TiO2) and electrolyte with National Institute for Interdisciplinary Science & Technology 35 35 Annual Report 2018-19 DSC in recent times by virtue of its better backbone rigidity, efficient charge transport properties, and the opportunity for further structural modifications. We have reported the synthesis and characterization of three metal free D-π-A organic dyes employing indolo[3,2-b]indole as the donor unit. The optical, electrochemical and photovoltaic properties were analyzed in detail as a function of π-spacers employing benzene (IID-1), thiophene (IID-2) and furan (IID-3). Eventually, the best performance was demonstrated by the dye bearing benzene as π-spacer. The role of recombination in determining the photovoltaic performance as a function of the nature of π-spacer was explored in detail using various perturbation similar additive concentrations in a way to understand techniques carried out on the fabricated devices and its the in-depth charge transfer process leading to higher comparison with the results obtained from molecular photoconversion efficiencies and also to probe the orbital calculations (New J. Chem., 43, 862-873, 2019) various deleterious processes taking place in copper Aggregation Induced Light Harvesting of devices which gives an opportunity to further improve Molecularly Engineered D-A-π-A Carbazole its performance in future (Journal of Materials Chemistry Dyes for DSCs A,6, 22204-22214, 2018). Indolo[3,2-b]indole Donor-Based D-π-A Dyes for DSCs: Investigating the Role of π-Spacers Towards Recombination Fused conjugated metal-free organic dyes have become a prominent class of dyes to be used in A novel class of metal free organic dyes (CCTh and CCBz) with D-A-π-A configuration, having carbazole as the donor unit and 3-cyanopyridine as auxiliary acceptor replacing conventional benzannulated heterocycles along with variable π-linkers, were synthesized and used in DSC. Both the dyes are having cyanoacrylic acid as the anchoring group with thiophene (CCTh) and phenylene (CCBz) as π-linkers. The photophysical, electrochemical, theoretical and photovoltaic properties of both the dyes were investigated in detail. The absorption spectra of both the dyes on TiO2 showed 36 National Institute for Interdisciplinary Science & Technology 36 Annual Report 2018-19 broader absorption bands compared to the solution istry to achieve the otherwise difficult to obtain pho- spectra indicating aggregation in solid state. The toproducts but also underlines their potential in op- aggregation induced emission (AIE) studies indicates toelectronic device fabrication ( J.Am.Chem.Soc.141, J-aggregation for both the dyes. CCTh with thiophene 5635−5639, 2019). linker showed more broader absorption compared to Organic Field-Effect Transistors (OFETs) CCBz, and the photovoltaic performance recorded for CCTh directly indicates better light harvesting ability Charge Carrier Polarity Modulation in Diketopyrrolo- Pyrrole-Based Low Band Gap corresponding to the red shifted J-aggregated states. Semiconductors by Terminal Functionalization Hence, solar cells fabricated with CCTh gave a power Organic semiconductors with variable conversion efficiency of 3.39% and CCBz delivered an charge carrier polarity are required for efficiency of 2.03% under full sun condition. A detailed optoelectronic applications. Synthesis of three novel investigation of device dynamics has been carried diketopyrrolopyrrole (DPP)-based D−A molecules out by employing charge extraction (CE), intensity- having three different terminal groups (amide, modulated photovoltage spectroscopy (IMVS) and ester, and dicyano) and study of their electronic open-circuit voltage decay (OCVD) measurements properties have been done. An increase in electron (Solar Energy,174, 1085-1096, 2018). acceptor strength from amide to dicyano leads to a Organic Light Emitting Diodes bathochromic shift in absorption. Photoconductivity Supramolecular Gel Phase Controlled [4+2] and FET measurements confirmed that a small Diels–Alder Photocycloaddition for Electroplex increase in acceptor strength can result in a large Mediated White Electroluminescence change in the charge transport properties from p-type Diels−Alder photocycloaddition of 9-phenylethyny- to n-type. The molecule with an amide group, DPP− lanthracene results in multiple [4+2] and [4+4] cy- amide, exhibited a moderate p-type mobility (1.3 × cloaddition products in solution, which can be con- 10−2 cm2 V−1 s−1), whereas good n-type mobilities were trolled to form specific products under a restricted observed for molecules with an ester moiety, DPP− environment. We have exploited the gel phase of a 9-phenylethynylanthracence derivative as a confined medium to specifically yield the [4 + 2] cycloadduct in >90% yield. The photocycloadduct (anti-form) exhib- ited a blue emission with CIE chromaticity of x = 0.16/y = 0.16. Construction of an organic light emitting device with the photocycloadduct, using a carbazole-based hole transporting host, resulted in white light emis- −2 2 −1 −1 sion with a CIE chromaticity of x = 0.33, y = 0.32. This ester (1.5 × 10 cm V s ), and with a dicyano group, −2 cm2 V−1 s−1). The terminal functional observation not only highlights the use of gel chem- DPP−DCV (1 × 10 group modification approach presented here is a simple and efficient method to alter the charge carrier polarity of organic semiconductors (ACS Appl. Mater. Interfaces 11, 1088−1095, 2019). Stimuli Responsive Donor-Acceptor Poly (Dithienyl-Benzothiadiazole) for Efficient Charge Transport Applications Preparation of D-A copolymers with alternate donor and acceptor fragments as active layer receives special National Institute for Interdisciplinary Science & Technology 37 37 Annual Report 2018-19 temperature which relies on the texture and domains generated in the film. Light induced enhancement in charge transport owing to the formation of photo- induced charge carriers postures a facile strategy for the fabrication of high performing plastic electronic devices (Materials Chemistry and Physics, 222,52-65, 2018). interest since the intra-molecular charge transfer interaction between the donor and acceptor units can Macroscopically Oriented (3-Pentadecyl be readily tailored to modulate their electronic band- Phenol) Dangled Fluorene Based Conductive structures suitable for various device applications. Polymer Through Side Chain Engineering for Solution processed conjugated polymer OFETs Microelectronics gathered wide attention in flexible electronics recently Design and development of processable due to their low cost and ease of fabrication. Quality macroscopically ordered intrinsically conducting of polymer circuits is mainly judged by the mobility polymers (ICPs) are receiving overwhelming interest of charge carriers through the channel of constituent in the academia and industry owing to the emergence transistors. Albeit OFETs, fabricated with polymeric of versatile flexible microelectronic devices. These active layer, are more flexible and processable than their flexible, portable and implantable electronic devices inorganic counterparts, realize high carrier mobility, globally are inevitable constituents in every walks require specially designed substrates, and utilize of our life style. ICPs are endowed with unique opto- sophisticated working conditions. Furthermore, most electronic properties, excellent thermo-mechanical of the OFETs derived from ICPs have high threshold stability, low band gap, excellent charge carrier mobility, solution processability, flexible, and light voltages (Vth) to set the devices ON which apparently raises the power consumption and may ultimately lead weight. They are portable in nature compared to their to the device breakdown via internal heating. We have inorganic counterparts. Solution processability is one of reported a facile strategy for the macroscopic ordering the most attractive features of organic semiconductors, of a D-A semiconducting copolymer on the active layer enabling low-cost, low-temperature, and large-area of OFET by varying the combinations of solvents and the device fabrication. A solution processable conjugated concomitant improvement of its OFET performance. polymer generally contains two parts - π-conjugated Further, photo-responsive switching of the transfer polymer backbone and peripheral solubilizing side characteristics has been monitored which seems chains. The π-conjugated backbone determines the exquisitely useful for the future organic electronic optical, electrochemical and electronic behaviour of applications. The investigation of a donor-acceptor copolymer of 3-hexylthiophene and benzothiadiazole (PDHTBT) to generate macroscopically oriented nanofibers by self-assembly approach to be used as an active layer for OFET is reported. Aligned polymeric nanofibers with long range order has been confirmed by various microscopic techniques and XRD analyses. OFET containing aligned nanofibers (Si/SiO2/PDHTBT/ Ag) exhibits an impressive field effect mobility of 2.29 ± 0.85 cm2 V-1 s-1 with an ON/OFF ratio of ~105 and a low threshold voltage of -0.47±0.05 V at room 38 National Institute for Interdisciplinary Science & Technology 38 Annual Report 2018-19 that material. Enhancement in processability and formation of ordered films are projected through side chain engineering. Side chain can enhance the self-assembly process through electrostatic layer by layer assembling (ELBLS) and the back bone can contribute through π-π stacking and hydrogen bonding. In this work, we have designed a solution processable macroscopically oriented conductive polymer of fluorene dangled 3-pentadecylphenol (3-PDP) through side chain engineering and self- 5.36 Å, sandwiched by independent layers of organic assembly approach. Initially, fluorene was coupled cations. The density functional theory calculations with 3-PDP, and then, further subjected to oxidative showed that the oxygen in water molecules has a significant contribution to the band edges of the polymerisation in presence of anhydrous FeCl3. Polarity of the solvent and time on self-assembly process were material. The photodetector device fabricated using studied using various microscopic techniques which this material showed an efficient charge separation at suggested the formation of macroscopically oriented low voltage (1 V) due to the good electronic conduction 2 4 fibres having 20-30 nm diameter in chloroform with between the Bi I10 - dimer units (Chem. Mater.,31, electrical conductivity of (2.1×10-2 S cm-1). Optical 1941−1945, 2019). and electrochemical band gaps were calculated Low Temperature-processed Zinc Oxide (ZnO) from the studies made from UV-Vis spectroscopy Thin Films for P–N Junction-based Visible-Blind and cyclic voltammetry. Further, we studied its field Ultraviolet Photodetectors effect transfer characteristics by fabricating the OFET Ultraviolet (UV) photodetectors have drawn extensive attention due to their numerous applications in both device having configuration (Si/SiO2/PFLPDB/Ag) and measured its field effect mobility (1.076 cm2 V-1 s-1) at 1 civilian and military areas including flame detection, V and ON/OFF ratio of the device calculated as 1.82×103 UV sterilization, aerospace UV monitoring, missile suggests its application as an excellent active material early warning, and ultraviolet imaging. ZnO-based UV for organic microelectronics (Express Polymer Letters, detectors exhibit remarkable performance; however, accepted, 2019). many of them are not visible-blind, and the fabrication techniques involve a high-temperature annealing PHOTODETECTORS step. We fabricated a p–n junction photodiode based Zero-Dimensional Lead-free Hybrid Perovskite- on annealing-free ZnO thin films prepared from ZnO like Material with a Quantum-well Structure nanoparticles (NPs) and N,N′-di(1-naphthyl)-N,N′- Low-dimensional perovskites are an emerging diphenyl-(1,1′-biphenyl)-4,4′-diamine (NPB). NPB class of materials with high stability and excellent was chosen due to its transparent nature in the visible optoelectronic properties. Herein, we introduce a region and high hole mobility. The device exhibited novel, lead-free, zero-dimensional perovskite-like responsivity of 0.037 A W-1 and an external quantum 2 material, (1,3-propanediammonium) Bi2I10·2H2O, efficiency (EQE) of 12.86% at 5 V bias under 360 nm for optoelectronic applications. This material illumination. In addition, with no biasing, the device exhibited good moisture and thermal stability under exhibited an on–off ratio of more than 103 and a linear ambient conditions. Single-crystal X-ray diffraction dynamic range (LDR) of 63 dB. A high built-in potential analysis revealed a quantum-well structure having at the ZnO/NPB interface could be the reason for this 4 the inorganic Bi2I10 - clusters periodically arranged in performance at zero bias (RSC Adv.,8, 37365-37374, the crystallographic “c” axis separated by a distance of 2018). National Institute for Interdisciplinary Science & Technology 39 39 Annual Report 2018-19 ENERGY STORAGE Green Synthesized Gold (Au) Nanoparticles Dispersed Porous Carbon Composites for Electrochemical Energy Storage Gold nanoparticles were prepared successfully by Green synthesis method using the reducing agent extracted from Solanumnigrumleaf (SNL). Gold nanoparticles dispersed porous carbon (G5/c and G10/C) composites have been prepared via nanosheets (Journal of Materials Science: Materials in the pyrolysis of the colloidal gold. The presence of Electronics, 29 (19), 16598-16608, 2018). antioxidant compounds in SNL extract is responsible One-pot Synthesis of G-C3N4/MnO , G-C N4/ for reducing the gold nanoparticles. The synthesized 2 3 SnO2 Hybrid Nanocomposites for Supercapacitor nanocomposite contained small-sized spherical Applications nanoparticles and porous carbon. Electrochemical The rapid agglomeration of layered materials during energy storage performance of the porous carbon/ gold electrochemical process reduces their shelf life and nanoparticles composite is evaluated in symmetric specific capacitance, which can be prevented by the two electrode configuration. An aqueous symmetric introduction of suitable spacers between the layers. supercapacitor based on G10/C composite electrode Herein, we report the electrochemical performance exhibited a gravimetric specific capacitance of 80 F of MnO2 and SnO2 metal oxides spacers incorporated g-1 at 1 A g-1 and retains a cycling stability of 93% even layered graphitic carbon nitride g-C3N4 in symmetric after 5000 charge-discharge cycles (Materials Science two electrode configuration. for Energy Technologies, 2, 389-395, 2019). The as-prepared g-C3N4/MnO2 and g-C3N4/SnO2 hybrid Titania Nanotubes Dispersed Graphitic Carbon nanocomposites act as efficient electrode materials for Nitride Nanosheets as Efficient Electrode symmetric supercapacitors. The performance of the Materials for Supercapacitors electrode materials is compared with that of the bare The synthesis of a hybrid nanocomposite containing g-C3N4. A remarkable increase in specific capacitance one dimensional (1D) TiO2 nanotubes supported was obtained for the g-C3N4/MnO2 composite electrode -1 over a two dimensional (2D) network of conducting (174 F g ) when compared to the bare g-C3N4 electrode -1 graphitic carbon nitride (g-C3N4) nanosheets by a facile (50 F g-1) and g-C3N4/SnO2 electrode (64 F g ). At a hydrothermal strategy was carried out. Symmetric constant power density of 1 kW kg-1, the symmetric supercapacitors based on the hybrid composite supercapacitors based on g-C3N4, g-C3N4/SnO2, and electrodes were fabricated and their electrochemical g-C3N4/MnO2 electrodes exhibited energy densities energy storage performances were evaluated and the of 6.9, 8.8 and 24.1 Wh kg-1 respectively (Sustainable results were compared with individual component Energy and Fuels, 2, 2244-2251, 2018). based supercapacitors. The symmetric supercapacitor based on the composite with 1:4 weight ratio of TiO2 and g-C3N4 exhibited a remarkable increase in the specific capacitance in comparison with the individual components. The improvement in electrochemical behavior of the composite sample was attributed to the increase in surface area of the composite due to the spacer effect of titania nanotubes in the 2D g-C3N4 40 National Institute for Interdisciplinary Science & Technology 40 Annual Report 2018-19 Organic-inorganic Hybrid Composite Material As NIR blocking is achieved at -2.8 V (Patent application a High Performance Supercapacitor Electrode under process). The preparation of few-layered MoS2 nanosheets via Preferential Face-on and Edge-on Orientation exfoliation from bulk for electrochemical application of Thiophene Oligomers by Rational Molecular was carried out. A nanocomposite containing MoS2 Design and reduced graphene oxide (rGO) has been prepared Precise control over the supramolecular organization by simple physical mixing. The electrochemical of organic semiconducting materials guiding properties of the MoS2 nanosheets and MoS2-rGO to exclusive face-on or edge-on orientation is a nanocomposite have been analyzed in 3-electrode challenging task. In the present work, we study configuration. At a scan rate of 10 mV s-1, the MoS 2 the preferential packing of thiophene oligomers nanosheets and the MoS GO nanocomposite exhibit 2-r induced through rational molecular designing and self-assembly. The acceptor-donor-acceptor type oligomers having 2-(1,1-dicyano-methylene) rhodanine as acceptor favored a face-on packing, while that of functionalized with N-octylrhodanine preferred an edge-on packing as evident from 2D-grazing incidence angle X-ray diffraction, tapping-mode atomic force microscopy (AFM) and Raman spectroscopy analyses. As an outcome of the preferred orientation, the oligomers exhibited specific capacitance values of 375 F g-1, and 739 F g -1 anisotropic conductivity in the self-assembled state, respectively. MoS -rGO nanocomposite electrode 2 revealed by the conducting AFM experiment (Chem. retains a stability of 96% even after 5000 cycles of Asian J., 14, 963 – 967, 2019). continuous charge-discharge at a current density of 6 A g-1 (Vacuum, 3 (11), 3234-3240, 2018). Multifunctional Chromogenic Devices We developed multifunctional EC glasses where smart function of optical modulation can be combined with energy storage. Recently, we developed technology for voltage dependent spectrally selective modulation with integrated energy storage smart glasses. This technology would enable “smarter” control over the optical/energy throughput. Significant NIR blocking without compromising visible transmission could be achieved with a voltage up ±2.3 V. Complete Vis- National Institute for Interdisciplinary Science & Technology 41 41 Annual Report 2018-19 Photoinduced Photoluminescence Enhancement in Self-Assembled Clusters of Formamidinium Leadbromide Perovskite Nanocrystals Nanocrystals of formamidinium lead bromide perovskite (FAPbBr3), self-assembled into clusters in powder and film samples, provide a prolonged photoluminescence lifetime which is attributed to the diffusion of charge carriers through interparticle states formed among nanocrystals. Interestingly, the photoluminescence lifetime decreases and the emission intensity increases for the clusters with the synthesized nanocomposites exhibited excellent increase in the intensity of excitation light. By doping antibacterial activity against gram-negative bacterial the nanocrystal clusters with C60, we successfully strains. Electrochemical performance of the harvested the photogenerated charge carriers. composites is evaluated in symmetric two-electrode configuration. At a power density of 1 kW kg-1, the symmetric supercapacitor based on Au nanoparticles dispersed carbon electrodes exhibits an energy density of 7.1 Wh kg-1 (Applied Surface Science, 479, 96-104, 2019) ELECTROCHEMICAL SENSORS Carbon Quantum Dots Modified Carbon Paste Electrode based Sensor for Selective and Sensitive Determination of Adrenaline A Carbon quantum dots based carbon paste electrode (CQDs/CPE) was fabricated and used for Nonetheless, at high intensities of excitation, the rate the determination of Adrenaline (AD) at nanomolar of radiative recombination becomes comparable to level. This fabricated electrode exhibited very high that of the electron transfer to C60. Thus, the optimum electrocatalytic activity to the oxidation of Adrenaline rate of electron transfer to C60 is accomplished by in supporting electrolyte (PBS pH 7.4). The scan minimally exciting the self-assembled nanocrystals rate variation studies with the modified electrode (Nanoscale, 11, 9335-9340 2019). revealed that the overall electrode process was Antibacterial and Electrochemical Activities controlled by diffusion process. A lower detection of Silver, Gold, and Palladium Nanoparticles Dispersed Amorphous Carbon Composites Gold, silver, and palladium (Pd) nanoparticles dispersed amorphous carbon composites have been prepared successfully via Green synthesis method using the reducing agent extracted from Cissusquadrangularis stem (CQS). The presence of antioxidant compounds in CQS extract is responsible for reducing and capping metal nanoparticles. The 42 National Institute for Interdisciplinary Science & Technology 42 Annual Report 2018-19 via chronoamperometry. Interference by biological overlapped cyclic voltammetric peaks of these ternary molecules such asserotonin (5-HT) and ascorbic acid mixtures. The electrode was further applied to the (AA) to the electrochemical oxidation of AD on the determination adrenaline in pharmaceutical samples fabricated electrode were tested. It was observed with percentage recoveries of 99.2%–100.8% (ACS that with the modified electrode the selective Applied Materials and Interfaces, 10 (50), 43343–43351, determination of AD was possible. Further, with the 2018). fabricated electrode, simultaneous analysis of AA, FLUORESCENT SENSORS AD and 6-HT was performed and observed that the overlapped peaks of these analytes on naked electrode Supramolecular Reassembly of Self-Exfoliated were well resolved into 3 peaks with the modified Ionic Covalent Organic Nanosheets for Label- Free Detection of Double-Stranded DNA electrode. Along with a decent sensitivity and Ionic covalent organic nanosheets (iCONs), a selectivity, the electrode also showed a higher stability member of the two-dimensional (2D) nanomaterials and antifouling nature. The real time application of family, offer a unique functional platform for a wide the projected scheme was proved by employing the range of applications. We explored the potential of said electrode for adrenaline in adrenaline bitartrate an ethidium bromide (EB)-based covalent organic injections (ACS Omega, 4 (4), 7903-7910, 2019). framework (EB-TFP) that self-exfoliates in water Electrochemical Determination of Adrenaline resulting in 2D ionic covalent organic nanosheets Using Mxene/Graphite Composite Paste (EB-TFP-iCONs) for the selective detection of double- Electrodes stranded DNA (dsDNA). In an aqueous medium, An efficient electrochemical sensor for the detection the self-exfoliated EB-TFP-iCONs reassemble in of adrenaline was fabricated using MXene/ the presence of dsDNA resulting in hybrid EB-TFP- Graphite composite paste electrode (MXene/GCPE). iCONs-DNA crystalline nanosheets with enhanced The fabricated electrode exhibited a sensitive fluorescence at 600 nm. Steady-state and time- electrochemical response to adrenaline in phosphate resolved emission studies revealed that the buffer solution of pH 7.4, and its catalytic activity is reassembly phenomenon was highly selective for much higher than that of the bare graphite paste dsDNA when compared to single-stranded DNA electrode. The electron transfer reaction of MXene/ (ssDNA), which allowed to use the EB-TFP-iCONs as a GCPE is a diffusion controlled process. The graph of 2D fluorescent platform for the label-free detection of concentration of adrenaline with the peak current complementary DNA strands (Angew. Chem., Int. Ed.,57, exhibited two linearity, one in the lower and other 8443–8447, 2018 (VIP Article). in the higher concentration range with a detection limit of 9.5 nM. The simultaneous analysis of adrenaline, ascorbic acid and serotonin revealed that the fabricated electrode could separate the National Institute for Interdisciplinary Science & Technology 43 43 Annual Report 2018-19 A Cyclometalated IrIII Complex As a Lysosome- targeted Photodynamic Therapeutic Agent for Integrated Imaging and Therapy in Cancer Cells Organelle-targeted photosensitizers having luminescence properties are potential theranostic agents for simultaneous luminecence imaging and photodynamic therapy (PDT). In this work, we report a water-soluble luminescent cyclometalated IrIII complex, Ir-Bp-Ly, as a lysosome-targeted theranostic oligo(p-phenylenevinylene) derived π-gelator (OPVC). probe. Ir-Bp-Ly exhibits exceptional photophysical OPVC exhibits a reversible mechanochromism; while, properties, with good triplet-state quantum yield the analogous achiral derivative (OPVA) having a (0.90), singlet oxygen generation quantum yield (0.71 linear side chain does not, as established from the at pH 4), and long lifetime (1.47 ms). Interestingly, Ir- fluorescence and circular dichroism studies. The helically twisted chromophore packing in OPVC allows mechanical reorganization of the self-assembly and the associated fluorescence intensity variation at different wavelength positions, in the broad emission spectrum, resulting in a perturbation in the color ratio leading to the observed mechanochromic emission color change. This exciting new finding may have wide ranging implications in the design of stimuli responsive molecular materials with reversible optical properties (J. Mater. Chem. C, 7, 1292–1297, 2019). Direct Evidence of Solvent Polarity Governing Bp-Ly localizes mostlyin lysosomes due to the presence the Intramolecular Charge and Energy Transfer: of morpholine units, suggesting its potential use as a Ultrafast Relaxation Dynamics of Push-pull lyso-tracker. Ir-Bp-Ly displays a notable PDT effect in Fluorene Derivative C6glioma cells, efficiently generating reactive oxygen Photoinduced charge and energy transfer are species owing to close proximity between the energy significant photophysical processes controlling levels of its triplet state and those of molecular oxygen the efficiency of the photosynthesis and molecular (3O2). The mechanism of cell death has been studied electronics. Here, the influence of solvent polarity through caspase-3/7 and flow cytometry analyses and excitation wavelength on the dynamics of excited which clearly established the apoptotic pathway state relaxation pathways of push–pull chromophore (Chem. −Eur. J. 24, 10999–11007, 2018, Hot Article, (PXFCN), where phenoxazine and cyanofluoreneacted highlighted with a Frontispiece). A Self-recovering Mechanochromic Chiral π-Gelator Mechanochromism is a stress-induced perturbation of electronic property in molecular materials. In this work, we demonstrated that the presence of a branched chiral chain facilitates mechanochromic response in a molecular assembly as illustrated with a chiral 44 National Institute for Interdisciplinary Science & Technology 44 Annual Report 2018-19 as donor and acceptor respectively, are investigated in detail by using steady state spectroscopy, nanosecond and femtosecond transient absorption spectroscopy and picosecond emission spectroscopy. In acetonitrile (ACN), the steady state emission spectra of PXFCN exhibited three maxima at around 330, 405 and 620 nm covering the complete continuum range (CIE coordinates of 0.32, 0.40) with absolute quantum yield of ≈ 0.12. The aggregation induced emission with an increase quantum yield of ≈ 0.32 was observed to achieve selectivity, efficiency, and catalysis in a in tetrahydrofuran and water mixture due to the number of metalloenzymes. An iron(III) porphyrin formation of ano-aggregates. Interestingly, the steady with a photochromic axial ligand which upon state and time resolved emission spectra of PXFCN irradiation with two different wavelengths reversibly in ACN obtained by exciting at different wavelengths switches its spin state between low-spin (S = 1/2) and exhibited the occurrence of both the intramolecular high-spin (S = 5/2). The switching efficiency is 76% at charge and energy transfer processes, whereas in room temperature. The system is neither oxygen nor cyclohexane (CHX) the emission originated mainly water sensitive, and no fatigue was observed after from the local excited state revealing an efficient more than 1000 switching cycles. This system serves intramolecular energy transfer. The femtosecond as a simple model for the first step of the cytochrome transient absorption spectra in the polar solvent, ACN P450 catalytic cycle (Nature Commun. 9, Article Number shows that the excited state relaxation pathway is 4750, 2018). controlled by solvent stabilized twisted intramolecular Low Cost Portable Raman Spectrometer charge transfer dynamics limiting the formation of Raman spectroscopy is a versatile spectroscopic triplet state. However, in the case of CHX, the charge technique that probes the characteristic vibrational transfer state formed upon photoexcitation decayed and rotational transitions of the materials; and to the triplet state by geminate charge recombination. thus, provide their fingerprint information. As a The nanosecond transient absorption spectra manifest result, recently Raman spectroscopy has emerged the dominant feature of triplet state and the charge as a valuable tool for material identification and is transfer state in CHX and ACN respectively and their impacting many field of basic science and technology. complete dynamics were obtained. Thus, based on Some of the examples include their utilization for bio- the transient absorption and emission spectra, it is inferred that the intramolecular charge transfer occurring along with the energy transfer is controlled by the polarity of the solvent through conformational changes leading to favourable position yielding the charge and energy transfer between the donor and acceptor moieties (Phys. chem.chem.Phys.,21, 11087- 11102, 2019). Light Controlled Switching of Spin State of Iron(III) Controlled switching of the spin state of transition metal ions, particularly of FeII and FeIII, is a prerequisite National Institute for Interdisciplinary Science & Technology 45 45 Annual Report 2018-19 medical fields, ingredient identification in chemical a) b) e) and pharmaceutical industry, quality and monitoring control, detection of food adulterant, counterfeits, Nanoclusters drugs / narcotics, explosives, and forensicetc. Though CT-DNA the basic concept of the technique was invented in this c) d) country by Sir C. V. Raman in 1928 and got Nobel prize, it is still hard to find any Indian manufacturers and we rely on foreign companies for this technology. To unravel Nanonetwork the usefulness of this technology to the problems faced in our society, it is necessary to master this technology. into micrometer sized aggregates and subsequent Presently, the institute is having two major programs precipitation. On the other hand, the aniline derivative focusing on the applications of Raman Spectroscopy: F-An, which is reported to form nanoclusters of 3-5 (i) a CSIR mission mode project on “Nano-biosensors nm size, interact with DNA through ordered, chiral and Microfluidics for health care” and (ii) an industry assemblies on CT-DNA template perturbing the highly collaborated Ph.D. program, (KSCSTE-VINVISH-CSIR- networked structure of CT-DNA to form nanonetworks, NIIST PAIR (Partnering Academic Industrial Research)) which eventually transform to condensed aggregates. initiated by the Government of Kerala (KSCSTE). In first The binding interactions between CT-DNA and program, it is targeted to develop methodologies for F-An nanoclusters were established via UV-Vis, cancer diagnosis using Raman spectroscopy; whereas AFM and TEM analyses and the chiral nature of the in latter, the industry’s interest is to establish proof of fullerene nanocluster assemblies on CT-DNA was concept device for fake pill identification. The basic confirmed through the induced circular dichroism hardware part in both the cases is a portable Raman exhibited around 250-370 nm region, corresponding spectrometer; and to start with, the institute has to the F-An nanocluster absorption. In contrast, the initiated acquiring the skill and knowledge required for phenothiazine derivative, F-PTz, which forms larger fabricating it. Initially, we tested the feasibility of the nanoclusters of ~70 nm in 10% DMSO-PBS showed drawn optical layout on an optical bench configuration only weak interactions with CT-DNA without affecting using low cost components which later transferred its network structure. These results demonstrate the into the first prototype of portable device. Later, with role of the hydrophobic-hydrophilic balance in the the support from industry, the design was successfully design of DNA interacting fullerene derivatives in translated into a robust miniature device. controlling their cluster size and interactions with PHOTOBIOLOGY CT-DNA and have significance in applications such as DNA condensation, gene delivery and dimension Chiral Self-assembly of Fullerene Clusters on CT- controlled nanomaterial fabrication (Faraday Discuss., DNA Templates 207, 459-469, 2018). The differential interactions of three mono- substituted fullerene derivatives having pyridinium, COMPUTATIONAL CHEMISTRY RESEARCH aniline or phenothiazine end groups (F-Py, F-An Computational Chemistry is a branch of theoretical and F-PTz, respectively) with calf thymus DNA (CT- chemistry in which computer assisted simulations of DNA) are explored via spectroscopic and imaging molecules and molecular behaviour are done using techniques. The pyridinium derivative, F-Py gets mathematical calculations based on fundamental molecularly dissolved in 10% DMSO-PBS and interact laws. In Computational Chemistry various models, with CT-DNA via groove binding and electrostatic functions and approximations are used for interactions leading to initial condensation of CT-DNA understanding the concepts of molecular binding, 46 National Institute for Interdisciplinary Science & Technology 46 Annual Report 2018-19 solving chemical problems such as predicting the Hidden Dicarbene Nature of Acetylene reaction feasibility and reaction mechanism pathways. DFT derived molecular electrostatic potential (MESP), CSIR-NIIST activities in this area apply the state-of- 13C), bond order and coordination reactions show the-art computational quantum chemistry methods δ NMR chemical shift ( that alkynes (RCCR) attain to study structure and reactivity of molecular systems 1,2-dicarbene nature during CCR angle bending. and made significant original contributions to the Alkyne carbon atoms of bent structures exhibit MESP electronic structure theory related to structure, around 200 ppm typicalδfeatures unique to lone-pair bonding and reactivity of organic, organometallic and bearing atoms, for carbene centers and large reduction inorganic systems. in CC triple bond character. Lone pair bearing atoms Prediction of Reduction Potential of R substituents enhance the carbene character. The The influence of mono- and multiple substituent bent alkynes can be trapped with Lewis acids (BH3, BF3, AlF3 and AlCl3) as the lone pairs developed on carbon effect on the reduction potential (E0) of 1,3,6-triphenyl fulvenes is investigated using B3LYP-SMD/6-3111G(d,p) level density functional theory. The molecular electrostatic potential (MESP) minimum at the fulvene π-system (Vmin) and the change in MESP at any of the fulvene carbon atoms (DVC) for both neutral and reduced forms are used as excellent measures of substituent effect from the para and meta positions of the 1,3 and 6-phenyl moieties. Substitution at 6-phenyl para position has led to significant change in E0 than any other positions. By applying the additivity rule of centers provide strong donor type dative bonding. The dative bond gives a formal valence electron count six on carbon and suggests the formation of acceptor type dative bonding to carbon from Lewis base Lewis base) systems (←) (NH3). Reaction of alkynes with (Lewis acid Lewis base)2 complexes which are (←)Alkyne(←yield (Lewis acid)2 exothermic and exergonic for many cases. These complexes are examples of capto-dative substituent effects, an equation in DVC is derived to carbon(II) compounds (ChemPhysChem 19:23 3266- predict E for multiply substituted fulvenes. Further, E 0 0 3272, 2018). is predicted for a set of 2000 hexa-substituted fulvene derivatives where the substituents and their positions DIAGNOSTICS in the system are chosen in a random way. The Calix[4]arene Based Redox Sensitive Molecular calculated E0 agreed very well with the experimental Probe for SERS Guided Recognition of Labile Iron E0 reported by Godman et al. Predicting E0 solely by Pool in Tumor Cells substituent effect offers a simple and powerful way to Targeting the intracellular ‘labile’ iron pool has select suitable combinations of substituents on fulvene emerged as a key modulator for cancer progression system for light harvesting applications (Journal of since the former is responsible for several pathological Computational Chemistry 39.15, 881-888, 2018). processes in tumor cells. Herein, we have initiated National Institute for Interdisciplinary Science & Technology 47 47 Annual Report 2018-19 of disease biomarkers present in lung cancer. The multiplex nanoprobes were prepared by attaching dual-functional Raman-active fluorogens onto spherical gold nanoparticles through a peptide linker, Phe-Lys-Cys (FKC), which is engineered with a cathepsin B (cathB) enzyme cleavage site. The enzyme- triggered switchable nanoprobes were utilized for the a non-fluorescent calix[4]arene based triazole simultaneous detection of pathologically relevant appended molecular probe (PTBC) for redox-specific lung cancer targets by tethering with specific antibody detection of Fe3+ under physiological condition by UV- units. The multiplex-targeted multicolor coded vis, FT-IR, 1H NMR, HR-MS spectroscopies, ITC and the detection capability of the antitags was successfully binding strategy between Calix[4]arene and Fe3+ was developed as a valid protein screening methodology, modelled by DFT calculations. As a new insight, PTBC which can address the unmet challenges in the probe showed significant Raman fingerprint through conventional clinical scenario for the precise and early surface enhanced Raman scattering (SERS) modality diagnosis of lung cancer. (ACS Appl. Mater. Interfaces 10, revealing the ultrasensitive detection of Fe3+ with a 38807−38818, 2018). LOD of 2 nM. Interestingly, intracellular “iron pool” CATALYSIS has been recognized in human lung adenocarcinoma Accessing Highly Functionalized cells (A549) by the PTBC illustrating the distinct Cyclopentanoids via A Cascade Palladation Raman mapping. Finally, PTBC imparted cytotoxicity Approach: Unprecedented Benzylic C–H via Reactive Oxygen Species (ROS) generation in Activation Towards Cyclopentenoindanes cellular milieu signifies its capability as a theranostic For an organic chemist, the one-step synthesis of molecular probe. (Anal. Chem., 90, 7148–7153, 2018). molecules with multiple stereocentres at adjacent Enzyme-driven Switchable Fluorescence-SERS positions is a laborious task. This objective was Diagnostic Nanococktail for Multiplex Detection realized in part by the use of both organo- and metal- of Lung Cancer Biomarkers catalysed cascade reactions. Here in, we describe Comprehensive profiling of multiple protein targets our efforts on the development of a Pd-catalysed plays a critical role in deeper understanding of specific tandem reaction for the synthesis of trisubstituted disease conditions associated with high heterogeneity cyclopentanoids from simple and easily available and complexity. In view of this fact, we have developed starting materials. A Pd-catalyzed synthesis of smart programmable nano architectures, which could 3,4,5-trisubstituted cyclopentenes from diazabicyclic integrate clinically relevant diagnostic modalities for olefins and o-iodobenzoates has been developed. the multiplexed detection of most prevalent panel NHCO2R H N CO2R CO2R asca e reac on I I C d ti H C NH R H 3 CO2R CO2R CO2 NCO R CO R 2 N 2 u H N RO2C N Pd-catalyzed Pd-catalyzed R RO2CN O2C CO2R u NHCO2R 'N ' Benzylic C-H activation NHCO2R N CO2R RO2C 48 National Institute for Interdisciplinary Science & Technology 48 Annual Report 2018-19 The hitherto unknown cascade process involves three stages: carbopalladation, oxypalladation and a Tsuji–Trost reaction. We have also developed a facile route involving a novel benzylic C–H activation towards cyclopentenoindane moieties (Chemical Communications 54(24) 2982-2985, 2018). PHYTOCHEMISTRY Antidiabetic Potential of Phytochemicals Isolated from Stem Bark of Myristica Fatua Houtt. disease (CHD), nonalcoholic fatty liver, type 2 diabetes Var. Magnifica (Bedd.) Sinclair etc. Pancreatic lipase plays a vital role in food fat digestion and absorption. Therefore, in order to control obesity, inhibition of pancreatic lipase enzyme is the active therapy. In recent times, natural/herbal products also considered as alternative medicine for the treatment of obesity and related disorders. Many plant-based extracts reported for the treatment of Phytochemical investigation of the stem bark of obesity and associated diseases. Myristica fatua Houtt. led to the isolation of a new Based on the traditional applications and its large compound 1 (3-tridecanoylbenzoic acid), along with medicinal properties in a long history of Ayurvedic six known acylphenols (2–7). All the compounds medicine, we have selected Curcuma amadaRoxb. displayed moderate inhibitory activity on α-amylase for the exploration of its inhibition properties against and significant activity on α-glucosidase; however, the pancreatic lipase. The rhizomes of C. amada are malabaricone B (6) and C (7) were identified a rich source of essential oils; and more than 130 as potent α-glucosidase inhibitors with IC50 phytochemicals are isolated which possess various values of 63.70 ± 0.546, and 43.61 ± 0.620 µM biological properties. Herein, we have isolated the respectively. Acylphenols (compounds 3–7) also major compound (E)-Labda-8(17),12-diene-15,16- showed significant antiglycation property. The dial. This was synthetically trans-formed to rationally molecular docking and dynamics simulation studies designed triazole appended analogues and evaluated confirmed the efficient binding of malabaricone C for their pancreatic lipase inhibitory potential. Among with C-terminus of human maltase-glucoamylase the semi-synthetic derivatives, two are identified as (2QMJ). Malabaricone B also enhanced the 2-NBDG most active candidates of the series with excellent [2-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-2- PL inhibitory activity slightly higher than that of the deoxy glucose] uptake in L6 myotubes. These findings positive control Orlistat. This is the first report on demonstrate that acylphenols isolated from Myristica the PL inhibitory activity of labdane dial and its semi fatua Houtt. can be considered as a lead scaffold for the synthetic triazole appendages (ACS Med. Chem. Lett., 9 treatment of type II diabetes mellitus (Bioorganic and (7), 662–666, 2018). Medicinal Chemistry 26 (12); 3461-3467, 2018). Discovery of Natural Product Derived Functionalized Pyrimidines from Alkynes and Pancreaticlipase Inhibitors: Ligand based Nitriles: Application towards Synthesis of Marine Molecular Hybridization Approach Natural Product Meridianin Analogs Obesity contributes to the genesis of many metabolic Fully substituted pyrimidine synthesis accomplished disorders including dyslipidemia, coronary heart from alkynes and nitriles via BF3.Et2O mediated [2+2+2] National Institute for Interdisciplinary Science & Technology 49 49 Annual Report 2018-19 cycloaddition. The substrate scope of the reaction was convenient process. The pyrimidine analogues were broad to include terminal alkynes to internal alkynes also screened for their broad spectrum of antibacterial and aromatic nitriles to aliphatic nitriles. The highlights property against ten bacteria. Among the derivatives, of our protocol are solvent free-reaction conditions, three compounds have displayed diverse activity on 100% atom economy and good to acceptable chemical various gram positive and gram-negative bacteria. yields. The marine alkaloid, meridianin mimics were In particular, 2,4-dimethyl-6-p-tolylpyrimidine has synthesized successfully by utilizing this protocol. In shown excellent inhibition potential against most of general, the developed protocol significantly broadens the tested organisms with a range of 9 to 21 mm zone the scope of diversity of pyrimidines in a simple and of inhibition (ChemistrySelect, 3, 6394 – 6398, 2018). 50 National Institute for Interdisciplinary Science & Technology 50 Environmental Technology Division Expertise Environmental Impact Assessment, Water & Wastewater treatment technologies, Solid & Hazardous Waste management, Environmental Biotechnology, Environmental Analytical Chemistry, Persistent Organic Pollutant Monitoring & Mitigation, Dioxin Research, Pollution abatement, Process development & Optimization, Geographic information system applications, Computer-Aided Casting Design by simulation and optimization, Application of Soft Computing Methodologies, Modeling & Simulation. NABET & MoEF&CC accredited consultant Organisation , NABL Accredited Laboratory MoEF recognized centre for dioxin analysis Scientist : 8 Technical staff : 3 Students : 16 Facilities Dioxin Research, ICP-MS (Inductively coupled plasma mass spectrometry), Wastewater testing and analysis, Ongoing projects(Grant-in-aid, : 16 Sponsored, Consultancy and Technical Services, In-house) Publications (SCI+non SCI) : 4 Ph. D. awarded : 2 51 Annual Report 2018-19 पर्यवरण ꥍ셌饍योगकी पभाग पर्यावण प्र셌饍योगकी प्रभाग 啍षे के प्राकृ तिक संसाधनरों के प्रदषणू नियंतण और मलू ् संवर्न के लिए स्देशी प्र셌饍योगिकियं बनाने मᴂ स啍क्र् 셂प से लगा हुआ है। पर्यावण प्र셌饍योगकी प्रभाग की संपर्ू गतिवि啍ध्रों को इन दो विष्रों के अतं र्त रखा जा सकता है। इसके अलावा, प्रभागीय गतिविधियाँ अपशिष्ट प्रबंधन, डाइऑक्सन अनसु ंधान और पर्यावण प्रभाव आकलन (ईआईए) के 啍ष配रोंमᴂ परिवर्तत होती हℂ। अपशिष्ट प्रबंधन के समाधान, अपशिष्ट उपचार, मि絍ट के शोधन आदि मᴂ विकसित विशेषजता से, विभाजन ने अत्봾धनिु क तकनीकी समाधान और शमन उप봾्रों की स्थित मᴂ एक जगह बनाई है। सीएसआईआर-एनआईआईएसटी एक एनएबीईटी मान्ता प्राप्तहै, के रल मᴂ एक परामर्दाता संगठन है, जो दो 啍ष配रोंमᴂ खनन और बंदरगाहरों और हार्ब मᴂ मान्ता प्राप्तहै। भारत की सरकारी और निजी 啍षे 饍वार ईआईए सेवाओ ं का उपयोग परियोजनाओ ं की वैधानिक मजं रू ी के लिए किया जाता है। सीएसटीडीएच (कॉमन रिसर् एडं टेक्नलॉजी डेवलपमᴂट हब) DSIR, सरकार 饍वार वित्त पोषित एक परियोजना है। । सीआरटीडीएच अनसु ंधान एवं विकास और परामर् सेवाओ ंके लिए MSMEs के लिए पर्यावणीय हस्啍षप को सकम करने के लिए सवु िधाए ं प्रदान करता है। एमएसएमई से जड़ु पर्यावणीय म饍ु दों को विकास, हस्啍षप और तकनीकी समाधान के लिए लिया जाता है। विनियमरों के साथ-साथ संसाधन की खपत को कम करने और संचालन की दकता मᴂ सधु ार करने के लिए तकनीकी सहायता प्रदान की जाती है। सीआरटीडीएच परियोजना के तहत अत्봾धनिु क डाइऑक्सन वि�लषण सवु िधा की स्थपना की गई है। पर्यावण प्र셌饍योगकी प्रभाग के परीकण और वि�लषण प्रयोगशाला को आईएसओ/आईईसी 17025: 2005 के अनसु ार जल, अपशिष्ट जल, डाइअ आॉक्सन, फु रान और पॉली क्लोीनयकु बिपिनिल् (पीसीबी) के वि�लषण के लिए एनएबीएल 饍वार मान्ता प्राप्तहै। इसके अलावा, पर्यावण, वन और जलवाय ु परिवर्न म配ं रलय (एमओईएफ़सीसी), सरकार 饍वार सीएसआईआर-एनआईआईएसटी की सिफारिश की गई है। भारत की पर्यावणीय मजं रू ी के लिए डाइऑक्सन वि�लषण के लिए एक रेफरल प्रयोगशाला के 셂प मᴂ। प्रभाग के अधिकांश आरएडडीं परिणाम सफल, नवीन और लागत प्रभावी प्र셌饍योगिकियों के 셂प मᴂ हℂ, जो "विनाश के बिना विकास" का एक पारिस्थितकी तंत बनाने के लिए प्रयासरत हℂ। हाइलाइट्स 500 किलो嵍रम/दिन कमता एनआईआईएसटी कॉम्पक् फू ड वेस् बायोगैस प्लाट त्रᴂद्रम इटं रनेशनल एयरपोर् पर स्थापत। एनआईआईएसटी कℂटीन से 2000 लीटर 嵍रेेटर के उपचार के लिए एक पायलट प्लाट स्थापत किया गया था। पायलट संयंत इकाई (670 किलो嵍रम/बैच) के लिए पर्क्ेटेट दषिू त मि絍ट हटाने का प्रदर्न किया गया था। मिश섿त मिश섿त नगरपालिका ठोस अपशिष्ट के उपचार के लिए बायोडायरीकरण प्र啍क्र्봾 को अनकु ू लित किया गया। गजु रात मᴂ झĂगा फ़ड कारखाने के लिए गंध नियंतण प्रणाली का डिजाइन एनएबीएल मान्ता प्राप्त प्रयोगशाला जल, अपशिष्ट जल, डाइऑक्सन, फु रान और पॉली क्लोीनयकु बाइफिनाइल (पीसीबी) के वि�लषण के लिए स्थापत की गई है। के रल मᴂ नगरपालिका ठोस कचरे के खलेु जल से डाइऑक्सन के उत्सरन कारकरों का निर्धाण किया गया। 22 फरवरी - 25 फरवरी 2019 के दौरान अपशिष्ट उपचार संयंत, बह्मपरु म, कोच्च के ठोस अपशिष्टंप ड यार् मᴂ आग लगने के दौरान परिवेशी वाय ु नमनू ा और अवशिष्टरा ख का नमनू ा लिया गया। ““ उन्त ”भारत पर 2019 मᴂ एक व्봾पक तीन कार्शालाओ ंका आयोजन किया गया। नमनू ाकरण, नमनू ा तैयार करने और डाइऑक्सन और पीसीबी के परिमाणीकरण मᴂ प्रशिकण आयोजित किया गया था। भारतीय दर्ु भ पथृ ्व, कोल्म, के रल 饍वार ब्लकरों II और IIEE मᴂ समद्रु तट रेत खनिजरों के खनन के लिए पर्यावण प्रभाव आकलन (EIA) अध्यन किया गया। के रल खनिज और धात ु लिमिटेड (KMML), चवारा, के रल 饍वार ब्लक IV और IVEE मᴂ खनन समद्रु तट खनिजरों के लिए EIA अध्यन। 52 National Institute for Interdisciplinary Science & Technology 52 Annual Report 2018-19 The Environmental Technology Division is actively engaged in creating indigenous technologies for pollution control and value addition to the region’s natural resources. The entire activities of Environmental Technology Division (ETD) can be put under these two topics. Further, the divisional activities converge into the areas of waste management, dioxin research and Environmental Impact Assessment (EIA). From the expertise developed in waste management solutions, effluent treatment, soil remediation etc., the division has made a niche in state of the art technological solutions and mitigation measures. CSIR-NIIST is a NABET accredited, Category A consultant organisation in Kerala with accreditation in two areas i.e Mining and Ports & Harbour. The EIA services are used by government and private sector for statutory clearance of projects. CRTDH (Common Research & Technology Development Hub) is a project funded by DSIR, Govt. of India. CRTDH provides facilities for R&D and consultancy services enabling environmental interventions for MSMEs. Environmental issues associated with MSMEs are taken up for development, interventions and technological solutions. Technical support is provided to meet regulations as well as to reduce resource consumption and improve efficiency of operation. The state of the art Dioxin analysis facility has been established under the CRTDH project. The Testing and Analysis Laboratory of ETD is accredited by NABL as per ISO/IEC 17025: 2005 for analysis of Water, Waste water, Dioxins, Furans and Poly Chlorinated Biphenyls (PCBs). In addition, CSIR-NIIST has been recommended by Ministry of Environment, Forest and Climate Change (MoEFCC), Govt. of India as a referral laboratory for Dioxin analysis for environmental clearances. Most of the R&D outcomes of the division are in the form of successful, innovative and cost-effective technologies striving to create an ecosystem of “development without destruction”. National Institute for Interdisciplinary Science & Technology 53 53 Annual Report 2018-19 Highlights Major activities of the division during 2018-19: 500 kg/day capacity NIIST compact food waste biogas plant installed at Trivandrum International Airport. A pilot plant for treating 2000 litres of greywater from NIIST canteen was set up. Pilot plant unit (670 kg/batch) for demonstrating perchlorate contaminated soil remediation was set up. Biodrying process for treatment of mixed unsorted Municipal Solid Waste was optimized. Design of odour control system for shrimp feed factory in Gujarat NABL accredited laboratory has been set up for the analysis of Water, Waste water, Dioxins, Furans and Poly Chlorinated Biphenyls (PCBs). Determination of emission factors of dioxins from open burning of municipal solid wastes in Kerala was carried out. Ambient air sampling and residual ash sampling were carried out during the fire broke out at solid waste dump yard of Waste Treatment Plant, Brahmapuram, Kochi during 22nd – 25th February 2019. A comprehensive three day workshop “DIOXIN India 2019” on “Advanced training in sampling, sample preparation and quantification of dioxins and PCBs” was conducted. Environmental Impact Assessment (EIA) studies carried out for mining beach sand minerals in blocks II and IIEE by Indian Rare Earths, Kollam, Kerala. EIA studies for mining beach sand minerals in blocks IV and IVEE by Kerala Minerals and Metals Ltd. (KMML), Chavara, Kerala. 54 National Institute for Interdisciplinary Science & Technology 54 Annual Report 2018-19 Scale up and field installation of NIIST compact greywater from NIIST canteen is treated in this system food waste biogas plant daily. The entire treatment system consists of an initial The compact food waste biogas plant developed by equalization tank followed by anaerobic treatment CSIR-NIIST was scaled up to 500 kg/day capacity from in a baffled anaerobic reactor with biofilm support the existing 50 kg/day level. In a joint project with medium. Around 70% COD reduction happens at Airport Authority of India (AAI) and a private industry, this stage. Subsequently, there is a suspended growth Swatch Future Energy Solution (the NIIST technology aerobic treatment unit, where the residual COD is licensee) a 500 kg food waste-biogas-power unit consumed to discharge limits. The total COD from its was installed at Trivandrum International Airport. initial 1500±30 mg/L level was reduced to ~30 mg/L. The project was fully funded by AAI, the scale-up The biogas produced from the anaerobic treatment design was provided by NIIST, while the fabrication unit can be used as biofuel. The entire treatment and installation was done by the industry. The plant system will be consolidated into a single modular unit. is expected to generate around 90-100 cubic meter biogas every day, that will be converted into ~110-120 kWh of electricity. The installation of the plant was completed in Dec 2018 and trial runs are currently in progress. The reactor was designed to treat ~5 kg VS/m3 of the reactor working volume. Around 90 % volatile solid degradation was observed in the reactor. The operation and maintenance of the system for the first one year will be done jointly by CSIR-NIIST and the industry partner. Clear water from canteen wastewater after treatment Ex-situ-soil bioremediation system for perchlorate The environmental monitoring and bioremediation of perchlorate, an endocrine disrupting ground water contaminant, is one of the areas of research in the environmental technology division in CSIR- NIIST. In the continuing efforts an ex-situ bioprocess Large capacity (500 kg/day) food waste biogas plant was developed for decontaminating perchlorate installed at Trivandrum International airport. contaminated soil in a comparatively short period. Onsite greywater treatment/recycle system In this process the contaminated soil will be flushed In a new initiative, as part of CSIR FTT project, the with water and the wash water containing perchlorate development of modular onsite greywater treatment will be completely treated with a bio-regenerator. The cum recycle system is in progress. This is a combined perchlorate free water will be again used for washing anaerobic-aerobic system, that will be suitable for fresh lot of soil, and the cycle can be continued. The treating greywater from canteens, small restaurants, bio-regenerator (Patent filed) is a fixed film bioreactor hotels etc. which will find wide application in fast inoculated with NIIST developed bacterial consortium growing cities where sewerage network is limited. (cultures submitted with IMTECH) expressing specific Presently at NIIST, as a pilot plant, around 2000 litres enzymes capable of reducing perchlorate into National Institute for Interdisciplinary Science & Technology 55 55 Annual Report 2018-19 chloride and oxygen. Compared with the existing pressure drop is a key parameter that determines practices for remediating perchlorate contaminated the biodrying pile height. Laboratory measurement soil, this approach is comparatively fast without any of pressure drop as a function of air velocity in small environmental impacts. We have demonstrated the diameter vessels containing MSW is not accurate process up to 670 kg soil per batch. Our previous studies because of air short-circuiting along walls. This effect have revealed soil contamination of perchlorate at cannot be avoided except by having large vessels. But bulk handling sites like perchlorate production units filling large vessels to the required pile heights is not and space R&D labs as one of the sources of ground feasible in the laboratory. Hence, a new large diameter water contamination. The present process will find apparatus with a short pile height was compressed application for remediating perchlorate contaminated with deadweight was constructed. This apparatus soil in such places. is able to simulate the load because of the pile self- weight above a layer. The air pressure (mm.wg), P, in terms of air velocity (m/min), v, and specific pile weight kg MSW / m2, (w) fits the following relation: Process flow sheet for bioremediation of soil contaminated with perchlorate Drying and pressure drop determination in 1 m diameter pile with dead weight for compression Pilot plant unit (670 kg/batch) for demonstrating perchlorate contaminated soil remediation. The municipal waste management scheme examined various options for waste collection, transport, A Comprehensive Municipal Waste treatment process and final disposal. Management Scheme for Kerala This project, sanctioned by the Department of The following collection systems were analyzed and Environment and Climate Change, Government costs (capex and opex) were estimated: of Kerala, in 2016 with a budget of Rs. 1 crore, was i. Door-to-door collection, wet and dry segregated completed and report submitted. household and commercial waste ii. Door-to-door collection, mixed household waste This year, experiments to enable scale-up of the and wet commercial waste; biodrying reactor were conducted. The airflow Bin collection – dry commercial waste; 56 National Institute for Interdisciplinary Science & Technology 56 Annual Report 2018-19 Option ii. was optimal. Segregated collection was sub- is no residual ash for disposal as ash is incorporated optimal because of the high cost of quality control into cement clinker. There is no need for exhaust gas required to maintain segregation efficiency. Quality treatment because combustion temperature and gas control requires the waste collector to inspect waste retention time in cement kiln is sufficient to prevent before collection at each household. This requires time formation of dioxins. along with corresponding increase in wages. Without Biodrying uses self-generated heat to dry unsegregated adequate control over quality of waste, downstream municipal solid waste. After drying, the solid waste processing operation that assume segregation, will is mechanically processed to separate metals and fail. inert materials such as glass and stones, to produce a Taking Thiruvananthapuram as a model, the waste combustible, high-calorie fraction comprising plastics, transport requirements were estimated. The number paper, dry organic materials, textile fabrics, rubber, of garbage trucks and collection auto-rickshaws, the leather etc. This fraction is shredded to required size fuel and maintenance costs were calculated. and baled to produce RDF. It can be used as a fuel in thermal power generation. Process parameters The optimal treatment process has the following required for design of a biodrying plant for mixed waste components: were determined in a series of biodrying experiments. i. BMT plant for biodrying mixed waste and dry waste with recovery of RDF Various waste compositions were tested. ii. Anaerobic digestion of waste with power Based on experiments conducted, the biodrying generation, dewatering and drying of digestate process design is formulated as : The following options for utilization of RDF were a. Waste composition: At least 60% organic waste examined. with 55% to 60% moisture is suitable for biodrying, with moist air. Wastes with lower organic matter i. RDF fired thermal power plant and moisture need to be dried physically with ii. Coal fired thermal power with 10% RDF substitution unsaturated air. ii. Cement kiln with 25% RDF substitution b. Air to be supplied in upflow mode. Downflow Option I. is uneconomical since the power plant sizes mode causes bottom layers to compact by wetness, causing high back pressure. are small (less than 15 MW) and capital investment is 3 high. c. Air flow required 2 m /kg waste/d d. Saturated air by air recirculation required for Option II. is far more economical as plant sizes are wastes with greater than 55% organic content. larger 250MW and generation of toxic dioxins is e. Drying time 10 d negligible. RDF produced from across the state can be f. Mixing: Breakup agglomerates without mixing transported to a single power plant. along depth on 4th day. Option III. Cement kiln is most economical and g. Bed height: 2 to 3 m. Lower bed height when environmentally preferred option. Kerala has waste moisture content is higher. one cement factory which is a State Government h. Air pressure: Varies from 150mm w.g. to 20 mm w.g. Enterprise. The RDF produced across the state can be i. Exhaust air odour destruction: Gas biofilter used in just one factory. Suitable kiln burner and waste j. Bed temperature maximum to be limited to 65oC. handling system is required for utilization of RDF in Mixing breakup of pile agglomerates required cement factory. The capital investment for cement if temperature exceeds 65oC. Channels in pile kiln burner replacement is lower than that required for through which dominant air flows occur should be establishing a co-firing thermal power station. There not more than 45oC. National Institute for Interdisciplinary Science & Technology 57 57 Annual Report 2018-19 k. Temperature to be held above 50oC for 24h NABL accredited Testing and Analysis facility within 4 days of loading for destruction of fly NABL accredited laboratory for testing and analysis of larvae as they hatch. water/waste water samples ranging from surface water The Government of Kerala has decided to set-up to industrial effluents and for the analysis of Dioxins, Waste-to-Energy (WtE) plants at 8 locations in Kerala, Furans and Poly Chlorinated Biphenyls (PCBs) has been although our analysis concludes that it is a not a cost- set up at CSIR-NIIST. Beneficiaries include industries, effective option. One 11.8 MW Waste-to-Energy plant hospitals, Govt. Departments & Ministries, regulatory at Brahmapuram in Kochi is in the advanced stage agencies like pollution control boards, hotels, resorts, of project approvals. The plant has Biodrying BMT to healthcare units etc. produce RDF, followed by Air-fed gasification type power generation. The waste handling capacity is 500 tpd. The power costs from the plant are in the range of Rs.15 per kWh. The cost of treatment is Rs.3.27 per tonne MSW. Purchase of power at higher cost subsidizes waste treatment cost. The implied subsidy for the Kochi WtE plant is Rs.9.3/kWh and Rs.6.2/kg RDF. In comparison, the option of utilization of RDF produced in cement factory has implied subsidy of Rs.2.0/kg RDF. We recommend BMT (Biodrying) Plants at all census towns as the key technology for Kerala. Odour Control Systems Design and Technology Transfer M/s. Avanti Feeds Ltd., is the largest manufacturer of shrimp/prawn feed in the country. The company’s factory at Valsad, Gujarat has production line of 83 tpd established in 2011, and another 83 tpd production line established in 2014. The raw materials used in feed production are fishmeal, soyameal, fish oil, isopropyl NABL accredited laboratory for testing and alcohol and other ingredients. The Valsad factory analysis is located in a tight space, with private residential areas around, and hence faces odour complaints. Setting up of Major Analytical Facility – The measurement of odour in some of the exhaust Inductively Coupled Plasma Mass Spectrometry air streams was carried out by NIIST licensee, Elixir for Elemental Analysis Envirosystems Pvt. Ltd. The odour control system Inductively coupled plasma mass spectrometry designed for the plant comprises ((ICP-MS) is routinely used in many diverse 1. Ventilation system for capture of odour emissions research fields such as earth, environmental, 2. Odour destruction system using gas biofilter pharmaceuticals, Ayurveda drugs/ formulations, The gas biofilter technology was transferred to life and forensic sciences and in food, material, M/s AP Engineers Pvt. Ltd. Erode. The company chemical, semiconductor and nuclear industries. supplies fishmeal manufacturing equipment. The high ion density and the high temperature in a Preliminary design and investigations were carried plasma provide an ideal atomizer and element ionizer out for Elgi Rubber Ltd., for reclaim rubber factory for all types of samples and matrices introduced odour control. 58 National Institute for Interdisciplinary Science & Technology 58 Annual Report 2018-19 by a variety of specialized devices. Outstanding can be calculated by multiplying emission factor and properties such as high sensitivity (ppt–ppq), relative activity rate (total quantity of material processed). salt tolerance, compound-independent element Copies of report have been provided to MoEFCC, response and highest quantitation accuracy lead to MoHUA and CPCB for necessary policy decision the unchallenged performance of ICP-MS in efficiently making in scientific solid waste management in the detecting, identifying and reliably quantifying trace country. elements. The increasing availability of relevant The major findings of the study are reference compounds and high separation selectivity The average emission factor of dioxins to air and extend the molecular identification capability of ICP land is 5.1 & 34.71 µg PCDD-F TEQWHO/ ton of MS hyphenated to species-specific separation waste burned based on the emission studies techniques. Coupling of Ion chromatograph with conducted in wet waste (original weight basis) ICP - MS enable speciative separation and quanti- samples. fication of As (III), As (V), arsenobetaine, Hg (II), A large decrease of dioxin levels in residual ash methyl- Hg, Cr (III), Cr (VI) etc. The instrument is of dry waste combustion compared to wet waste serving the ongoing R & D activities of the institute as was observed. It indicates that moisture levels and well as the clients from industries, regulatory bodies poor combustion conditions play a major role in etc. enhancing dioxin formation. Further studies are ongoing to understand this phenomenon. It is found that 87 % of the total dioxin emitted is present in the residual ash of wet waste and only 13 % is emitted to air. The dioxin emission in ambient air in the vicinity of open burning site in Thiruvananthapuram city was found to be 13.04 pg TEQPCDD/F per m3 of air, whereas it was found to be 0.2 pg TEQPCDD/F per m3 of air in control samples. The ambient air data is in line with the simulated open burning studies where the stack emission concentration is 18.05 pg Inductively Coupled Plasma Mass TEQPCDD/F per Nm3 of air. Spectrometer (ICP-MS) Dioxin Research & Monitoring CSIR-NIIST has been recommended by MoEFCC as a referral laboratory for dioxin analysis for environmental clearances. We have submitted the report on “Determination of emission factors of dioxins from open burning of municipal solid wastes in Kerala” to Kerala State Pollution Control Board in December 2018. It is the first such study conducted in India. A “Burn Hut” was constructed in the campus and simulated waste combustion studies were carried out using known compositions of municipal solid wastes. Emission factor is the total TEQ of dioxin generated during the combustion of unit quantity of material Simulated waste combustion experiments & isokinetic under consideration. The annual emission inventories sampling National Institute for Interdisciplinary Science & Technology 59 59 Annual Report 2018-19 CSIR-NIIST conducted ambient air and residual ash sampling during the solid waste dumpyard fire break out at Brahmapuram Plant, Kochi during 22nd – 25th February 2019. The study was taken up suo moto by CSIR- NIIST in view of serious societal implications. The analysis showed higher levels of dioxin emission from dump-yard fire and is in tune with our study report submitted to KSPCB. The important findings of the study are Dioxins were detected and quantified in ambient air, residual ash and sediment samples collected from the premises of waste dumpyard during fire break out. The average dioxin levels observed in ambient air was found to be 10.3 pg TEQ/m3. The observed levels are 50 and 10 times higher than reference and field blank data. The average dioxin concentration observed in residual ash samples collected from different Air and Residual ash sampling at Brahmapuram locations in the fire covered area is 158.5 ng TEQ/kg waste dumpyard of ash. The observed dioxin levels in sediment samples collected from nearby marsh fields is 6.8 ng TEQ/ kg. The total estimated dioxin emitted = 72 milligram Toxicity equivalence (TEQ). The WHO /FAO maximum tolerable monthly intake of dioxins for humans is 70 picogram TEQ/ kg body weight (annual tolerable annual intake Brahmapuram waste treatment plant (Google Inc.) as on for a 65 kg person is 54.6 nanogram TEQ). While 23/02/2019 and the boundary demarked in red is the fire only a very small fraction of the dioxins generated covered area reaches humans via the food chain, the total dioxin VIII. Environmental Impact Assessment (EIA) generated is sufficient to exceed tolerable annual Environmental Impact Assessment (EIA) is the intake of 72 x 10-3 / 54.6 x 10-9 = 1.3 million persons. systematic identification and evaluation of the potential impacts (effects) of proposed projects, plans, programs, or legislative actions, relative to the physical–chemical, biological, cultural, and socioeconomic components of the environment. It is a mandatory process for obtaining Environmental Clearance (EC) for various developmental projects. EIA promotes sustainable development by identifying environmentally sound practice and mitigation measures for development. 60 National Institute for Interdisciplinary Science & Technology 60 Annual Report 2018-19 Our major clients, Indian Rare Earths Ltd and Kerala Fugitive Dust Model (FDM) is used to predict Minerals & Metals Ltd are public sector companies dispersion of particulate matter in the study area and situated in Neendakara Kayamkulam (NK) block of shows incremental increase in pollution due to truck Kollam district, Kerala stretching 22.5 km having traffic. However, the values are within the CPCB limit beach sand heavy mineral deposits rich in ilmenite, prescribed for PM10, which is 100µg/m3 for 24 hours. rutile, zircon, monazite, sillimanite etc. EIA studies The maximum value of PM10 for an average of 24 are mandatory to sustain these industries and these hours was 63 µg/m3 observed in the buffer zone and companies rely on us for carrying out these studies. minimum value for PM10 for an average of 24 hours 3 Through our EIA studies, our commitment towards was 45 µg/m . Similarly, SO2, NO2 values showed less environment protection and monitoring is adhered to than 10 µg/m3 for all stations. The permissible limits while ensuring our customer’s meeting the mandatory for this area as per NAAQ standards for PM10 is 100 µg/ 3 3 EIA requirement. m and for SO2 and NO2 the limits are 80µg/m . Thus the observed values for air quality taken over the study Indian Rare Earths Ltd (IREL) has appointed CSIR-NIIST, period in core and buffer zone is within the permissible to evaluate the environmental impacts that due to limits. the proposed heavy mineral sand mining operations and to work out an environmental management and monitoring programme to prevent, control, minimize or eliminate the adverse environmental impacts envisaged from the mining activity. A purely physical process separates the heavies and no chemicals are used. The mined out heavies are transported to mineral separation plant and the mined voids are refilled simultaneously making space for re- vegetation / resettlement. The mineral concentrate can be transported by trucks or by waterway using NWAI developed TS canal (Figure 1). Ambient air quality sampling locations for NK Block IIEE Dispersion Model for PM in NK Block IIEE Base map of NK Block IIEE 10 National Institute for Interdisciplinary Science & Technology 61 61 Annual Report 2018-19 The mitigation measure includes the feasibility of using Commercialization of the Virtual Casting Solver floating barges/country boats and pumping through Technology pipes as a means of transporting heavy minerals to Virtual Casting is a software package for the simulation IREL plant. The TS canal, a part of national waterway-3 of solidification process of industrial castings and was runs through the mine lease of IREL Block II EE (Eastern developed by CSIR-NIIST which can predict shrinkage Extension). The mine lease does not have access to defects in a given casting design. In 2011, the Virtual well-developed roads where TS canal can be utilized Casting Solver Technology was transferred to 3D for the transportation of heavies to MSP. The consultant Foundry Tech Pvt. Ltd., (3DFT) a company incubated recommends the transportation of the heavies using in the Indian Institute of Technology Bombay. floating/towing barges with mechanical articulated This company maintains and markets AutoCAST connectivity. This will also provide employment to which uses an integrated easy‐to‐use environment the Project affected people (PAPs). Another option for for casting method design, solid modeling, and transportation of heavies is by pumping. A two stage simulation. During 2012-13, Virtual Casting Solver pumping can be used to transport heavy mineral slurry was fully integrated with their casting design to mineral separation plant. Advantages of barge software AutoCAST, giving birth to FLOW+ module transport which is eco-friendly as compared to road in AutoCAST X1 software. During 2013-19, AutoCAST transport are covered in the report. The EIA study also X1 with FLOW+ has been showcased at various Indian includes marine ecological survey, socio-economic Foundry Exhibitions. Till date, more than 175 licenses survey, hydrogeological survey, assessment of impacts of AutoCAST-X1 have been sold to various ferrous, non- and its mitigation measures etc. ferrous foundries and academic institutes in India by 3D Foundry Tech Pvt. Ltd. CSIR-NIIST is a lead technical During this period NIIST has completed the field partner for this product. studies and submitted the draft final report for carrying out the public hearing which was successfully The focus this year has been on the benchmarking and completed for these two blocks and the final beta testing of the modified mold filling algorithm report is submitted online to State Environmental which includes the pressure head and inertia effects Impact Assessment Authority (SEIAA) for according by testing the software code on industrial casting Environmental Clearance. EIA of NK Block IV of Indian parts. This innovative, realistic & quick mold filling Rare Earths Ltd and submitted final report and this software module has been released in the new version project has accorded Environmental Clearance from of AutoCAST X1- Release 11.10.1. In addition, network SEIAA. flow based hydraulics model is developed to predict COMPUTATIONAL MODELLING AND the velocity, flow rate and pressure at the in-gate SIMULATION locations. This code was benchmarked for simple The Computational Modeling and Simulation Group two-ingate casting geometry and the results were is engaged in interdisciplinary, collaborative research. presented as a poster at the Seventh International We develop computational techniques for a wide Conference on Solidification Science and Processing range of phenomena and processes like metal casting (ICSSP – 2018), which was held during November 19- and welding, multiphase hydrodynamics including 22, 2018 at Thiruvananthapuram. reaction kinetics of various chemical reactors like rotary AutoCAST X1-FLOW+ is available from Shri. kilns, stirred and fluidized bed reactors. Further this Babaprasad Lanka, CEO, 3D Foundry Tech Pvt. Ltd. group is also involved in development of commercial 507-C, Ecstasy Business Park City of Joy, JSD Road, technical software and providing computational Mulund (W) Mumbai – 400 080, India. Phone: +91 support to other groups within the Institute. 98921 00072 E-Mail: [email protected] 62 National Institute for Interdisciplinary Science & Technology 62 Annual Report 2018-19 Mold Fabrication (for speed and consistency), Efficient Melting and Direct Casting (for energy efficiency), Metal Matrix Composite Processing (for advanced applications), Data Sensing and Analytics (for optimization and reliability) The starting point is a 3D model of the cast part which can be created using a solid modeling software or can be given as a STL file from the customer. This is imported into the casting design & simulation software for methods design. The as-cast model is sent to the 3D plastic printer which is a 3D FDM printer with novel features. The plastic pattern is then placed in an adjustable mold box in a semi-automatic mold making set-up into which silica sand mixed with resin and a cross linking agent is poured. After ramming, the mold box is removed and is placed under the bottom pouring melting unit. The melting and pouring unit has add-on facilities for making vacuum induced casting and MMC castings with particle addition and stirring. After shakeout and cleaning, the casting is subjected to quality checking by radiography. In addition, sensors are used in the hardware units for collecting data which is used for on-line and off-line SMART FOUNDRY 2020 data analytics. This project was sanctioned during August 2016 for Rs. 8.25 crores from DST under Technology Systems Development Program and with a contribution of RS. 1.25 crores from five private industrial partners and CSIR-NIIST is the overall project coordinator for this project and the amount sanctioned for CSIR-NIIST is Rs. 3.32 crores for a period of three years. The objective of this project is to develop and demonstrate an ultra-compact SMART Foundry with Version 1 of the modular set-up of SMART FOUNDRY unique and novel features for economic production was demonstrated at VNIT, Nagpur on 1st September of small intricate metal parts of high quality with the 2018. A SMART Foundry workshop was also conducted following modules by a collaborative initiative by a during 31st August - 2nd September 2018 at VNIT national network of researchers and entrepreneurs which was attended by 32 local college teachers, who from all over India greatly appreciated the collaborative technology Casting Design and Simulation (for high yield and development, and showed interest in joining the SF quality), initiative. National Institute for Interdisciplinary Science & Technology 63 63 Annual Report 2018-19 The entire facility can be set up in a room (25 m2), which and other innovative applications. The new process is ideal for training students, who, in turn, can set up aims to change the perception of metal casting from micro manufacturing units with very little investment. “dirty, difficult, and dangerous” to “sustainable, smart, They can also use it for making replacement parts of and safe.” costly equipment, metal busts, household appliances 64 National Institute for Interdisciplinary Science & Technology 64 Materials Science & Technology Division Expertise Minerals & Metallic Materials, lectronics & Energy Materials, Polymers & Composites, Ceramics, Computational Modeling & Simulation Scientist : 19 Technical staff : 6 Students : 73 Facilities XRD (X-ray diffraction), XPS (X-ray photo electron spectroscopy), EM (Scanning electron microscopy), PMS (Physical property measurement system), D XRD (X-ray diffraction), BET (Brunauer, Emmett and teller) Ongoing projects : 46 (Grant-in-aid, Sponsored, Consultancy and Technical Services, In-house) Publications (SCI+non SCI) : 72 Ph. D. awarded : 11 65 Annual Report 2018-19 पदार्थ व煍ञन तथा ꥍ셌饍योगकी पभाग पदार् वि煍ञन तथा प्र셌饍योगकी प्रभाग स啍क्र् 셂प से धात,ु चीनी मि絍ट की चीजᴂ, पॉलिमर, इलेक絍रॉनक और चबंु कीय साम嵍र के 啍ष配रोंमᴂ उच् वि煍ञन और प्रासंगिक प्र셌饍योगिकियों के लिए अगणी आर एडं डी गतिवि啍ध्रों को काटने मᴂ शामिल है। इसके अलावा, इस प्रभाग के वै煍ञानकरों 饍वार उच् गणु वत्ता वाले प्रकाशनरों और पेटᴂट के लिए अतःं विषय प्रकृ ति के मौलिक शोध किए जा रहे हℂ। इस प्रभाग ने एससीआई पत्काओ ं मᴂ 72 पत प्रकाशित किए हℂ, जिनमᴂ औसत प्रभाव कारक 3.235 है, जिसमᴂ प्रति वै煍ञानक प्रभाव कारक 2.904 है और विभाजन को इस वर् 3 अमेरिकी पेटᴂट प्राप्तु हए हℂ। हाइलाइट्स बायोडि嵍रडेबल पॉलीएलैक्टक एसिड और कॉयर कं पोजिट । स्पो絍셋निक् और मैग्नटो-ऑप्टकल अनप्रु योगरों के लिए डोपेड TiO2 啍क्रस्ल । कोण-निर्भ रंग बदलते कोलाइडल फोटोनिक 啍क्रस्ल सि啍ण्रों । डोनर-स्वकर्त चार् ट्रसफर स्टक् का उपयोग करते हुए सपु रमॉलेक्लय र ब्लक कॉपोलिमर । 嵍रफीन आधारित झिल्ल के लिए झिल्ल । एजं ाइम मकु , जैव-डीजल मᴂ प्रयकु खाना पकाने के तेल के 셂पांतरण के लिए सिरेमिक उत्प्रेक प्र啍क्र्봾 । सिलिका आधारित कार्बनक-अकार्बनक संकर फ्लोरसᴂट स्봾ही । कार्बनक डाई हटाने के आवेदन के लिए आयन-एक्चᴂज संसाधित चबंु कीय नैनो-कं पोजिट-कार्बनक-अकार्बनक संकर फ्लोरसᴂट स्봾ही प्रिंट करने योग् पदानक्रु मित। निकल नैनोवायर आधारित सᴂसर-स्-चिकनाई द्विश कार्न फाइबर प्रबलित स्मार एल्मीय नियम कं पोजिट-Ni-B-CeO2 कᴂपोसिट कोटिंग् । मैग्नीशिम मिश धातओु ंपर लंतानम फॉस्फ ट कोटिंग् । धात ु कार्बनक जेल इटं रप्रि絍रेटंग बहुलक नेटवर् व्तय ्न् आतरिकं Fe-N- डोपेड झरझरा 嵍रफाइट कार्न डी । माइक्र셋 / अल絍र निस्पदन के लिए सिरेमिक झिल्ल । 66 National Institute for Interdisciplinary Science & Technology 66 Annual Report 2018-19 MSTD of CSIR-NIIST is actively involved in cutting edge R&D activities leading to high science and relevant technologies in the areas of Metals, Ceramics, Polymers, Electronic and Magnetic materials. In addition, fundamental research of interdisciplinary nature is being carried out by the scientists of this division leading to high quality publications and patents. This division has published 72 papers in SCI journals with an average impact factor of 3.235 with impact factor per scientist being 2.904 and the division has got 3 US patents granted this year. Highlights Biodegradable polylactic acid and coir composites Doped TiO2 crystals for spintronics and magneto-optical applications Angle-dependent color changing colloidal photonic crystal arrays Donor-acceptor charge transfer stacks using supramolecular block copolymers Graphene based membranes for desalination Enzyme free, ceramic catalytic process for the conversion of used cooking oil into bio-diesel Silica based organic-inorganic hybrid fluorescent ink Ion-exchange processed magnetic nano-composites for organic dye removal application Organic-inorganic hybrid fluorescent ink Printable hierarchical nickel nanowire based sensors Self-lubricating bidirectional carbon fiber reinforced smart aluminum composites Ni-B-CeO2composite coatings Lanthanum phosphate coatings on magnesium alloys Metal organic gel interpenetrating polymer network derived intrinsic Fe-N-doped porous graphitic carbon Multi-channeled ceramic membranes for micro/ultra filtration National Institute for Interdisciplinary Science & Technology 67 67 Annual Report 2018-19 Coir and Coir Composites is developed for the synthesis of low dimensional and Natural fiber-reinforced composites offer high specific highly efficient stable anatase TiO2 nanocrystals and strength and good mechanical properties being Co-doped TiO2 nanocrystals. Co-doped TiO2 shows a light weight and eco-friendly. The development narrowing of bandgap due to Co incorporation in TiO2 of renewable and biodegradable materials has which can be useful for visible light photocatalysis in attracted significant attention in terms of meeting practical applications. X-ray photoelectron spectra the growing demand for sustainable development, show the presence of Co2+, Co3+ and Ti3+ and certain given the increase in environmental awareness. We amount of oxygen vacancies. Magnetic behavior shows have developed a process for the surface modification weak ferromagnetic behavior in undopedand 3% Co- of coir fibers using a plasma treatment method. This doped TiO2 at room temperature whereas at higher method has many advantages in surface modification concentration, Co-doped TiO2 shows paramagnetic including its effective alteration of surface properties behavior which is explained well by taking into and reducing the usage of environmentally hazardous consideration the bound magnetic polaron (BMP) chemicals. We have also developed a process for formation. The doping with magnetic impurities the surface treatment of geotextiles with silylated associated with oxygen vacancies could enable natural phenolic exudates of plant species including coupling between them to enhance BMP overlapping cashew nut shell liquid, cardanol, or derivatives of and ferromagnetic exchange interaction in the pentadecenyl phenols to improve the longevity of system apart from their potential optical properties. the coir geotextiles. We have developed the process A significant reduction in bandgap associated with for the production of household articles/automobile its interesting magnetic properties makes Co-doped parts/packaging materials based on Coir and Poly TiO2 a well-suited material for future spintronics and (lactic acid) composites. magneto-optical applications. Products developed using polylactic acid and coir Variation of magnetic properties of TiO with doping composites 2 Angle-dependent color changing colloidal Magnetic behavior of TiO2 and doped TiO2 nanocrystals for spintronics and magneto- photonic crystal arrays using polymer/inorganic optical applications microspheres on flexible surfaces Sir C.V. Raman had discussed the origin of colors TiO2 is a known semiconductor and the defects present in the material is known to control its transport in the plumage of the bird, CoraciasIndica in properties. Magnetic behavior of the semiconductor one of his paper published in 1934. Apart from the contribution from chemical coloration, the TiO2 was modified by the substitution of Cr ions in the lattice. A simple low temperature sol-gel method unique brilliant angle-dependent color is mainly 68 National Institute for Interdisciplinary Science & Technology 68 Annual Report 2018-19 due to well-ordered hierarchal structures present loading of BNNSs (≥1 wt %) leads to the agglomerated in the feathers of peacock and butterflies as a nanocomposites. Lower loadings of the BNNSs induces result of the interaction of light with periodic the formation of ordered α form (when crystallizing structures on their surfaces. Mimicking these from the melt at a cooling rate of 10 °C/min) but the structures found in nature requires state-of-the- mixture of α’ and α forms are formed in the presence art nanofabrication facilities. Another approach of higher loading of BNNSs. It was observed that would be self-assembled colloidal particles by the crystallization of PLLA occurred rapidly with the employing colloidal crystallization methods for narrow distribution of crystal size and degree of crystal the fabrication of bio-inspired photonic crystal perfection in highly dispersed nanocomposites and the arrays. The color of ordered photonic crystals thermal conductivity of PLLA/BNNSs nanocomposites arrays changes when viewed at different angles was found to increase significantly with BNNSs loading and under different lighting conditions. These (J. Phys. Chem. B 2018, 122, 6442−6451,2018 ) angle-dependent color changing photonic crystals can be used in combination with advanced fluorescent materials to create new generation authentication technologies. In the current global scenario, there is great demand for the development of color changing materials that can changes color in response to changes in pH, humidity, aging and analyte concentration. Here, we could successfully develop angle-dependent color changing photonic crystals on both solid Directed Assembly of Hierarchical Supramolecular Block and flexible surfaces over large area. Scale up of Copolymers: A Strategy to Create Donor-Acceptor Charge specialty colloidal particles and the fabrication Transfer Stacks processes are underway. A three-component hierarchical self-assembly approach was developed to generate stable alternate donor-acceptor (D-A) assemblies within block copolymer microdomains by involving the supramolecular approach in self-assembly of block copolymers. Block copolymer supramolecules Angle-dependent color changing photonic crystals on composed of two small molecules (donor and solid and flexible surfaces acceptor) and polystyrene-block-poly(4-vinylpyridine) Influence of Boron Nitride Nanosheets on the (PS-b-P4VP). 1-Pyrenebutyric acid (PBA, donor) Crystallization and Polymorphism of Poly(ʟ- forms hydrogen bonding with P4VP and aromatic lactide) interactions with naphthalene diimide (NDI, acceptor) Impact of delaminated boron nitride nanosheets to generate charge transfer (CT) complexes within the (BNNSs) on the crystallization behavior and crystalline block copolymer domains in the solid state. Formation structure of melt-crystallized poly-L-lactic acid (PLLA) of hierarchical structures and charge-transfer was studied using wide-angle X-ray diffraction and complexes between PBA and NDI were established by scanning electron microscopy. Addition of lower experimental techniques. Space charge limited current loadings of BNNSs (~0.5 wt %) resulted in the highly analysis showed the enhanced charge carrier mobility dispersed PLLA nanocomposites, whereas the higher in PS-b-P4VP (PBA+NDI) supramolecules compared National Institute for Interdisciplinary Science & Technology 69 69 Annual Report 2018-19 to the physical blends of PBA+NDI. The organization of different phosphors. Compared to the previous of donor and acceptor molecules within the block realizations of flexible nanowire white LEDs, these copolymer microdomains open up new insight in the novel LEDs improved the CRI from 54 to 86 and showed area of electronic devices because of its advantages a colour tunable from bluish cool white colour to such as solution processability, controlled formation of natural white and finally to warm white. The flexibility hierarchical assemblies and the CT interaction in the tests showed that the LEDs can be bent down to 1.5 solid state (Macromolecules , 52, 2889−2899, 2019) cm curvature radius without degradation. Therefore, the replacement of the nano-phosphors used in the previous realization by relatively inexpensive micro- phosphors does not degrade the good mechanical flexibility of the nanowire white LEDs. Tilted SEM image of InGaN/GaN NW LEDs grown on sapphire substrate. (b) Schematic illustrations of the NW LED structure Phosphor-converted flexible nitride nanowire white light- in a cross-sectional view. (c) Schematic illustration of the emitting-diodes fabrication processing of the 2nd-generation flexible white LED Flexible optoelectronic devices are one of the most Synthesis of semiconductor oxide nanotubes rapidly evolving fields. The nitride nanowires (NWs) based composite particles via ion-exchange provide the possibility to fabricate flexible devices reactions and their application in removal of as their footprint is small compared to the bending organic dyes from aqueous solutions radii of the macroscopic devices. Dr. Maria and her Hydrothermally synthesized hydrogen titanate research team from Centre de Nanosciences et de (H2Ti3O7) nanotubes (HTN) possess very high specific Nanotechnologies (C2N), France reported the first surface-area (300-400 m2 g-1) and high dye adsorption flexible white LED based on the InGaN/GaN NWs and capacity (100-120 mg g-1). However, due to their yellow nanophosphors (ACS Photonics,3(4),597-603, small size, the separation of H2Ti3O7 nanotubes from 2016). However, this 1st-generation flexible white LED the treated aqueous solution is a major problem. On had a poor colour performance: it emitted a bluish cool the other hand, the spherical (diameter=1-100 µm) white light with a high correlated colour temperature flyash particles, which are produced as by-product of (CCT) of 6306 K and a low colour rendering index (CRI) coal combustion in the thermal power plants, have of 54. Recently, Dr. Maria Tchernycheva and research relatively low dye adsorption capacity; however they team from NIIST collaboratively demonstratedflexible can be separated from the treated aqueous solution via nanowire white light-emitting-diodes (LEDs) consist gravity settling. It appears that the composite of flyash of flexible InGaN/GaN nanowire LED pumps capped particles and HTN may be beneficial to obtain high with removable phosphor-doped PDMS membranes. dye adsorption capacity along with high separation Different phosphors with tens of microns grain size efficiency. However, depositing HTN on the surface of emitting from green to orange were investigated flyash particles has been a challenge. In this context using a violet-blue pump and a blue-green pump. NIIST has developed a new technique to attach HTN In addition, a flexible NW white LED with a warm on the surface of flyash particles. In this technique, white emission was demonstrated using two-layers the surface of flyash particle is first sensitized via the 70 National Institute for Interdisciplinary Science & Technology 70 Annual Report 2018-19 adsorption of metal-cations (Mn+such as Sn2+/Sn4+, Development of graphene based membrane Fe2+/Fe3+, Pb2+, Zn2+, Cu2+, Mn2+). When the surface- from graphite ore for desalination sensitized flyash particles are stirred with HTN in The problem of fresh water scarcity has continued an aqueous solution at neutral solution pH, the to intensify globally. One of the most powerful nanotubes undergo ion-exchange reaction, typically techniques to fully secure the availability of fresh at the tube opening, during which the intercalated water is desalination. In any desalination process, H+ are replaced with Mn+ cations. Since the latter are the role of a membrane is crucial. Membrane fouling, anchored to the surface of flyash particles, HTN get high energy demand and trade-offs between salt permanently attached to the surface of flyash particles rejection and water flux remained as challenges via ion-exchange bond formation at the tube opening. of water desalination membranes. To meet the As a corollary, HTN can be directly attached to the needs of advanced desalination required to address surface of oxides of Mn+ without any prior sensitization the water challenges of the twenty-first century, a step. Using this principle, the magnetic nanocomposite breakthrough in RO membrane technology is a must. of HTN and γ-Fe2O3 could be successfully synthesized Recently graphene-based materials with their unique which exhibits not only high dye adsorption capacity physicochemical properties have emerged as potential but also the ability to be separated from the treated candidates with excellent desalination characteristics. aqueous solution by using an external magnetic field. Recently, graphene-based materials with their unique A US patent has been granted for this process as Shukla physicochemical properties have emerged as potential et al.,U.S. Patent Number 9,993,814, Granted on 12-June- candidates with excellent desalination characteristics. 2018. Hence, in a preliminary study at NIIST, Graphene Oxide (GO) was synthesized via chemical exfoliation of graphite flakes (from beneficiated ore) by modified Hummer’s method and characterized. GO membrane was developed by vacuum filtration of GO solution through mixed cellulose acetate membrane. Contact angle measurement confirmed the hydrophilicity of GO membrane. An attempt has been made for studying GO membrane over porous support GO SEM image of GO membrane Semi conductor oxide nano tubes based composite particles National Institute for Interdisciplinary Science & Technology 71 71 Annual Report 2018-19 the desalination performance of the membrane in Silica based organic-inorganic hybrid fluorescent terms of percentage salt rejection and conductivity ink measurement. Further studies are going on in the UV readable fluorescent inks have potential optimization of the parameters and also engineering applications in optical reading systems, the space between GO layers by incorporating cross- intelligence information and in automatic linkers during membrane fabrication. identification systems. However, sustaining Transesterification of waste cooking oil into the fluorescence at the printed level requires a biodiesel extensive optimisation in the synthetic chemistry The Food Safety and Standards Authority of India and ink formulation. With the aim of developing (FSSAI) has launched an initiative, repurpose used a fast-curing fluorescent ink, NIIST synthesised cooked oil, and recommended to use it for the fluorescent silica nanoparticles through modified production of biodiesel by the year 2022. India has the Stöber method. The rheostable viscous ink of potential to recover 220 crore litres of used cooking fluorescent silica was formulated by choosing oil from food industries and it is extremely essential ethanol as solvent system. The developed ink to find an appropriate technology for the conversion provides promising applications in the fields of of used cooking oil to biodiesel via industrially automatic identification, optical devices and viable process. In this context, a new heterogeneous information encryption. ceramic catalyst has been identified and validated for the transesterification of waste cooking oil to obtain methyl esters biodiesel. The catalytic loading, oil methanol ratio, reaction time, temperature, pH and milling conditions were optimized. More than 95% yield is seen at reaction temperature and time Photographs of (a) fluorescent ink printed on flexible Mylar of 65 oC/6h. Presence of fatty acid methyl esters were substrate, (b) under a hand-held UV lamp, showing bright green emission and (c) fluorescent ink under UV light. established. The physico-chemical properties of biodiesel are mitigating well with the ASTM standards Printable hierarchical nickel nanowire based for biodiesel. sensors Unlike the traditional lithography that involves time-consuming and costly procedures, the printed electronics, requires simple printing steps for device fabrication. Hierarchical nickel nanostructures were synthesized using a simple reduction method employing ethylene glycol. The developed structures exhibited Ms of 51 emu/g, better electrical conductivity (2.19 ×106 S/m), and an impressive thermal Waste Cooking Biodiesel Parameters conductivity of 33 W/m.K even for a densification of Oil Feed Methyl esters about 40%. Even with high porosity in the compacted o Specific gravity @ 30 C 0.926 0.893 form, the promising properties of h-NiNWs are due Kinematic Viscosity @ 40 oC [cSt] 51.0 18.0 to their effectively interconnected networks, similar Acid value mg KOH/g 5.820 1.459 to a foam structure. Hence, NiNWs proposed as good C (%) 18.93 21.02 candidate for a soft magnetic sensor. NiNWs could be H (%) 2.808 3.141 used for sensing magnetic microbeads for biological S (%) 6.7 0.127 72 National Institute for Interdisciplinary Science & Technology 72 Annual Report 2018-19 applications and sensitivity could be optimized by alloy due to the formation of self-lubricating tribolayer tuning the electrical resistivity, the diameter, and on the pin surface, which intercepts the contact of aspect ratios of hierarchical structures. The novel matrix metal to counter surface. The BD carbon fiber formulation of the screen-printable ink using these enhanced the hardness and compressive strength of nanostructures could make printing of magnetic the composite by restraining the plastic flow behavior devices for industrial applications. Low-cost flexible of matrix. HRTEM shows the presence of Al2O3 and magnetic sensors would be a reality with this kind of MgAl2O4 spinel, confirmed by EDS and SAD pattern, at magnetic printed structures replacing lithographically the composite interface. The composite shows a lower patterned expensive magnetic thin films. density of 2.16 g/cm 3 which is a major advantage for weight reduction compared to the monolithic alloy Self-lubricating bidirectional carbon fiber (2.7 g/cm3) reinforced smart aluminum composites by squeeze infiltration process Ni-B-CeO2composite coating for enhanced wear Self-lubrication is one of the smart material properties and corrosion resistance of Aluminium alloy required for producing components with enhanced Nickel-based coatings on aluminium with specific wear resistance and low coefficient of friction. surface properties are of great interest for anti-corrosive, Bidirectional (BD) satin weavepolyacrylonitrile (PAN) antiwearing,and self-lubricating applications. In based carbon fiber (Cf) fabric preform was successfully the present study electroless Ni-B alloy and Ni-B- infiltrated with aluminum alloy by squeeze infiltration CeO2 nanocomposite coatings were formed on 356 process. The infiltrated composite shows the uniform aluminium alloy surfaces. Ceria incorporation to Ni-B distribution of carbon fibers in the matrix with the coating reducesthe average nodular grain size from elimination of porosities, fiber damage and close 1150 nm to 650 nm and Ni crystallite size from 15 nm to control on the formation of deleterious aluminum 9.97 nm. Ni-B-CeO2nanocomposite shows remarkable carbide (Al4C3) phase. Cf/Al composite exhibits improvement in microhardness of 684 VHN compared remarkable wear resistance compared to unreinforced to pure Ni-B coating with 424 VHN. Enhanced wear resistance and reduction in friction coefficient are observed for the nanocomposite coatings compared to (a) (b) SEM micrograph of the surface texture of electroless (a) Ni-B alloy and (b) Ni-B-CeO composite coatings 2 (c) (d) (a) Optical Micrograph of Aluminum infiltrated carbon fibre layers, (b) Carbon fibre- Matrix interface bonding, (c) Remarkable enhancement in wear behaviour of carbon fibre reinforced Al composite compared to the base alloy and (d) Self lubricating (a) Uncoated and (b) electroless NiB-CeO coated tribolayer formed in between the mating surfaces. 2 A356 cylinder liners National Institute for Interdisciplinary Science & Technology 73 73 Annual Report 2018-19 356 Al alloy and Ni-B alloy coating. Potentiodynamic was also analyzed for comparison. The least corrosion polarization measurements show a remarkable current (4.46 µA/cm2) from Tafel plots was observed reduction in the corrosion current density for ceria for samples coated at pH 7.5 in comparison to that added nanocomposite coating (2.48×10−6 A cm−2) obtained through chemical conversion method (8.59 than that of the particle-free counterpart (11.18×10−6 µA/cm2). −2 A cm ). Uniform Ni-B-CeO2composite coating was Melamine formaldehyde–metal organic gel obtained on centrifugally cast A356 aluminium alloy interpenetrating polymer network derived cylinder liners which have potential applications in intrinsic Fe–N-doped porous graphitic carbon automotive systems. Fe and N doped carbon for catalyst application in fuel cells to improve the kinetics of oxygen reduction Sol-gel lanthanum phosphate coatings on reaction (ORR) was obtained by the pyrolysis of an magnesium (Mg) alloys for better corrosion resistance interpenetrating polymer network comprised of an organic thermosetting polymer enriched with N Lanthanum phosphate based sol-gel coating (melamine-formaldehyde (MF)) and a metalorganic was developed on AZ31 magnesium alloy. 0.1 M gel (Fe-MOG) network. During pyrolysis, the precursor concentrations of lanthanum nitrate [La(NO ) ] and 3 3 undergo restructuring to generate highly porous ammonium bi phosphate [NH H PO ] were used 4 2 4 graphitic sheets with firmly anchored Fe and N. The to prepare the lanthanum phosphate sol. Coatings introduction of porogen like naphthalene in the MF were made at different pH ranges (5.5, 6.5, 7.5 and polymer has been examined as a strategy to enhance 8.5). Typical SEM micrograph for sample coated at the surface area. Pyrolysis of this precursor resulted in pH 7.5 showed that substrate surface was completely the formation of porous carbon with enhanced surface covered with fiber like LaPO . EDS analysis confirmed 4 area of 950 m2/g with hetero porous architecture. This the presence of high percentage of La and P ensuring is due to the sublimation of dissolved naphthalene. the formation of LaPO during coating. Corrosion 4 The atomic percentage of Fe and N was estimated to performance of the developed coatings in 1 wt. % NaCl be 0.13 and 2.8 at% respectively. About 70 % of the was evaluated using electrochemical polarization. N was found to be in the form of graphitic N, with LaPO coating obtained through conversion coated 4 high catalytic activity. The catalyst exhibited an onset potential of 0.91 V vs RHE with four electron reduction pathway. A better durability was achieved even after 5000 cycles of operation. SEM, EDAX and Tafle curves of coated surfaces Potential (v)-current (i) curves for Fe-N doped porous graphitic carbon 74 National Institute for Interdisciplinary Science & Technology 74 Annual Report 2018-19 Multi-channeled ceramic membranes for micro/ (SEM) with energy dispersive X-Ray (EDAX) we got ultra filtration applications the elemental values in weight % and atomic % for Asymmetric ceramic membranes are deposited over Carbon, Oxygen, Titanium and Iron in the sample. support materials like alumina, zirconia, silica and The XRF results of Chavara ilmenite show that the titania which make them cost effective, durable and presence of major oxides of ilmenite as TiO2 of about resistant towards high temperature and chemical 59.53% which was followed by Fe2O3 (25.15%). The XRD attack. Initially alumina based multi-channelled analysis of ilmenite samples shows ilmenite as the porous support tubes are developed followed by major phase and other phases such as pseudobrookite membrane layer depositions by sol / slurry coatings of and pseudorutile. Finally, SEM of surface and sub- nanosized metal oxide sols. This method has serious surface sediments to describe the surface textures like, limitations such as reduced flux and high costs and mechanical and chemical pits, etch-Vs, grooves and there is a growing demand. so on has documented micro-morphology of ilmenite Lanthanum phosphate (LaPO4) has been shown to grains. The mineral exhibits sub-rounded shape along possess unique properties compared to commonly with 'V" marks of impact and solution reactions. Further, used ceramics and is inherently hydrophobic aiding the results were substantiated via EDAX analysis antifouling characteristics. Moreover, the nanorod where it shows the weight percentages of minor morphology plays a vital role in increasing the flux impurities like Al, Si along with major components of rate. CSIR-NIIST developed a single layer LaPO4 sol Ti and Fe. The results of EDAX –analysis shows reduced coating on alumina ceramic membranes that resulted ilmenite difficult to leachable TiO2 content of 59.13% in micro/ultrafiltration with enhanced flux values. (Ti-35.49% and O-24.03%). Whereas, the reduced Sugarcane juice clarification tests at IIT Guwahati ilmenite easy to Leachable shows 59.99 percentage indicated turbidity removal of 99.5 % .A pre-pilot (Ti-36.01% and O-24.21%). Fe content for the reduced plant is setup at HR Johnson, Mumbai under DST ilmenite difficult to leachable is 26.12% where as that (Department of Science and Technology) funding. The of reduced ilmenite easy to leachable is 24.42%. Other technology was realised in collaboration with CSIR- than major elements, leached ilmenite and reduced CGCRI, Kolkata. ilmenite shows the presence of impurities like Al of about 0.59% and 0.83%. Raw ilmenite shows Ti and Fe content of 36.38% and 24.51%. SEM–EDAX enabled advanced chemical and morphological analysis of ilmenite mineral will impact on the efficiency for determining their grade and potential applications. Multi-channelled ceramic membrane tubes (left) and sugarcane juice clarification through the developed membranes Investigation on mineralogical, geochemical and morphological characterization of raw material and intermediate samples of KMML Ilmenite from Chavara deposit was studied for SEM and XRD patterns of Ilmenite deposits from structure and geochemical studies using ED-XRF, XRD Chavara and SEM-EDAX. By using advanced characterization techniques such as scanning electron microscope National Institute for Interdisciplinary Science & Technology 75 75 Microbial Processes And Technology Division Expertise Microbial based processes and microbial biotechnology Scientist : 8 Technical staff : 1 Students : 42 Facilities Biofuel pilot plant, Solid-state fermentation pilot plant (Koji Room) Ongoing projects : 23 (Grant-in-aid, Sponsored, Consultancy and Technical Services, In-house) Publications (SCI+non SCI) : 24 Ph. D. awarded : 3 76 Annual Report 2018-19 माइक्र셋बियल प्रक्रा तथा ꥍ셌饍योगकी पभाग माइक्र셋बियल प्र啍क्र्봾 तथा प्र셌饍योगकी प्रभाग (एमपीटीडी) का जनादेश जैव प्र셌饍योगकी के विशिष्ट अगणी 啍ष配रोंमᴂ उच् गणु वत्ता वाले अनसु ंधान एवं विकास का संचालन करना है। पर्यावणीय स्थिता सनिशु 椿त करते हुए 啍ष配री जैव 셋तरों की खोज और मलू ्यवरन मᴂ महत्पर्ू जोर दिया जाता है । माइक्र셋बियल संसाधनरों की खोज और दोहन करके जैव प्र啍क्र्봾अरों और उत्पद विकास के कᴂ द्रित 啍ष配रों के अनसु ंधान मᴂ प्रभाग स啍क्र् 셂प से शामिल है । अनसु ंधान के वर्मान ध्봾न कᴂ द्रित 啍ष配रोंमᴂ शामिल हℂ i) औ饍योगक एजं ाइम और मलू ्यवर्त रसायनरों (ii) जैव ईधनं और बायोरिफाइनरी (iii) जैव स啍क्र् अण ु (iv) स्वस्थ और जीनोमिक् (v) पादप स啍ू षजीव इटं रैक्न और (vi) प्र셋बायोटिक और एल्ल न्絍य रस्ूटय कल् । दसू री पीढ़ बायोइथेनॉल पर विशेष अनसु ंधान एवं विकास के लिए प्रभाग मᴂ एक समर्पत "जैव ईधनं कᴂद्र"है। लि ग्नसेल्लय ोसिक बायोइथेनॉल के उत्पदन का पायलट संयंत, अब ओन-साइट ठोस-अवस्थ किण्न एजं ाइम उत्पदन पायलट संयंत से समर्थत है, जो लागत प्रभावकता और हℂडलिंग के लिए बेहतर अवसर प्रदान करता है। प्रभाग के आर एडं डी मᴂ विभिन् माइक्र셋बियल ि봾्셋प्र셋सेस के विकास शामिल हℂ और किण्न प्र셌饍योगकी पर तथा प्र셋बायोटीक, जैव-कीटनाशकरों और जैव उर㔵रक आदि के लिए माइक्र셋बियल फॉरलेशनम् पर काम करने के लिए मजबतू उ饍यग संबंध भी है । हाइलाइट्स 2800 आईय ू / जीडीएस की उपज के साथ सब्絍रट के 셂प मᴂ चिकन पंख और गेहू ं के चोकर का उपयोग करते हुए 絍र स्त पर प्रदर्शत के रातिनसे उत्पदन के लिए प्र啍क्र्봾। कोडन अनकु ू लित के रातिनसे जीन को पिचिया पास्टरिस मᴂ सफलतापरू 㔵क क्लन किया गया। मेटाबॉलिक 셂प से इजीं नियर कोरिनेबैक्टरियम ग्टल ामिकम उपभेदरों को सफलतापरू 㔵क α,-अमीनो एसिड (गाबा (गामा-अमीनोब्ूटय क एसिड) और 5- अमिनोवालेरते (δ- अमिनोपंतानोट) और चीनी एसिड, डी- क्सलोनिक एसिड के उत्पदन के संबंध मᴂ बनाया गया था। सिंथेटिक से उनके उत्पदन के साथ-साथ बायोमास हाइ蕍셋लाइजेट मीडिया के संबंध मᴂ अवधारणा का प्रदर्न किया गया है। लैक्टोैसिलस प्लाटारम 饍वार एक्सपॉलीसेके राइड उत्पदन के लिए सस्टनेबल कार्न 셋त के 셂प मᴂ कसावा स्टार हाइ蕍셋लाइजेट के उपयोग को प्रदर्शत किया गया दो औ饍योगक परियोजनाए ं श셂ु की गई:ं (1) डेयरी उत्पदरों मᴂ उपयोग के लिए स्देशी स्टार् कल्च कं सोर्टिय (2) गिबेरेलिक एसिड (जीए 3) के विकास के लिए ि봾्셋प्र셋सेस एन्टेरोेक्ट एसपी से 2,3-ब्टेय नियोल के उत्पदन के लिए ि봾्셋प्र셋सेस को लैब स्क ल के तहत अनकु ू लित किया गया था 5- हय蕍셋क्समेथील फु रफु रालडीहैड से 2,5-फु रिंडिकार्क्सिक एसिड का उत्पदन के लिए एक जैविक प्र啍क्र्봾 । स啍ू षजीिरों का उपयोग करके कार्कु शलता 67% 셂पांतरण के साथ विकसित किया गया था । उपन्봾स जीनस पोक्कली बैक्टरिया से संबंधित एक संभावित नॉवेल प्लाट रहिजोबैक्टरिया स絍रन को पोकली चावल से पहली बार पहचाना गया और लवणता के तनाव को कम करने के लिए दिखाया गया। माइक्र셋एल्ग 饍वार तेल संचय मᴂ तनाव की भमिू का पर शोध ने अवलोकन किया कि तनाव से जड़ु पौधरों के हार륋न के साथ उपचार तनाव तं配रों और अतं र्जत विकास हार륋न के मॉड्यलेशनू 饍वार (एम य ू एफ ए) और पी य ू एफ ए उत्पदन को बढ़ता है सेलेनोप셋प्र셋टीन जीन की पहचान माइक्र셋एल्ग स्क नडेसमस क्वाडकोडा (सी ए एस ए) सी सी 202 उपयोग किए जाने वाले कु किं ग ऑयल का उपयोग करके पॉलीहाइ蕍셋क्स ब्टीय रेट का उत्पदन प्रयोगशाला पैमाने पर प्रदर्न किया गया था, जिसमᴂ 3.8g / L उत्पदन होती है। 2 जी इथेनॉल पर पैन सी एस आई आर कार्क्रम के साथ 9 सी एस आई आर प्रयोगशालाओ ंकी भागीदारी NIIST 饍वार समन्वत किया गया था। 2G इथेनॉल उत्पदन की लागत को कम करने (<셁पये 100 / एल) के ल啍ष के साथ श셂ु किया गया है। एकीकृ त प्र啍क्र्봾 योजना को डिज़इन किया गया है और सभी यनिू ट संचालन के लिए महत्पर्ू प्र啍क्र्봾ओ ंऔर रणनी啍त्रों की लागत किया गया है। National Institute for Interdisciplinary Science & Technology 77 77 Annual Report 2018-19 The mandate of the Microbial processes and Technology Division (MPTD) division is to conduct high quality R & D in specific frontier areas of Biotechnology. Significant emphasis is put in exploration and value addition of regional bioresources while ensuring environmental sustainability. The division is actively involved in research in the focussed areas for bioprocesses and products development by exploring and exploiting the microbial resources. The current focus of research are in the areas of i) Industrial enzymes and value added chemicals ii) Biofuels and biorefinary (iii) bioactive molecules iv) Health and genomics (v) plant microbe interactions and (vi) probiotic and algal nutraceuticals. The Division has a dedicated “Centre for Biofuels” for exclusive R&D on 2nd generation bioethanol. The pilot plant for the production of lignocellulosic bioethanol is now supported by on-site solid-state fermentation enzymes production pilot plant, bringing better cost-effective and handling opportunities. The Division is involved in R & D on developing different microbial bioprocess and has strong industry linkages to work on fermentation technology, microbial formulation for probiotic, biopesticides and biofertilizers etc. Highlights Process for keratinase production demonstrated at tray level using chicken feather and wheat bran as substrates with a yield of 2800 IU/gDS. Codon optimized keratinase gene successfully cloned in Pichia pastoris. Metabolically engineered Corynebacterium glutamicum strains were successfully made with respect to the production of α, ω-amino acids (GABA (gamma-aminobutyric acid) and 5-aminovalerate (δ-Aminopentanoate) and the sugar acid, D- xylonic acid. The proof of concept with respect to their production from synthetic as well as biomass hydrolysate media is demonstrated. Demonstrated the use of Cassava Starch Hydrolysate as Sustainable Carbon Source for Exopolysaccharide Production by Lactobacillus plantarum Two Industrial projects were initiated: (1) the development of a bioprocess for Gibberellic acid (GA3) and (ii) the development of indigenous starter culture consortia for using in dairy products A bioprocess for the production of 2,3-butanediol from Enterobacter sp. was optimized under lab scale A biological process for the production of 2,5-Furandicarboxylic acid (FDCA) from 5-hydroxymethylfurfuraldehyde (HMF) using microorganisms was developed with 67% conversion efficiency. A potential novel plant associated rhizobacteria strain belonging to the novel genus Pokkalii bacter were identified for the first time from Pokkali rice and shown to provide salinity stress alleviation. Research on the role of stress in oil accumulation by microalgae led to the observation that treatment with stress associated plant hormones significantly increases MUFA and PUFA production by modulation of stress mechanisms and endogenous growth hormone Selenoprotein gene identified from microalga Scenedesmus quadricauda CASA CC202 Polyhydroxy butyrate production using used cooking oil was demonstrated at lab scale with a yield of 3.8g/L PANCSIR program on 2G ethanol with participation from 9 CSIR labs and coordinated by NIIST was kick started with a target of reducing the cost of 2G ethanol production to < Rs 100/L. Integrated process scheme is designed and costs worked out for all unit operations. Critical processes and strategies to reduce cost was derived. 78 National Institute for Interdisciplinary Science & Technology 78 Annual Report 2018-19 Brief report of the R &D activities the available surface area of keratin has increased. Bioprocesses and Products Different ratios of feather (in % wt/wt) – 10, 25, 35, 40, 50, 60 and 70% to wheat bran were tried and lower Industrial Enzymes feather concentration yielded high activity, close to Production of keratinase enzyme using Streptomyces 3000 IU/gDS. Feather may be required only to act as albidoflavus. an inducer for keratinase production and starch in WB The actinomycete – Streptomyces albidoflavus, may act as a carbon source. A plate assay for starch producing keratinase could yield upto 3000 IU/gDS utilization by the organism confirmed presence of under solid state fermentation in flask scale studies. good amylase activity For scale up purposes the substrate was changed to chicken feather from a poultry process factory, which was used in milled form. The original moisture content optimized for the trials were 90 % with the un-milled feather. Under tray fermentation in 50g capacity trays, 90% moisture resulted in a slurry and yield was reduced to 629 IU/gDS. Optimization of the moisture content resulted in improved yield upto 1481 IU/gDS at 75% moisture Amylase production by S.albidoflavus A) Optimization of feather to wheat bran ratio B) Amylase production by S.albidoflavus Highest keratinase activity obtained was 2888 IU/gDS at the lowest F: WB ratio of 10:90. This was close to the enzyme activity obtained under optimized conditions Slurry formation at 90% moisture of Phase I in flasks. Further optimization of parameters PhI – Phase I optimized conditions is expected to yield still higher activities. Ph II F- Phase II (milled feather) in flasks Ph II T- Phase II (milled feather) in trays Cloning of the keratinase gene in Pichia pastoris Keratinase production using chicken feather medium system A) Comparison of keratinase production in flasks vs trays The gene for keratinase (Salb-S13A5_ker) from S.albido B) Slurry formation at higher moisture content flavus which was cloned earlier in E coli had a lower Since the particle size of feather has reduced expression. It was therefore decided to express the considerably, it was speculated that a high feather gene from the yeast system –Pichia pastoris. The gene to wheat bran ratio (F:WB) may not be necessary as sequence was codon optimized for yeast expression National Institute for Interdisciplinary Science & Technology 79 79 Annual Report 2018-19 and was synthesized by outsourcing to “GeneScript”. process parameters affecting enzyme production were The codon optimized gene which was obtained as an optimized through statistical design of experiments. insert in pUC57 was amplified using the primer pair A maximum lipase titer of 220 U/mL was obtained SA_CO_F (5' AAGAATTCTCTGAACCCCAGTCAG 3') - after 24h of incubation in shake flask cultures with SA_CO_R (5' AAGGTACCTTATCCTATCTCTACGCC 3') an inoculum concentration of 0.6 % v/v, incubation to give a 1000 bp long product. The gene was cloned temperature of 30 °C and medium pH 9.0. Castor into pTZ57R/T (Eco R1/Kpn1), Transformed DH5α and oil (0.5% v/v) was used as the inducer for lipase Confirmed by colony PCR production. The enzyme was found to be compatible with five different commercial detergents indicating its potential to be used in detergent formulations. It also acted as a biocatalyst in a transesterification process which has many industrial applications. The pTZ57R/T vector containing insert was cut using Eco R1 and Kpn1 to release the gene and it was cloned into linearized pPICZα vector cut with the same enzymes. Ligated and transformed into E coli TOP10F and plated on low salt LB zeozin plates. Insert was confirmed by colony PCR. The plasmid was isolated and linearized using SacI and the linearized vector was Lipase production by Pseudomonas guariconesis transformed into Pichia pastoris strains GS115, KM71H under the effect of substrate (castor oil) concentration and X33. Colony PCR of transformed colonies of Pichia pastoris, performed using 5’AOX forward primer and Biopolymers and Biosurfactants gene-specific reverse primer confirmed that one clone (KG3) in the GS115 strain carried the gene. Response Surface Modelling and Optimization of Culture Media in Fermentative Production of 2,3-butanediol 2,3-Butanediol is a promising platform chemical with extensive industrial applications. The present study aims to develop a microbial fermentation approach for the production of 2,3-Butanediol. A wild strain of bacteria, Enterobacter cloacae SG1, was studied its capacity to ferment glucose to 2,3- butanediol. Batch fermentation parameters were optimized and media engineering was performed using statistical approach by response surface methodology for increasing the yield of 2,3-Butanediol. At the optimized condition, Cloning of codon optimized keratinase gene in P.pastoris 25.86 g/L 2,3-butanediol was obtained from Box- Microbial Lipase Behnken design with 0.36g BDO/g of glucose. The A newly isolated culture, Pseudomonas guariconesis, is optimization resulted in almost two times increase in reported for the first time for lipase production. Various the production of 2,3-Butanediol. 80 National Institute for Interdisciplinary Science & Technology 80 Annual Report 2018-19 Development of a sustainable process for the Microbial Metabolites production of poly-3-hydroxybutyrate using Whole cell based biocatalytic production of 2,5 kitchen and food waste furan dicarboxylic acid (FDCA) Study was conducted to develop a process for Study was performed to develop an eco- conversion of food and kitchen waste to an eco-friendly friendly biological process for the production biopolymer, thereby addressing two societal issues- of 2,5-Furandicarboxylic acid (FDCA) from waste management and bioconversion of waste to an 5-hydroxymethylfurfuraldehyde (HMF) using eco-friendly biopolymer. Twenty positive isolates were microorganisms. Microorganisms were isolated obtained after primary screening with Nile red. Upon from the soil samples and evaluated for its secondary screening the strain FH which is a Bacillus biotransformation efficiency. Among the isolates, species showed highest poly-3-hydroxybutyrate Aspergillus flavus APLS-1 was found to be potent for production. Media engineering was carried out by efficient conversion of HMF to FDCA. The bioconversion adopting Plackett-Burman and Box-Behnken design parameters were optimized by Box-Behnken design. experiments using waste cooking oil as sole carbon The optimization resulted 67% conversion efficiency source. Maximum PHB production (3.8 g/L) was where 1g/L HMF (8 mM) was transformed to 0.83 g/L observed with ammonium sulphate concentration (6.6 mM) FDCA in 14 days at pH 6.5 with biomass of 0.5%, yeast extract concentration of 0.2% and size of 5.7 g/L and biomass age 60 hr. This is a first inoculum concentration of 7.5%. report on Aspergillus sp., capable of detoxifying HMF The extracted polymer was characterized by FTIR, and produce FDCA. No DFF peaks were observed in 1H NMR and 13C NMR. Standard (PHB from Sigma the HPLC profile after biotransformation by A.flavus Aldrich) and the extracted polymer gave similar APLS-1. The intermediate compound analysis showed profiles, indicating that the extracted polymer is PHB. that there is a rapid conversion of HMF to HMF acid and further conversion of HFCA to FFCA and FDCA is getting delayed. It might be due to the absence of channel proteins or by the limitation of oxygen uptake for the sequential oxidation. Positive isolates showing orange red fluorescence after Nile red staining HPLC chromatogram analysis of intermediates in the bioconversion Contour plots showing interactions of various process parameters of HMF to FDCA by A. flavus APLS-1 (A) Standards of HMF alcohol, affecting PHB production by Bacillus sp. using waste cooking oil as HMF,HMF acid, DFF, FFCA, FDCA and 2-furoic acid; sole carbon source (B) Production of FDCA using optimized condition National Institute for Interdisciplinary Science & Technology 81 81 Annual Report 2018-19 Probiotics and Nutraceuticals algae based high value metabolite accumulation Cassava starch hydrolysate as sustainable carbon economically feasible. Methyl Jasmonate and Salicylic source for exopolysaccharide(EPS)production by acid were used to induce primary lipid accumulation Lactobacillus plantarum and high value metabolite accumulation in N.oceanica Cassava starch hydrolysate (CSH) proved to be CASA CC201 without compromising the growth a potential alternative for EPS production by L. characteristics. Exogenous application of MeJA plantarum. Enzymatic hydrolysis of 9 % (w/v) cassava promoted 1.4-fold increment of micro algal growth starch resulted in nearly 85 % conversion of it to compared to control. Treatment with 10ppm SA the sugars which can be directly assimilated by the induced significantly higher lipid production of bacterium. Culture medium (pH 7.3) having cassava 475mg/L (2.2 fold). Total carbohydrate, protein and sugar (40g/L), yeast extract (40g/L) and ammonium pigment production was also found to be increased sulphate (5.5g/L) along with tween 80 (4g/L), calcium in a hormone specific and concentration dependent chloride (10mM) and hydrogen peroxide (3mM) found manner. Interestingly treatment with higher doses to be very effective for EPS production. After the double of MeJA promoted Monounsaturated fatty acid step ethanol precipitation, a maximum titer of 6.5±0.5 production, particularly oleic acid (C18:1) at early g/L crude EPS was obtained in static flask cultures stationary growth phase, while treatment with SA incubated at 370C with 2% v/v inoculum and it was induces essential omega 3 fatty acid production (EPA, 4.4±0.5 g/L with the control medium having lactose as C20:5). This significant modification of fatty acid carbon source. Thermal stability and molecular weight compositions was correlated with the oxidative stress were remained unchanged irrespective of the carbon in terms of total Reactive oxygen species production source used. and endogenous IAA levels. Collectively, the results indicated that treatment with stress associated plant hormones significantly increased high value metabolite accumulation specifically MUFA and PUFA production by modulation stress mechanisms and endogenous growth hormone levels . Fig.8: Effect of cassava sugar concentration on EPS Production Mechanistic insights of stress hormones mediated lipid accumulation and modulation of specific fatty acids in Nannochloropsis oceanica CASA CC201: Nannochloropsis species are oleaginous marine microalgae, considered as potential feedstock for nutraceutical and pharmaceutical applications. It is Effect of MeJA and SA on lipid accumulation and modulation of specific class of fatty acids in N. oceanica CASA CC201. necessary to overcome several drawbacks for making 82 National Institute for Interdisciplinary Science & Technology 82 Annual Report 2018-19 Identification of selenoproteins gene from that, after an 8 hr of ER stress induction, there was a microalga Scenedesmus quadricauda CASA 1.2±0.2769 fold increase in its mRNA level as compared CC202: to control. Selenoproteins are a class protein in which an unusual amino acid selenocysteine (Sec) is incorporated into it by TGA codon (normally act as stop codon) using specific cellular machinery. Most of these A selenoproteins are associated with redox balancing of the cell. They are present in all domains of life except plants and fungi. Surprisingly, some of the micro algal species belong to plant kingdom do have the system to synthesize these unique proteins. We found that the microalga Scenedesmus quadricauda possess all the machinery to synthesize the selenoproteins and also identified selenoprotein T (SelT) from S. quadricauda by B its whole genome sequencing and analysis. SelT gene was amplified from S. quadricauda by Polymerase Chain reaction (PCR) and sequenced for further confirmation. A. RNA isolated from S.quadricauda treated with DTT (ER stress (a) inducer) and without DTT (control, C).B showing fold change in the SelT transcript under ER stress. Plant Microbe Interaction PGPR tools for improving crop productivity in stressed agricultural systems: Phyto-beneficial properties of the novel isolates. All three strains L1E11T, L1E4 and 228 were able to grow (b) on minimal salts medium with ACC as sole nitrogen source and exhibited ACCd activities in the range from 1.87±0.27 to 2.88±0.71 µmol of α-ketobutyrate/h/ mg of protein. Further, we identified the presence of a putative acds gene (1008bp) encoding ACCd in the draft genomes of L1E11T and 228. This result was further confirmed by polymerase chain reaction (PCR) amplification of the acds gene using specific primer pair F1ACC/R1ACC. These results clearly suggest an active Confirmation of the gene for selenoprotein T (SelT) from S. quadricauda PCR for seleopporotein gene confirmation, B) ACCd gene functioning in the novel strains. Following BLAST Analysis this, an investigation of the phytostimulatory effects Identification of SelT transcript level from of the novel strains on pokkali rice variety (VTL-6) was Scenedesmus quadricauda checked. Initial treatment of VTL-6 seeds with strains T The transcript level analysis of SelT in S.quadricauda by L1E11 , L1E4 and 228 (OD600=1.0) respectively, did not inducing Endoplasmic reticulum (ER) stress revealed have any negative effect on the seed germination National Institute for Interdisciplinary Science & Technology 83 83 Annual Report 2018-19 similar as they shared 99.9-100% 16S rRNA sequence similarities among each other. 16S rRNA gene sequence comparisons with reference bacteria with validly published names available in GenBank and the Eztaxon e-database indicated that strains L1E11T, L1E4, and 228 belong to the order Oceanospirillales within the class Gammaproteobacteria and were most closely related to Balneatrix alpica 4-87T with only 92.1% 16S rRNA sequence similarity. The strains shared 16S rRNA gene sequence similarities lower than 91.50% with representative members of the orders Oceanospirillales and Alteromonadales other than the genus Balneatrix. In the 16S rRNA maximum likelihood tree, the strains L1E11T, L1E4 and 228 formed a distinct monophyletic clade with 100% bootstrap support, which was well separated from its nearest phylogenetic neighbour, B. Positive growth effect of L1E11T on VTL-6 rice plants after 14 days alpica 4-87T and also from other described members of post inoculation (a). Respective graph shows the differences in root length and fresh weight of the L1E11T inoculated and uninoculated the order Oceanospirillales. plants after 14 days post inoculation (b). L1E11T inoculated VTL-6 rice plants survives longer (a) compared to uninoculated control Apart from being phylogenetically distinct, the novel plants (b) under 200mM NaCl stress. strains L1E11T, L1E4 and 228 can be differentiated from indicating that they may not be seed pathogens. their nearest phylogenetic neighbour, B. alpica 4-87T in Interestingly, we observed an increased root length many phenotypic and biochemical properties as listed and fresh weight in L1E11T treated seeds as compared to in Table 1. The major whole cell fatty acids detected non-treated pokkali seeds after 14 days of incubation. in strains L1E11T, L1E4 and 228 were C16:1 ω6c/ C16:1 Similar results were obtained in repeat experiments ω7c, C16:0 and C18:1 ω6c /C18:1 ω7c which is in line (data not shown), indicating that L1E11T able to with most members of the order Oceanospirillales. promote rice growth. Furthermore, we found that The comparison of the fatty acid contents under both L1E11T treated rice plants were able to resist 200mM conditions showed that the novel strains contained NaCl stress better as compared to the uninoculated higher amounts of C12:0 3-OH (4.5-10.0%) than control plants. All these data clearly suggest that the type strain of B. alpica (2.2%). Further, the novel L1E11T can mediate growth and protect its host plant strains were well differentiated from B. alpica DSM from saline stress by modulating the stress ethylene 16621T based on the presence of C12:0 and absence levels as like other ACCd producing plant beneficial of significant amounts of C10:0 3-OH (Table 1). Thus, rhizobacteria functions. However, further detailed the whole cell fatty acids profile of the novel strains experiments are required to prove this conclusion. and its closest phylogenetic neighbour B. alpica DSM 16621T appeared to be significantly different (Table 2). Proposal of Pokkaliibacter plantistimulans The type strain L1E11T contained ubiquinone Q-8 gen. nov. sp. nov., by a polyphasic taxonomic as major respiratory quinone and an unknown approach. phospholipid (PL), phosphatidylethanolamine (PE), The almost complete 16S rRNA gene sequences (>1400 and phosphatidylglycerol (PG) as major polar lipids bp) of the three novel strains L1E11T, L1E4 and 228 were which are in agreement with chemotaxonomic data determined. The strains were phylogenetically very reported for the order Oceanospirillales. 84 National Institute for Interdisciplinary Science & Technology 84 Annual Report 2018-19 Maximum Likelihood phylogenetic tree based on of 16S rRNA gene sequences of L1E11T, L1E4, 228 and the members of the order Oceanospirillales. Bootstrap values greater than 70% are shown at nodes. Scale bar indicates nucleotide substitution per site. National Institute for Interdisciplinary Science & Technology 85 85 Annual Report 2018-19 B. alpica Genome Based differences and AAI/ANI values Characters L1E11T L1E4 228 DSM 16621T T Human Pathogen - - - +a The estimated genome size of L1E11 and 228 was ACC larger as compared to its nearest phylogenetic relative, deaminase + + + nd T T production B. alpica DSM 16621 . In addition, the genomes of L1E11 Growth at and 228 contained higher numbers of transposases, 42°C + + - + mobile elements and CRISPR associated proteins as 46°C - - - + compared to B. alpica DSM 16621T. All these data suggest Growth in that genome plasticity correlates with environmental 6% NaCl + + + - 7% NaCl - - + - complexity. In support of this view, a comparison of the API 20NE results three genomes using BRIGS software was performed, Nitrate reduction - - - + keeping L1E11T as the reference genome. This analysis Indole production - - - + clearly showed that the genomes of two novel strains Assimilation of T L-Arabinose + + + - L1E11 and 228 were highly similar. In contrast, no Caprate + + + - highly conserved regions were observed between the D-Maltose + - - + genomes of B. alpica DSM 16621T and L1E11T and 228, Phenyl acetate + + + - with similarities of 70% or less obtained between B. Utilisation of T Rhamnose - - + nd alpica DSM 16621 and the reference genome. Further, Xylose + + + - we identified several unique regions in the genomes T Table 1. Useful phenotypic characters which differentiates of L1E11 and 228 that are absent in the genome of strain L1E11T, L1E4 and 228 from their nearest phylogenetic B. alpica DSM 16621T. Interestingly, these identified neighbour B. alpica DSM 16621T. Symbols; +, positive; -, negative; nd, not determined; a, causes pneumonia and unique regions encode gene functions that attribute meningitis plant-associated lifestyle. Thus, these genome results clearly differentiated the two novel genomes from 228 B. alpica L1E11T L1E4 DSM 16621T the genome of its closest phylogenetic neighbour; B. Tryptic Marine Tryptic Marine Tryptic Marine Marine soy alpica. Furthermore, the genome contents which may agar soy agar agar soy agar agar agar agar be due to their specific adaptations to the habitats Saturated from which they were isolated. C12:0 3.3 2.6 3.4 3.0 2.9 - - C16:0 31.7 28.3 33.6 30.1 26.4 20.6 18.3 Hydroxy C10:0 3-OH - - - - - 3.4 3.1 C12:1 3-OH 1.1 - 1.2 - - - - C12:0 3-OH 9.0 7.3 10.0 7.8 4.5 2.2 2.2 Cyclo C17:0 cyclo 2.6 - 2.3 - - - - Feature 3* 27.4 32.6 22.1 29.1 36.0 45.1 49.2 Feature 8* 22.8 26.1 24.6 27.3 27.9 27.6 26.3 Table 2. Whole cell fatty acid composition of strains L1E11T, L1E4, 228 and B. alpica DSM 16621T. All data obtained in this study. Only fatty acid percentages amounting 1% or higher are shown. Summed features represent groups of two fatty acids which could not be separated by GLC and MIDI system. Cells were grown in both marine agar and tryptic soy agar for 2 days at 28oC. *Summed Feature 3, C ω7c/C ω6c/ C Genome comparison of L1E11T, 228 and B. alpica DSM 16621T with 16:1 16:1 16:1 regard to gene functions related to plant-associated lifestyle ω6c/C16:1 ω7c; Summed Feature 8, C18:1 ω7c/ C18:1 ω6c. 86 National Institute for Interdisciplinary Science & Technology 86 Annual Report 2018-19 Finally, the ANI values between the two novel Engineering of cellulase-producing Penicillium genomes (L1E11T and 228) and B. alpica DSM 16621T sp. for quality enhancement and hyper-secretion was in the range of 76.4-76.6%. These values are of biomass hydrolyzing enzymes well below the proposed cut-off of 94% for species Penicillium janthinellum is a cellulase hyper-producer delineation. Together, these genomic data clearly and produces a higher titer of cellulase in comparison support the distinct taxonomic status of the novel to the commercially used hyper producing fungus strains higher than the species level rank within the Trichoderma reesei RUT C30. A comparison of the order Oceanospirillales. cellulose hydrolysis by these fungi shows higher In summary, on the basis of phylogenetic divergence, glucose release from pretreated rice straw by P low 16S rRNA similarity values, chemotaxonomic, janthinellum enzyme. phenotypic and genomic data, strains L1E11T, L1E4 and 228 can be considered to represent a novel species of a novel genus, for which the name Pokkaliibacter plantistimulans gen. nov. sp. nov., is proposed, with strain L1E11T (=DSM 28732T =MCC 2992T) as the type strain Genomics Proteomics and Molecular Biology of industrial Microorganisms Cloning and overexpression of the Hypothetical protein NCgl 2838 of Corynebacterium glutamicum ATCC 13032 The hypothetical protein NCgl 2838 [Corynebacterium glutamicum ATCC 13032] for Sortase (Cg-Srt (GeneBank No. NP_602126) residues 45-274) was cloned into the NdeI-SalI restriction sites of the pET28a vector. Comparison of glucose release during hydrolysis reactions using cellulase enzymes from P.janthinellum and T.reesei The protein was successfully expressed as soluble from A) Acid pretreated and B) Alkali pretreated rice straw functional protein in BL21 (DE) 3 E. coli cells and was purified and the His tagged protein is confirmed by Total cellulase activity, endoglucanase activity and appropriate Western blot. The purified protein showed beta glucosidase (BGL) activity of P.janthinellum was sortase like hydrolytic activity towards sub E1-LAETG, also higher than T .reesei indicating its huge potential sub E2-LAXTG an in vitro HPLC assay. as a source of biomass hydrolyzing activity. 37kDa 25kDa Purified Protein Lane M: 10-250kDa protein marker Lane 1: 20 µg of purified protein Lane 2: 40 µg of purified protein Purified hypothetical protein NCgl 2838 of Corynebacterium glutamicum ATCC 13032 showing Sortase like hydrolytic activity National Institute for Interdisciplinary Science & Technology 87 87 Annual Report 2018-19 help in deciphering the gene regulation in this fungus. A total of 22023 genes were expressed under these conditions of which 1167 genes were differentially expressed (Log FC>2 and FDR <0.05). Comparison of P.janthinellum and T.reesei for a. total cellulase Gene expression pattern in control (glucose) and test activity, b. beta glucosidase activity and c. endoglucanase (cellulose) conditions. The Venn diagram shows the no. activity during growth in basic Mandel and Weber medium of transcripts in each condition with cellulose as sole carbon source It was also observed that blending in of a glucose Of these 815 genes were upregulated and 352 genes tolerant BGL from Aspergillus unguis to the were down regulated. Three of the cellobiohydrolase P. janthinellum cellulase can enhance its biomass genes, 7 endoglucanase genes and 4 BGL genes were hydrolyzing potential to a significant level. Since the highly upregulated under induction conditions. A organism exhibits high cellulase production and since total of 39 transcription factors were differentially practically nothing is known about its gene regulation, expressed. Three xylanase genes and one LPMO gene the genome of the organism was sequenced by whole was also highly upregulated. Besides these, the known genome shot gun sequencing by NGS (Genbank orthologs of fungal cellulase regulators – ClrB, Cre I, Accession No. NPFE00000000). Major cellulase genes XlnR were upregulated and Ace1 was downregulated identified from the genome is provided below. hinting a transcriptional control of cellulase production by the fungus. Biofuels and Biorefineries PANCSIR-2G Ethanol (PANCSIR-2GE) Program India strongly supports renewable transportation fuels and the new biofuel policy mandates ethanol blending in gasoline. The country urgently needs 2G ethanol (2GE) technologies that are cost competitive, but the existing bioethanol technologies in the country are limited in number and largely dependent on imported consumables (eg. enzymes) with very Summary of cellulase genes identified and annotated from the less transparency on the cost of production. CSIR genome of P. janthinellum NCIM 1171 represented by its constituent laboratories has been working on lignocellulosic biomass conversion to Transcriptome analyses of the organism was performed ethanol (2G Ethanol/Bioethanol) for past several for fungus grown in inducing (cellulose as carbon years. However, we have not been able to bring out a source) and uninduced (glucose as carbon source) cost effective technology for 2G ethanol production conditions to study the differentially expressed genes that may be considered ready for commercialization. and genes co-regulated with cellulases, which might While some labs have processes covering the entire 88 National Institute for Interdisciplinary Science & Technology 88 Annual Report 2018-19 unit operations from biomass conversion to ethanol- The project has identified the major cost contributors distillation and dehydration; some labs have developed as hydrolysis and pretreatment steps. Reduction in processes/technologies for particular unit operation(s). hydrolysis cost can be attained to some extent by Individually these operations may be as good as, or lowering enzyme production costs. Attaining credits even superior to their counterparts employed in the for by products is identified as a must to reduce costs currently demonstrated global technologies. A new to the targeted level. Zero liquid discharge process for PAN CSIR FTT project on 2G ethanol has been launched waste water management for biorefinery is a unique where CSIR-NIIST is the coordinating lab. 8 other labs CSIR 2GE USP which none of the existing technology – CSIR-IIP, IICT, NCL, CFTRI, NEERI, CSMCRI and CGCRI providers in India is offering. The ZLD process is are involved in the project. End to end process scheme estimated to be net energy positive and can also provide for conversion of rice straw to ethanol was derived as credits to the 2GE process through biogas, fertilizers represented in Figure 20. The target of the project is to etc. Enzyme cocktail for biomass hydrolysis, being achieve an operation cost of Cost contributions of individual unit operations in bioethanol production National Institute for Interdisciplinary Science & Technology 89 89 Annual Report 2018-19 also evaluated for its reactivity towards formaldehyde Organosolv lignin seems to be a better candidate for for the phenol-formaldehyde resin. the replacement of phenol in phenol formaldehyde resin owing to the high content of sinapyl group whose Isolation of lignin by alkali yielded better recovery ortho position are free to react with formaldehyde to compared to other two methods. However, organosolv form phenol formaldehyde resin as adhesives lignin was purer as per XPS and NMR analysis. Table-1 Comparison of physical properties of lignin Lignin GPC Mol. IR Total Phenolic and aliphatic 2D-NMR % lignin on surface by Wt (g/mol) OH In mmol/g XPS Alkali 1292 G-S-H lignin (1327,833) Conjugated: 0.637 β-O4, G,S & H type 94 lignin 1120(C-H S unit) Unconjugated: 2.09 lignin Total : 2.68 G>S Dioxane 3153 G-S-H lignin type Conjugated: 0.50 β-O4, G,S & H type 86 lignin (1327,833) Unconjugated: 0.62 lignin C-H S unit (1116) Total : 1.12 G>H>S Organosolv 4230 G-S-H lignin (1327,833) Conjugated: 0.944 β-O4, β-5, G,S & H type 98 lignin C-H S unit (1100) Unconjugated: 1.180 lignin Total : 2.122 S>G>H Standard 1692 G-S lignin type Conjugated: 0.499 β-O4, β-5, G,S type lignin 88 Kraft 1118 (S lignin) Unconjugated: 3.05 G>S lignin 1029,1325(G lignin) Total : 3.556 Use of metabolically engineered Corynebacterium plastic and polymer synthesis. The α,ω- diamines and glutamicum as the cell factory for the production amino acids serves as potential C5 building blocks of of value added products from lignocellulosic the valuable polyamides like nylon. Initiated a research derived sugars programs looking at the construction of recombinant C. glutamicum is able to co-utilize mixed carbon Corynebacterium glutamicum strains for the production sources, making it a preferential host for utilization of above said chemicals. C. glutamicum strains were of complex carbon sources such as second generation successfully made with respect to the production of- biomass (plant biomass that does not have any value as amino acids (GABA (gamma-aminobutyric acid) and food and no or less value as fodder) for the production 5-aminovalerate (δ-Aminopentanoate)) and the sugar of commodity chemicals. Xylonic acid is a promising acid, D- xylonic acid. The proof of concept with respect organic acid with important application as a green to their production in synthetic media is demonstrated. solvent and effective biocatalyst and precursor for bio 40 1.8 35 1.6 30 1.4 1.2 25 1 20 0.8 15 Conc : g/L 0.6 OD @ 600 nm 600 @ OD 10 0.4 5 0.2 0 0 0 20 40 60 80 100 120 140 Time (h) 0.5 % Glucose 3.5 % Xylose Xylonic acid production OD @ 600 nm Utilization of Xylose and corresponding D-xylonic acid Production of 5-Amino valerate (AMV) by genetically modified. production by recombinant C. glutamicum strain containing C.glutamicum strain with respect to glucose percentage in CGXII xylose dehydrogranse gene (xylB) of Caulobacter crescentus medium In CGXII medium 90 National Institute for Interdisciplinary Science & Technology 90 Annual Report 2018-19 RESEARCH PLANNING AND BUSINESS DEVELOPMENT CONTRACT RESEARCH PROJECTS 2018-19 Project Title Project Leader Sponsoring Agency Agro Processing & Technology Division Bio processing of two coded anti-diabetic medicinal plants based on ethnomedical leads- A molecular Dr P Jayamurthy DBT pharmacological approach Bis Indolyl methane conjugates of Biaryls: Role in apoptosis, cell cycle regulation and PI3K/AKT/mTOR Dr S Priya KSCSTE signalling pathway in Human breast and cervical cancer cells Can enrichment of Palm Neera Syrup cause Dr M V Reshma KSCSTE immunomodulation Development of biflavonoid based lead molecule (NIIST Dept. of Health Research, -OBT-2) from Garcinia travancorica for non-alcoholic fatty Dr G Sindhu New Delhi liver disease Development of novel leads for anti-obesity from North East traditional system through chemistry biology Dr K G Raghu DBT interphase Dissect the function of fundamental cilia-genes Dr Shobi Veleri DBT associated with ciliopathies in patients Enhancement of the stability & acceptability for newly M/s Pankajakasturi Herb- Mr V V Venugopal developed products als India Ltd, TVM Evaluation of beneficial effect of Boeravinone-B from Boerhaavia diffusa against diabetic cardiomyopathy Dept. of Health Research, through mitochondria mediated pathway in H9c2 Mr Salin Raj New Delhi cardiomyoblast and heart for development of nutraceuticals Identification of proprotein convertase subtilisin kexin-9 Dept. of Health Research, Dr Shyni G L (PCSK-9) inhibitors from Garcinia cambogia New Delhi In vitro evaluation of nutritional and probiotic activity of Dr P Nisha Tata Chemicals sweetners Investigation of resveratrol based compounds from Dr P Jayamurthy KSCSTE Dipterocarpaceae family for their anti-diabetic potential Mining and characterization of novel antimicrobial Dr S Nishant Kumar DST molecules produced by streptomyces species Occurrence of acrylamide, a heat induced food toxicant, Food Safety & Standards in processed food products of India: mitigation strategies Dr P Nisha Authority of India and health risks National Institute for Interdisciplinary Science & Technology 91 91 Annual Report 2018-19 Post-harvest operations for value addition of indigenous Dr P Nisha Dept of Agriculture , GOK fruits and vegetables Role of mitophagy in cardiac hypertrophy: an in vitro cell Dr Vandana Shankar DST line approach Technology development for value addition/preservation Coconut Development Mr V V Venugopal of coconut water Board, Cochin Valorization of spent turmeric/amla: Process development for antioxidant dietary fibre enriched Dr P Nisha BIRAC products as metabolic enhancers Coconut Development Value addition of coconut syrup and its studies Dr M V Reshma Board, Cochin Chemical Sciences & Technology Division Activity guided screening of phospho diestrease inhibitors from Indian medicinal plants to treat erectile Dr A Kumaran ICMR dye function Biocompatible combined polymer polysaccharide core-shell VEGF-Targeted Nano-Carrier for sustained Dr K K Maiti DBT Intraocular pharmacotherapy towards diabetic retinopathy Cucurbit[n] uril homologues and their derivatives as Dr Rakesh Mishra DST receptors for a few ionic and neutral analytes Design and development of bio-based novel liquid crystalline conductive electrodes and electrolytes for high Dr J D Sudha DST performing flexi-energy storage devices Design and processing of nano structured hybrid Dr Narayanan Unni DST composite materials for electro chemical energy storage Design, synthesis and studies of self-assembling Dr V K Praveen DST (FAST TRACK) luminescent metallo- peptides Development of a Knoevenagel condensation/dipolar cycloaddition strategy towards highly functionalized Dr Jubi John DST (FAST TRACK) heterocycles and its applications in medicinal/ material chemistry & chemical biology Development of flexible solar cells through innovative Dr J D Sudha ISRO photoanode/ Active later systems Development of multiplexing detection platform of breast cancer biomakers by non-invasive Surface Dr K K Maiti DST Enhanced Raman Scattering (SERS)- Nanoprobe Development of novel NIR absorbing sensitizers and their nano-conjugates for the multi model cancer imaging and Dr Joshy Joseph DBT therapy 92 National Institute for Interdisciplinary Science & Technology 92 Annual Report 2018-19 Development of novel organic materials for photovoltaic Dr C Vijayakumar DST applications Development of synthetic strategies for diverse compound collection of privileged structural motifs for Dr L Ravi Shankar KSCSTE medicinal chemistry Dynamic molecular, supramolecular and surface chemistry for spatiotemporal modulation of smart Dr Sreejith Shankar Pooppannal DST advanced functional materials Engineering intelligent theranostic nanocarrier for Dr K K Maiti SERB targeted therapy and diagnosis of Cancer Engineering Nanostructured surfaces for Developing Dr Yoosaf Karuvath DBT SERS Sensing Platform Fluorescent molecules and assemblies for sensing and imaging Dr A Ajayaghosh DST (J C Bose Fellowship) Gold nanorod based targeted nanoprobe for cancer theranostics: Diagnosis by Surface Enhanced Raman Dr K K Maiti DBT Scattering (SERS) and fluorescence imaging and therapy by PDT and PTT Indigenous development of Semi-automatic equipments Ministry of Science & Dr Narayanan Unni for large area dye-sensitized solar module fabrication Technology, DST Investigation of ultra-fast dynamics of chromophores involved in singlet exciton fission processes towards solar Dr Karunakaran Venugopal DST cell applications Large area opto-electronics for Australia and India : From Dr Narayanan Unni DST materials to advanced devices Dr Animesh Low cost photonic device for diagnostic applications DST Samanta Mechanical stimulation induced microscopic crystalline structure changes in molecular materials: Implications on Dr Sunil Varughese SERB drug formulation and mechanochromic behavior Modulating the morphology and molecular packing of self-assembled organic nanomaterials for efficient photo- Dr Yoosaf Karuvath SERB induced electron transfer Nano structured electrodes for energy storage devices Dr Raghy Raghavan SERB Nature Inspired chemical entities for healthcare Dr B S Sasidhar SERB applications New materials for improved, cost-effective perovskites Dr Joshy Joseph DST solar cells National Institute for Interdisciplinary Science & Technology 93 93 Annual Report 2018-19 Quantum chemical modelling of CC and CN metathesis reactions and functional molecules containing unusual Dr C H Suresh SERB carbon-metal bonds Revealing the interaction mechanism of the protein with lipids in the apoptosis process: electronic, vibrational and Dr Karunakaran Venugopal DBT conformational relaxation dynamics of the heme in the liposomes Solar Hydrogen: An alternative avenue Dr Suraj Soman DST Sulfonimidamides: Its synthesis and applications in organic synthesis; Development of new methodologies Dr Ganesh Chandra Nandi DST for the synthesis of hetrocyclic systems Sustainable utilization of abundant natural resources: Synthetic transformations of zerumbone and germacrone Dr K V Radhakrishnan SERB towards chemically diverse sesquiterpenoid architectures Synthesis a library of Aza-C KRN 7000 and Aza galacto Dr L Ravi Shankar SERB lipid analogues for immunomodulatory screening Environmental Technology Division Algal biomass as a potential renewable resource of energy: Production of fuels & chemicals by Dr Churchil Angel Antony Raj DST heterogeneous catalysis Determination of emission factors of dioxins from open Kerala State Pollution Dr K P Prathish burning of municipal wastes in Kerala Control Board Development and demonstration of a 500kg/day food waste biomethanation plant at Trivandrum International Dr B Krishnakumar Airport Authority of India Airport Development and field demonstration of waste Jai Hari Food Products, Dr B Krishnakumar management systems for a medium scale industry Pathanamthitta Development of chloride free saleable iron oxide from by-products of Titanium pigment production via chloride Dr K P Prathish DST route Development of hydrothermal liquefaction of microalgae Dr Paneer Selvam DST for production of bio-oil Novel hybrid nanostructured surface modified electrodes Dr K P Prathish DST for sensors and biosensors SMART FOUNDARY (SMART= Sustainable Metal casting Dr S Savithri DST using Advanced Research and Technology STP secondary treatment, a feasibility study Dr B Krishnakumar Kerala Water Authority 94 National Institute for Interdisciplinary Science & Technology 94 Annual Report 2018-19 Materials Science & Technology Division Alumina based LTCC & HTCC substrate for hybrid Dr K P Surendran DST microelectronic circuits instrategic sector applications Bio plastic from poly( Lactic acid)/ Coir composites Mr M Brahmakumar Coir Board Chemical functionalization of Si with 2D structures: Anode materials for lithium ion battery with significantly Dr Saju Pillai DST improved volumetric capacity Designing green, self-healing coatings for metal Dr K G Nishanth SERB protection Development and in-vitro Characterization of magnesium alloys for biocompatible and biodegradable Dr A Srinivasan SERB implant applications Development of Biodegradable mulching mats using Dr Saju Pillai NCRMI coir-polymer systems Development of ceramic membranes and setting up of a Dr U S Hareesh DST (TSDP) pre-pilot plant manufacturing facility Development of graphene based membranes from Dr S S Sreejakumari Ministry of Mines graphite ore for desalination Development of hydrophobic glaze for porcelain insulator Dr S Ananthakumar M/S Adithya birla Development of light weight functionally graded metal- ceramic composite armour materials for defence Dr T P D Rajan ARMREB, New Delhi applications Development of Light weight near net shape aluminium composite substrates for thermal management in Dr T P D Rajan DST, New Delhi electronic and avionic packaging systems Development of Lightweight Aluminum based Crankcase Dr T P D Rajan WABCO India Ltd for Automotive Air Compressor Brake Systems Development of magnetically modulated therapeutically active layered double hydroxide(LDH) as a nanomedicine Dr Manoj Raama Varma SERB with hyperthermia potential for cancer theranostics Development of novel magnetodielectric materials for Dr Manoj Raama varma ISRO miniaturized microstrip patch antennas Developments of environmentally benign inorganic pigments for energy saving cool roof and anti-corrosive Dr K G Nishanth SERB applications National Institute for Interdisciplinary Science & Technology 95 95 Annual Report 2018-19 Generation of structural data for new ceramic complex Dr Prabhakar Rao ICDD oxides Green Synthesis of Warm White Light Emitting Single Phase Oxyfluoride Phosphors for Thermally Stable, Dr Subrata Das SERB Energy Efficient, and Elevated color Rendering LED Lamps. Improvement of Flux Pinning in Bi-based superconductor Dr Manoj Raama varma SERB Tapes Investigation of structural, optical, magnetic properties and electronic structure of binary inter-metallic alloys for Dr M Vasundhara DST the spintronic applications Large-Scale Production of Coir/Polymer Composites for Dr V S Prasad NCRMI Acoustic Applications Process development for enhancing the longevity of coir Dr V S Prasad Coir Board geotextiles( Coir Bhoovastra) Process development for surface modification of coir Dr Bhoje Gowd Coir Board fibers for enhanced spinnability Processing of CeO2 Nanoparticles for energy saving glaze Dr S Ananthakumar IRE coatings and cool textiles Processing Of TiO2 coated hydrous Kaolin for enhanced Dr S Ananthakumar M/s Surya Mine Chem brightness and thermal stability Production of polymer/coir composites for furniture Mr M Brahmakumar NCRMI Application Quantitative assessment of hot tearing characteristics Aeronautical Research of aerospace magnesium alloys using instrumented Dr A Srinivasan and Development Board constrained rod casting (CRC) technique Recovery of scandium metal from acid leach liquor from Dr M Sundararajan Ministry of Mines titanium mineral industries Synthesis and characterization of broad spectrum ultraviolet filter with visible light emission and Dr Adersh Ashok DST antioxident activity: A potential multifunctional active ingredient with multitude of applications Technology development of recycling of aluminium Dr M Ravi DST (SARAPS) alloys for industrial applications 96 National Institute for Interdisciplinary Science & Technology 96 Annual Report 2018-19 Microbial Processes & Technology Division Bio prospecting and taxonomic studies of marine micro Dr N Ramesh Kumar Ministry of Earth Sciences organisms in search of novel anti-infectives Characterization of major agro-residues biomass in India Dr Rajeev K Sukumaran TIFAC Characterization, recombinant expression, process scale up validation of selected hydrolases from native action Dr Rajeev K Sukumaran DBT bacteria for commercial exploitation Deciphering interacting partners of PAMPs / Effectors of collechotrichium falcatum that trigger innate immunity Dr Rajeev K Sukumaran DBT in sugarcane Development of a bioprocess for the commercial Margosa Bio grow India Dr K Madhavan Nampoothiri production of Gibberallic acid Pvt. Ltd. Development of a gene expression platform for heterologous protein production in the filamentous Dr Rajeev K Sukumaran DBT fungus Aspergillus unguis Development of a sustainable process for the production Dr R Sindhu DST of poly-3-hydroxybutyrate using kitchen and food waste Direct utilization of agroresidual biomass for the production of α,ω-diamines as well as α,ω-amino acids: Dr K Madhavan Nampoothiri DBT strain and process development using Corynebacterium glutamicum Exploration and exploitation of microflora from Institute of Bio resources Marcha and soil samples from high altitude soils for the Dr P Binod and sustainable Develop- production of 2,5-furan dicarboxylic acid and selected ment, Manipur industrially important enzymes Holistic processes and practices for clean energy in Dr P Binod DST INDO-NORDEN strengthening bioeconomic startegies Integrated biorefinery for converting paper mill waste Dr P Binod DBT INDO UK into chemical wealth Investigation of the dynamics & mechanism of flocculation by polymers and biopolymers for separation Dr Rakesh Kumar Yasarla Ministry of Mines of solid particles of high rate thickeners in mineral processing industries Investigation on the synergistic effect of phytohormones on omega -3- fatty acid production from nanochloropsis Dr Muthu Arumugham DBT sp. National Institute for Interdisciplinary Science & Technology 97 97 Annual Report 2018-19 Isolation and Development of starter cultures for Accelerated Freeze Dry- Dr K Madhavan Nampoothiri Dairy Products ing Co.LTD, Loktak lake biomass (para- grass) based bio refinery for fuels and chemicals: Value addition through Dr Rajeev K Sukumaran IBSD, Manipur biotechnological and thermochemical platform Microbiome analysis of saline tolerant Pokkali rice varieties of coastal agri saline fields(Pokkali and Kaippad tract) of Kerala and evaluating their core endophyte Dr N Ramesh Kumar DBT beneficial rhizobacteria for enhancing rice growth under saline conditions Molecular and functional characterization of active saline adapted nitrogen fixing plant growth promoting bacteria Dr N Ramesh Kumar SERB of native grown coastal saline tolerant rice varieties (Pokkali) of Kerala Molecular approach to enhance folate production in Dr K Madhavan Nampoothiri KSCSTE probiotic lactic acid bacteria Quantification of substrate across membrane proteins Dr Harsha Bajaj DBT, New Delhi Study on chemo-enzymatic transformation of lignin derived from lignocellulosic biomass for potential Dr Leena Perumal DST WOS A application as adhesives 98 National Institute for Interdisciplinary Science & Technology 98 Annual Report 2018-19 CONSULTANCY PROGRAMMES Project Title Project Leader Client Analysis of water samples from Chimery, Vazhavi & Cheer- Dr K P Prathish KSRSE, GOK akuzhi river basins M/s. Apicore Pharmaceuticals Characterization and confirmation of drug intermediates Dr L Ravi Shankar Pvt.Ltd. Characterization and interpretation of chemical intermedi- M/s Omgene Life Sciences Pvt. Dr L Ravi Shankar ates(Cis) and active pharmaceutical ingredients(APIs) Ltd. M/s. Momentive Performance Characterization of silicone and silicone derivatives Dr E Bhoje Gowd Materials (India) Pvt.Ltd. Design of ETP for Kottarakara temple, TDB Dr Ajit Haridas TDB Thiruvananthapuram EIA and EMP study for IREL NK Block-II & NK Block-II EE Dr J Ansari IRE Ltd EIA study for KMML I V VII Phase II Dr J Ansari KMML EIA study for KMML pond Dr J Ansari KMML Estimation of phenolics in cashew formulation and valida- Western India Cashew Compa- Dr J D Sudha tion of procedure ny Pvt. Ltd. Hospital STP design Dr Ajit Haridas HLL Infra Tech Services Ltd,TVM KWA water treatment plant fly & red worm problem Dr B Krishnakumar Kerala Water Authority Microstructure analysis of industrial yarns Dr E Bhoje Gowd M/s SRF Ltd Mineralogical, geochemical and morphological characteri- Dr K Harikrishna sation of raw ilmentite, reduced ilmenite, leached ilmenite KMML Bhat and synthetic rutile Odour control and effluent pre-treatment at Al Badr Fish Dr Ajit Haridas WAPCOS Ltd Canning unit at CSEZ, Kakkanad Odour control for shrimp feed factory Dr Ajit Haridas Avanti Feeds Limited Performance improvement of ETP Dr Ajit Haridas BPCL -Kochi refinery Process details for biogas recovery from spent tapioca leaf Dr B Krishnakumar ICAR-CTCRI Sampling and analysis of water samples from Malampuzha Dr K P Prathish KSREC and Chittoorpuzha Technical assistance for designing ETP for RBI, TVM Dr B Krishnakumar RBI, Trivandrum Technical support to flow + solver code of Autocast XI Dr S Savithri 3D Foundary Tech Pvt Ltd Department of space, Vikram X-ray photoelectron spectroscopy (XPS) of metallic powder Dr Saju Pillai Sarabhai space centre (VSSC), samples of VSSC, Thumba, Trivandrum Trivandrum National Institute for Interdisciplinary Science & Technology 99 99 Annual Report 2018-19 हस्तक्षर किए एमओयू / समझौते अनु समझौता 煍ञपन की उस फर्म/ फरमों का नाम जिनके साथ शीर्क परियोजना का मुखिया क्रमांक पकृ ति समझौता 煍ञपन / समझौता किया गया है गैस और वाष् अणओु ंके लिए सिरेमिक 1 भिन्ता का डीड नोरितके, लिमिटेड, जापान डॉ स अनंतकु मार अड्सोरबंट्स का विकास एक 500केजी/डे फू ड वेस् बायोमीशन प्लाट 2 स्वच फ्चय र एनर् सॉल्शय स,ं ति셁वनंतपरु म डॉ। बी कृ ष्कु मार स्थापत करना समझौता डायनेमिक पावर विंडो (डीपीडबल्)य प्र셌饍योगकी का गोपनीय प्रकटीकरण असाही इडियां ग्लस लिमिटेड (एआईएस), 3 डॉ आदर् अशोक संयकु विकास समझौते नई दिल्ल डायनेमिक पावर विंडो (डीपीडबल्)य प्र셌饍योगकी का एम/एस असही इडियां ग्लस लिमिटेड 4 समझौता 煍ञपन डॉ आदर् अशोक संयकु विकास (एआईएस), न् य दिल्ल झरझरा सिरेमिक समर्न और सिरेमिक झिल्ल का सीएसआईआर-सᴂटल ग्लस एडं सिरेमिक 5 समझौता डॉ। य ू एस हरेश विनिर्मण प्र셌饍योगकी रिसर् इसं ्टट्यट,ू हैदराबाद एडं ोफाइटिक बैक्टरियल फॉरलेशनम् अर्थत 6 तकनीकी हस्तातरण 蕍र शेख मोहिउ饍दन, पश椿म बंगाल डॉ। बी एस दिलीप कु मार विनिर्मण। संयंत टॉनिक गोपनीय प्रकटीकरण सानई-कॉनकेु यर (इडियां ) पायथ लिमिटेड, डॉ सनीलु व셁घसे 7 फार्मस्ूटय कल् योगरों समझौते मायवम सिंथेटिक और प्राकृ तिक उत्पदरों के विरोधी राजीव गांधी सᴂटर फॉर बायोटेक्नलॉजी, 8 सहयोग समझौता डॉ ल रविशकं र संक्रामक / एटीं वायरल गणु त्रᴂद्रम सखेू काली मिर् (काली) और परिपक् हरी मिर् 9 से सफेद काली मिर् का प्रसंस्कण (पाइपर नाइगम तकनीकी हस्तातरण श् अब्लद मनाफ ए, कोल्म डॉ। बी एस दिलीप कु मार एल) नारियल पानी के सीटू संरकण और मलू ्यवरन मᴂ 10 नारियल विकास बोर्, कोचीन वेणगु ोपाल मᴂ श् वी प्र셌饍योगकी विकास समझौते का 煍ञपन 11 कोकोनट सिरप और इसके अध्यन का मलू ्यवरन समझौते का 煍ञपन नारियल विकास बोर्, कोचीन वेणगु ोपाल मᴂ श् वी बोगर प्रयोगशालाओ,ं आधं प्रदेश और मैसर् विष् ण इसं ्टट्यटू ऑफ फार्मस्ूटय कल 12 पी-जीपी अवरोधकरों का सं�लषण सहयोग समझौता एजकेशनु एडं रिसर् (वीआईपीईआर), डॉ ल रविशकं र आधं प्रदेश और विष् ण कॉलेज ऑफ फार्सी (एसवीसीपी), तेलंगाना छोटे-कोण एक्-रे बिखरने, चौड़-कोण एक्-रे मोमᴂटिव परफॉरमᴂस मैटेरियल् (इडियां ) 13 विवर्न और फू रियर ट्रसफॉर्म स्पे絍셋स्कपी साम嵍र परीकण के लिए डॉ भोजे गौड प्राइवेट लिमिटेड, बℂगलोर (एफटीए) पर आधारित साम嵍र समझौता रिकॉन ऑयल इडं स絍रज प्राइवेट लिमिटेड 14 गैर-प्रकटीकरण समझौते के लिए समझौता गैर प्रकटीकरण समझौता डॉ। के जी रघु मबंु ई 100 National Institute for Interdisciplinary Science & Technology 100 Annual Report 2018-19 ठोस राज् किण्न, माइक्र셋बियल योगरों और प्र啍क्र्봾 प्रायोजित अनसु ंधान के 15 त्रित 굍रज सखु ाने कं लिमिटेड, कोचीन डॉ। माधवन नामपथिरु ी का सत्봾पन लिए समझौता एनआईआर परावर्क सीईओ2 नैनोकणरों के प्रायोजित अनसु ंधान के मेसर् इडियं न रेयर अर् लिमिटेड टेक्नलॉजी 16 प्रसंस्कण के लिए ऊर्ज की बचत ग्लेज़ग कोटिंग् डॉ स अनंतकु मार लिए समझौता डेवलपमᴂट काउंसिल, कोल्म और शांत वस्त्र ऑटोमोटिव एयर कं प्रेसर ब्क सिस्म के लिए हल्क 17 गोपनीय समझौता डबल्एय बीसीओ इडियां लिमिटेड, चेन्ई डॉ। टी पी डी राजन एल्मीय नियम आधारित क्रै ककेस का विकास स्वस्थ देखभाल के लिए नैनो बायोसᴂसर और 18 समझौते का 煍ञपन आरसीसी, टीवीएम डॉ क क मैटी माइक्र셋 तरल पदार् स्वचेबल इलेक絍셋क्र셋मिक स्मार विंडो अनप्रु योगरों के पारस्रिक गैर 19 डीसीएम श्रीम लिमिटेड, ग蔼गु ांव डॉ। बिस्वप्रिय देब लिए अणओु ,ं सामग्रियो और प्र셋टोटाइप का विकास प्रकटीकरण सम्झता 20 खर् की गई हल्द का मल्ू याकन समझौता 煍ञपन अरजन् प्राकृ तिक लिमिटेड, अलवाए डॉ। पी निशा दर्, सजनू और गठिया के खिलाफ अपनी कमता के पारस्रिक गैर आर् वैद फार्सी (कोयम्टूर) लिमिटेड, 21 लिए तैयारी के विभिन् समय पर एवारथिस का एक डॉ। पी। जयमर्तू प्रकटीकरण सम्झता कोयंबटूर तलनु ात्क अध्यन ग셁तु ्वकर्ण मर कास्टिग और निचो蔼 कास्टिग 饍वार श् कालीश्वरी मेटल फाउंडर् (पी) लℂडेड, 22 संसाधित उच् श啍鄿 अल-सी-क्ई-एमजी-य श् मिश डॉ एम रवि प्रकटीकरण समझौते शिवकाशी धात ु के माइक्र셋स्क्च यांत्क गणु रों की स्थपना के लिए अध्यन एटीं वायरल लीड के 셂प मᴂ सिंथेटिक यौगिकरों के कै थोलिक विश्ववि饍봾लय 23 साम嵍र स्थनांतरण डॉ। जबु ी जॉन डिजाइन, सं�लषण और जैविक मल्ू याकन बेल्जिम 24 बायो फिल्ट मीडिया तकनीकी हस्तातरण ए.पी. इजीं नियर्, तमिलनाडु डॉ अजीत हरिदास स्वटनर् के पोषण और प्रीबायोटिक गतिविधि का पारस्रिक गैर 25 टाटा के मिकल् लिमिटेड, महारा�ट डॉ निशा पी वि絍셋 मल्ू याकन प्रकटीकरण सम्झता उन्त चमक और थर्ल स्थिता के लिए टीआईओ 26 समझौता मैसर् सर्यू माइन केम, अहमदाबाद डॉ स अनंतकु मार लेपित हाइ蕍रॉलक काओलिन का प्रसंस्कण उपन्봾स का विकास रसायन वि煍ञन जीव वि煍ञन इटं रफे ज के माध्म से उत्तर परू 㔵 पारंपरिक प्रणाली से 27 समझौते का 煍ञपन डीबीटी डॉ। के जी रघु मोटापा विरोधी के लिए होता है केले का फ़इबर एक्絍रक्न 28 तकनीकी हस्तातरण इडसं 絍र सेराफ् फाउंडेशन बℂगलोर द राजीव के सकु ु मारन नए विकसित उत्पदरों के लिए स्थिता और मैसर् पंकजा कस्ूत ी हर्ल् इडियां लिमिटेड, 29 समझौता वेणगु ोपाल मᴂ श् वी स्वकार्ता मᴂ वदृ 鴿 त्रᴂद्रम National Institute for Interdisciplinary Science & Technology 101 101 Annual Report 2018-19 MoUs/ Agreements Signed Nature of the Name of the firm/firms with whom SN Title Project leader MoU the MoU/Agreement is entered into Development of Ceramic adsor- Deed of Varia- 1 M/s. Noritake Co., Ltd., Japan Dr S Ananthakumar bents for gas and vapour molecules tion Installing A 500KG / Day Food Ms. Swatch Future Energy Solutions, 2 Agreement Dr B Krishnakumar Waste Biomethanation Plant Thiruvananthapuram Confidential Joint development of Dynamic M/s. Asahi India Glass Limited (AIS), 3 Disclosure Dr Adarsh Ashok Power Window (DPW) Technology New Delhi Agreement Joint development of Dynamic M/s. Asahi India Glass Limited (AIS), 4 MoU Dr Adarsh Ashok Power Window (DPW) Technology New Delhi Manufacturing technology of po- M/s. CSIR-Central Glass & Ceramic 5 rous ceramic support and ceramic Agreement Dr U S Hareesh Research Institute, Kolkata membranes Manufacturing Endophytic bacteri- Technology 6 Dr. Sekh Mahiuddin, West Bengal Dr B S Dileep Kumar al formulation viz. PLANT TONIC Transfer Confidential Sanofi-Synthlabo (India) Pvt Ltd, 7 Pharmaceutical formulations Disclosure Dr Sunil Varughese Mumbai Agreement Anti-infective/antiviral properties of Collaboration M/s. Rajiv Gandhi Centre for Biotech- 8 Dr L Ravi Shankar synthetic and natural products Agreement nology, Trivandrum Processing of white pepper from Technology 9 dried pepper (black) and matured Shri. Abdul Manaf A, Kollam Dr B S Dileep Kumar Transfer green pepper (Piper nigrum L) Technology Development for in situ M/s. Coconut Development Board, 10 Preservation and Value Addition of MoA Mr V V Venugopal Cochin Coconut Water Value addition of Coconut Syrup M/s. Coconut Development Board, 11 MoA Mr V V Venugopal and its studies Cochin M/s. BogaR Laboratories, Andhra Pradesh AND M/s. Vishnu Institute Collaboration of Pharmaceutical Education and Re- 12 Synthesis of p-gp inhibitors Dr L Ravi Shankar Agreement search (VIPER), Andhra Pradesh & Sri. Vishnu College of Pharmacy (SVCP), Telangana 102 National Institute for Interdisciplinary Science & Technology 102 Annual Report 2018-19 Materials based on small-angle X-ray scattering, wide-angle X-ray Agreement for M/s. Momentive Performance Materi- 13 Dr E Bhoje Gowd diffraction and Fourier transform Material Testing als (India) Private Limited, Bangalore infrared spectroscopy (FTIR) Agreement for Non-Disclosure Non-Disclosure M/s. Recon Oil Industries Private Limit- 14 Dr K G Raghu Agreement Agreement ed Mumbai Solid state fermentation, microbial Agreement M/s. Accelerated Freeze Drying Co. Dr Madhavan Nam- 15 formulations and validation of for Sponsored Ltd., Cochin, poothiri process Research Processing of NIR reflective CeO2 Agreement M/s Indian Rare Earth Limited Technol- 16 nanoparticles for energy saving for Sponsored Dr S Ananthakumar ogy Development Council, Kollam glaze coatings and cool textiles Research Development of Lightweight Aluminum based Crankcase for Confidentiality 17 WABCO India Limited, Chennai Dr T P D Rajan Automotive Air Compressor Brake Agreement Systems Nano biosensors and Micro fluidics Memorandum 18 RCC, TVM Dr K K Maiti for Health care of Agreement Development of molecules, mate- Mutual Non- rials and prototypes for switchable 19 Disclosure DCM Sriram Ltd, Gurgaon Dr Biswapriya Deb electrochromic smart window Agreement applications Valorization of spent turmeric 20 MoU Arjuna Natural Ltd, Alwaye Dr P Nisha generated A comparative study of avarthys Arya Vaidya Pharmacy (Coimbatore) Mutual Non- at various times of preparation for Limited, 21 Disclosure Dr P Jayamurthy their potential against pain, inflam- Coimbatore Agreement mation and arthritis Study for establishing microstruc- Sri Kaliswari Metal Powders(P) Ltd, ture mechanical properties of high Disclosure 22 strength Al-Si-Cu-Mg-Sr alloy Dr M Ravi Agreement Sivakasi processed by gravity die casting and squeeze casting Design, synthesis and biological Material trans- Katholieke Universiteit 23 evaluation of synthetic compounds Dr Jubi John fer Belgium as antiviral leads Technology 24 Bio filter media A.P. Engineers, Tamil Nadu Dr Ajit Haridas Transfer Mutual Non- Vitro Evaluation of Nutritional and M/s. TATA Chemicals Limited, Maha- 25 Disclosure Dr Nisha P Prebiotic Activity of Sweeteners rashtra Agreement National Institute for Interdisciplinary Science & Technology 103 103 Annual Report 2018-19 Processing Of TiO2 coated hydrous 26 Kaolin for enhanced brightness and Agreement M/s Surya Mine Chem, Ahmedabad Dr S Ananthakumar thermal stability Development of novel leads for anti-obesity from North East tradi- Memorandum 27 DBT Dr K G Raghu tional system through chemistry of Agreement biology interphase Technology Indus Tree Crafts Foundation, Ben- Dr Rajeev K Suku- 28 Banana Fibre Extraction Transfer galuru maran Enhancement of the stability & M/s Pankaja Kasthuri Herbals India 29 acceptability for newly developed Agreement Mr V V Venugopal Ltd, TVM products 104 National Institute for Interdisciplinary Science & Technology 104 Annual Report 2018-19 पेटᴂट भारत में दायर Patent No Title Grant Date Inventors सॉलिड-स्टट लाइटिंग के लिए उच् फलकरों के साथ अय्प्नपाल अजयघोष, किजमु रिु पी। दिव्봾, 303798 मॉलिक्लय र प्र셋सेस, ज़िंक के सहकारी संघरों का चयन, दो 30/11/2018 सम्त श्रीनिसन फोटो इमेजिंग एनआईईआरआईटी और एक प्र啍क्र्봾 के लिए डीईई ने 304520 एनएएलएपीपीड एसओएल-फिल फिल्म के आधार पर 17/12/2018 संताकु मार धान्, तलसीदु ास राव परीकण किया। पोकक絍ट प腍셋से थॉमस, थि셁थानाथिल पठार ढंके हुए और मद्रिु त लेटेक् रबर शीट की ड्रिंग के लिए 30763 19/02/2019 पीओयएलओएसई,ू कु मार पिल्ई राजᴂद्र प्रसाद, एक प्राकृ तिक प्राकृ तिक पानी का उपयोग मरु कन कृ ष्म रावन विदेश में दायर Patent No Title Grant Date Inventors अर्चालक नैनोट्यबू -फ्लाेश और अर्चालक नैनोट्यबू -मैटल शकु ्ल सत्जीत विष्,ण पडिनहटटाइल ऑक्सइड कम्पोजट पार्टिकिलटी, उनका प्र셋सिडिंग के जरिए 9993814 12/06/2018 हरषे, नारायण हरषे, जोसे मन,ु मायन-एक्चᴂज मैके निक, और डाई पार् मᴂ उनके पास आने के क셁णाकरन रेम्봾 लिए विधि है। सेक्वन एबमिू न प्रॉडक्ट् के सेलेक्टिग लेबलिंग और सᴂसिंग के लिए एक स्क्वैइन आधारित फ्लोरइड प्र셋सेस्, पीएच मॉनीटरिंग अय्प्नपालि अजयघोष, पालपरावु न 6360896 29/06/2018 और थाइलिस कॉलिंग इन सेल् और प्रेजेन्न थेरोफ के लिए स्ल प्र셋सीजर। कोबाल् से जड़ु इनगनल ब्् य पिग्ᴂट्स मैग्नीशिम हवलिंग 10035914 ट्रांशन एलीमᴂट्स ऑक्सडेस और एक ही प्र啍क्र्봾 के लिए 31/07/2018 पडला पाराभकर राव, सरस्ती दिवाई प्र啍क्र्봾 सॉलिड-स्टट लाइटिंग के लिए उच् फलकरों के साथ मॉलिक्लय र अय्प्नपाल अजयघोष, किजमु रिु पी। 10144722 04/12/2018 प्र셋सेस, ज़िंक के सहकारी संघरों का चयन, दो फोटो इमेजिंग दिव्봾, सम्त श्रीनिसन कोबाल् की ओर से नए इनरोलॉजिकल ब्् य पिग्ᴂट्स मैग्नीशिम CN106414618B हवलिंग ट्रांशन एलीमᴂट ऑक्सडेस और उसी प्र啍क्र्봾 के लिए 25/01/2019 पडला पाराभकर राव, सरस्ती दिवाई एक प्र啍क्र्봾 National Institute for Interdisciplinary Science & Technology 105 105 Annual Report 2018-19 भारत मᴂ मंजूर Title Inventors File No Filing Date सेरेकिन और उसके सिद्धत के लिए प्र啍क्र्봾 के कु स्त कु मार मैती, प्रकटीकरण के कार्यन्वन के लिए किट की 201811028087 26/JUL/2018 वार्ष क셁णाकरन, कंु जरु मन सजु ाथन देखरेख डेब बिसवाप्रिय,चाककोथ, लखनऊ, थर्ममीटरिक साम嵍र और उपचार सतू इग्नतऔस विजठा मेशरम मनोज रामकृ ष्, सिंह जे 201811035273 19/SEP/2018 आइविंदर, तंजौर पलीु यवराु ज ऑक्सजन लिमिटेड 饍वार दिए गए बायोमेट्क स्पैनश स्ᴂट वॉश से कलर के रिमवू ल के लिए अजित हरिदास, चर्चल एटेनं ाराज 201811048597 21/DEC/2018 एक प्र啍क्र्봾 अलपैलफोसफोकोलिन् और मिलटेफोसिन के लंकला पल्ल, रवीशकं र, प्रसार और विस्थपन के लिए उन्त एकल गैस 201911003844 31/JAN/2019 थंगरास ु अ셁ण कु मार, अय्प्नपालि अजयघोष प्र啍क्र्봾 भारत मᴂ मंजूर Title Inventors File No Filing Date एक स्थाी और / या छूट को कम करने के लिए प्र啍क्र्봾 कृ ष्कु मार भस्करण 11 2016 006 253.2 11 /07/2018 एक थर륋-लैमिनेटेड बहुपत्नकृ त 啍जक्र셋न उच् तापमान सह-पंजीकृ त सिरेमिक (एचटीसीसी) टेप और प्र啍क्र्봾 के क़ ुझइकिल पैठमहरन सरू ेनद्रन 2018-537797 19/07/2018 आधार पर आधारित एक जैव सरु 啍ष निजीकरण और / या छूट को कम करने कृ ष्कु मार भस्करण, अनपमु ा विनजा 16/071374 19/07/2018 के लिए नादराजा ससिध बलप्प सोम्पपा,माध्यमक थोडी पाइलियम के उपचार की प्र啍क्र्봾 के लिए प्र啍क्र्봾 फतहथाल सलफैना, अय्प्नपालि PCT/IN2018/050898 31/12/2018 अजयगहृ 106 National Institute for Interdisciplinary Science & Technology 106 Annual Report 2018-19 Patents GRANTED IN INDIA Patent No Title Grant Date Inventors Molecular probes with high fluorescence for Ayyappanpillai Ajayaghosh, 303798 solid-state lighting, selective discrimination of 30/11/2018 Kizhumuri P. Divya, Sampath counterions of zinc, two photon imaging Srinivasan Dye entrapped sol-gel film based test strip sensor Santhakumar Dhanya, 304520 17/12/2018 for nitrite and a process thereof Talasila Prasada Rao Pokkattu Pathrose Thomas, An improved natural convection drier useful for Thiruthanathil Pathrose 30763 the drying of coagulated and pressed latex rubber 19/02/2019 Poulose, Kumara Pillai sheets Rajendra Prasad, Murukan Krishnamma Praveen GRANTED abroad Patent No Title Grant Date Inventors Semiconductor oxide nanotubes-flyash and Shukla Satyajit Vishnu, semiconductor oxide nanotubes-metal oxide Padinhattayil Hareesh, 9993814 composite particles, their processing via ion-exchange 12/06/2018 Narayani Harsha, Jose Manu, mechanism, and methods for their recycling in the Karunakaran Remya dye-removal application thereof A squaraine based fluorescent probe for selective labeling and sensing of serum albumin proteins, ph Ayyappanpillai Ajayaghosh, 6360896 29/06/2018 monitoring and thiol imaging in cells and a process for Palappuravan Anees the preparation thereof Inorganic blue pigments from cobalt doped Padala Prabhakar Rao, 10035914 magnesium having transition element oxides and a 31/07/2018 Saraswathy Divya process for the preparing the same Molecular probes with high fluorescence for solid- Ayyappanpillai Ajayaghosh, 10144722 state lighting, selective discrimination of counterions 04/12/2018 Kizhumuri P. Divya, Sampath of zinc, two photon imaging Srinivasan New inorganic blue pigments from cobalt doped Padala Prabhakar Rao, CN106414618B magnesium having transition element oxides and a 25/01/2019 Saraswathy Divya process for the preparing the same National Institute for Interdisciplinary Science & Technology 107 107 Annual Report 2018-19 FILED IN INDIA Title Inventors File No Filing Date Screening kit for detection of Kaustabh Kumar Maiti, Varsha Karunakaran, precancerous lesions of cervix and process 201811028087 26/07/2018 Kunjuraman Sujathan for the preparation thereof Deb Biswapriya, Chakkooth Vijayakumar, Thermoelectric materials and the Ignatious Vijitha, Meshram Manoj 201811035273 19/09/2018 preparation thereof Ramakrishna, Singh Jaivinder, Tanjore Puli Yuvaraj A process for the removal of color from biomethanated distillery spent wash by Ajit Haridas, Churchil Angel Antonyraj 201811048597 21/12/2018 oxygen limited wet oxidation Improved single vessel process for preparation and purification of Lankalapalli Ravi Shankar, Thangarasu Arun 201911003844 31/01/2019 alkylphosphocholines and miltefosine Kumar, Ayyappanpillai Ajayaghosh thereof FILED abroad Title Inventors File No Filing Date A bioprocess for reducing perchlorate Krishnakumar Bhaskaran, Anupama 11 2016 006 253.2 11 /07/2018 and/or nitrate Vijaya Nadaraja A thermo-laminated multilayered Kuzhichalil Peethambharan Surendran, zircon based high temperature co-fired Mailadil Thomas Sebastian, Jobin 2018-537797 19/07/2018 ceramic (htcc) tape and the process Varghese thereof A bioprocess for reducing perchlorate Krishnakumar Bhaskaran, Anupama 16/071374 19/07/2018 and/or nitrate Vijaya Nadaraja Sasidhar Balappa Somappa, Process for the preparation of pyrylium Chettiyal Thodi Fathimath Salfeena, PCT/IN2018/050898 31/12/2018 salts Ayyappanpillai Ajayaghosh 108 National Institute for Interdisciplinary Science & Technology 108 Annual Report 2018-19 परीक्षण और वि�लषण सेवाएँ सेल सीएसआईआर-एनआईआईएसटी की टेस्टिग एडं एनालिटिकल सर्वसेज (टीएएससी) इन-हाउस और बाहरी आर & डी गतिवि啍ध्रों, शि啍षािदरों और देश के उ饍यगरों को पराू करती है। अत्봾धनिु क सवु िधा देश के द啍षणी भाग मᴂ सर㔵श्ष्ठमᴂ से एकहै और लैब के लिए राजस् का एक सतत प्रवाह उत्न् करने के लिए बड़ पैमाने पर उपयोग किया जाता है। बाहरी नमनू ा वि�लषण भगतु ान के आधार पर किया जाता है। रिपोर् की अवधि के दौरान विभिन् शैक्षक संस्थनरों और विश्ववि饍봾ल्रों के लगभग 113 छा配रों, 57 आरएडडीं संस्थनरों और 15 उ饍यगरों ने इस सवु िधा का उपयोग किया था और बाहरी एजᴂ啍स्रों और छा配रों से नेनमू के परीकण और वि�लषण से 11.94627 लाख 셁पये का राजस् उत्न् हुआ था। उपकरणरों के बीच, एक्-रे इलेक絍रन माइक्र셋स्कपी (एक्पीएस) ने क्रमशः 2.80ा ल ख, एनएमआर / एचआरएमएस और एसईएम / एक्आरडी सवु िधाओ ंको इक絍ठ किया। सीएसआईआर ने अपनी वि�लषणात्क सवु िधाओ ं का एक रा�絍री पोर्ल श셂ु किया था जिसे "एनालिसिसिसिर" कहा जाता है। इस पोर्ल के माध्म से परू े सीएसआईआर की परिष्क त वि�लषणात्क इसं 絍셂 मᴂटेशन सवु िधा को दनियाु मᴂ कहĂ से भी बकु किया जा सकता है। वर्मान मᴂ इस सवु िधा का उपयोग परीकण मोड के तहत किया जा रहा है और सीएसआईआर-एनआईआईएसटी ने इस पोर्ल के माध्म से अपनी प्रमखु उपकरण बकिु ं ग को सफलतापरू 㔵क स्थनांतरित कर दिया है। वर्मान मᴂ पोर्ल मᴂ सीएसआईआर-एनआईआईएसटी के 256 उपयोगकर्त हℂ। TESTING AND ANALYTICAL SERVICES CELL The Testing and Analytical Services (TASC) of CSIR-NIIST caters to the in-house and external R&D activities, academia and Industries of the Country. The state of the art facility is one of the best in southern part of the Country and extensively utilized generating a steady flow of revenue for the Lab. The external sample analysis is carried out on payment basis. During the period of the report approximately 113 students from various educational institutes and universities, 57 R&D institutions and 15 Industries had utilized this facility and a revenue of Rs.11.94627 lakhs was generated from the testing and analysis of the sample from the external agencies and students. Among the instruments, the X-ray Electron Microscopy (XPS) collected 2.80 lakhs, NMR/HRMS and SEM/XRD facilities generated Rs.3.22 lakhs and Rs.1.49 lakhs respectively. CSIR had commenced a National Portal of its analytical facilities termed “AnalytiCSIR”. Through this portal, the sophisticated analytical instrumentation facility of entire CSIR can be booked from anywhere in the world. The facility currently is being used under test mode and CSIR-NIIST had successfully migrated its major equipment booking through this portal. The portal at present has 256 users from CSIR-NIIST. National Institute for Interdisciplinary Science & Technology 109 109 Annual Report 2018-19 煍ञन ससाधनं कᴂद्र 煍ञन संसाधन कᴂद्र,ंस् स थन मᴂ अनसु ंधान और विकास के सभी 啍ष配रों मᴂ सचू ना ꥍ셌饍योगकी सेवाएं पसु ्करों, पत्काओ,ं प्रिंट और इलेक絍रॉनक मीडिया मᴂ समदृ साम嵍र का प्रयोगशाला परिसर गीगाबिट फाइबर ऑप्टक बैकबोन के माध्म से परस्प संगह करने वाला सहायक विभाग है। संस्थन के वै煍ञानकरों, तकनीकी जड़ु हुआ है और एनकेएन से 100 एमबीपीएस लीज् लाइन के साथ जड़ु व्啍鄿्रों, और अनसु ंधान वि饍वनरों की जानकारी की आवश्कता को पराू हुआ है और सभी इटं रनेट और इ絍ं रनेट आवश्कताओ ंको पराू करने के लिए करने के अलावा, के रसी अकादमिक और अनसु ंधान संस्थनरों से आने वाले बीएसएनएल से 28 एमबीपीएस लीज् लाइन भी है। नेटवर् को विनियमित अनसु ंधान वि饍वनरों के लिए भी अपनी सेवा का विस्ता करता है। केआरसी ने किया जाता है और वायर् और वायरलेस नेटवर् के माध्म से 1050+ 2018-19 की अवधि के दौरान संगह को बढ़कर 13917 पसु ्कᴂ, 10947 इटं रनेट कनेक्न के लिए सिस्म और नेटवर् के प्रदर्न के संबंध मᴂ एक मानक और 11387 बाउंड वॉल्मय ऑफ पीरियडिकल कर दिया है। 2018 वास्तिक समय, अत-से-अं तं 饃श् प्राप्त करने के लिए सरु 啍षत किया जाता है। के दौरान, केआरसी ने विली से 17 ई-पसु ्कᴂ खरीदĂ और संगह मᴂ छह हिदीं AADHAR सकम बायोमेट्क अटᴂडᴂस सिस्म आठ अलग-अलग पसु ्करों सहित 59 नई किताबᴂ शामिल की गई।ं इसके अतिरिक, 27 पसु ्कᴂ स्थनरों पर स्थापत किया गया था। संस्थगत आईडी कार् सभी अनमनु ् प्राप्तु हई।ं उपरोक संगह के अलावा, वि饍वनरों के पास स्प्रिगर,नैचर, अमेरिकन उपयोगकर्तओ ंको जारी किए गए थे और दरवाजरों और दरवाजरों तक सरु 啍षत के मिकल सोसाइटी, रॉयल सोसाइटी ऑफ के मिस絍र, विली ब्लकवेल, पहुचं बनाए रखी गई थी। ऑक्फोर् यनिवर्सू टी प्रेस से रा�絍री 煍ञन संसाधन कं सोर्टिम के माध्म से ऑनलाइन पत्काओ ं तक पहुचं है। शोधकर्तओ ं के लिए स्पशलाइज् डिजिटल प्रदर्न प्रणाली को अनसु ंधान के परिणामरों, नोटिसरों और परिप配रों, डेटाबेस वाइज साइसफं ाइडं र, वेब ऑफ साइस,ं डरवेंट इनोवेशन इडेकं ्, लॉरेल आदि के प्रदर्न के लिए सात अलग-अलग स्थनरों पर रखा गया क्पैटय और एएसटीएम शामिल हℂ। एनआईएसटी शोधकर्तओ ंकी अतिरिक और रखा गया। यनिू ट मद्रणु और स्कैनंग की सवु िधा भी प्रदान करती है जानकारी की आवश्कता जै गेट प्स के माध्म से अन् सीएसआईआर, और आईटी उत्पदरों और प्रयोगशाला के उपकरणरों के अधिगहण मᴂ गणु वत्ता डीएसटी, संस्थनरों से संसाधन साझा करने के माध्म से परू ी हुई। पारंपरिक आश्वासन सनिशु 椿त करने मᴂ सहायता भी प्रदान करती है। । सेवाओ ंके अलावा, वै煍ञानकरों और छा配रों के रोअनु ध पर साहित् खोज, पेटᴂट नए दिशानिर्शरों के अनसु ार साइट के पन:ु निर्मण के साथ ही संस्थन की खोज, प्रशस्त पत वि�लषण किया गया। केआरसी ने उच् गणु वत्ता वाली वेबसाइट के लिए STQC प्रमाणन प्रगति पर है। संस्थन मᴂ आयोजित रा�絍री पत्काओ ं मᴂ प्रकाशित करने के लिए शोधकर्तओ ं की सहायता की और और अतं र्र�絍री सम्मलनरों के लिए वेबसाइटरों का विकास और रखरखाव साहित्यक चोरी की जाँच और परू 㔵 कला खोज मᴂ मदद की। कᴂद्र स्चालित किया गया। सॉ괼्टेयर इसं ्टलेशन, पनु र्स्पना, मरम्त, सॉ괼्टेयर अपडेट, है और ई-गवर्नेस के मानदडं रों की पष्टिु करता है। नेटवर् और आईटी से संबंधित म饍ु दों के लिए शोधकर्तओ ं को डेस्टॉप के केआरसी संस्थन की वेबसाइट, सोशल मीडिया पेज, और संस्थगत भडं ार एएमसी के प्रबंधन के अलावा लैपटॉप और साथ ही अन् कं प्टय र बाह्य भी रखता है। वे नियमित 셂प से अपडेट होते हℂ आईआर वर्मान मᴂ 2600 उपकरणरों की सहायता प्रदान की। कई सॉफ्टेयर इसं ्टलेशन और डेटाबेस को जर्ल लेख, 319 पीएचडी 镍सर और 220 समाचार आइटम शामिल हℂ। कᴂद्र बनाए रखा गया था। इसं ्टट्यशनलू रिपॉजिटरी, लिबसाइट, केम絍र, सिग्लट, ने एक द्विवारक समाचार पत ’प्रकाशित किया है। केआरसी नियमित 셂प उत्पत्त, एज़प्셋क्स के लिए स्टो और खरीद सॉ괼्टेयर, डी-स्पस और कोहा। से संदर् प्रबंधन सॉफ्टेयर, साहित् खोज, परू 㔵 कला खोज, खलीु पहुच,ं एप्लकेशन, मेल और वेबसाइट साम嵍र के लिए समय-समय पर बैकअप अनसु ंधान मल्ू याकन, शोधकर्तओ ं के लिए सोशल मीडिया, साहित्यक लिया गया। सर㔵र 嵍रड एटीं वायरस सॉफ्टेयर को तैनात करके इटं रनेट सरु 啍षत चोरी को रोकने और प्रभावी संचार आदि पर प्रशिकण प्रदान कर रहा है। किया जाता है। 110 National Institute for Interdisciplinary Science & Technology 110 Annual Report 2018-19 सचू ना का अधिकार और लकण वर्न, न्絍य रस्ुटय कल् और कार्यत्क खाद पदार्: विकास भारत मᴂ हर सार㔵जनिक प्राधिकरण के काम मᴂ पारदर्शता और जवाबदेही और मान्ता, डायोनिंस और पीसीबी, धात ु कास्टिग और विशेषता, को बढ़ाव देने के लिए वै煍ञानक और तकनीकी मामलरों के लिए सचनू ा रिमोट सᴂसिंग और जीआईएस के नमनेू और वि�लषण मᴂ उन्त प्रशिकण। के अधिकार अधिनियम -2005 का कार्यन्वन। अवधि के दौरान, 83 ईआईए और प्रबंधन, साम嵍र विशेषता तकनीक और इम्नय ोलॉजी तकनीक आरटीआई अनप्रु योगरों और 6 अपीलरों को जानकारी प्रदान की जाती है। मᴂ आवेदन। इलेक絍रॉनक और प्रिंट मीडिया के माध्म से कार्क्रमरों को सीएसआर कौशल पहल व्봾पक प्रचार दिया गया। 2018-19 के दौरान, 46 उम्मदि봾िरों को ह봾्रों पर सीएसआईआर एनआईआईएसटी ने सीएसआईआर कौशल पहल कार्क्रम प्रायोगिक गतिवि啍ध्रों और केस स्डी के निष्पदन मᴂ गहन प्रशिकण दिया के तहत विभिन् खडं रों के तहत लघ ु अवधि के पाठ्यक्रम पेशकि ए। पाठ्यक्रम गया था। वित्तीय वर् के दौरान, CSIR - NIIST और कृ षि कौशल परिषद हℂ; वि�लषणात्क रसायन वि煍ञन और इसं 絍셂 मᴂटेशन तकनीक, संचालन और (ASCI) ग셁嵍ु रम के बीच एक समझौता 煍ञपन पर हस्ताक किए गए। मार् रखरखाव किण्करों / बायोरिएक्ट, तकनीक की फाइटोके मिकल प्र셋फाइलिंग 2018 के दौरान चेन्ई मᴂ 絍रनर के प्रशिकण कार्शाला मᴂ दो स्टफ सदस्यों ने भाग लिया। National Institute for Interdisciplinary Science & Technology 111 111 Annual Report 2018-19 KNOWLEDGE RESOURCE CENTRE Information services The Knowledge Resource Centre is the supporting Samachar’. KRC is regularly providing training on division having rich collection of books, periodicals, reference management software, literature search, reference materials in print and electronic media in prior art search, open access, research evaluation, all areas of R&D being carried out in the institute. social media for researchers, preventing plagiarism, Besides catering to the information need of scientists, and effective communication etc. technical personals and research scholars of the Information technology services institute, KRC also extend its service to the visiting The laboratory campus is interconnected through research scholars from academic and research gigabit fiber optic backbone and linked with 100 institutions. During the period 2018-19, KRC enhanced mbps leased line from NKN and also 28 mbps leased the collection to 13917 Books, 10947 Standards and line from BSNL to fulfill all the Internet and intranet 11387 Bound Volumes of Periodicals. During 2018, KRC requirements. The network is regulated and secured purchased 17 e-books from Wiley and 59 new books to gain a real-time, end-to-end view with respect to including six Hindi books were added to the collection. system and network performance to 1050+ internet Additionally, 27 books were received gratis. Apart from connection through wired and wireless network. the above collection, the scholars have access to online journals from SpringerNature, American Chemical AADHAR enabled Biometric Attendance System was Society, Royal Society of Chemistry, Wiley Blackwell, installed at eight different locations. Institutional ID Oxford University Press through National Knowledge cards were issued to all permissible users and secured Resource Consortium. Specialized databases viz access to doors and gates are maintained. SciFinder, Web of Science, Derwent Innovation Index, Digital Display System were placed and maintained Qpat and ASTM are also provided to researchers. in seven different locations for exhibiting research The additional information requirement of NIIST outcomes, notices and circulars, laurels etc. The unit researchers fulfilled through resource sharing from also provides printing and scanning facility and also other CSIR, DST institutes through J-GatePlus. In provides assistance in ensuring Quality assurance in addition to the traditional services, Literature search, the acquisition of IT products and devices of the lab. Patent search, Citation analysis were carried out The STQC certification for the institute’s website is in on requests from scientists and students. KRC also progress along with the revamping of the site as per assisted researchers to publish in high-quality journals the new guidelines. Websites were developed and and helped in plagiarism check and prior art search. maintained for national and international conferences The center is automated and confirms to the norms of held in the institute. Provided help to researchers e-governance. for software installations, reinstallations, repairs, KRC also maintains the institute website, Social software updates, network and IT related issues apart media pages and institutional repository. They are from managing the AMC of desktops, laptops as updated regularly. The IR presently consists of 2600 well as other computer peripherals. Many software journal articles, 319 PhD Theses and 220 News items. installations and databases were maintained viz. The center publishes a biannual newsletter ‘NIIST Stores and Purchase Software, D-Space and Koha 112 National Institute for Interdisciplinary Science & Technology 112 Annual Report 2018-19 for Institutional Repository, Libsuite, Chemdraw, Techniques, Operation and Maintenance of fermenters Sigmaplot, Origin., Ezproxy. Backups were taken / bioreactors, Techniques of Phytochemical profiling periodically for applications, mails and website and characterization, Nutraceuticals and Functional contents. The internet is secured by deploying server Foods: Development and Validation, Advanced grade antivirus software. Training in Sampling and Analysis of Dioxins and PCBs, RTI Metal Casting and Characterization, Remote sensing Implementation of Right to Information Act-2005 and GIS application in EIA and Management, Materials in the institute for Scientific & Technical matters Characterization Techniques and Immunology to promote transparency and accountability in the Techniques. The programmes were given wider working of every public authority in India. During the publicity through electronic and print media. During period, information is provided to 83 RTI applications 2018-19, 46 candidates were given intensive training and 6 appeals. in the execution of hands-on experimental activities and case studies. During the financial year, an MOU CSR Skill Initiative was signed between CSIR – NIIST and Agriculture Skill CSIR NIIST introduced short term courses under various Council of India (ASCI) Gurugram. Two staff members segments under CSIR Skill Initiative programme. The attended the trainer’s training workshop at Chennai courses are; Analytical Chemistry and Instrumentation during March 2018. National Institute for Interdisciplinary Science & Technology 113 113 Annual Report 2018-19 PUBLICATIONS 1. AASHISH (A), NEETHU (K S), KRISHNA PRIYA (G), HAREESH 9. ANAS (S), NAIR (P V), MAHESH (K V), LINSHA (V), (U S), SANKARAN (M), SUDHA (J D). SHUHAILATH (A), PEER MOHAMED (A), WARRIER (K G K), Flexible Electrochemical Transducer Platform for ANANTHAKUMAR (S). Neurotransmitters. Engineered Hetero Structured Arrays of ZnO NanoX (X = ACS Omega, 2018, 3(3):3489-3500 Discs, Rods and Wires) and CdTe Quantum Dots for Advanced Electron Transport Applications. 2. ABHILASH (P), ROSHNI (S B), MOHANAN (P), SURENDRAN Materials & Design, 2018, 141:267-275 (K P). A Facile Development of Homemade Substrate using ‘Quench 10. ANGEL MARY JOSEPH, NAGENDRA (B), SHAIJU (P), Free’ Glass-Ceramic Composite and Printing Microstrip Patch SURENDRAN (K P), BHOJE GOWD (E). Antenna on it. Aerogels of Hierarchically Porous Syndiotactic Polystyrene Materials & Design, 2018, 137:38-46 with a Dielectric Constant Near to Air. Journal of Materials Chemistry C, 2018, 6(2):360-368 3. ABHILASH (V), SAVITHRI (S), PILLAI (U T S). Similitude Analysis on Flow Characteristics of Water, A356 and 11. ANI DEEPTHI, VIDYA SATHI, VIJAY NAIR. AM50 Alloys During LPC Process. Recent Topics of Radical-Based Carbon-Carbon Bond Journal of Materials Processing Technology, 2018, 257:270-277 Formations. Tetrahedron Letters, 2018, 59(29):2767-2777 4. ADAK (A), PANDA (T), ANJU (R), BEJOYMOHANDAS (K S), ASHA (K S), PRAKASHAM (A P), BALARAM (M), PANDA (M 12. ANJALI (B A), SURESH (C H). K). Electronic Effect of Ligands vs. Reduction Potentials of Fischer Distinct Mechanoresponsive Luminescence, Carbene Complexes of Chromium: A Molecular Electrostatic Thermochromism, Vapochromism, and Chlorine Gas Sensing Potential Analysis. by a Solid-State Organic Emitter. ACS Omega, 2018, 3(5):5291- New Journal of Chemistry, 2018, 42(22):18217-18224 5300 13. ANJALI (B A), SURESH (C H). 5. AISWARYA (R), DIJITH (K S), SURENDRAN (K P). Predicting Reduction Potentials of 1,3,6-Triphenyl Fulvenes Printable Hierarchical Nickel Nanowires for Soft Magnetic Using Molecular Electrostatic Potential Analysis of Substituent Applications. Effects. ACS Omega, 2018, 3(10):14245-14257 Journal of Computational Chemistry, 2018, 39:881-888 6. AKSHAY (V R), ARUN (B), MANDAL (G), MUTTA (G R), 14. ANJALY (S), MANURAJ (M), NARAYANAN UNNI (K N). ANUPAMA (C), VASUNDHARA (M). Addressing the Efficiency Roll-off in a Fluorescent OLED Observation of Optical Band-Gap Narrowing and Enhanced by Facile Electron Transport Layer Doping and Carrier Magnetic Moment in Co-Doped Sol-Gel-Derived Anatase TiO2 Confinement. Nanocrystals. Optical Materials, 2018, 79:413-419 Journal of Physical Chemistry C, 2018, 122(46):26592-26604 15. ANJANA (P M), BINDHU (M R), UMADEVI (M), RAKHI (R B). 7. AKSHAY (V R), ARUN (B), SUNEESH (M V), VASUNDHARA (M). Antimicrobial, Electrochemical and Photo Catalytic Activities Surfactant-Induced Structural Phase Transitions and of Zn Doped Fe3O4 Nanoparticles. Enhanced Room Temperature Thermoelectric Performance Journal of Materials Science - Materials in Electronics, 2018, in n-Type Bi2Te3 Nanostructures Synthesized via Chemical 29(7):6040-6050 Route. 16. ANJU (M), SINDHU (R), BINOD (P), ABRAHAM (A), ATHIRA ACS Appl. Nano Mater, 2018, 1(7):3236-3250 (R S R), MATHEW (A K), PANDEY (A). Production of Pectinase from Bacillus Sonorensis MPTD1. 8. AKSHAY (V R), ARUN (B), DASH (S), PATRA (A K), MANDAL (G), MUTTA (G R), ANUPAMA (C), VASUNDHARA (M). Food Technology and Biotechnology, 2018, 56(1):110-116 Defect Mediated mechanism In Undoped, Cu and 17. ANJU (V), AWANTIKA (S), SHILPA (G), BRIJESH (K), PRIYA Zn-doped TiO2 Nanocrystals For Tailoring (S), SABULAL (B), RAMESHKUMAR (K B). The Band Gap and Magnetic Properties. Terpenes and Biological Activities of Euphorbia Tortilis. RSC Advances, 2018, 8(73):41994-42008 LETTERS IN ORGANIC CHEMISTRY, 2018, 15(3):221-225 114 National Institute for Interdisciplinary Science & Technology 114 Annual Report 2018-19 18. ANNROSE SUNNY, AKSHAY (V R), VASUNDHARA (M). 27. ARUN (B), ATHIRA (M), AKSHAY (V R), SUDAKSHINA (B), Effect of Annealing Temperature on The Size and Magnetic MUTTA (G R), VASUNDHARA (M). Properties of CoFe2O4 Nanoparticle. Investigation on the Structural, Magnetic and Magnetocaloric AIP Conference Proceedings, 2018, 1953(1):030162 Properties of Nanocrystalline Pr-Deficient Pr1-x SrxMnO3−δ Manganites. 19. ANNROSE SUNNY, ANEESH KUMAR (K S), VARSHA (K), Journal of Magnetism and Magnetic Materials, 2018, 448:322- AATHIRA (M), MUTTA (G R), MAITI (K K), RAGHAVENDRA 331 REDDY (V), VASUNDHARA (M). Magnetic Properties of Biocompatible CoFe2O4 Nanoparticles 28. ARUN (B), SUDAKSHINA (B), AKSHAY (V R), DEVI Using a Facile Synthesis. CHANDRASEKHAR (K), YANG (H D), VASUNDHARA (M). Nano-Structures & Nano-Objects, 2018, 16:69-76 Structural and Magnetic Behavior of (Ni, Cu) Substituted Nd0.67Sr0.33MnO3 Perovskite Compounds. 20. ANTONYRAJ (C A), AJIT HARIDAS. AIP Conference Proceedings, 2018, 1953(1):120016 A Lignin-derived Sulphated Carbon for Acid Catalyzed Transformations of Bio-derived Sugars. 29. ARUN (B), SUNEESH (M V), SUDAKSHINA (B), AKSHAY (V Catalysis Communications, 2018, 104:101-105 R), CHANDRASEKHAR (K D), VASUNDHARA (M). Effect of Mn-site Substitution on Magnetic 21. ANUPAMA (C), ROUT (K), VASUNDHARA (M), JOSHI (S R), Ordering and Critical Behavior in JAI SINGH. Nd0.67Sr0.33 MnO3 Manganite. Structural and Magnetic Study of Undoped and Cobalt Doped Journal of Physics and Chemistry of Solids, TiO2 Nanoparticles. 2018, 123:327-335 RSC Advances, 2018, 8(20):10939-10947 30. ARUN (K B), JANU (C), VENUGOPAL (V V), 22. ANUPAMA (N), PREETHA RANI (M R), SHYNI (G L), RAGHU MADHAVANKUTTY (T S), NISHA (P). (K G). Spent Cumin Seeds Generated from Ayurvedic Industry as a Glucotoxicity Results in Apoptosis in H9c2 Cells Via Alteration Source of Bioactive Compounds for Nutraceutical/Functional in Redox Homeostasis Linked Mitochondrial Dynamics and Food Applications. Polyol Pathway and Possible Reversal with Cinnamic Acid. Journal of Food Processing and Preservation, 2018, Toxicology in Vitro, 2018, 53:178-192 42(1):e13392 23. ANUPAMA (N), SINDHU (G), RAGHU (K G). 31. ARUN (K B), MADHAVAN (A), RESHMITHA (T R), THOMAS Significance of Mitochondria on Cardiometabolic Syndromes. (S), NISHA (P). Fundamental and Clinical Pharmacology, 2018, 32(4):346-356 Musa Paradisiaca Inflorescence Induces Human Colon Cancer Cell Death by Modulating Cascades of Transcriptional Events. 24. ANUSREE (S S), SINDHU (G), PREETHA RANI (M R), RAGHU Food and Function, 2018, 9(1):511-524 (K G). Insulin Resistance in 3T3-L1 Adipocytes by TNF-Alpha 32. ARUN GOPI, SAJITHA (M), REETHU HARIDAS,LISTO is Improved by Punicic Acid Through Upregulation of VARGHESE, YOOSAF (K). Insulin Signalling Pathway and Endocrine Function, and Cooperative and FRET-Assisted Brightness Enhancement Downregulation of Proinflammatory Cytokines. in Oligo(phenylene ethynylene): Quantum Dot Organic- Biochimie, 2018, 146:79-86 Inorganic Nanohybrids. Chemistry - An Asian Journal, 2018, 13(11):1492 – 1499 25. ARINDAM MAL, MISHRA (R K), PRAVEEN (V K), ABDUL KHAYUM (M), BANERJEE (R), AJAYAGHOSH (A). 33. ARYA (A D), ELIZABETH JACOB. Supramolecular Reassembly of In Silico Prediction of ErbB Signal Activation from Receptor Self-Exfoliated Ionic Covalent Organic Nanosheets for Label- Expression Profiles Through a Free Detection of Double-Stranded DNA. Data Analytics Pipeline. Angewandte Chemie-International Edition, 2018, 57(28):8443- Journal of Biosciences, 2018, 43(2):295-306 8447 34. ASHITHA (K T), PRAVEEN KUMAR (V), FATHIMATH 26. ARUN (B), AKSHAY (V R), VASUNDHARA (M). SALFEENA (C T), SASIDHAR (B S). Observation of Enhanced Magnetocaloric Properties With BF3•OEt2-Mediated Tandem Annulation: A Strategy To A-Site Deficiency in Construct Functionalized Chromeno- and Pyrano-Fused La 0.67Sr 0.33MnO3 Manganite. Pyridines. Dalton Transactions, 2018, 47(43):15512-15522 The Journal of Organic Chemistry, 2018, 83(1):113-124 National Institute for Interdisciplinary Science & Technology 115 115 Annual Report 2018-19 35. ASWATHI (K), JASNAMOL (P P), MANOJ RAAMA VARMA. 44. BALAMURUGAN (K), UTHAYAKUMAR (M), SANKAR (S), Griffiths-like Phase in High T-C Perovskite La2FeReO6 HAREESH (U S), WARRIER (K G K). Prepared in a Controlled Reducing atmospheren. Effect of Abrasive Waterjet Machining on LaPO4/Y2O3 AIP Conference Proceedings, 2018, 1953(1):120041 Ceramic Matrix Composite. Journal of the Australian Ceramic Society, 2018, 54(2):205-214 36. ASWATHY (B A), PRABHAKAR RAO (P), SUCHITHRA (V G). New Perovskite Type Orange Red Emitting Phosphors, 45. BALAMURUGAN (K), UTHAYAKUMAR (M), SANKAR (S), HAREESH (U S), WARRIER (K G K). SrGd0.5Nb0.5O3:xEu3+ For WLED Applications. Modeling and Surface Texturing on Surface Roughness in Materials Letters, 2018, 229:182-184 Machining LaPO4-Y2O3 Composite. Materials and Manufacturing Processes, 2018, 33(4):405-413 37. ASWATHY (U), KATHIRESAN (S), ARUMUGAM (M). Kinetin and Gibberellic Acid (GA3) Act Synergistically 46. BALAMURUGAN (K), UTHAYAKUMAR (M), SANKAR (S), to Produce High Value Polyunsaturated Fatty Acids in HAREESH (U S), WARRIER (K G K). Nannochloropsis Oceanica CASA CC201. Preparation, Characterisation and Machining Of LaPO4-Y2O3 Algal Research-Biomass Biofuels and Bioproducts, 2018, Composite By Abrasive Water Jet Machine. 32:182-192 International Journal of Computer Aided Engineering and Technology, 2018, 10(6):684-697 38. ASWATHY (V S), MANOJ RAAMA VARMA, SANKAR (C R). Electronic Structure and Low Temperature Magnetoresistance 47. BHAGYANATHAN (C), KARUPPUSWAMY (P), RAGHU (R), of Polycrystalline TlMQ2 (M = Sc, Bi, Q = Se, Te). GOWTHAM (S), RAVI (M). AIP Conference Proceedings, 2018, 1953(1):080030 Recycling of LM25 Aluminum Alloy Scraps. Materialprufung/Materials Testing, 2018, 60(9):848-854 39. ASWATHY (V S), SANKAR (C R). Low Temperature Thermoelectric and Magnetoresistive 48. BHUI (I), MATHEW (A K), CHAUDHURY (S), Properties of Tl2Cu3FeQ4 (Q = S, Se, Te). BALACHANDRAN (S). Inorganic Chemistry Frontiers, 2018, 5(7):1553-1562 Influence of Volatile Fatty Acids in Different Inoculum to Substrate Ratio and Enhancement of Biogas Production Using 40. ATHIRA (K V R), PRABHAKAR RAO (P), SREENA (T S), AJU Water Hyacinth and Salvinia. THARA (T R). Bioresource Technology, 2018, 270:409-415 Pigmentary Colors From Yellow to Red in Bi2Ce2O7 by Rare Earth Ion Substitutions as Possible High NIR Reflecting 49. BIJINA (P V), SURESH (C H), GADRE (S R). Pigments. Electrostatics for Probing Lone Pairs and Dyes and Pigments, 2018, 160:177-187 Their Interactions. Journal of Computational Chemistry, 41. ATHIRA (K V R), PRABHAKAR RAO (P), SREENA (T S),. 2018, 39(9):488-499 Broad Greenish-Yellow Luminescence in CaMoO4 by Si4+ Acceptor Doping as Potential phosphors for White Light 50. BISWAPRIYA DEB, GAYATHI (P T G), SAJITHA (S). Emitting Diode Applications. Electrochemistry of Transition Metal Oxide Based Mountable Journal of Materials Science - Materials in Electronics, 2018, Electrochromic Devices. 29(19):16647-16653 ECS Transactions, 2018, 85(7):91-105 42. ATHIRA (K), VIBHUDARSHAN, SURESH (C H), NARAYANAN 51. BOBBA (K N), SARANYA (G), ALEX (S M), NITHYA (V), MAITI UNNI (K N), LUXMI VARMA (R). (K K), BHUNIYA (S). Solution Processable Carbazole Derivatives for Dopant SERS-Active Multi-Channel Fluorescent Probe for NO: Guide Free Single Molecule White Electroluminescence by Room to Discriminate Intracellular Biothiols. Temperature Phosphorescence. Sensors and Actuators B: Chemical, 2018, 260:165-173 Journal of Photochemistry and Photobiology A - Chemistry, 2018, 360:249-254 52. BONAM (S R), GORANTLA (J N), ARUN KUMAR (T), LANKALAPALLI (R S), SAMPATH KUMAR (H M). 43. AWASTHEEA (N), RAIA (V), VERMA (S S), SAJIN (F K), Polyhydroxy-N-Alkyl-2-Pyrrolidinones as a New Class of MANGALAM S NAIR, GUPTA (S C). Glycolipid Analogues with Immune Modulation Potential. Anti-Cancer Activities of Bharangin Against Breast Cancer: Journal of Carbohydrate Chemistry, 2018, 37(1):30-43 Evidence for the Role of NF-kB and lncRNAs. Biochimica et Biophysica Acta (BBA) - General Subjects, 2018, 1862(12):2738-2749 116 National Institute for Interdisciplinary Science & Technology 116 Annual Report 2018-19 53. CHANDRASEKARAN (S), AJAYAGHOSH (A), SURESH DAS. 62. GAYATHRI (T), VIJAYALAKSHMI (A), SREEJITH (M), JOSHY JOSEPH, Photochemistry, Photophysics and Photobiology. MADHUSUDHANA RAO (N), SINGH (S P). Journal of Chemical Sciences, 2018, 130(10):148 Study on Liposomal Encapsulation of New Bodipy Sensitizers for Photodynamic Therapy. 54. CHETHANA (K R), SASIDHAR (B S), NAIKA (M), KERI (R S). ACS Medicinal Chemistry Letters, 2018, 9(4):323-327 Phytochemical Composition of Caesalpinia Crista Extract As Potential Source For Inhibiting Cholinesterase and β-Amyloid 63. GAYATHRI PRABHU (T G), SAJITHA (S), VIJITHA (I), SHAIJU Aggregation: Significance To Alzheimer’s Disease. (S), REMYA (R), BISWAPRIYA DEB. Asian Pacific Journal of Tropical Biomedicine, 2018, 8(10): 500- Tuning of Physical and Electrochemical properties of 512 Nanocrystalline Tungsten Oxide Through Ultraviolet Photoactivation. 55. DAVIS DELLA (T), SURESH (C H). Electrochimica Acta, 2018, 272:135-143 Anion-Encapsulating Fullerenes Behave As Large Anions: A 64. GAYATHRI PRABHU (T G), SHAIJU (S S), REMYA (R), DFT Study. BISWAPRIYA DEB. Physical Chemistry Chemical Physics, 2018, 20(38):24885- Hydrated tungsten oxide nanosheet electrodes for broadband 24893 electrochromism and energy storage. Materials Today Energy, 2018, 10:380-387 56. DHANYA (B P), GREESHMA (G), SASIKUMAR (P), NEETHU (S), MEENU (M T), SHARATHNA (P), JUBI JOHN, SUNIL VARUGHESE, SABU (M), DAN (M), RADHAKRISHNAN (K V). 65. GEETA (M G), RIYAZ (A), KRISHNAN (C), SCARIA (V). Rapid Transition of Facial Features from Early to Mid - Lewis-Acid-Catalyzed Activation of Zerumbone towards Adolescence in Autosomal Dominant Hyper IgE Syndrome Sesquiterpenoid Derivatives: Sustainable Utilization of with a STAT3 Variation. Abundant Natural Resources for the Synthesis of Chemically Indian Journal Of Pediatrics, 2018, 85(7):595-596 Diverse Architectures. Asian Journal of Organic Chemistry, 2018, 7:471 – 476 66. GEORGE (G), SISUPAL (SB), TOMY (T), KUMARAN (A), VADIVELU (P), SUVEKBALA (V), SIVARAM (S), RAGUPATHY (L). 57. DIJITH (K S), AISWARYA (R), PILLAI (S), SURENDRAN (K P). Facile, Environmentally Benign and Scalable Approach to Polyol Derived Ni and NiFe Alloys For Effective Shielding of Produce Pristine Few Layers Graphene Suitable for Preparing Electromagnetic Interference. Biocompatible Polymer Nanocomposites. Materials Chemistry Frontiers, 2018, 2(10):1829-1841 Scientific Reports, 2018, 8(1):11228 58. DIVYA (S), PRABHAKAR RAO (P), ATHIRA (K V R), AJU 67. GHOSH (A), DASH (S), SRINIVASAN (A), SAHU (M S R), THARA (T R). SURESH (C H), CHANDRASHEKAR (T K). Intense Blue Colors in Wolframite-Type Co2+:MgWO4 Oxides 24π Core‐Modified Nonfused Pentaphyrin with Möbius Through Distortion in Co2+ Octahedra. Aromaticity ChemistrySelect, 2018, 3(2):410-417 Chemistry - A European Journal, 2018, 24(68):17997-18002 59. FATHIMATH SALFEENA (C T), BASAVARAJA, ASHITHA (K 68. GHOSH (S), SAEKI (A), PRAVEEN (V K), AJAYAGHOSH (A). T), PRAVEEN KUMAR (V), SUNIL VARUGHESE, SURESH (C A Hybrid Organogel of a Low Band Gap Diketopyrrolopyrrole H),SASIDHAR (B S). with PC71BM: Phase Separated Morphology and Enhanced Synthesis of Symmetrical and Unsymmetrical Triarylpyrylium Photoconductivity. Ions Via An Inverse Electron Demand Diels -Alder Reaction. ChemNanoMat, 2018, 4:831-836 Chemical Communications, 2018, 54(88):12463-12466 69. HANNA (B), SURENDRAN (K P), NARAYANAN UNNI (K N). 60. GAYATHRI (T H), YAREMCHENKO (A A), MACIAS (J), Low Temperature-Processed ZnO Thin Films for p-n Junction- ABHILASH (P), ANANTHAKUMAR (S). Based Visible-Blind Ultraviolet Photodetectors. Magnesium-Doped Zircon-Type Rare-Earth Orthovanadates: RSC Advances, 2018, 8(65):37365-37374 Structural and Electrical Characterization. Ceramics International, 2018, 44(1):96-103 70. HARSHA (N), MANU JOSE, SRIRAM (K), SHUKLA (S). Hydrothermal Synthesized Magnetically Separable 61. GAYATHRI (T H), YAREMCHENKO (A A), ZAKHARCHUK (K), Mesostructured H2Ti3O7/ Y-Fe2O3 Nanocomposite For ABHILASH (P), ANANTHAKUMAR (S). Organic Dye Removal via Adsorption and Its Regeneration Impact of Acceptor-Type Substitution on Electrical Transport / Reuse Through Synergistic Non-Radiation Driven H2O2 Properties of Zircon-Type EuVO4. Activation. Journal of the European Ceramic Society, 2018, 38(1):145-151 Environmental Science and Pollution Research, 2018, 25:20304-20319 National Institute for Interdisciplinary Science & Technology 117 117 Annual Report 2018-19 71. HEMAVATHI (B), JAYADEV (V), PRADHAN (S C), GOKUL (G), 80. JASNAMOL (P P), RIJILA (M), PAULOSE (A P), SANKAR (C R). JAGADISH (K), RAMAMURTHY (P C), NARAYANAN UNNI (K Collective Dipolar Relaxations in a Molecular Nanomagnet, N), AHIPA (T N), SURAJ SOMAN, BALAKRISHNA (R G). Mn12-Acetate. Aggregation Induced Light Harvesting of Molecularly Journal of Magnetism and Magnetic Materials, 2018, Journal Engineered D-A-π-A Carbazole Dyes for Dye-Sensitized Solar of Magnetism and Magnetic Materials Cells. Solar Energy, 2018, 174:1085-1096 81. JASNAMOL (P P), SANKAR (C R), MANOJ RAAMA VARMA. Memory and Aging Effects of Molecular Nanomagnet Mn12 72. INDU (S T), MANISH KUMAR, VARJANI (S J), WU (Y), Benzoate. GNANSOUNOU (E), SINDHU (R). AIP Conference Proceedings, 2018, 1953(1):120050 Sequestration and Utilization of Carbon Dioxide by Chemical and Biological Methods for Biofuels and Biomaterials by 82. JASNAMOL (P P), SANKAR (C R), PAULOSE (A P), MANOJ Chemoautotrophs: Opportunities and Challenges. RAAMA VARMA. Bioresource Technology, 2018, 256:478-490 Hopping Conduction and Spin Glass Behavior of La2FeMnO6. Journal of Alloys and Compounds, 2018, 743:403-409 73. INDUJA (I J), SEBASTIAN (M T). Microwave Dielectric Properties of Cold Sintered Al2O3-NaCl 83. JASNAMOL (P P), SANKAR (C R), PAULOSE (A P), VALANT Composite. (M), ARTEM (B), MANOJ RAAMA VARMA. Materials Letters, 2018, 211:55-57 Unusual Magnetodielectric Effects in La2CuMnO6 Induced by a Dynamic Crossover in Dielectric Relaxation at TC. 74. INDUJA (I J), VARMA (M R), SEBASTIAN (M T). Materials Research Bulletin, 2018, 100:226-233 Mineral Sillimanite-Based Hard Substrates for HTCC Applications. 84. JATISH KUMAR, GEORGE THOMAS (K). Journal of Electronic Materials, 2018, 47(10):6171-6176 Probing The Bilayer-Monolayer Switching of Capping Agents On Au Nanorods and its Interaction With Guest Molecules. 75. IRFANA JESIN (C P), NANDI (G C). Journal of Chemical Sciences, 2018, 130(10):138 Catalyst-Controlled Dual Reactivity of Sulfonimidamides: Synthesis of Propargylamines and N-Propargyl 85. JATISH KUMAR, WEI (X), BARROW (S J), FUNSTON (A M), Sulfonimidamides. GEORGE THOMAS (K), MULVANEY (P). Chemistry - A European Journal, 2018, 25:743-749 Coupled Plasmon Resonances and Gap Modes in Laterally Assembled Gold Nanorod Arrays. 76. JAMSHEENA (V), MISHRA (R K), VEENA (K S), SINI (S), Zeitschrift für Physikalische Chemie, 2018, 232(9):1607-1617 JAYAMURTHY (P), LANKALAPALLI (R S). New 1,2-Dihydropyridine-Based Fluorophores and Their 86. JAYAKUMAR (E), PRAVEEN (A P), RAJAN (T P D), PAI (B C). Applications as Fluorescent Probes. Studies on Tribological Characteristics of Centrifugally Cast ACS Omega, 2018, 3(1):856-862 SiCp-Reinforced Functionally Graded A319 Aluminium Matrix Composites. 77. JANARSHANAN (J C), MISHRA (R K), DAS (G), SINI Transactions of the Indian Institute of Metals, 2018, (S), JAYAMURTHY (P), SURESH (C H), PRAVEEN (V K), 71(11):2741-2748 NARAYANAPILLAI (M), BABU (B P). Functionalizable 1H-Indazoles by Palladium CatalyzedAza- 87. JEEN MARIA (M), SANTHOSH (B), PEER MOHAMED (A), Nenitzescu Reaction: Pharmacophores to Donor-Acceptor ANANTHAKUMAR (S). TypeMulti-Luminescent Fluorophores. Design and Fabrication of Flexible Poly(Vinyl Chloride) Asian Journal of Organic Chemistry, 2018, 7(10):2094-2104 Dielectric Composite Reinforced with ZnO Microvaristors. Journal of Applied Polymer Science, 2018, 135(12):46031 78. JASNAMOL (P P), ASWATHI (T V), SANKAR (C R), MANOJ RAAMA VARMA. 88. JOSE (A A), ANUSREE (G), PANDEY (A), BINOD (P). Structural, Magnetic, and Magnetotransport Properties of Production Optimization of Poly-γ-Glutamic Acid by Bacillus LaFe0.5Ni0.5O3. Amyloliquefaciens Under Solid-State Fermentation Using Soy Ceramics International, 2018, 44(18):22401-22405 Hull as Substrate. Indian Journal of Biotechnology, 2018, 17(1):44-49 79. JASNAMOL (P P), REDDY (C O), PAULOSE (A P), SANKAR (C R). Surface Spin Tunneling and Heat Dissipation in Magnetic Nanoparticles. Materials Research Express, 2018, 5(3):036101 118 National Institute for Interdisciplinary Science & Technology 118 Annual Report 2018-19 89. JOSEPH (M M), NARAYANAN (N), NAIR (J B), 98. KRISHNAN (J), ANU JOSE, SASIDHAR (B S), SURESH KARUNAKARAN (V), RAMYA (A N), SUJAI (P T), SARANYA (E), MENON (R S), NAIR (V). (G), ARYA (J S), VIJAYAN (V M), MAITI (K K). An Uncommon Multicomponent Reaction Involving Exploring the Margins of SERS in Practical Domain: An Nucleophilic Heterocyclic Carbenes: Facile Synthesis of Fully Emerging Diagnostic Modality For Modern Biomedical Substituted Cyclopentanones. Applications. Inorganic Chemistry Frontiers, 2018, 5(7):1202-1208 Biomaterials, 2018, 181:140-181 99. KRISHNAN (R), KRISHNAN (S B), BALAN (B), GOPIDAS 90. JYOTI (R), ANJU (R), CHAUDHARY (A), PANDA (M K), (K R). RANJAN (P). Self-assembly and photoinduced electron transfer in a donor- Polymorphism in Sn(IV)-Tetrapyridyl Porphyrins with a β -cyclodextrin-acceptor supramolecular system§ . Halogenated Axial Ligand: Structural, Photophysical, and Morphological Study. Journal of Chemical Sciences, 2018, 130(10):134 Crystal Growth and Design, 2018, 18(3):1437-1447 100. KRISHNAN (R), LANG (E), MIDHA (S), PATIL (P B), 91. KARTHIK (N), BINOD (P), PANDEY (A). RAMESHKUMAR (N). SSF Production, Purification and Characterization of Chitin Isolation and Characterization of a Novel Deacetylase from Aspergillus Flavus. 1-Aminocyclopropane-1-Carboxylate (ACC) Deaminase Biocatalysis and Biotransformation, 2018, 36(4):296-306 Producing Plant Growth Promoting Marine Gammaproteobacteria From Crops Grown in Brackish 92. KAVIL (J), ANJANA (P M), PERIYAT (P), RAKHI (R B). Environments. Proposal for Pokkaliibacter Plantistimulans One-Pot Synthesis of g-C3N4/MnO2 and g-C3N4/SnO2 Hybrid Gen. Nov., Sp. Nov., Balneatrichaceae Fam. Nov. in the Order Nanocomposites for Supercapacitor Applications. Oceanospirillales and an Emended Description of The Genus Sustainable Energy & Fuels, 2018, 2(10):2244-2251 Balneatrix.. Systematic and Applied Microbiology, 2018, 41(6):570-580 93. KAVIL (J), ANJANA (P M), PERIYAT (P), RAKHI (R B). Titania Nanotubes Dispersed Graphitic Carbon 101. KRISHNAN (S B), KRISHNAN (R), GOPIDAS (K R). Nitride Nanosheets as Efficient Electrode Materials for Effect of N-Alkyl Substituents on the Hierarchical Self- Supercapacitors. Assembly of beta-Cyclodextrin-Linked Pyrene-Pyromellitic Journal of Materials Science - Materials in Electronics, 2018, Diimide Charge-Transfer Complexes. 29(19):16598-16608 Chemistry - A European Journal, 2018, 24(44):11451-11460 94. KNYAZEV (Y U V), LUKOYANOV (A V), YU.I. KUZ’MIN (Y U I), 102. KUMAR (M P), LATHIKA (L M), MOHANACHANDRAN KUCHIN (A G), VASUNDHARA (M),. (A P), RAKHI (R B). The Influence of Copper Impurity on the Electronic Structure A High-Performance Flexible Supercapacitor Anode Based On and Optical Properties of TmNi5 Compound. Polyaniline/Fe3O4 Composite@Carbon Cloth. Optics and Spectroscopy, 2018, 124(6):784-788 ChemistrySelect, 2018, 3(11):3234-3240 95. KNYAZEV (YU V), LUKOYANOV (A V), KUZMIN (YU I), 103. LEKSHMI (D R), THOMAS LETANG , SURENDRAN (K VASUNDHARA (M). P). The Structure of Electronic States and Optical Properties of High Permittivitty (La 0.5 Sr 0.5 )CoO 3- δ - La(Co 0.5 Ti 0.5 )O Cr80Al20 Compound. 3- δ Ceramic Composites For Optics and Spectroscopy, 2018, 125(2):195-198 Next Generation MIM Capacitors. Journal of the European Ceramic Society, 2018, 38(11):3853- 96. KOTTUPARAMBIL (R R), BONTHA (S), RANGARASAIAH (R 3860 M), ARYA (S B), ANURADHA JANA, MITUN DAS, BALLA (V K), SRINIVASAN (A), PRABHU (T R). 104. LU (C H), YANG (C Y), SUDIPTA (S), DAS (S). Effect Of Zinc and Rare-Earth Element Addition On Facile Synthesis and Spectroscopic Characterization of Mechanical, Corrosion, and Biological Properties of Siliconitride Phosphors for White Light-Emitting Diodes. Magnesium. Journal of the American Ceramic Society, 2018, 101:4916-4920 Journal of Materials Research, 2018, 33(20): 3466-3478 105. MAEDA (T), NGUYEN (T V), KUWANO (Y), XIXI CHEN, 97. KRISHNAN (A), VARATHAN (E), SREEDEVI (P), MIYANAGA (K) HIROYUKI NAKAZUMI, YAGI (S)), SUBRAMANIAN (V), VENUGOPAL (K), LUXMI VARMA (R). SURAJ SOMAN, AJAYAGHOSH (A). Design, Synthesis and Photophysical Investigation of Intramolecular Exciton-Coupled Squaraine Dyes for Dye- Triphenylamine-bithiophene Dyes as RGB Emitters For White Sensitized Solar Cells. Light Applications. Journal of Physical Chemistry C, 2018, 122 (38):21745-21754 Dyes and Pigments, 2018, 159:77-84 National Institute for Interdisciplinary Science & Technology 119 119 Annual Report 2018-19 106. MAIMUNNISA(S), GORE(P), RAJAN (T P D), RAJA (V S). Chemical Composition and Cytotoxicity of Garcinia Rubro- Role of Centrifugal Casting on Electrochemical Corrosion Echinata, A Western Ghats Endemic Species. Behavior of A356-SiCp Composite in 3.5 wt.% NaCl. Natural Product Communications, 2018, 13(11):1497-1499 Journal of Materials Engineering and Performance, 2018, 27(8):4224-4210 114. MINJU (T), RAJITH (I), SREEKUMAR (K),NAIR (B N), MOHAMED (A P), ANILKUMAR (G M), YAMAGUCHI 107. MANASH (G), MASTO (R E), JOSHY GEORGE, (T), HAREESH (U S). BALACHANDRAN (S). Morphological Ensembles of N-Doped Porous Carbon Derived Exposure and Cancer Risk Assessment of Polycyclic Aromatic from ZIF-8/Fe-Graphene Nanocomposites: Processing and Hydrocarbons (PAHs) in the Street Dust of Asansol City, India. Electrocatalytic Studies. Sustainable Cities and Society, 2018, 38:616-626 Chemistry Select, 2018, 3(30):8688-8697 108. MANASH (G), MASTO (R E), JOSHY GEORGE, 115. MOHAN (B), SALFEENA (C T F), ASHITHA (K T), BALACHANDRAN (S). KRISHNAN (G V), ABDUL RASHEED (S J), VARGHEESE (A M), PATIL (S A), DILEEP KUMAR (B S), SASIDHAR (B Tracing Source, Distribution and Health Risk of Potentially S). Harmful Elements (PHEs) in Street Dust of Durgapur, India. Functionalized Pyrimidines from Alkynes and Nitriles: Ecotoxicology and Environmental Safety, 2018, 154:280-293 Application towards the Synthesis of Marine Natural Product 109. MANDAL (S), MAITI (K K), AVIJIT (B), PRANGE (T), Meridianin Analogs. NEUMAN (A), NIVEDITA (A). Chemistry Select, 2018, 3(23):6394-6398 Experimental and DFT Studies for Substituent Effects on 116. MORANG (P), DEVI (S P), JHA (D K), DUTTA (B K), Cycloadditions of C,N-Disubstituted Nitrones to Cinnamoyl DILEEP KUMAR (B S). Piperidine. Tea Root Brown-Rot Fungus Disease Reduction and Yield Indian journal of chemistry section B- Organic chemistry Recovery With Rhizobacteria Inoculation in Both Nursery and including medicinal chemistry, 2018, 57(1):108-119 Field Trials. 110. MANJUNATHA (K), KOLEY (T S), VISHAL (K), DATEER Rhizosphere, 2018, 6:89-97 (R B), GEETHA (B), SASIDHAR (B S), PATIL (S A), PATIL (S A). 117. MOREIRA (R L), LOBO (R P S M), RAMOS (S L L M), SEBASTIAN (M T), MATINAGA (F M), ARIETE RIGHI, Magnetic Nanoparticle-Tethered Schiff Base-Palladium(II): DIAS (A). Highly Active and Reusable Heterogeneous Catalyst for Raman and Infrared Spectroscopic Investigations of a Suzuki-Miyaura Cross-Coupling and Reduction of Nitroarenes Ferroelastic Phase Transition in Ba2ZnTeO6 Double Perovskite. in Aqueous Medium at Room Temperature. Physical Review Materials, 2018, 2(5):054406 Applied Organometallic Chemistry, 2018, 32:e4266 118. MRINALINI (M), ACHARY (B S), GHOSH (S), 111. MANU JOSE, SRIRAM (K), RESHMA (R), VIDYA (UV), KOTESHWAR (D), SEELAM PRASANTHKUMAR, SHUKLA (S). GIRIBABU (L). Synergistic Persulfate Activation as an Efficient and Cost- Unveiling the Reversibility of Crystalline-Amorphous Effective Approach For Removal of Organic Synthetic-Dyes Nanostructures via Sonication-Induced Protonation. From Aqueous Solutions Using Magnetic Pd-Fe3O4-Flyash Journal of Physical Chemistry C, 2018, 122(18):10255-10260 Composite Particles as Catalyst. Journal of Environmental Chemical Engineering, 2018, 6:3709- 119. MUKHOPADHYAY (R D), DAS (G), AJAYAGHOSH (A). 3717 Stepwise Control Of Host-Guest Interaction Using a Coordination Polymer Gel. 112. MARYDASAN (B), MADHURI (B), CHERUKOMMU Nature Communications, 2018, 9:19871.754861111 (S), JOSE (J), VIJI (M), KARUNAKARAN (S C), CHANDRASHEKAR (T K), RAO (K S), RAO (C M), RAMAIAH (D). 120. NAEEM (K C), NAIR (V C). Reversible Switching of Solid-state Luminescence by Heat- In Vitro and In Vivo Demonstration of Human-Ovarian- induced Interconversion of Molecular Packing. Cancer Necrosis through a Water-Soluble and Near-Infrared- Molecular Systems Design and Engineering, 2018, 3(1):142-149 Absorbing Chlorin. Journal of Medicinal Chemistry, 2018, 61(11):5009-5019 121. NANDI (G C), IRFANA JESIN. 113. MENON (L N), SINDHU (G), RAGHU (K G), Direct Synthesis of N-Acyl Sulfonimidamides and RAMESHKUMAR (K B). NSulfonimidoyl Amidines from Sulfonimidoyl Azides. Advanced Synthesis & Catalysis, 2018, 360:2465-2469 120 National Institute for Interdisciplinary Science & Technology 120 Annual Report 2018-19 130. PANDA (M K), NAYANA (R), ASHA (A P), PRAKASHAM (A P). 122. NIKOLAOU (V), CHARISIADIS (A), SOFIA (C), High Contrast Mechanochromic and Thermochromic ALEXANDROPOULOS (I), PRADHAN (S C), SURAJ SOMAN, PANDA (M K), COUTSOLELOS (A G). Luminescence Switching by a Deep Red Emitting Organic Crystal. Enhancement of the Photovoltaic Performance in D3A Cryst Eng Comm, 2018, 20:6046-6053 Porphyrin-Based DSCs by Incorporating an Electron Withdrawing Triazole Spacer. 131. PANDA (T), MAITI (D K), PANDA (M K). Polyhedron, 2018, 140:9-18 Inkless Writing and Self-Erasing Security Feature of (Z)-1,2- 123. NISHANT GOPALAN, NAMPOOTHIRI (K M). Diarylacrylonitrile-Based Materials: A Confidential Data Communication. Biorefining of Wheat Bran For The Purification of Ferulic Acid. ACS Applied Materials & Interfaces, 2018, 10:29100-29106 Biocatalysis and Agricultural Biotechnology, 2018, 15:304-310 132. PANWAR (N), JOBY (J P), SURENDRA KUMAR, 124. NISHY (P), RENUKA (S). COONDOO (I), VASUNDHARA (M), NITU KUMAR, A Scientometric Examination of the Water Quality Research in RATNAKAR (P), RAHUL (S), KATIYAR (R S). India. Observation of Magnetization Reversal Behavior in Environmental Monitoring and Assessment, 2018, 190(4):225 Sm0.9Gd0.1Cr0.85Mn0.15O3 orthochromites. AIP Advances, 2018, 8(5):055818 125. NITHA (P R), JOSEPH (M M), GREESHMA (G), MAITI (K K), RADHAKRISHNAN (K V), DAS (P). 133. PANWAR (N), SURENDRA KUMAR, COONDOO (I), Chloroform as a Carbon Monoxide Source in Palladium- VASUNDHARA (M), NITU KUMAR. Catalyzed Synthesis of 2-Amidoimidazo [1,2-a]Pyridines. Low Temperature Magnetic and Magnetocaloric Studies in Organic and Biomolecular Chemistry, 2018, 16(35):6430-6437 YCr0.85Mn0.15O3 Ceramic. Physica B: Condensed Matter, 2018, 545:352-357 126. OKAMURA (N), MAEDA (T), FUJIWARA (H), ANJALY (S), NARAYANAN UNNI (K N), AJAYAGHOSH (A), YAGI 134. PARVATHY (S V), SALINI (C), VENKATESWARAN (G), (S). SANTHOSH (R), KIRAN KUMAR (M), PANDEY (A), Photokinetic Study on Remarkable Excimer Phosphorescence BINOD (P). from Heteroleptic Cyclometalated Platinum(II) Complexes Optimization of Process Parameters for the Production of Bearing a Benzoylated 2-Phenylpyridinate Ligand. γ -Linolenic Acid by Cunninghamella elegans CFR C07 in Physical Chemistry Chemical Physics, 2018, 20(1):542-552 Submerged Fermentation. 127. ORLOWSKA (E), BABAK (M V), DOMOTOR (O), ENYEDY Food Technology and Biotechnology, 2018, 56(1):96-100 (E A), RAPTA (P), ZALIBERA (M), BUCINSKY (L), MAL?EK (M), GOVIND (C), VENUGOPAL (K), FARID (Y 135. PAUL (A K), JAYARAM (D T), SANEESH BABU (P S), C S), MCDONNELL (T E), LUNEAU (D), SCHANIEL (D), ADARSH (N), SHAMEEL THURAKKAL, ASHA NAIR (S), ANG (W H), ARION (V B).. RAMAIAH (D). NO Releasing and Anticancer Properties of Octahedral Synthesis and In Vitro Photobiological Studies of Porphyrin Ruthenium-Nitrosyl Complexes with Equatorial 1H-Indazole Capped Gold Nanoparticles. Ligands. Journal of Chemical Sciences, 2018, 130(10):133 Inorganic Chemistry, 2018, 57(17):10702-10717 136. POOJA (R K), JOSEPH (M M), ABDUL SALAM (A A), SREELEKHA (T T), DHANYA (S), BISWAS (S), PAI (K S R). 128. PANCRECIOUS (J K), DEEPA (J P), VARANYA JAYAN, ULAETO (S B), RAJAN (T P D), PAI (B C). Erratum: Bisindole-Oxadiazole Hybrids, T3P®- Nanoceria Induced Grain Refinement In Electroless Ni-B- Mediatedsynthesis and Appraisal of Their Apoptotic, CeO2 Composite Coating for Enhanced Wear and Corrosion Antimetastatic and Computational Bcl-2 Binding Potential. Resistance of Aluminium Alloy. Journal of Biochemical and Molecular Toxicology, 2018, Surface and Coatings Technology, 2018, 356:29-37 32(11):e22212 129. PANCRECIOUS (J K), ULAETO (S B), RAMYA (R), RAJAN 137. PRABHA (B), NEETHU (S), KRISHNAN (S L), SHERIN (T P D), PAI (B C). (D R), MADHUKRISHNAN (M), ANANTHAKRISHNAN (R), RAMESHKUMAR (K B), MANOJKUMAR (T K), Metallic Composite Coatings by Electroless Technique - a JAYAMURTHY(P), RADHAKRISHNAN (K V). Critical Review. Antidiabetic Potential of Phytochemicals Isolated From The International Materials Reviews, 2018, 63(8):488-512 Stem Bark of Myristica Fatua Houtt. var. magnifica (Bedd.) Sinclair. Bioorganic & Medicinal Chemistry Letters, 2018, 26(12):3461- 3467 National Institute for Interdisciplinary Science & Technology 121 121 Annual Report 2018-19 138. PRATHAPAN (A), SALIN RAJ (P), RANI (M P), RAGHU 147. RAJI (G R), UTHAMAN (B), JOB (R B), THOMAS (S), (K G). SURESH (K G), MANOJ RAAMA VARMA. Apoptosis In Angiotensin II-Stimulated Hypertrophic Cardiac Magnetocaloric Effect and Critical Behavior Study in NiMnSnIn Cells -Modulation By Phenolics Rich Extract Of Boerhavia Heusler Alloys. Diffusa L.. Intermetallics, 2018, 10:116-125 Biomedicine and Pharmacotherapy, 2018, 108:1097-1104 148. RAJKUMAR (P), PARK (J T), MADHUMITA (P), JATIS 139. PRATHEESH (K), ALLESU (K), JOSEPH (M A), RAVI (M). KUMAR (D), BHOJE GOWD (E), RAJSHEKHAR (K), High Cycle Fatigue Properties of near eutectic Al Si Piston MISHRA (A), KWAK (J), KIM (J H). Alloy. Transition-Metal-Based Layered Double Hydroxides Tailored Material Today proceedings, 2018, 5(2):406-8413 for Energy Conversion and Storage. Journal of Materials Chemistry A, 2018, 6(1):12-29 140. PREETHA RANI (M R), ANUPAMA (N), SREELEKSHMI (M), RAGHU (K G). 149. RANA (A), SHARMA (C), PRABHU (D D), MAHESH Chlorogenic Acid Attenuates Glucotoxicity in H9c2 Cells KUMAR, YOOSAF (K), SURESH DAS, SURESH CHAND, SINGH (R K). Via Inhibition of Glycation and PKC α Upregulation and Revealing Charge Carrier Dynamics in Squaraine:[6, Safeguarding Innate Antioxidant Status. 6]-Phenyl-C 71-Butyric Acid Methyl Ester Based Organic Solar Biomedicine and Pharmacotherapy, 2018, 100:467-477 Cells. 141. PRIYA (P), NIKHITHA (S O), ANAND (C), DIPIN NATH AIP Advances, 2018, 8(4):045302 (R S), KRISHNAKUMAR (B). Biomethanation of Water Hyacinth Biomass. 150. RANGANATHAN (P), GU (S). Bioresource Technology, 2018, 255:288-292 Numerical Simulation of Catalytic Upgrading of Biomass Pyrolysis Vapours in a FCC Riser. 142. PRIYADARSHI (R), SREEJITH (S), POPOVITZ-BIRO Fuel Processing Technology, 2018, 171:162-172 (R), COHEN (S R), KAPLAN - ASHIRI (I), DADOSH (T), LINDA (J W S), BOJANA (V), TENNE (R), LAHAV (M), 151. RANGANATHAN (P), SAVITHRI (S). VAN DER BOOM (M E). Computational Fluid Dynamics Simulation of Hydrothermal Decoration of Inorganic Nanostructures by Metallic Liquefaction of Microalgae in a Continuous Plug-flow Reactor. Nanoparticles to Induce Fluorescence, Enhance Solubility, and Bioresource Technology, 2018, 258:151-157 Tune Band Gap. Journal of Physical Chemistry C, 2018, 122(12):6748-6759 152. RAVEENDRAN (R L), SUDHA (J D). Design and Development of Biogel Through Hierarchical 143. PRIYADARSHI (R), SREEJITH (S), POPOVITZ-BIRO (R), Self-Organisation of Biomolecule for Sustainable Antibacterial COHEN (S R), PINKAS (I), TENNE (R), LAHAV (M), VAN Applications. DER BOOM (M E). Chemistry Select, 2018, 3(13):3825-3831 Tubular Hybrids: A Nanoparticle-Molecular Network. Langmuir, 2018, 34(7):2464-2470 153. REBELLO (S), ABRAHAM (A), MADHAVAN (A), SINDHU (R), BINOD (P), BAHULEYAN (A K), ANEESH 144. PUSHPENDRA KUMAR, SUDIPTA (S), PANDEY (M K), (E M), PANDEY (A). DAS (S), ANUPAMA (C), JAI SINGH. Non-Conventional Yeast Cell Factories For Sustainable Investigations on Optical Properties of ZnO Decorated Bioprocesses. Graphene Oxide (ZnO@GO) and Reduced Graphene Oxide FEMS Microbiology Letters, 2018, 365(21):1-10 (ZnO@r-GO). Journal of Alloys and Compounds, 2018, 744:64-74 154. REJITH (R G), SUNDARARAJAN (M). Combined Magnetic, Electrostatic, and Gravity Separation 145. RAJEEV (V R), PAULOSE (A K), NARAYANAN UNNI (K N). Techniques for Recovering Strategic Heavy Minerals from Ammonia Gas Detection Using Field-Effect Transistor Based Beach Sands. On A Solution-Processable Organic Semiconductor. Marine Georesources & Geotechnology, 2018, 36(8):959-965 Vacuum, 2018, 158:271-277 155. REJITHA (J R), SASIKUMAR (R), ELIZABETH JACOB. 146. RAJESH (R O), GODAN (T K), PANDEY (A), BINOD (P). Multiple Roles of Adenomatous Polyposis Coli Gene in Wnt Whole Cell Based Biocatalytic Production of 2,5-Furan Signalling - a Computational Model. Dicarboxylic Acid. Biosystems, 2018, 172:26-36 Indian Journal of Experimental Biology, 2018, 56(7):493-497 122 National Institute for Interdisciplinary Science & Technology 122 Annual Report 2018-19 156. REMYA (G S), SURESH (C H). 165. SALFEENA (C T F), RENJITHA (J), DAVIS (R), SURESH Assessment of the Electron Donor Properties of Substituted (E), SASIDHAR (B S). Phenanthroline Ligands in Molybdenum Carbonyl Complexes Synthesis of 1,2,4-Trisubstituted-(1H)-Imidazoles Through Using Molecular Electrostatic Potentials. Cu(OTf)2 -/I2-Catalyzed C-C Bond Cleavage of Chalcones and New Journal of Chemistry, 2018, 42(5):3602-3608 Benzylamines. ACS Omega, 2018, 3(7):8074-8082 157. REMYA (P R), SURESH (C H). Grubbs and Hoveyda-Grubbs Catalysts for Pyridine Derivative 166. SANDEEP (A), PRAVEEN (V K), RAO (D S S), KRISHNA Synthesis: Probing the Mechanistic Pathways Using DFT. PRASAD (S), AJAYAGHOSH (A). Molecular Catalysis, 2018, 450:29-38 Transforming a C3 -Symmetrical Liquid Crystal to a π-Gelator by Alkoxy Chain Variation. 158. REMYA (R), GAYATHRI PRABHU (T G), NARAYANAN ACS Omega, 2018, 3(4):4392-4399 UNNI (K N), BISWAPRIYA DEB. Physicochemical Studies on Nafion® Modified ZnO Interlayers 167. SANDEEP (C), VEDHANARAYANAN (B), DAS (G), for Enhanced Electron Transport in the Inverted Polymer Solar PRAVEEN (V K), AJAYAGHOSH (A). Cells. Self-Assembly of Bodipy-Derived Extended π-Systems. Chemistry Select, 2018, 3(35):9995 -10001 Bulletin of the Chemical Society of Japan, 2018, 91(1):100-120 159. RENJITHA (J), SHYNI (G L), PRAVEEN (V K), SALFEENA 168. SANDEEPA (K V), JOSHY JOSEPH. (C T F), ASHITHA (K T), KRISHNA RAO (VRD), Chiral Self-assembly of Fullerene Clusters on CT-DNA MANGALAM S NAIR, RAGHU (K G), SASIDHAR (B S). Templates. Discovery of Natural Product Derived Labdane Appended Faraday Discussions, 2018, 207:459-469 Triazoles as Potent Pancreatic Lipase Inhibitors. ACS Medicinal Chemistry Letters, 2018, 9(7):662-666 169. SANDEEPA (K V), REMYA (R), BISWAPRIYA DEB, JOSHY JOSEPH. 160. ROBBY (V), BAMBA (F), JONAS (W), JOICE (T), JEROEN Rational Synthesis of a Polymerizable Fullerene - Aniline (J), MEERVELT (L V), JUBI JOHN, WIM (D). Derivative: Study of Photophysical, Morphological and Sequential Ugi Reaction/Base-induced Ring Closing/ Photovoltaic Properties§. IAAC Protocol Toward Triazolobenzodiazepine-fused Journal of Chemical Sciences, 2018, 130(10):135 Diketopiperazines and Hydantoins. Beilstein Journal of Organic Chemistry, 2018, 14:626-633 170. SANDHYA (K S), REMYA (G S), SURESH (C H). 161. ROHINI (S), ASWANI (R), PRIYA (P), KRISHNAKUMAR Intermolecular Dihydrogen Bonding in VI, VII, and VIII Group (B), RADHAKRISHNAN (E K). Octahedral Metal Hydride Complexes With Water. Differential Modulation of Endophytic Microbiome of Ginger Journal of Chemical Sciences, 2018, 130:98 in the Presence of Beneficial Organisms, Pathogens and Both as Identified by DGGE Analysis. 171. SANTHAKUMAR (H), NAIR (R V), DIVYA (S P), SHENOY (S J), ANOOPKUMAR (T), AJAYAGHOSH (A), JAYASREE Current Microbiology, 2018, 75:1033-1037 (R S). Real Time Imaging and Dynamics of Hippocampal Zn2+ 162. ROSHIN (P), SREELEKSHMI (R V), MENON (A R R). Under Epileptic Condition Using a Ratiometric Fluorescent Cetyltrimethyl Ammonium Bromide Modified Kaolin as a Reinforcing Filler for Natural Rubber. Probe. Journal of Polymers and the Environment, 2018, 26(1):39-47 Scientific Reports, 2018, 8(1):9069 163. SAGARIKA (N), PRINCE (M V), ANJINEYULU (K), 172. SANTHINI (P V), SMRITHY (A S), IRFANA JESIN (C P), PANDISELVAM (R), SREEJA (R), SUNIL VARUGHESE, JUBI JOHN, RADHAKRISHNAN (K V). MATHEW (S M). Accessing Highly Functionalized Cyclopentanoids: Via a Characterization and Optimization of Microwave Assisted Process for Extraction of Nutmeg (Myristica fragrans Houtt.) Cascade Palladation Approach: Unprecedented Benzylic C-H Mace Essential Oil. Activation Towards Cyclopentenoindanes. Journal of Essential Oil Bearing Plants, 2018, 21(4):895-904 Chemical Communications, 2018, 54(24):2982-2985 164. SAHOO (D), SABEELA BEEVI (U), ASWINI KUMAR (O), 173. SANTHOSH (B), BABITHA (K B), JEEN MARIA (M), PANDEY (A), MEENA (S), RAJEEV K SUKUMARAN. PEER MOHAMED (A), ANANTHAKUMAR (S). Effect of Dilute Acid Pretreatment of Wild Rice Grass (Zizania Aqueous Mechanical Oxidation of Zn Dust: An Inventive Latifolia) from Loktak Lake for Enzymatic Hydrolysis. Technique for Bulk Production of ZnO Nanorods. Bioresource Technology, 2018, 253:252-255 ACS Sustainable Chemistry & Engineering, 2018, 6(1):143-154 National Institute for Interdisciplinary Science & Technology 123 123 Annual Report 2018-19 174. SARANYA (G), JOSEPH (M M), KARUNAKARAN (V), 182. SELVARAJ (N), VANDANA (S), BEJOYMOHANDAS (K NAIR (J B), SARITHA (V N), VEENA (V V), SUJATHAN S), DUAN (Y), ZHANG (J),. (K), AJAYAGHOSH (A), MAITI (K K). Influence of Branched Polyester Chains on the Emission Enzyme-Driven Switchable Fluorescence-SERS Diagnostic Behavior of Dipyridamole Molecule and Its Biosensing Ability. Nanococktail for the Multiplex Detection of Lung Cancer ACS Omega, 2018, 3:15530-15537 Biomarkers. ACS Applied Materials & Interfaces, 2018, 10 (45):38807-38818 183. SHAHABAZUDDIN (M), SARAT CHANDRA (T), MEENA (S), SUKUMARAN (R K), SHETTY (N P), 175. SARANYA (S), BAIJU (T V), GREESHMA (G), MUDLIAR (S N). RADHAKRISHNAN (K V). Thermal Assisted Alkaline Pretreatment of Rice Husk Lewis Acid Catalyzed Povarov Reaction of Pentafulvenes for Enhanced Biomass Deconstruction and Enzymatic and Spiro[2,4]-Hepta-[4,6]-Diene: An Efficient Access to Saccharification: Physico-Chemical and Structural Cyclopentene Fused Quinolines. characterization. Synthetic Communications, 2018, 48(7):816-829 Bioresource Technology, 2018, 263:199-206 176. SARANYA (S), GREESHMA (G), SMRITHY (A S), 184. SHAIJU (P), SANJEEVA MURTHY (N), BHOJE GOWD (E). RADHAKRISHNAN (K V). Nonsolvent-Induced Morphological Changes and Rhodium(III)-Catalyzed C-H Activation/Alkylation of Nanoporosity in Poly(l-Lactide) Films. Diazabicyclic Olefins with Aryl Ketones: Facile Synthesis of Soft Matter, 2018, 14(8):1492-1498 Functionalized Cyclopentenes. Synlett, 2018, 29(15): 2023-2026 185. SHAMEEL (T), ANJALY (S), NARAYANAN UNNI (K N), JOSHY JOSEPH, RAMAIAH (D). 177. SARANYA (S), SARATH CHAND (S), GREESHMA (G), Simple Solution Processable Carbazole-oxadiazole Hybrids for JIJITHA (V), RADHAKRISHNAN (K V). Un-doped Deep-blue OLEDs. A Facile Access to Trans-3-Styryl-4-hydrazinocyclopentenes Journal of Photochemistry and Photobiology A - Chemistry, via Palladium¬-Catalyzed Ring Opening of Diazanorbornenes 2018, 358:192-200 with (Z)-β-Bromostyrenes/2,3-Dibromohydrocinnamic Acids. Synthesis - Stuttgart, 2018, 50(01):184-192 186. SHAMEEL (T), SANJU (K S), ANJALY (S), NARAYANAN 178. SARITHA (S N), SYAM DAS (S), RESHMA (P N), INDIRA UNNI (K N), JOSHY JOSEPH, RAMAIAH (D). (M). Design and Synthesis of Solution Processable Green Supplementation of All Trans Retinoic Acid Ameliorates Fluorescent D-π-A Dyads for OLED Applications. Ethanol-induced Endoplasmic Reticulum Stress. New Journal of Chemistry, 2018, 42(7):5456-5464 Archives of Physiology and Biochemistry, 2018, 124(2):131-138 187. SHANKAR (S S), SHEREEMA (R M), RAKHI (R B). 179. SASIKUMAR (P), SHARATHNA (P), PRABHA (B), Electrochemical Determination of Adrenaline Using MXene/ SUNIL VARUGHESE, ANIL KUMAR (N), SIVAN (V V), SHERIN (D R), SURESH (E), MANOJKUMAR (T K), Graphite Composite Paste Electrodes. RADHAKRISHNAN (K V). ACS Applied Materials & Interfaces, 2018, 10 (50):43343-43351 Dihydro-β-agarofuran Sesquiterpenoids From The Seeds of Celastrus Paniculatus Willd. and Their α-glucosidase 188. SHEREEMA (R M), RAO (T P), SAMEER KUMAR (V B), SRUTHI (T V), PRABHU (G R D), SHANKAR (S S). Inhibitory Activity. Individual and Simultaneous Electrochemical Determination Phytochemistry Letters, 2018, 26:1-8 of Metanil Yellow and Curcumin on Carbon Quantum Dots 180. SAVITHRI (S), SASIKUMAR (R). Based Glassy Carbon Electrode. Size and Morphology of Gas Porosity in Castings—Insights Materials Science and Engineering: C, 2018, 93:21-27 into Computational Experiments Using a Cellular Automaton 189. SHIJINA (K), RAJITH (I), SUMITHA (N S), SAILAJA (G Model. S), SREEKUMAR (K), NAIR (B N), PEER MOHAMED (A), Transactions of the Indian Institute of Metals, 2018, ANILKUMAR (G M), YAMAGUCHI (T), HAREESH (U S). 71(11):2657-2665 Melamine Formaldehyde-Metal Organic Gel Interpenetrating Polymer Network Derived Intrinsic Fe-N-Doped Porous 181. SELVAKUMAR (P), UMADEVI (K), JANAKIRAM (P), Graphitic Carbon Electrocatalysts For Oxygen Reduction HARIDAS (A). Reaction. Biofuel from Marine Microalgae (Indian Species) Marine New Journal of Chemistry, 2018, 42(23):18690—18701 Environment to Lab and Lab to Land Technology. European Biomass Conference and Exhibition Proceedings, 2018, 191 – 203 124 National Institute for Interdisciplinary Science & Technology 124 Annual Report 2018-19 190. SHOBI (V), PRADEEP (P), DUNBAR (G L), MAITI (P). 199. SOMAN (S), CHACKO (A S), PRASAD (V S), ANJU (P), Molecular Insights into the Roles of Rab Proteins in SURYA (B S), VANDANA (K). Intracellular Dynamics and Neurodegenerative Diseases. Self-assembly of Oleylamine Modified Nano-fibrillated Neuro Molecular Medicine, 2018, 20(1):18-36 Cellulose from Areca Husk Fibers into Giant Vesicles. Carbohydrate Polymers, 2018, 182:69-74 191. SHUKLA (P), TIWARI (S), JOSHI (S R), AKSHAY (V R), VASUNDHARA (M), VARMA (S), JAI SINGH, 200. SOUMYA (R S), PRATHAPAN (A), SALIN RAJ (P), ANUPAMA (C). VINEETHA (V P), RAGHU (K G). Morphological and Optical Study of Cobalt Doped ZnO Thin Selenium Incorporated Guar Gum Nanoparticles Safeguard Films. Mitochondrial Bioenergetics During Ischemia Reperfusion Physica B: Condensed Matter, 2018, 550:303-310 Injury in H9c2 Cardiac Cells. 192. SIBI (N), INDUJA (I J), SURENDRAN (K P), SUBODH International Journal of Biological Macromolecules, 2018, (G). 107(Part A):254-260 Natural Garnet Reinforced High Density Polyethylene Composites for Sustainable Microwave Substrates. 201. SOUMYA (R S), SHERIN (S), RAGHU (K G), ABRAHAM (A). Materials Research Bulletin, 2018, 106:478-484 Allicin Functionalized Locust Bean Gum Nanoparticles For Improved Therapeutic Efficacy: An in Silico, in Vitro and in Vivo 193. SIJLA ROSELY (C V), NAGENDRA (B), SIVAPRASAD (V Approach. P), BHOJE GOWD (E). International Journal of Biological Macromolecules, 2018, Influence of Boron Nitride Nanosheets on the Crystallization 109:740-747 and Polymorphism of Poly(L-lactide). Journal of Physical Chemistry B, 2018, 122(24):6442-6451 202. SOUMYA (S), SHEEMOL (V N), AMBA (P), PEER MOHAMED (A), ANANTHAKUMAR (S). 194. SINDHU (R), BINOD (P), GNANSOUNOU (E), Sn and Ag Doped ZnO Quantum Dots with PMMA by In PRABISHA (T P), LEYA THOMAS, MATHEW (A K), Situ Polymerization for UV/IR Protective, Photochromic ABRAHAM (A) , PANDEY (A), FARACO (V). Multifunctional Hybrid Coatings. Enzymatic Hydrolysis of Microwave Assisted Acid Pretreated Solar Energy Materials and Solar Cells, 2018, 174:554-565 Chili Postharvest Residue For The Production of Value Added Products. 203. SREE MANU (K M), VAISAKH MANOJ, ARSHA (A G), Indian Journal of Experimental Biology, 2018, 56:479-483 VISHNU (R L), RESMI (V G), RAJAN (T P D), PAI (B C). Selectively Reinforced Aluminum Metallic Hybrid Composites 195. SINDHU (R), BINOD (P), MATHEW (A K), ABRAHAM (A), PANDEY (A), GNANSOUNOU (E), CASTRO (G E). by Liquid Metal Squeeze Infiltration Process. An Effective Surfactant-assisted Hydrothermal Pretreatment Transactions of the Indian Institute of Metals, 2018, Strategy for Bioethanol Production from Chili Post-harvest 71(11):2827-2832 Residue by Separate Hydrolysis and Fermentation. Bioprocess and Biosystems Engineering, 2018, 41(4):565-571 204. SREEDEVI (P), NAIR (J B), PREETHANUJ (P), JEEJA (B S), SURESH (C H), MAITI (K K), LUXMI VARMA (R). 196. SINDHU (R), BINOD (P), SABEELA BEEVI (U), Calix[4]arene Based Redox Sensitive Molecular Probe for SERS ABRAHAM (A), MATHEW (A K), MADHAVAN (A), Guided Recognition of Labile Iron Pool in Tumor Cells. REBELLO (S), PANDEY (A). Analytical Chemistry, 2018, 90(12):7148?7153 Applications of Microbial Enzymes in Food Industry. Food Technology and Biotechnology, 2018, 56(1):16-30 205. SREEJITH (S), CHOVNIK (O), LINDA (J W S), LAHAV (M), VAN DER BOOM (M E). 197. SMITHA (V S), PEER MOHAMED (A), WARRIER (K G K), Directed Molecular Structure Variations of Three-Dimensional NAIR (B N), HAREESH (U S). Halogen-Bonded Organic Frameworks (XBOFs). Transparent and Hydrophobic MTMS/GPTMS Hybrid Aerogel Crystal Growth and Design, 2018, 18(4):1967-1977 Monoliths and Coatings by Sol-Gel Method: A Viable Remedy for Oil-Spill Cleanup. 206. SREEJITH (S), PETERS (M) , STEINBORN (K), Chemistry Select, 2018, 3(11):2989-2997 KRAHWINKEL (B), SÖNNICHSEN (F D), GROTE (D), SANDER (W), LOHMILLER (T), RÃŒDIGER (O), 198. SMITHA (V S), SYAMILI (S S), PEER MOHAMED (A), HERGES (R). NAIR (B N), HAREESH (U S). Light-Controlled Switching Of The Spin State Of Iron(III). ORMOSIL-ZrO2 Hybrid Nanocomposites and Coatings Nature Communications, 2018, 9(1):4750 On Aluminium Alloys For Corrosion Resistance; A Sol-Gel Approach. New Journal of Chemistry, 2018, 42(12):10337-10347 National Institute for Interdisciplinary Science & Technology 125 125 Annual Report 2018-19 207. SREEKUMAR (N), CHENNATTUAAERY (A J), ANIE (M), 215. SUDAKSHINA (B), ARUN (B), DEVI CHANDRASEKHAR SELVARAJU (N). (K), YANG (H D) , VASUNDHARA (M). Anaerobic Digester Sludge as Nutrient Source For Culturing of Magnetically Induced Electrical Transport and Dielectric Microalgae for Economic Biodiesel Production. Properties of 3d Transition Elemental Substitution at the Mn- International Journal of Environmental Science and site in Nd0.67Ba0.33MnO3 Manganites. Technology, 2018, 15(12):2607-2614 AIP Conference Proceedings, 2018, 1953(1):120051 208. SREEKUMAR (N), HARIDAS (A), GODWIN (G S), 216. SUDAKSHINA (B), ARUN (B), DEVI CHANDRASEKHAR SELVARAJU (N). (K), YANG (H D), VASUNDHARA (M). Lipid Enhancement in Microalgae by Temporal Phase Structural and Magnetic Properties of Nd0.67Ba0.33MnO3 Separation: Use of Indigenous Sources of Nutrients. Manganites with Partial Replacement of Fe and Cu at Mn-site. Chinese Journal of Chemical Engineering, 2018, 26(1):175-182 Physica B: Condensed Matter, 2018, 539:14-20 209. SREENA (T S), PRABHAKAR RAO (P), AJMAL (K N), 217. SUDAKSHINA (B), ARUN (B), VASUNDHARA (M). ATHIRA (K V R). Electrical, Magnetic, and Magnetotransport Behavior of Influence of Morphology on Luminescence Properties of Inhomogeneous Xenotime-type Phosphors NaYP2O7:Eu3+ Synthesized via Nd1-xCaxMnO3 (0.0≤ x≤ 0.8) Manganites. Solid State and Citrate-gel Routes. Journal of Magnetism and Magnetic Materials, 2018, 448:250- Journal of Materials Science - Materials in Electronics, 2018, 256 29(9):7458-7467 218. SUDHEESH (K V), JAYARAM (P S), SAMANTA 210. SREENA (T S), PRABHAKAR RAO (P), ATHIRA (K V R), (A), BEJOYMOHANDAS (K S), JAYASREE (R S), AJU THARA (T R),. AJAYAGHOSH (A). Exploitation of Eu3+ Red Luminescence Through Order- A Cyclometalated IrIII Complex as a Lysosome-Targeted Disorder Structural Transitions In Lanthanide Stannate Photodynamic Therapeutic Agent for Integrated Imaging and Pyrochlores For Warm White LED Applications. Therapy in Cancer Cells. Physical Chemistry Chemical Physics, 2018, 20(37):24287- Chemistry - A European Journal, 2018, 24(43):10999-11007 24299 211. SREENA (T S), PRABHAKAR RAO (P), ATHIRA (K V R), 219. SUDHEESH (K V), JOSEPH (M M), DIVYA (S P), AJU THARA (T R). SAMANTA (A), MAITI (K K), AJAYAGHOSH (A). Narrow-band Red-emitting Phosphor, Gd3Zn2Nb3O14:Eu3+ pH-Controlled Nanoparticles Formation and Tracking of with High Color Purity for Phosphor-converted White Light Lysosomal Zinc Ions in Cancer Cells by Fluorescent Carbazole- Emitting Diodes. Bipyridine Conjugates. Journal of Alloys and Compounds, 2018, 751:148-158 Chemistry Select, 2018, 3(8):2416-2422 212. SRUTHI (T V), LINCY (E), RAJI (G R), HARITHA (K), 220. SURAJ SOMAN, PRADHAN (S C), MUHAMMED SHARATH SHANKAR (S), VANDANA (S), VISHNU (R), YOOSUF, VINAYAK (M V), LINGAMOORTHY (S), ASWINI (P), SAMEER KUMAR (V B). GOPIDAS (K R). Horizontal Transfer of miR-23a from Hypoxic Tumor Cell Probing Recombination Mechanism and Realization of Colonies Can Induce Angiogenesis. Marcus Normal Region Behavior in DSSCs Employing Cobalt Journal of Cellular Physiology, 2018, 233(4):3498-3514 Electrolytes and Triphenylamine Dyes. Journal of Physical Chemistry C, 2018, 122(25):14113-14127 213. SUBHA (P V), NAIR (B N), VISAKH (V), SREERENJINI (C R), PEER MOHAMED (A), WARRIER (K G K), 221. SURESH (C H), BIJINA (P V). YAMAGUCHI (T), HAREESH (U S). Hidden Dicarbene Nature of Acetylenes and Captodative Germanium-incorporated Lithium Silicate Composites as Bonding on Carbon. Highly Efficient Low-temperature Sorbents for CO2 Capture. ChemPhysChem, 2018, 19:3266-3272 Journal of Materials Chemistry A, 2018, 6(17):7913-7921 222. SURESH (C H), NEETHA MOHAN, DELLA (T D). 214. SUCHITHRA (P S), MAHESH (K V), PREM (P), PEER A Noncovalent Binding Strategy to Capture Noble Gases, MOHAMMED (A), ANANTHAKUMAR (S). Hydrogen and Nitrogen. Multiwall Carbon Nanotube Reinforced Teflon Fibrils for Journal of Computational Chemistry, 2018, 39(15):901-908 Oil Spill Clean Up and its Effective Recycling as Textile Dye Sorbent. Journal of Environmental Management, 2018, 211:198-205 126 National Institute for Interdisciplinary Science & Technology 126 Annual Report 2018-19 223. SURIYAKUMAR (S), GOPI (S), KATHIRESAN (M), BOSE 231. VEDHANARAYANAN (B), PRAVEEN (V K), DAS (G), (S), BHOJE GOWD (E), NAIR (J R), ANGULAKSHMI (N), AJAYAGHOSH (A). MELIGRANA (G), BELLA (F), GERBALDI (C), STEPHAN Hybrid Materials of 1D and 2D Carbon Allotropes and (A M). Synthetic π-systems. Metal Organic Framework Laden Poly(Ethylene Oxide) Based NPG Asia Materials, 2018, 10:107-126 Composite Electrolytes for All-Solid-State Li-S and Li-Metal Polymer Batteries. 232. VEENA (K S), SAMEENA (M T), PADMAKUMARI (A K Electrochimica Acta, 2018, 285:355-364 P), SRINIVASA (G T K), NISHANTH (K S), RESHMA (M V). 224. SYAMA (H P), ARUN (K B), SINUMOL (G), DHANYA Development and Validation of HPLC Method For (R), ANUSREE (S S), NISHA (P), LANKALAPALLI (R S), Determination of Sugars in Palm Sap, Palm Syrup, Sugarcane SUNDARESAN (A), JAYAMURTHY (P). Jaggery and Palm Jaggery. Syzygium Cumini Seed Exhibits Antidiabetic Potential via International Food Research Journal, 2018, 25(2): 649-654 Multiple Pathways Involving Inhibition of α-Glucosidase, DPP-IV, Glycation, and Ameliorating Glucose Uptake in L6 Cell 233. VENKATESWARA (Y), GUPTA (S), SAMATHAM (S S), Lines. MANOJ RAAMA VARMA, ENAMULLAH, SURESH (K G), Journal of Food Processing and Preservation, 2018, ALAM (A). 42(2):e13464 Competing Magnetic and Spin-Gapless Semiconducting Behavior in Fully Compensated Ferrimagnetic CrVTiAl: Theory 225. SYAMA (H P), SITHARA (T), LEKSHMY KRISHNAN (S), and Experiment. JAYAMURTHY (P). Physical Review B - Condensed Matter and Materials Physics, Syzygium Cumini Seed Attenuates LPS Induced Inflammatory 2018, 97(5):054407 Response in Murine Macrophage Cell Line RAW264.7 Through NF-κB Translocation. 234. VERMA (S S), AWASTHEE (N), RAI (V), MISHRA (S), Journal of Functional Foods, 2018, 44:218-226 NAIR (M S), GUPTA (S C). Isodeoxyelephantopin, a Novel Sesquiterpene Lactone, 226. THEJUS (P K), KOLEY (B), NISHANTH (K G). Induces Apoptosis, Inhibits Invasion, and Abolishes Cancer An Intense Purple Chromophore Based on Co2+ in Distorted Cell Proliferation Through Suppression of Nuclear Factor- Tetrahedral Coordination. Kappa B (NF-Kappa B) Activation. Dyes and Pigments, 2018, 158:267-276 Cancer Medicine, 2018, 7(SI Supplement.1):53-54 227. THIYAGARAJAN (S), ARUMUGAM (M), SENTHIL (N), 235. VIJAY NAIR (G), PULLA RAO (C), RAMARAJ (R), VELLAIKUMAR (S), KATHIRESAN (S). SRINIVASAN (S), TYAGI (A K), CHANDRASEKHARAM Functional Characterization and Substrate Specificity Analysis (M), ANINDYA (D), GHOSH (K), GHOSH (S), HAJRA (A), of Δ6-Desaturase from JUSTIN THOMAS (K R), SHARMA (P K), SINGH (K N), TALUKDAR (P). Marine Microalga Isochrysis Sp. Chemical Research Society of India Awards 2018. Biotechnology Letters, 2018, 40(3):577-584 Angewandte Chemie-International Edition, 2018, 57(8):2029- 228. THOMAS (S), DHANYA (B P), ARUN (K B), SINI (S), 2030 DAN (M), RADHAKRISHNAN (K V), NISHA (P). Zerumbone, a Cyclic Sesquiterpene from Zingiber zerumbet 236. VIJAY NAIR. Induces Apoptosis, Cell Cycle Arrest, and Antimigratory Effects Gilbert Stork: Organic Chemist and Teacher (1921-2017). in SW480 Colorectal Cancer Cells. Resonance, 2018, 23(12);1327-1332 Journal of Agricultural and Food Chemistry, 2018, 66(3):602-612 237. VINAYAK (M V), MUHAMMED YOOSUF, PRADHAN (S C), LAKSHMYKANTH (T M), SURAJ SOMAN, GOPIDAS 229. UTHAMAN (B), REVATHY (R ), JOB (R B), MANOJ (K R). RAAMA VARMA. A Detailed Evaluation of Charge Recombination Dynamics in Structural, Dielectric and Impedance Spectroscopy Studies in Dye Solar Cells Based on Starburst Triphenylamine Dyes. Co doped La 0.7Te 0.3 MnO3. Sustainable Energy & Fuels, 2018, 2(1):303-314 AIP Conference Proceedings, 2018, 1832(1):040004 238. VINOD KUMAR, BINOD (P), SINDHU (R), 230. VARJANI (S), SRIVASTAVA (V K), INDU (S T), SINDHU GNANSOUNOU (E), VIVEK (A). (R), GNANSOUNOU (E). Bioconversion of Pentose Sugars to Value Added Chemicals Culture Based Approaches, Dependent and Independent, for and Fuels: Recent Trends, Challenges and Possibilities. Microbial Community Fractions in Petroleum Oil Reservoirs. Bioresource Technology, 2018, 269:443-451 Indian Journal of Experimental Biology, 2018, 56(7):444-450 National Institute for Interdisciplinary Science & Technology 127 127 Annual Report 2018-19 242.VIVEK (N), PANDEY (A), BINOD (P). 239. VISHAL (K), DATEER (B R), SASIDHAR (B S), PATIL (S An Efficient Aqueous Two Phase Systems Using Dual Inorganic A), PATIL (S A). Electrolytes to Separate 1,3-Propanediol from the Fermented Green Synthesis of Palladium Nanoparticles: Applications in Broth. Aryl Halide Cyanation and Hiyama Cross-Coupling Reaction Bioresource Technology, 2018, 254:239-246 Under Ligand Free Conditions. Catalysis Letters, 2018, 148(6):1562-1578 243. WEINHOLD (A), DORCHEH (E K), RAN LI, RAMESHKUMAR (N), BALDWIN (I T). 240. VISHAL (K), KOLEY (T S), MANJUNATHA (K), DATEER (B Antimicrobial Peptide Expression in a Wild Tobacco Plant R), KERI (R S), SASIDHAR (B S), PATIL (S A), PATIL (S A). Reveals The Limits of Host-Microbe-Manipulations in The A New Magnetically Recyclable Heterogeneous Palladium(II) Field. as a Green Catalyst For Suzuki-Miyaura Cross-Coupling and Elife, 2018, e28715 Reduction of Nitroarenes in Aqueous Medium at Room Temperature. Inorganica Chimica Acta, 2018, 478:195-210 241. VIVEK (N), MEERA (C), KIRAN KUMAR (M), CASTRO (G E), BINOD (P), PANDEY (A). Pentose Rich Acid Pretreated Liquor as Co-Substrate for 1,3-Propanediol Production. Renewable Energy, 2018, 129(Part B):794-799 128 National Institute for Interdisciplinary Science & Technology 128 Annual Report 2018-19 एनआईआईएसटी वै煍ञानकⴂ 饍वरा विदेश दौरा नाम दौरा किया देश & अवधि यात्रका उ饍दश㔯 मेसर् नोरिटेक कं पनी मᴂ बैठक के लिए और टोक्य इसं ्टट्यटू डॉ य ू एस हरीश जापान (02/04/2018-06/04/2018) ऑफ टेक्नलॉजी, जापान मᴂ व्봾ख्봾न देने के लिए पर् फिनलℂड कओपियो विश्ववि饍봾लय, फिनलℂड मᴂ इडो नॉर्न डॉ पी बिनोद फिनलℂड (16/05/2018-30/05/2018) ू ु ं परियोजना की समी啍ष बैठक के लिए फिनलℂड का दौरा बोर् मᴂ इडं ो-जर्न साइसं एडं टेक्नलॉजी सᴂटर की संयकु वै煍ञानक डॉ टी पी डी राजन जर्नी (25/05/2018-26/05/2018 परिषद की बैठक मᴂ भाग लेने के लिए जर्नी का दौरा इडं ो-जर्न् अनसु ंधान कार्क्रम के तहत काम करने के लिए डॉ के माधवन नंपतिरू ी जर्नी (04/07/2018-24/07/2018) बेलेफेल् विश्ववि饍봾लय जर्नी का दौरा डॉ पी बिनोद हांगकांग (16/08/2018-18/08/2018) हांगकांग पर चौथे अतं र्र�絍री सम्मलन मᴂ भाग लेने के लिए रासायनिक पारिस्थितकी के लिए अधिकतम प्लाडे संस्थन का डॉ एन रमेशकु मार जर्नी (06/09/2018-28/09/2018) दौरा डॉ सी एच सरु ेश ऑस絍रेलिय (20/09/2018-29/09/2018) क्Ăसलℂड विश्ववि饍봾लय ऑस絍रेलिय का दौरा डॉ पी बिनोद जर्नी (1/10/2018-14/10/2018) बीलेफेल् जर्नी के विश्ववि饍봾लय का दौरा करने के लिए हिरोशिमा के किताकु श ू विश्ववि饍봾लय मᴂ अतं र्र�絍री पॉलिमर डॉ ई भोजे गौ蔼 जापान (4/12/2018- 7/12/2018) सम्मलन मᴂ भाग लेने के लिए स्पन के रा�絍री अनसु ंधान परिषद, वेलᴂसिया, स्पन की या配र करने डॉ पी निशा स्पन (27/2/2019- 27/5/2019) के लिए डॉ ए अजयघोष जापान (7/3/2019- 16/3/2019) ओसाका प्रान् विश्ववि饍봾लय का दौरा करने के लिए 셂सी अकादमी के वि煍ञन की यराू ल शाखा के मिहेव इसं ्टट्यटू डॉ एम वसंधु रा 셂स (12/3/2019- 17/3/2019) ऑफ मेटल फिजिक् का दौरा करने के लिए National Institute for Interdisciplinary Science & Technology 129 129 Annual Report 2018-19 FOREIGN VISITS BY NIIST SCIENTISTS NAME PLACE OF VISIT & PERIOD PURPOSE OF VISIT Meeting of M/S Noritake company and Dr U S Hareesh Japan(02/04/2018-06/04/2018) lecture at Tokyo Institute of Technology Review meeting of INDO NORDEN Dr P Binod Finland(16/05/2018-30/05/2018) Project at university of Eastern Finland To attend the joint scientific council meeting Dr T P D Rajan Germany(25/05/2018-26/05/2018 of Indo- German Science & Technology Centre To visit Bielefeld university Germany to work Dr K Madhavan Nampoothiri Germany (04/07/2018-24/07/2018) under Indo-German research program To attend the 4th international Dr P Binod Hongkong(16/08/2018-18/08/2018) Conference in Hongkong To visit Max Plank Institute for Chemical Dr N Rameshkumar Germany(06/09/2018-28/09/2018) Ecology Dr C H Suresh Australia(20/09/2018-29/09/2018) To visit Queensland university Australia Dr P Binod Germany(01/10/2018-14/10/2018) To visit university of Bielefeld Germany To attend International Polymer Conference Dr E Bhoje Gowd Japan (04/12/2018- 7/12/2018) at University of Kitakyushu, Hiroshima To visit Spanish National Research Council, Dr P Nisha Spain(27/02/2019- 27/5/2019) Valencia, Spain Dr A Ajayaghosh Japan (07/03/2019- 16/3/2019) To visit Osaka Prefecture University To visit Miheev Institute of Metal Physics of Dr M Vasundhara Russia (12/03/2019- 17/03/2019) Ural Branch of Russian Academy of Sciences 130 National Institute for Interdisciplinary Science & Technology 130 Annual Report 2018-19 विदेशी वै煍ञानकⴂ / प्रत脿त व㔯क鄿यⴂ के एनआईआईएसटी का दौरा Name Country from Date Purpose of visits बायो इमेजिंग और सᴂसिंग के लिए "इजीं नियरिंग फं क्नल डॉ। शिवरामपनिकर श्जीत सिगापं ुर 24.09.2018 मटेरियल और सॉफ्-ऑर嵇निक नैनोहाइब섿ड्स" पर व्봾ख्봾न देने के लिए। प्र셋 गिल्बर स्टॉर फ्रस 22.10.2018 मेमोरियम मᴂ कार्क्रम "ईधनं कोशिकाओ ंऔर इलेक絍셋लिसिस के लिए हाइ蕍셋जन प्र셋 टेको यामागचीु जापान 07.12.2018 अर्व्यस्थ और व्यवस्त साम嵍र डिजाइन" पर व्봾ख्봾न देने के लिए चक्रवाती प्लेटनम (द्तीय) परिसिरों के "फॉस्फोसᴂट एक्समेसर प्र셋 शिगयकिु यागी जापान 12.12.2018 फॉर्शन का नियंतण" पर व्봾ख्봾न देने के लिए बेहतर पांडुलिपि तैयार करने के लिए टिप्: एक संपादक का प्र셋 सरु ेश सी पिल्ई आयरलℂड 09.01.2019 饃ष्टिकोण 嵍रफीन कोटिंग और नैनो啍क्रस्लाइन मिश धात ु संरचना: प्र셋फेसर रमन सिंह ऑस絍रेलिय 08.03.2019 उल्लखनीय उपन्봾स सं啍षाण प्रतिरोध के लिए दो उपन्봾स नैनो प्र셌饍योगकी 饃ष्टिकोण "셂थेनियम (II) कैटालॉज् रिडॉक्-न्ूय ल सी एच बॉन् डॉ। मसिलामणि जिगनमोहन चेन्ई 12.07.2018 फं क्नलाइज़शन ऑफ एरोमैटिक् हेटेरोमैटिक्" पर एक व्봾ख्봾न देने के लिए प्र셋फेसर उदयमित बᴂगल셁ु 03.08.2018 आचार् पीसी रे स्माक व्봾ख्봾न सपु रमॉलेकु लर एनसᴂबल: संभावित उत्प्रेक और पाली उत्प्रेक डॉ। वंदना भल्ल पंजाब 08.10.2018 सिस्म" पर व्봾ख्봾न देने के लिए “आणविक मान्ता, बायोइमेजिंग और डायग्नोस्क अनप्रु योगरों प्र셋 मनोज कु मार पंजाब 08.10.2018 के लिए“ फ्लोरसᴂट पार् के विकास पर व्봾ख्봾न देना” संतन ु भ絍टचार् प्र셋 कोलकाता 22.11.2018 "भविष् के कार्बनक सं�लषण" पर व्봾ख्봾न देने के लिए "अनसु ंधान कौशल के अनकु ू लन के लिए उत्सहजनक रवैया" पर डॉ। गिबी घी वर嵀ज ति셁वनंतपरु म 28.11.2018 एक व्봾ख्봾न देने के लिए पिचियास्टैपस की सतत संस्क ृतियों मᴂ इथेनॉल उत्पदन के प्र셋फेसर अतलु नारंग दिल्ल 14.12.2018 काइनेटिक्" पर एक व्봾ख्봾न देने के लिए National Institute for Interdisciplinary Science & Technology 131 131 Annual Report 2018-19 VISITS OF FOREIGN SCIENTISTS/EMINENT PERSONALITIES TO NIIST Name Country from Date Purpose of visits To deliver a lecture on “Engineering Functional Dr Sivaramapanicker Sreejith Singapore 24.09.2018 Materials and Soft-organic Nanohybrids for Bio imaging and Sensing” Prof Gilbert Stork France 22.10.2018 Programme for In memoriam To deliver a lecture on “Hydrogen Economy and Prof Takeo Yamaguchi Japan 07.12.2018 Systematic Material Design for Fuel Cells and Electrolysis” To deliver a lecture on “Control of Phosphorescent Prof Shigeyuki Yagi Japan 12.12.2018 Excimer Formation of Cyclometalated Platinum (II) Complexes” Tips for improved Manuscript Preparation: An Prof Suresh C Pillai Ireland 09.01.2019 Editor’s perspective Graphene Coating and Nanocrystalline Alloy Prof Raman Singh Australia 08.03.2019 Structure: Two Novel Nanotechnology Approaches for Remarkable Corrosion Resistance To deliver a lecture on “Ruthenium(II)‑Catalyzed Dr Masilamani Jeganmohan Chennai 12.07.2018 Redox-Neutral C‑H Bond Functionalization of Aromatics Heteroaromatics” Professor UdayMaitra Bengaluru 03.08.2018 Acharya PC Ray memorial Lecture To deliver a lecture on “Supramolecular Dr Vandana Bhalla Punjab 08.10.2018 Ensembles: Potential Catalytic and Poly catalytic Systems” To deliver a lecture on “Development of Prof Manoj Kumar Punjab 08.10.2018 Fluorescent Probes for Molecular Recognition, Bioimaging and Diagnostic Applications” To deliver a lecture on “Future of Organic Prof Santanu Bhattacharya Kolkata 22.11.2018 Synthesis” To deliver a lecture on “Fostering Attitude for Dr Giby Ghee Vargheese Thiruvananthapuram 28.11.2018 Optimizing Research Skills” To deliver a lecture on ”Kinetics of Ethanol Prof Atul Narang Delhi 14.12.2018 production in continuous cultures of Pichia stipities” 132 National Institute for Interdisciplinary Science & Technology 132 Annual Report 2018-19 पीएचडी पुरस्क ृ पुरस्क ृत Sl. No. नाम थीसिस शीर्क सपरवाइु जिंग गाइड की तिथी एसीएसआईआर अयमान सलिह 1 फं गल सेललु ोज उत्पदन और अनप्रु योग डॉ राजीव के सकु ु मारन 02.04.2018 ओमर इदरिस बाइसिकल ओलेफिन् के डिसेममे絍रज़शन और इडं ोल् के 2 संथिनी पी वी मल्टकं पोनᴂट रिएक्सश के माध्म से हेटरोसायकल और डॉ आर लक्मी वर्म 13.04.2018 कार्सायकल का सं�लषण अजेश विजया कार्सायकल और हेटेरोसायकल का निर्मण हेटरोबायिकल 3 डॉ के वी राधाकृ ष्न 03.05.2018 ओलेफिन् मᴂ स्टरिकस絍रन का उपयोग माइक्र셋इलेक絍रॉनक अनप्रु योगरों के लिए ढांकता हुआ सब्絍रट और 4 अभिलाष प डॉ के.पी. सरु ᴂद्रन 30.05.2018 स्क्रन प्रिंट करने योग् स्봾ही 5 धन्봾 बी पी जे셁म्बनेयंद के सिंथेटिक संशोधन उनके जैविक मल्ू याकन डॉ के वी राधाकृ ष्न 02.06.2018 ग्स्ℂड स्कक कैटलर् 饍वार सीसी बॉन् मेटाथिसिस पर घनत् 6 रेम् पी आर कार्यत्क सिद्धत अध्यन: मेटल-कार्न बॉन्डिग, मैके निज्, और डॉ सी एच। सरु ेश 20.06.2018 मेटेलासाइकल ऑर嵇निक डोनर-एक्ससर सिस्म् फॉर मेटल आयन रिकॉग्नशन एडं 7 शमील टी डॉ डी रमैया 29.06.2018 ओएलईडी एप्लकेशन फं क्नल फु लरीन का डिजाइन: ऑप्टइलेक絍셋निक के लिए उनके 8 संदीपा के वी फोटोफिजिकल और डीएनए सेल्-असᴂबली गणु रों की जांच Appli- डॉ जोशी जोसेफ 20.07.2018 cations सᴂसिंग और पीडीटी अनप्रु योगरों के लिए दो आयामी स्रित नैनोमे絍셋ज 9 श्रीज एम के आर嵇निककोनजेट्स के डिजाइन, सं�लषण और फोटोफिजिकल डॉ जोशी जोसेफ 20.07.2018 गणु डायज़ैिसाइक्लक ओलेफिं स के संक्रमण के माध्म से अपर्ण पी एस 10 संक्रमणमेटलकैटलजेड एस 2 सी-एच स啍क्र्ण: फं क्नलाइ焼् डॉ आर लक्मी वर्म 23.07.2018 साइक्लपᴂटेनिस तक पहुचं संरचना का मल्ू याकन संपत्ति की संपत्ति जीडी&सीए अददेड़ एमजी- 11 अतलु क डॉ ए। श्रीनिसन 26.09.2018 एएल & एएमपी; एमजी-ज़ेडएन अललोय॰ मोहम्द चिरल ओलिगो के डिजाइन, सं�लषण, स्-असᴂबली और 12 डॉ ए। अजयघोष 23.10.2018 हिफ्饍स दन बी एम चिरोप्टकलसी गणु (पी-फे निलीनथीलीन) डेरीवातिवेस National Institute for Interdisciplinary Science & Technology 133 133 Annual Report 2018-19 ऑर嵇नेल टारगेटिंग, फोटोडायनामिक थैरेपी और थेरानॉस्टक 13 सधेशु के वी डॉ ए अजयघोष 23.10.2018 एप्लकेशन के लिए ल्ूमय नेसᴂट प्र셋ब विभिन् आक봾िरों और आकृ 啍त्रों के आणविक आयनरों मᴂ हाइ蕍셋जन 14 डेला थेरेस डेविस डॉ सी एच सरु ेश 05.11.2018 भडं ारण पर घनत् कार्यत्क सिद्धत अध्यन 15 प्रिया पी पोषक तत्वों को हटाने और प्रमखु हमल봾ििरों के बायोमीटेशन कमता डॉ बी कृ ष्कु मार 16.11.2018 एटीं कℂसर डग् के ल啍षत वितरण के लिए आणविक ट्रसपोर्टरों के 16 ज्योत बी नायर डॉ कौस्भत कु मार मैती 20.11.2018 डिजाइन, सं�लषण और जैविक मल्ू याकन कु छ चनेु हुए औषधीय पौधरों की फाइटोके मिकल जांच और एक 17 嵍रीष् गोपालन डॉ के वी राधाकृ ष्न 20.11.2018 प्रचरु मा配र मᴂ प्राकृ तिक उत्पद ज़셁म्बन के सिंथेटिक परिवर्न 18 एजेलं मैरी जोसेफ मैक्र셋इलक絍셋णिक् अनप्रु योगरों के लिए उपन्봾स अल絍र-कम-साम嵍र डॉ बोजेगौ蔼 20.12.2018 सं�लषण, लकण वर्न और आयनिक सहसंयोजी ऑर嵇नोनाज़ज़ट 19 अरिंदम मल डॉ ए अजयघोष 27.12.2018 के अनप्रु योग मलू उपन्봾स 1 मोकयकलोपरोपने1-कार्啍षलते (एसीसी) के आण्वक और कार्यत्क लकण वर्न द啍षणी भारत, के रल के 20 राम्봾 कृ ष् डॉ एन रमेश कु मार 28.12.2018 तटीय खारा सहनशील पोककली चावल की किस्मों से डेमिन्से यकु एफ्फइटोबेफिशियल स्प्रज़ोैक्टरिया। जेओलिटिकिमिडजोलते 굍र मवर् -8 (ज़ेडआईएफ़-8) व्तय ्न् 21 मिजं ु थॉमस डॉ य ू एस हरेश 28.12.2018 झरझरा साम嵍र अनप्रु योगरों उपन्봾स कार्न-कार्न और कार्न-हेटेरोटॉम बॉन् बनाने की 22 जगदीश के डॉ बी एस ससिधर 28.12.2018 प्रति啍क्र्봾ओ ंऔर संबंधित रसायन वि煍ञन की खोज जमीन पर DFT और रेखीय पॉलीकेनैनलोगरों और पॉलीसाइक्लक 23 राखी आर डॉ। सी। एच। सरु ेश 30.01.2019 एरोमैटिक हाइ蕍셋कार्न के उत्तेजित गणु रों का अध्यन करता है स啍क्र्ण बाधा, संभावित घटाना और प्रतिदीप्तिशील आणविक 24 अजं लि बी इलेक絍셋स्टैटक कमता की भविष्यवणी करना: कार्बनक और डॉ सी एच सरु ेश 21.02.2019 ऑर嵇नोमैटिक् सिस्म डिजाइन, सं�लषण, फोटोफिजिकल और इलेक絍셋फाइनᴂस की पढ़ई 25 अथिरा कृ ष्ण डॉ आर लक्मी वर्म 25.03.2019 絍रइफे निलमाइन और कार्बजोल डेरिवेटिव केरल विश्व饍यलय 26 रंजीत एस तरल 啍क्रस्लीय ऊर्ज अनप्रु योगरों के लिए साम嵍र का संचालन डॉ जे डी सधु ा 17.04.2018 134 National Institute for Interdisciplinary Science & Technology 134 Annual Report 2018-19 पॉलीस्टरिन-क्ल नैनोकम्पोजट्स के आत्-असᴂबलिंग और एटी-ं 27 अन् न राजू डॉ टी.पी.डी. राजन 24.04.2018 करप्न लकण पᴂटफु ल्वनेस और इसके डेरिवेटिव् की ट्रांशन मेटल कैटालि焼् प्रीथानजु 28 ट्रस्फ़ॉशन: कार्बइल और हेटेरिसाइकल की ओर फै सिलिटी डॉ के वी राधाकृ ष्न 04.07.2018 प्रीथलायम स絍रटेजीज जैविक इलेक絍रॉनक् अनप्रु योगरों के लिए नई प्रभार परिवहन साम嵍र 29 सिलजा अब्हम डॉ जोशी जोसेफ 11.07.2018 का डिजाइन जलीय माध्म मᴂ प्लाट बायोमास के अवायवीय अवक्रमण का 30 जयप्रभा जे एस डॉ वी बी मणिलाल 30.07.2018 वि�लषण मैक्र셋स्कोपक 셂प से रोगाणरोु धी अनप्रु योगरों के लिए स्टार आधारित 31 रेशमा एल आर डॉ जे डी सधु ा 31.08.2018 हाइ蕍셋जेल का आदेश दिया कु छ Gd-Si-Ge आधारित इटं रमेटॉलिक् और लℂथेनम टेल्रिय यम 32 भाग् उथमन डॉ मनोज रामा वर्म 14.09.2018 मℂगनीज मᴂ संरचनात्क, चबंु कीय और मैग्नटोकलोरिक अध्यन हाई थर्ल कं डक्टिग एपॉक्स पॉलिमर डाइलेट्क् के प्रसंस्कण के 33 वैसाख एस एस डॉ एस अनंतकु मार 02.11.2018 लिए नोवेल नैनो / माइक्र셋 सिरेमिक फिलर् का डिजाइन चावल के मोथ पर विभिन् पौधरों के अर् की विषाकता पर एक 34 माया जी पिल्ई डॉ बीना जॉय 22.12.2018 अध्यन कॉर्से सेफेलोनिकासटेनटन (लेपिडोप्टेर: पाइरालिडे) सीयूएसएटी भोजन मᴂ ए啍क्रलामाइड पर अध्यन: वास्तिक और मॉडल 35 शमला एल डॉ पी निशा 05.05.2018 प्रण봾啍ल्रों मᴂ ए啍क्रलामाइड गठन पर अगदतू रों का प्रभाव स्-असᴂबली, सी 3 का संगठन और फोटोफिजिकलप्र셋टेक्ट् - 36 संदीप ए डॉ ए अजयघोष 31.08.2018 सममित डिस्कोटक अणु आर थि셁मलाई प्रतिदीप्ति मॉड्यलेशनू और स्-इक絍ठ पी- फे निलिथेनिलीन का 37 डॉ ए अजयघोष 31.08.2018 कु मारन अनप्रु योग ड़रिवेटिवस ज़िंक ऑक्सइड पर जांच - 嵍रफीन ऑक्सइड नैनोमे絍셋ज और 38 बबीता के बी डॉ एस अनंतकु मार 16.02.2019 नैनोकम्पोजट्स: सं�लषण, कार्यत्क गणु और अनप्रु योग National Institute for Interdisciplinary Science & Technology 135 135 Annual Report 2018-19 Ph D Awarded Sl. Date of Name Thesis Title Supervising Guide No. Award AcSIR 1 Ayman Salih Omer Idris Fungal cellulose production and applications Dr. Rajeev K. Sukumaran 02.04.2018 Synthesis of Heterocycles and Carbocycles Santhini P. V. 2 via Desymmetrization of Bicyclic Olefins and Dr. R. Luxmi Varma 13.04.2018 Multicomponent Reactions of Indoles Construction of Carbocycles and Heterocycles Ajesh Vijayan 3 Utilizing the StericStrain in Heterobicyclic Dr. K. V. Radhakrishnan 03.05.2018 Olefins Abhilash P. Dielectric Substrates and Screen Printable Inks 4 Dr. K. P. Surendran 30.05.2018 for Microelectronic Applications Dhanya B. P. Synthetic Modifications of Zerumboneand 5 Dr. K. V. Radhakrishnan 02.06.2018 their Biological Evaluation Density Functional Theory Studies on CC Bond Remya P. R. Metathesis by Grubbsand Schrock Catalysts: 6 Dr. C. H. Suresh 20.06.2018 Metal-Carbon Bonding, Mechanisms, andMetallacycles Shameel T. Organic Donor-Acceptor Systems for Metal Ion 7 Dr. D. Ramaiah 29.06.2018 Recognition and OLED Applications Design of Functional Fullerenes: Investigation Sandeepa K. V. 8 of their Photophysical and DNA Self-Assembly Dr.Joshy Joseph 20.07.2018 Properties for Optoelectronic Applications Design, Synthesis and Photophysical Sreejith M. Properties of OrganicConjugates of Two- 9 Dr.Joshy Joseph 20.07.2018 dimensional Layered Nanomaterials for Sensing and PDT Applications Desymmetrization of Diazabicyclic Olefins via Aparna P. S. 10 Transition MetalCatalyzed sp2 C-H Activation : Dr. R. Luxmi Varma 23.07.2018 Access to FunctionalizedCyclopentenes Athul K. R. Structure - Property Evaluation of 11 Dr. A. Srinivasan 26.09.2018 Gd&CaAdded Mg-Al & Mg-Zn Alloys. 136 National Institute for Interdisciplinary Science & Technology 136 Annual Report 2018-19 Mohamad Hifsudeen Design, Synthesis, Self-Assembly and 12 B. M. Chiroptical Properties of ChiralOligo Dr. A. Ajayaghosh 23.10.2018 (p-phenyleneethynylene) Derivatives Luminescent Probes for Organelle Targeted Sudheesh K. V. 13 Imaging, PhotodynamicTherapy and Dr. A. Ajayaghosh 23.10.2018 Theranostic Applications Density Functional Theory Studies on Della Therase Davis 14 Hydrogen Storage in MolecularAnions of Dr. C. H. Suresh 05.11.2018 Different Sizes and Shapes Priya P. Nutrient removal and biomethanation 15 Dr. B. Krishnakumar 16.11.2018 potential of prominent invadingmacrophytes Design, Synthesis and Biological Assessment Jyothi B. Nair Dr.Kaustabh Kumar 16 of Molecular Transporters for Targeted Delivery 20.11.2018 Maiti of Anti-Cancer Drugs Phytochemical investigation of some Greeshma Gopalan selected medicinal plants and synthetic 17 Dr. K. V. Radhakrishnan 20.11.2018 transformations of an abundant natural product zerumbone Angel Mary Joseph Novel Ultra-Low-Materials for Microelectronic 18 Dr. E Bhoje Gowd 20.12.2018 Applications Arindam Mal Synthesis, characterization and applications of 19 Dr. A. Ajayaghosh 27.12.2018 ionic covalent organicnanosheets Molecular and functional characterization of native novel 1aminocyclopropane Ramya Krishna 1-carboxylate (ACC) deaminase 20 Dr. N. Ramesh Kumar 28.12.2018 containingphytobeneficialrhizobacteria from coastal saline tolerant pokkali rice varieties of southern India, Kerala Zeoliticimidazolate framework-8 (ZIF-8) Minju Thomas 21 derived porous materials forfunctional Dr. U. S. Hareesh 28.12.2018 applications Exploration of novel carbon-carbon and Jagadeesh K. 22 carbon-heteroatom bond forming reactions Dr. B. S. Sasidhar 28.12.2018 and related chemistry DFT studies on ground and excited state Rakhi R. 23 properties of linear polyaceneanalogues and Dr. C. H. Suresh 30.01.2019 polycyclic aromatic hydrocarbons Predicting activation barrier, reduction Anjali B. potential and fluorescenceusing molecular 24 Dr. C. H. Suresh 21.02.2019 electrostatic potential: Organic and organometallicsystems Design, synthesis, photophysical and Athira Krishna 25 electroluminescence studies of triphenylamine Dr. R. Luxmi Varma 25.03.2019 and carbazole derivatives National Institute for Interdisciplinary Science & Technology 137 137 Annual Report 2018-19 University of Kerala Liquid Crystalline conducting Materials for 26 Renjith S Dr J D Sudha 17.04.2018 Energy Applications Self-Assembling and Anti-Corrosion 27 Annu Raju Characteristics of Polystyrene-Clay Dr T P D Rajan 24.04.2018 Nanocomposites Transition Metal Catalyzed Transformations Preethanuj 28 of Pentafulvenes and Its Derivatives: Facile Dr K V Radhakrishnan 04.07.2018 Preethalayam Strategies Toward Carbocycles and Heterocycle Design Of New Charge Transport Materials For 29 Silja Abraham Dr Joshy Joseph 11.07.2018 Organic Electronics Applications Analysis Of Anaerobic Degradation Of Plant 30 Jayaprabha J S Dr V B Manilal 30.07.2018 Biomass In Aqueous Medium Macroscopically ordered starch based 31 Reshma L R Dr J D Sudha 31.08.2018 hydrogels for antimicrobial applications Structural, Magnetic and Magnetocaloric 32 Bhagya Uthaman studies in some Gd-Si-Ge based Intermetallics Dr Manoj Raama Varma 14.09.2018 and Lanthanum Tellurium Manganites Design of Novel Nano/Micro Ceramic Fillers for 33 Vaisakh S S the Processing of High Thermal Conducting Dr S Ananthakumar 02.11.2018 Epoxy Polymer Dielectrics A Study on the toxicity of different 34 Maya G Pillai plant extracts on the rice moth Corcyra Dr Beena Joy 22.12.2018 cephalonicaStainton (Lepidoptera: Pyralidae) CUSAT Studies on acrylamide in food: Effect of 35 Shamala L precursprs on acrylamide formation in real and Dr P Nisha 05.05.2018 model systems Self- Assembly, organogelation and 36 Sandeep A photophysicalproperties of C3- Symmetrical Dr A Ajayaghosh 31.08.2018 discotic Molecules Fluorescence modulation and application 37 R Thirumalai Kumaran of Self-assembled P- Phenyleneethynylene Dr A Ajayaghosh 31.08.2018 derivatives Investigations on ZnO – Graphene Oxide Nanomaterials and Nanocomposites 38 Babitha K B Dr S Ananthakumar 16.02.2019 : Synthesis, Functional Properties and Application 138 National Institute for Interdisciplinary Science & Technology 138 Annual Report 2018-19 पबंधन परिषद् 01/01/2018 से 31/12/2019 की अवधि के लिए MANAGEMENT COUNCIL Period 01/01/2018 to 31/12/2019 अध㔯क्ष CHAIRMAN निदेशक, एनआईआईएसटी Director, CSIR-NIIST सदस㔯 MEMBERS डॉ अश픿नी कु मार नांगिया Dr Ashwini Kumar Nangia, निदेशक, सीएसआईआर-एनसीएल, पनु ा Director, CSIR-NCL, Pune डॉ एस सावित् Dr S Savithri, मखु ् वै煍ञानक Chief Scientist डॉ सी चंद्रशेखर भट्ट (दिसबरं 2018 तक) प्रमख,ु आरपीबीडी, सीएसआईआर- Dr C Chandrasekhara Bhat (up to December 2018) एनआईआईएसटी Head, RPBD, CSIR-NIIST डॉ पी निशि (जनवरी 2019 से) प्रमख, आरपीबीडी, सीएसआई Dr P Nishy (from January 2019) ु Head, RPBD, CSIR-NIIST आर-एनआईआईएसटी �रीसी के चद्रकात Shri C K Chandrakanth, ं ं Principal Scientist प्रधान वै煍ञानक डॉ यू एस हरीश Dr U S Hareesh, वरिष्ठ वै煍ञानक Senior Scientist डॉ पी जयमूर्鄿 Dr P Jayamurthy, वै煍ञानक Scientist �रीएम ब्रह्मकु मार Shri M Brahmakumar, प्रधान तकनीकी अधिकारी Principal Technical Officer CoFA/FAO Member सीओएफए/एफएओ, एनआईआईएसटी सदस㔯 सचिव MEMBER SECRETARY प्रशासन नियंतक/प्रशासन अधिकारी, एनआईआईएसटी CoA / AO, NIIST National Institute for Interdisciplinary Science & Technology 139 139 Annual Report 2018-19 हाल ही मᴂ भर酀 हुए वै煍ञानक 2018-19 Recently Recruited Scientists 2018-19 डॉ �रदेव �रदेव डॉ. ति셁मलेश बी वी �रीवᴂकटेश टी. डॉ. अन्जनेयुलु को配तकोटा. Dr. Shridevi D Dr. Thirumalesh BV Mr. Venkatesh T Dr. Anjineyulu Kothakota डॉ. इदं ू शर्म �रीधानी बाबू तलाकाला डॉ. सरजू सोमन डॉ. राजकु मार Dr. Indu Sharma Mr. Dhani BabuTalakala Dr. Suraj Soman Dr. Rajkumar डॉ इशिता नियोगी डॉ पवीण वी के डॉ पार्थकंु डू �रीसौरभ साकरे Dr. Ishita Neogi Dr Praveen V K Dr Partha Kundu Mr Saurab Sakhre डॉ सशाु ंत कु मार साहू डॉ कु मरन ए Dr Sushanta Kumar Sahoo Dr Kumaran A 140 National Institute for Interdisciplinary Science & Technology 140 Annual Report 2018-19 पदोन्नतिॉ / PROMOTIONS डॉ सावित्रएस डॉ. के माधवननंपूतिरि डॉ. राजीवसकु ु मारन Dr S Savithri Dr. K. Madhavan Nampoothiri Dr. Rajeev. K. Sukumaran मखु ् वै煍ञानक व. प्रधानवै煍ञानक प्रधानवै煍ञानक Chief scientist Senior Principal Scientist Principal Scientist डॉ. सत㔯जित विश्णुशुक्ल �रीअब्दल हलीम Dr. Satyajit Vishnu Shukla Mr. Abdul Haleem प्रधान वै煍ञानक व. वै煍ञानक Principal Scientist Senior Scientist �रीवी. मणि डॉ. पी निशा डॉ. पी जयमूर酀 Mr. Moni V Dr. P. Nisha Dr. P. Jayamurthy व. वै煍ञानक व. वै煍ञानक व. वै煍ञानक Senior Scientist Senior Scientist Senior Scientist �रीरमेश कु मार आर के Mr.Ramesh Kumar R K सहा. अनभु ाग अधिकारी Assistant Section Officer National Institute for Interdisciplinary Science & Technology 141 141 Annual Report 2018-19 सेवानिवत्ृ / RETIREMENT डॉ. ए. सन्ु रेशन डॉ अजीत हरिदास �रीटी पी मारेट Dr. A. Sundaresan Dr Ajit Haridas Shri D.P. Maret मखु ् वै煍ञानक मखु ् वै煍ञानक Finance & Account Officer Chief Scientist Chief Scientist VRS : 31.12.2018 VRS: 10.10.2018 VRS : 25.02.2019 स�ु रीलता टी एस डॉ. सी चनद्रशेखरा भट्ट डॉ ल啍ष्मवर्म Ms Latha T S Dr. Chandrasekhara Bhat Dr Luxmi Varma सहायक अनभु ाग अधिकारी व. प्रधान वै煍ञानक व. प्रधान वै煍ञानक Assistant Section Officer Sr.Principal Scientist Sr.Principal Scientist VRS : 06.04.2018 Retired: 31.12.2018 Retired: 31.03.2019 �रमती विजया पसाद �रीराजू एस Mrs. Vijaya Prasad Mr. Raju S वरिष्ठ तकनीकीधि अ कारी (3) वरिष्ठ लिपिआशु क (एम ए सी पी) Sr Technical Officer (3) Sr Stenographer (MACP) Retired: 31.01.2019 Retired: 31.03.2019 सेवा से इस्तफा /Resignation from Service �रमती अस्वी टी एम डॉ सदाथ सलीम Mrs. Aswathy T M Dr Sadath Salim जनियरू सचिवालय सहायक (जी) चिकित्स अधिकारी Jr Secretariat Assistant (G) Medical Officer 142 National Institute for Interdisciplinary Science & Technology 142 Annual Report 2018-19 सीएसआईआर- एनआईआईएसटीमᴂ स्थनांतरण / Transfer to CSIR-NIIST �रीएन एस राजू �री ॉमस टी कु रियाकोस �रीसी. क्रिस्तुराज �री रिकृ ष्न वी Mr N S Raju Mr Thomas T. Kuriakose Mr. C. Christu Raj Mr. Harikrishnan V प्रशासन नियंतक भडं ार व क्रय नियंतक प्रशासन नियंतक खडं अधिकारी (एफ & ए) Controller of Administration Controller of S&P Controller of Administration Section Officer (F&A) सीएसआईआर-एनआईआईएसटीसे स्थानांतरण Transfer from CSIR-NIIST डॉ पी सजाु ता देवी �रमती दिव्यामोहन �रीदुलीप कु मार मणि �रमती सोभना एस Dr P Sujatha Devi Mrs Divya Mohan Mr. Duleep Kumar Mani Mrs Sobhana S व.प्रिंसिपल वै煍ञानक Technical officer भडं ार व क्रय नियंतक प्रशासन नियंतक, सीएसआईआर, Senior Principal तकनीकी अधिकारी सीएसआईआर- सीएलआरआई, चेन्ई मद्रास कॉम्प्क्, चेन्ई Scientist CSIR-CLRI Chennai CoA, CSIR, Madras Complex, Chennai पुरस्कर तथा सम्मन / AWARDS AND HONOURS डॉ सरू ज सोमण के रल राज् यवाु वै煍ञानक परु स्का (KSYSA) 2018 के लिए के रल के माननीय मखु ्म配ं र श् पिनारयी विजयन से प्राप्त कर रहे है Dr Suraj Soman receiving the Kerala State Young Scientist Award (KSYSA) for 2018 from the Honourable Chief Minister of Kerala Sri. Pinarayi Vijayan. National Institute for Interdisciplinary Science & Technology 143 143 Annual Report 2018-19 डॉ सी एच सरु ेश ने रसायन वि煍ञन मᴂ महत्पर्ू योगदान के लिए डॉ ई भोजे गौ蔼 ने 19 दिसंबर, 2018 को IISER, पणेु मᴂ SP- के मिकल रिसर् सोसाइटी ऑफ इडियां (CRSI) कांस् पदक SI-MACRO 2018 के दौरान सोसायटी फॉर पॉलिमर साइस,ं प्राप्त किया। इडियां का प्र셋फेसर कौशल किशोर मेमोरियल अवार् प्र셋फेसर Dr. C. H. Suresh, received the Chemical Research आर ए माशेलकर से प्राप्त किया। Society of India (CRSI) Bronze Medal for Signifi- Dr. E. Bhoje Gowd received the Professor Kaushal cant contributions to Chemistry. Kishore Memorial Award of the Society for Poly- mer Science, India during SPSI-MACRO 2018 at IISER, Pune on December 19, 2018 from Prof. R.A. Mashelkar. डॉ टी.पी.डी. राजन को एनआईजीआईएस अवार् फॉर एक्सलᴂस इन जंग वि煍ञन और प्र셌饍योगकी 2018 डॉ वी.के. सारस्त, परू 㔵 र啍ष म配ं रलय के मखु ् वै煍ञानक सलाहकार और वर्मान मᴂ NITI अयोग सदस् और जवाहरलाल नेह셂 विश्ववि饍봾लय के चांसलर, 2 अक्टूब, 2018 को जयपरु मᴂ आयोजित कॉर् 2018 सम्मलन के दौरान दे रहे है डॉ. बिनोद पी को आई आई टी 셁蔼की मᴂ 18 दिसंबर 2018 को NIGIS Award for Excellence in Corrosion Science and Technology for 2018 presented to Dr. T.P.D. Rajan डॉ. सारस्त सदस् नीतीयोग 饍वार आई एस ईई एस फेलो परु स्का by Dr. V.K. Saraswat, former Chief Scientific Advisor से सम्मानत किया गया to Ministry of Defence and presently Member, NITI Dr. Binod P being conferred Fellow award by ISEES Aayog and Chancellor of Jawaharlal Nehru University is honoured by Dr. Saraswat, Member Niti Aayog at during the CORCON 2018 conference held at Jaipur IIT Roorkee on 18 Dec. 2018 on October 2, 2018. 144 National Institute for Interdisciplinary Science & Technology 144 Annual Report 2018-19 31/03/2019 को कर्मारी समूह की सचू ी डॉ ए अजयघोष वरिष्ठप्रि ंसिपल वै煍ञानक पर्यवरण ꥍ셌饍योगकी पभाग निदेशक डॉ के एन नारायणन उण्ण डॉ (श्मती) एलिज़त जेकब निदेशक का कार्यलय प्रिंसिपल वै煍ञानक मखु ् वै煍ञानक तथा प्रधान श् किरन जे.एस डॉ ए कु मरन डॉ (श्मती) एस सावि配र तकनीकी सहायक प्रिंसिपल वै煍ञानक मखु ् वै煍ञानक श् विष् ण गर्जु डॉ कौस्तभ कु मार मैती डॉ जे असं ारी कनिष्ठ आशलिपिु क वरिष्ठव ै煍ञानक वरिष्ठ प्रिंसिपल वै煍ञानक एवं प्रधान, ईएसडी कृ षि पससं ्रण तथा ꥍ셌饍योगकी पभाग डॉ बिश्वप्रिया देब डॉ बी कृ ष्कु मार डॉ के जी रघु वरिष्ठव ै煍ञानक प्रिंसिपल वै煍ञानक वरिष्ठ प्रिंसिपल वै煍ञानक एवं प्रधान डॉ क셁णाकरन वेणगु ोपाल श् बी अब्लद हलीम डॉ बी एस दिलीपकु मार वरिष्ठव ै煍ञानक वरिष्ठ वै煍ञानक वरिष्ठ प्रिंसिपल वै煍ञानक डॉ सनिु ल वर嵀स डॉ पार् कंु डू श् वी वी वेणगु ोपाल वरिष्ठव ै煍ञानक वरिष्ठ वै煍ञानक प्रिंसिपल वै煍ञानक डॉ वी के प्रवीण डॉ के पी प्रतीश डॉ श्मती एम वी रेश्म वरिष्ठव ै煍ञानक वै煍ञानक वरिष्ठ वै煍ञानक डॉ यसफू क셁वात श् सौरभ साकरे डॉ (श्मती) पी निशा वरिष्ठव ै煍ञानक वै煍ञानक वरिष्ठ वै煍ञानक डॉ एल रविशकं र श् धानी बाब ू तलाकाला डॉ पी जयमर्ू वरिष्ठव ै煍ञानक वै煍ञानक वरिष्ठ वै煍ञानक डॉ जोशी जोसफ श् वी के षाजिकु मार डॉ(श्मती) प्रिया एस वरिष्ठव ै煍ञानक वरिष्ठ तकनीकी अधिकारी (2) वै煍ञानक डॉ बी एस शशिधर श् जोशी जोर् श् टी वᴂकटेश वै煍ञानक वरिष्ठ तकनीकी अधिकारी (1) वै煍ञानक डॉ सी विजयकु मार श्मती पी एम सह셂बा डॉ अन्जनेयलु ु कोत्ताकोटा वै煍ञानक तकनीकी अधिकारी वै煍ञानक डॉ डी श्देवी श् टी पी पौलोस डॉ इदं ू शर्म वै煍ञानक वरिष्ठ तकनीशियन (3) वै煍ञानक डॉ सरू ज समनु पदार्थ व煍ञन तथा ꥍ셌饍योगकी पभाग डॉ (श्मती) बीना जोय वै煍ञानक डॉ के हरिकृ ष् भट प्रिंसिपल तकनीकी अधिकारी डॉ इशिता नेगी मखु ् वै煍ञानक एवं प्रधान श् डी आर शोभन कु मार वै煍ञानक डॉ पी प्रभाकर राव वरिष्ठ तकनीकी अधिकारी(1) डॉ (श्मती) जे डी सधु ा मखु ् वै煍ञानक श्मती दिव्봾 मोहन प्रिंसिपल तकनीकी अधिकारी डॉ मनोज रामावर्म तकनीकी अधिकारी श्मती सौमिनी मैथ्य वरिष्ठ प्रिंसिपल वै煍ञानक रसायन वि煍ञन तथा वरिष्ठ तकनीकी अधिकारी (1) डॉ एम रवि ꥍ셌饍योगकी पभाग श् रोबर् फिलिप वरिष्ठ प्रिंसिपल वै煍ञानक डॉ पी सजु ाता देवी वरिष्ठ तकनीकी अधिकारी (1) डॉ एस अनन्कु मार वरिष्ठ प्रिंसिपल वै煍ञानक एवं प्रधान श्मती एस विजी वरिष्ठ प्रिंसिपल वै煍ञानक डॉ के वी राधाकृ ष्न वरिष्ठ तकनीकी अधिकारी (1) डॉ टी पी डी राजन वरिष्ठ प्रिंसिपल वै煍ञानक श् किरन मोहन प्रिंसिपल वै煍ञानक डॉ सी एच सरु ेश तकनीकी अधिकारी डॉ एस वी शकु ्ल National Institute for Interdisciplinary Science & Technology 145 145 Annual Report 2018-19 प्रिंसिपल वै煍ञानक डॉ एन रमेश कु मार श् एम रामसामि पिल्ल डॉ य ु एस हरीश वरिष्ठव ै煍ञानक प्रिंसिपल तकनीकी अधिकारी प्रिंसिपल वै煍ञानक डॉ मत्तु ु अ셁मगमु श् एस पश्कु न डॉ ई भोजे गौड वै煍ञानक तकनीकी अधिकारी प्रिंसिपल वै煍ञानक श् एम किरन कु मार श् जी नागश्रीनिसु डॉ के जयशकं र वै煍ञानक वरिष्ठ तकनीशियन (2) प्रिंसिपल वै煍ञानक डॉ ल啍ष् राकेश कु मार यासरला श् पष्पु कु मार के आर नायर डॉ ए श्रीनिसन वै煍ञानक 嵍पर सी गैर तक. (एमएसीपी) वरिष्ठ वै煍ञानक डॉ ति셁मलेश बी वी अनुसधानं योजना तथा व㔯वसाय विकास डॉ एम सनु ्दरारजन वै煍ञानक श् सी के चन्द्रकान् वरिष्ठ वै煍ञानक श् पी एन शिवनकु ट् नायर प्रिंसिपल वै煍ञानक डॉ के पी सरु ेनद्रन वरिष्ठ तकनीशियन (2) श् आर एस प्रवीण राज वरिष्ठ वै煍ञानक एस एडं टी सेवा पभाग वरिष्ठ वै煍ञानक डॉ सज ु पिल्ल इजीं नियरिंग एवं सेवा पभाग डॉ दीपा बालन वरिष्ठ वै煍ञानक श् आर राजीव वै煍ञानक डॉ सबु ता दास वरिष्ठ अधीकण अभियंता डॉ राजकु मार वरिष्ठ वै煍ञानक श् जी चनद्रबाबु वै煍ञानक डॉ (श्मती) एम वसंधु रा अधीकण अभियंता श् बी वेणगु ोपाल वै煍ञानक श् चनद्रशेखर नीलम वरिष्ठ तकनीशियन (2) डॉ के जी निशांत सहायक कार्पालक अभियंता पशासन वै煍ञानक श् बी कार्तक श् सी 啍क्रस् त राज डॉ एस एस श्जाकु मारी सहायक अभियंता (सिविल) प्रशासन नियंतक वै煍ञानक श् पी अ셁मखमु श् एन एस राजू डॉ सशु ांत कु मार साहू सहायक अभियंता (सिविल) प्रशासन नियंतक वै煍ञानक श् एस हरिदासन पिल्ल श् के एफ जोसफ डॉ वी एस प्रसाद वरिष्ठ तकनीशियन ( 1) अनभु ाग अधिकारी(सा) प्रिंसिपल तकनीकी अधिकारी श् एम जयदीप श् एम के शिवदासन श् एम बह्मकु मार वरिष्ठ तकनीशियन (1) अनभु ाग अधिकारी(सा) प्रिंसिपल तकनीकी अधिकारी श् के एस प्रमोद श् टी जे बाबु श् ए पीर मोहम्द तकनीशियन (2) वरिष्ठर सु 啍ष अधिकारी वरिष्ठ तकनीकी अधिकारी (2) श् के सरु ेश कण्न श्मती के एस लतीदेवी डॉ एस रामस्वमी तकनीशियन (2) हिन्द अधिकारी वरिष्ठ तकनीकी अधिकारी (1) श् य ु धरणीपति श् के पी कृ ष्न श् वी हरीश राज तकनीशियन (2) सहायक अनभु ाग अधिकारी तकनीकी अधिकारी श् बी राधाकृ ष्न श्मती मेर् जोसफ श् एम पी वर् तकनीशियन (2) सहायक अनभु ाग अधिकारी प्रयोगशाला सहायक श् टी वी सतीश सश्ु नीत ू इदं चु डनू माइक्र셋बियल ꥍ셋सेस 嵍पर सी गैर तक. (एमएसीपी) सहायक अनभु ाग अधिकारी तथा ꥍ셌饍योगकी पभाग नॉलिज रिसोर्ससᴂटर श् आर के रमेशकु मार डॉ राजीवकु मार सकु ु मारन डॉ (श्मती) पी निशी वरिष्ठ सचिवालय सहायक वरिष्ठप्रि ंसिपल वै煍ञानक तथा केआरसी और आरपीबीडी प्रिंसिपल वै煍ञानक एवं प्रधान श्मती पी एस पद뤿नी के प्रधान डॉ के माधवन नंपतिू रि श् वी मणी वरिष्ठ लिपिआशु क (एमएसीपी) वरिष्ठ प्रिंसिपल वै煍ञानक वरिष्ठव ै煍ञानक श् ओ वी शशिकु मार डॉ पी बिनोद श् एस बी रिबिन जोन् वरिष्ठ लिपिआशु क (एमएसीपी) वरिष्ठ वै煍ञानक वरिष्ठ वै煍ञानक 146 National Institute for Interdisciplinary Science & Technology 146 Annual Report 2018-19 श् बी सतीशकु मार वरिष्ठ तकनीशियन (2) क. सचिवालय सहायक श् बी अजयकु मार सश्ु ए एल सजिता वरिष्ठ तकनीशियन (2) क. सचिवालय सहायक श् टी आर सरु ेश कु मार श् प्रवीण कण्णल वरिष्ठ तकनीशियन (2) वरिष्ठ तकनीशियन (1) श् टी के घोष श् टी एच बशीर 嵍पर सी गैर तकनीकी (एमएसीपी) वरिष्ठ तकनीशियन (2) श् जी भक्ल्लम श्मती शाना एस नायर 嵍पर सी गैर तकनीकी स्टफ नर् श्मती एम गीता प्रयोगशाला सहायक श् के उण्णकृ ष्न 嵍पर सी गैर तकनीकी (एमएसीपी) श् के मधु बेयरर (एमएसीपी) श् ए श्कु मारन वाशबॉय (एमएसीपी) वित्एवं लेखा श्मती पी वी विजि अनभु ाग अधिकारी (वित्त एवं लेखा) श्मती रमणी देवराज अनभु ाग अधिकारी (वित्त एवं लेखा) श् वी हरिकृ ष्न अनभु ाग अधिकारी (वित्त एवं लेखा) श् संजीव सदानन्न सहायक अनभु ाग अधिकारी श्मती कोमला सोमन सहायक अनभु ाग अधिकारी श्मती जी गीता सहायक अनभु ाग अधिकारी श् विष् ण वी एल कनिष्ठ आशलिपिु क श् पी रजित मल्ट टास्कि ग स्टफ भण्डर एवं क्रय श् थॉमस टी कु रियाकोस भडं ार व क्रय नियंतक श् सी एम कृ ष्दास सहायक अनभु ाग अधिकारी श् एम अनिलकु मार सहायक अनभु ाग अधिकारी सश्ु शीबा सैतू क. सचिवालय सहायक श्मती एल लता National Institute for Interdisciplinary Science & Technology 147 147 Annual Report 2018-19 STAFF LIST AS ON 31/03/2019 Dr A Ajayaghosh Dr K V Radhakrishnan Mrs S Viji Director Senior Principal Scientist Senior Technical Officer (I) DIRECTOR’S OFFICE Dr C H Suresh Mr Kiran Mohan Mr J S Kiran Senior Principal Scientist Technical Officer Technical Assistant Dr K N Narayanan Unni ENVIRONMENTAL Mr Vishnu Gurjar Principal Scientist TECHNOLOGY DIVISION Junior Stenographer Dr A Kumaran Dr (Mrs )Elizabeth Jacob Principal Scientist Chief Scientist & Head AGROPROCESSING & TECHNOLOGY DIVISION Dr Kaustabh Kumar Maiti Dr (Mrs) S Savithri Chief Scientist Dr K G Raghu Senior Scientist Dr Mr J Ansari Senior Principal Scientist & Head Dr Biswapriya Deb Senior Principal Scientist & Head, ESD Dr B S Dileep Kumar Senior Scientist Dr B Krishnakumar Senior Principal Scientist Dr Karunakaran Venugopal Principal Scientist Mr V V Venugopal Senior Scientist Mr B Abdul Haleem Principal Scientist Dr Sunil Varughese Senior Scientist Dr (Mrs) M V Reshma Senior Scientist Dr Parthakundu Senior Scientist Dr V K Praveen Senior Scientist Dr (Mrs) P Nisha Senior Scientist Dr K P Prathish Senior Scientist Dr Yoosaf Karuvath Scientist Dr P Jayamurthy Senior Scientist Mr Saurabh Sakhre Senior Scientist Dr L Ravi Shankar Scientist Dr (Mrs)S Priya Senior Scientist Mr Dhani Babu Talakala Scientist Dr Joshy Joseph Scientist Mr T Venkatesh Senior Scientist Mr V K Shajikumar Scientist Dr B S Sasidhar Senior Technical Officer(2) Dr Anjineyulu Kothakota Scientist Mr Joshy George Scientist Dr C Vijayakumar Senior Technical Officer(1) Dr Indu Sharma Scientist Mrs P M Saharuba Scientist Dr Shridevi Technical Officer Dr (Mrs) Beena Joy Scientist Mr T P Paulose Principal Technical Officer Dr Suraj Soman Senior Technician(3) Mr D R Soban Kumar Scientist Dr Ishita Neogi MATERIALS SCIENCE & Senior Technical Officer (1) TECHNOLOGY DIVISION Scientist Mrs Divya Mohan Dr K Harikrishna Bhat Dr (Mrs) J D Sudha Technical Officer Chief Scientist & Head Principal Technical Officer CHEMICAL SCIENCES & Dr P Prabhakar Rao Mrs Saumini Mathew TECHNOLOGY DIVISION Chief Scientist Senior Technical Officer (I) Dr P Sujatha Devi Dr Manoj Raama Varma Mr Robert Phillip Senior Principal Scientist & Head Senior Principal Scientist Senior Technical Officer (I) 148 National Institute for Interdisciplinary Science & Technology 148 Annual Report 2018-19 Dr M Ravi Mr M P Varkey Mr U Dharanipathy Senior Principal Scientist Lab Assistant Technician(2) Dr S Ananthakumar MICROBIAL PROCESSES & Mr B Radhakrishnan Senior Principal Scientist TECHNOLOGY DIVISION Technician(2) Dr T P D Rajan Dr Rajeev Kumar Sukumaran Mr T V Satheesh Principal Scientist Principal Scientist & Head Group C (NT) (MACP) Dr S V Shukla Dr K Madhavan Nampoothiri KNOWLEDGE RESOURCE CENTRE Principal Scientist Senior Principal Scientist Dr (Mrs) P Nishy Dr U S Hareesh Dr P Binod Senior Principal Scientist & Head of KRC & RPBD Principal Scientist Senior Scientist Mr V Moni Dr E Bhoje Gowd Dr N Ramesh Kumar Senior Scientist Principal Scientist Senior Scientist Mr S B Ribin Jones Dr K Jayasankar Dr Muthu Arumugam Senior Scientist Principal Scientist Scientist Mr M Ramasamy Pillai Dr A Srinivasan Mr M Kiran Kumar Principal Technical Officer Senior Scientist Scientist Mr S Pushkin Dr M Sundararajan Dr L Rakesh Kumar Yasarala Technical Officer Senior Scientist Scientist Mr G Nagasrinivasu Dr K P Surendran Dr B V Thirumalesh Senior Technician (2) Senior Scientist Scientist Mr Pushpakumar K R Nair Dr Saju Pillai Mr P N Sivankutty Nair Group C (NT) (MACP) Senior Scientist Senior Technician (2) RESEARCH PLANNING & Dr Subrata Das S & T SERVICES BUSINESS DEVELOPMENT Senior Scientist ENGINEERING SERVICES DIVISION Mr C K Chandrakanth Dr (Mrs) M Vasundhara Mr R Rajeev Principal Scientist Scientist Senior Superintending Engineer Mr R S Praveen Raj Dr K G Nishanth Mr G Chandra Babu Senior Scientist Scientist Superintending Engineer Dr Deepa Balan Dr S S Sreejakumari Mr Chandra Shekar Neelam Scientist Scientist Assistant Executive Engineer Dr Raj Kumar Dr Sushanta Kumar Sahoo Mr B Karthik Scientist Scientist Assistant Engineer (Civil) Mr B Venugopal Dr V S Prasad Mr P Arumugam Senior Technician(2) Principal Technical Officer Assistant Engineer (Civil) ADMINISTRATION Mr Brahmakumar Mr S Haridasan Pillai Mr C Christu Raj Principal Technical Officer Senior Technician (1) Controller Of Administration Mr A Peer Mohammed Mr M Jayadeep Mr N S Raju Senior Technical Officer (2) Senior Technician(1) Controller Of Administration Dr S Ramaswamy Mr K S Pramod Mr K F Joseph Senior Technical Officer(1) Technician (2) Section Officer (G) Mr V Harish Raj Mr K Suresh Kannan Mr M K Sivadasan Technical Officer Technician (2) Section Officer (G) National Institute for Interdisciplinary Science & Technology 149 149 Annual Report 2018-19 Mr T J Babu Assistant Section Officer Senior Security Officer Mrs Komala Soman Mrs K S Lathidevi Assistant Section Officer Hindi Officer Mrs G Geetha Mr K P Krishnan Assistant Section Officer Assistant Section Officer Mr Vishnu V L Mrs Mercy Joseph Junior Stenographer Assistant Section Officer Mr P Rejith Mrs Neethu Induchoodan Multi Tasking Staff Assistant Section Officer STORES & PURCHASE Mr R K Ramesh Kumar Mr Thomas T Kuriakose Assistant Section Officer Controller Of Stores & Purchase Mrs P S Padmini Mr C M Krishnadas Senior Stenographer (MACP) Assistant Section Officer (S&P) Mr O V Sasikumar Mr M Anilkumar Senior Stenographer (MACP) Assistant Section Officer (S&P) Mr B Satheesh Kumar Mrs Sheeba Saithu Junior Secretariat Assistant Junior Secretariate Assistant (S&P) Mrs A L Sajitha Mrs L Latha Junior Secretariat Assistant Senior Technician(2) Mr Praveen Kannal Mr B Ajayakumar Senior Technician(1) Senior Technician (2) Mr T H Basheer Mr T R Suresh Kumar Senior Technician(2) Senior Technician (2) Mrs Shana S Nair Mr T K Ghosh Staff Nurse Group C (NT) (MACP) Mrs M Geetha Mr G Bhakthavalsalam Lab Assistant Group C (NT) Mr K Unnikrishnan Gr C (NT) (MACP) Mr K Madhu Bearer(MACP) Mr A Sreekumaran Washboy(MACP) FINANCE & ACCOUNTS Mrs P V Viji Section Officer (F&A) Mrs Remani Devaraj Section Officer (F&A) Mr V Harikrishnan Section Officer (F&A) Mr Sanjeev Sadanandan 150 National Institute for Interdisciplinary Science & Technology 150 Annual Report 2018-19 घटनाए ं और समारोह जिग्यसा - वै煍ञानक-छात्कनेक्टकार्क्रम 18 अप्रैल 2018 को। सीएसआईआर-एनआईआईएसटी मᴂ जिग्봾सा- 2018 आयोजित किया गया। संस्थन निदेशक डॉ ए अजयघोष ने कार्क्रम का उ饍घटन किया। ति셁वनंतपरु म शहर के छह के न्द्री वि饍봾लय स्क लरों से 85 छा配रों और शिककरों ने इस कार्क्रममᴂ भाग लिया। सीएसआईआर-एनआईआईएसटी मᴂ जिग्봾सा का समन्व डॉ सी एच सरु ेश, प्रिंसिपल वै煍ञानक, और डॉ आर लक्म वर्म, वरिष्ठ प्रिंसिपल वै煍ञानक व प्रमख,ु रसायन वि煍ञन तथा प्र셌饍योगकी प्रभाग 饍वार किया गया । इस कार्क्रममᴂ प्रयोगशाला दौरा, और वै煍ञानकरों और शोध वि饍वनरों के साथ बातचीत आदि शामिल थी। छात्रके साथ बातचीत करते वै煍ञानक राष絍रीयꥍ셌饍योगकी दिवस समारोह सीएसआईआर-एनआईआईएसटी मᴂ 11 मई, 2018 को रा�絍री प्र셌饍योगकी दिवस मनाया । संस्थन निदेशक डॉ ए अजयघोष ने स्वगत भाषण दिया और दिन के मखु ् अतिथि का परिचय किया । पद्म एम सी दथन, वै煍ञानक सलाहकार, के रल सरकार और परू 㔵 निदेशक, वीएसएससी, ति셁वनंतपरु म समारोह मᴂ मखु ् अतिथि थे और उन्होंने रा�絍री प्र셌饍योगकी दिवस व्봾ख्봾न दिया । उन्होंने अपने भाषण मᴂ के रल के औ饍योगक 啍ष配रों 饍वार सामना किए जाने वाले अवसिरों और चनु 셌啍त्रों पर प्रकाश डाला और संबंधित 啍ष配रोंमᴂ प्रतिस्पर होने के लिए नई लागत प्रभावी प्र셌饍योगिकियों को श셂ु करने के पद्म �रीएम सी दथन, वै煍ञानक सलाहकार, केरल सरकार और पूर्व महत् पर जोर दिया दिया । डॉ आर ल啍ष् वर्म, अध्啍ष, अकादमिक निदेशक, वीएसएससी, त섿वᴂद्रम ने दर्कⴂ को सबं ोधित करते हुए कार्क्रम समिति ने धन्यवद प्रस्ता दिया। पद्म�रील啍ष्कु ट्टी अम्माका सम्मन समारोह पारंपरिक दवा के प्रयोग मᴂ अपनी सफलता के लिए के रल के ति셁वनंतपरु म जिले के कल्ला वन 啍षे से ल啍ष्कु 絍ट अम्म को पद्म परु स्का से सम्मानत किया गया, जो भारत का चौथा सर्च् नागरिक परु स्का है । ल啍ष्कु 絍ट अम्म को 'वनमत्तशु ्श' (मलयालम मᴂ जंगल की दादी) के 셂प मᴂ जाना जाता है । पद्म ल啍ष्कु 絍ट अम्म के सम्मनार् 22 मई 2018 को संस्थन मᴂ आयोजित समारोह मᴂ डॉ ए अजयघोष, निदेशक, सीएसआईआर-एनआईआईएसटी ने उन् ᴂ सम्मानत किया । पद्म ल啍ष्कु 絍ट अम्म पारंपरिक दवा का प्रयोग करने वाली एक प्रसिद जहर चिकित्क है। उन्होंने वन पौधरों से सोरायसिस, मधमेह,ु माइ嵍रन जैसी बीमारि्रों के लिए पारंपरिक दवाओ ं की तैयारी पर व्봾ख्봾न दिया। डॉ के जी रघ,ु प्रधान , कृ षि प्रसंस्कण तथा प्र셌饍योगकी प्रभाग डॉ ए अजयघोष, निदेशक, सीएसआईआर-एनआईआईएसटी ने ने इस कार्क्रम का समन्व किया। पद्म �रील啍ष्कु ट्टी अम्माको सम्मानितकरते हुए National Institute for Interdisciplinary Science & Technology 151 151 Annual Report 2018-19 ग फेस्: एमएसएमई - टेक्नलॉजी डेवलपर्सइटरफेसं ꥍ셋嵍रमﴂएमएसएमई के लिए टेक्नलॉजी सोर् ने समारोह की अध्यता की । श् के बिज ू आईएएस, निदेशक, इडं स絍रज एडं कॉमर् ने एमएसएमई के लिए आयोजित प्र셌饍योगकी फेस् का उ饍घटन किया। श् एस शिवगणनम, एआईए, एमएसएमई म配ं रलय, भारत सरकार ने मखु ् भाषण दिया और केएसएसआईए का राज् अध्य श् दामोदर अवनरू , ने आशीर्वद भाषण दिया । श् जी एस प्रकाश, उप निदेशक, एमएसएमई-डीआई, त्शरू ने धन्यवद प्रस्ता दिया। कार्क्रममᴂ प्र 셌饍योगकी प्रस्ुतत , आर एडं डी संस्थनरों 饍वार प्र셌饍योगिकियों की प्रदर्नी, एमएसएमई की डॉ.अजयघोष ए, निदेशक सीएसआईआर-एनआईआईएसटी उ饍घटन सत्के तकनीकी आवश्कताओ ंऔर इटं रएक्टि बैठक शामिल थĂ । दौरान दर्कⴂ को सबं ोधित करते हुए एमएसएमई को खाद एवं कृ षि प्रसंस्कण, पर्यावण और अपशिष्ट प्रबंधन, एमएसएमई विकास संस्थन, एमएसएमई म配ं रलय, त्शरू ने ऊर्ज कु शल प्र셌饍योगिकियों और कं पोजिट्स के 啍षे मᴂ वै煍ञानक संगठन 饍वार एनआईआईएसटी, ति셁वनंतपरु म और अन् हितधारकरों के सहयोग से 12 विकसित नई प्र셌饍योगिकियों को अपनाने के लिए कार्क्रम फायदेमदं था और ग फेस्": एमएसएमई - मलू ् वदृ 鴿 के अवसर के अलावा तकनीकी उन्नन और आधनिु कीकरणﴂजन,ू 2018 को"एमएसएमई के लिए प्र셌饍योगकी सोर् प्र셌饍योगकी डेवलपर् इटं रफेस कार्क्रम आयोजित किया । कार्क्रम द啍षणी के लिए भी उन् ᴂ मदद मिली । केएफआरआई, पीची, आरआरआईआई, राज्यों से एमएसएमई, आर एडं डी लैब् और प्र셌饍योगकी प्रदाताओ ंके द啍षणी कोट्म, आईडब्एसटी,ल बᴂगल셁,ु आईआईसीटी, हैदराबाद, के रल कृ षि शिखर सम्मलन के 셂प मᴂ आयोजित किया गया था । एमएसएमई के लिए विश्ववि饍봾लय, वेल्लाणी, एससीआईटीएमएसटी, केएससीएसटीई, प्र셌饍योगकी 셋तरों का प्रदर्न करना और प्र셌饍योगकी प्रदाताओ ं के सहयोग सीसीआरआई, आलप्षप ा, वीएसएससी, सीपीसीआरआई, कासरगोड, सी- से बेहतर प्र셌饍योगकी प्रबंधन के लिए प्र셌饍योगकी हस्तातरण को सगमु डैक, सीआईपीईटी, सीएफटीआरआई, मैसरू इत्봾दि जैसे वै煍ञानक संगठनरों बनाना कार्क्रम का उ饍शद ् था । श् पी.वी. वेलायधन,ु निदेशक एमएसएमई- ने सम्मलन मᴂ भाग लिया । कार्क्रममᴂ पैनल चर्च, बातचीत, आधनिु क डीआई, त्शरू ने गणमान् व्啍鄿्रों और प्रतिभ봾啍ग्रों का स्वगत किया। डॉ प्र셌饍योगकी हस्तातरण के अवसर, प्र셌饍योगिकियों की प्रदर्नी आदि शामिल ए.अजयघोश, निदेशक सीएसआईआर- एनआईआईएसटी, ति셁वनंतपरु म थे। कार्क्रममᴂ लगभग 250 एमएसएमई इकाइ्रों ने भाग लिया। अंतर्रा絍रीय यग दिवस योग का अभ्यस करती एनआईआईएसटी परिवार सीएसआईआर से प्राप्तनिर् शरों के अनसु रण मᴂ संस्थन मᴂ 21 जन,ू 2018 को अतं र्र�絍री योग दिवस के अवसर पर एक मास ड्ल और योग अभ्봾स का आयोजन किया गया । 152 National Institute for Interdisciplinary Science & Technology 152 Annual Report 2018-19 ई-टूल्सपर हिंदी कार्शाला/अभिमुखीकरण कार्क्रम कं प्टय र पर सामान्त: प्रयोग होने वाले सॉफ्टे्िरों के अलावा सी-डैक 饍वार हिदीं मᴂ काम करने के लिए विकसित सॉफ्टे्िरों जैसे शतलेखन,् म配ं र, प्रवाचक, वाइस टु टाइपिंग आदि के प्रयोग 饍वार कु शलतापरू 㔵क हिदीं मᴂ काम करने संबंधी व अन् उपयोगी जानकारी देने के लिए संस्थन के अधिकारि्रों /कर्चारि्रों के लिए दिनांक 25.07.2018 को एक कार्शाला व अभिमखीकु रण कार्क्रम का आयोजन किया गया । श् अनिल कु मार, मखु ् प्रबंधक (रा.भा), भारतीय स्टट बℂक, स्थनीय मखु ् कार्यलय, ति셁वनंतपरु म कार्शाला मᴂ अतिथि वक् रहे । हिदीं मᴂ प्रवीणता/ कार्साधक 煍ञन प्राप्त 23 अधिकारी /कर्चारी ने कार्शाला मᴂ भाग लिया । अतिथि वक् ने सबसे पहले प्रतिभ봾啍ग्रों को राजभाषा विभाग 饍वार ओनलाइन माध्म से हिदीं स्वं सीखने के लिए विकसित लीला हिदीं प्रबोध, प्रवीण तथा प्राज पाठ्यक्रमंब स ंधी जानकारी दी । इसके बाद, कं प्टय िरों मᴂ भाषा इडियां की साइट से इडिं क लℂग्वज इनपटु टूल् डाउनलोड श्री अनिल कुमार, मुख्य प्रबंधक (रा.भा), भारतीय स्टेट बैंक, स्थानीय करने की विधी को समझाया । कार्शाला के दौरान मशीन साधित अनवाु द मुख्य कार्यालय, तिरुवनंतपुरम कार्यशाला का संचालन करते हुए सिस्म –मतं राजभाषा के बारे मᴂ भी प्रतिभ봾啍ग्रों को समझाया गया जिससे कर सकता है । भाषण को प्र셋सेस करने के लिए कं प्टय र एनालॉग सिग्ल को प्रशासनिक, वित्तीय,कृ षि लध ु उ饍यग सचनू ा प्र셌饍योगकी स्वश्थ, र啍ष, शि啍ष डिजिटल सिग्ल मᴂ परिवर्तत करता है । प्र셋सेसिंग के बाद टेक्स उत्न् एव बℂकिग 啍ष配रों के दस्ताेजरों का अ嵍रजी से हिदी मᴂ अनवाद कर सकता है । ं ं ं ं ु होता है। फिर, अतिथि वक् ने शतलेखन-् राजभाषा, जो भाषण प्र셌饍योगकी के 啍षे मᴂ एक मील का पत्थ है, के बारे मᴂ प्रतिभ봾啍ग्रों को समझाया । उन्होंने बताया इसके बाद, प्रतिभ봾啍ग्रों को राजभाषा विभाग 饍वार विकसित ई- महोशब्कोश कि शतलेखन-् राजभाषा एक हिदीं स्पकर स्तंत, निरंतर भाषण पहचान का परिचय दिया गया । अतिथि वक् ने प्रतिभ봾啍ग्रों से अपील किया कि प्रणाली है, जो कं प्टय र को मानव भाषण को पहचानने मᴂ सकम बनाता है अपने अपने डेस्टॉप पर इन सभी सॉफ्टे्िरों को डाउनलोड करके अपने और हिदीं यनिू कोड मᴂ आउटपटु प्रदान करता है । उपयोगकर्त उपयकु इनपटु दैनंदिन कार्यो मᴂ इनका प्रयोग सनिशु 椿त करᴂ । फीडबैक के 셂प मᴂ प्रतिभ봾啍ग्रों डिवाइस यानी एक माइक्र셋फोन के माध्म से एप्लकेशन के साथ कम्ूनय केट को टीमरों मᴂ विभाजित करके एक प्र�नत्तरी भी आयोजित की गयी । हिंदी सꥍताह संस्थन मᴂ 14 सितंबर 2018 को हिदीं दिवस मनाया गया और 21 सितंबर तक हिदीं सप्ताह के 셂प मᴂ मनाया गया । दिनांक 14 सितंबर को हिदीं सप्ताह का औपचारिक उ饍घटन समारोह आयोजित किया गया । आयोजन समिति के अध्य डॉ. पी.प्रभाकर राव ने समारोह मᴂ उपस्थत सभी का स्वगत किया । उन्होंने अपने स्वगत भाषण मᴂ कᴂद्र सरकार कार्यल्रों मᴂ हिदीं दिवस और हिदीं सप्ताह के आयोजन की प्रासंगिकता पर सं啍षप्त जानकारी प्रस्त की । डॉ. ए. अजयघोष, निदेशक, सीएसआईआर- एनआईआईएसटी ने उ饍घटन सत की अध्यता की और हिदीं सप्ताह समारोह के औपचारिक उ饍घटन की घोषणा की । समारोह के दौरान माननीय गहृ म配ं र आयोजन समिति के अध㔯क्ष डॉ. पी. पभाकर राव उ饍घटन सत श् राजनाथ सिंह का हिदीं दिवस संदेश प्र셋जक्ट की सहायता से प्रतिभ봾啍ग्रों मᴂ प्रभागियⴂ का स्वगत करते हुये को दिखाया गया । उद्घाटन सत्र के बाद संस्थान में नव नियुक्त वैज्ञानिक डॉ. सुशांत कुमार साहू नें “ अक्षय संसाधनों से जैव-आधारित बहुलक” पर वैज्ञानिक प्रस्तुति दी । National Institute for Interdisciplinary Science & Technology 153 153 Annual Report 2018-19 इसके पश्त परू े सप्ताह के दौरान परियोजना स्टफ, अनसु ंधान छात आयोजित विभिन्न कार्यक्रम का उल्लेख करते हुये प्रतियोगिताओं के आदि सहित संस्थन के संपर्ू स्टफ सदस्यों निम्नलिखत प्रतियोगिताए ं सफल भागीदारों का साधुवाद किया । । मुख्य अतिथि ने अपने हिंदी सप्ताह आयोजित की गयी । समापन भाषण में आम जनता की भाषा के रूप में हिंदी सीखने का औचित्य 1) हिदीं ऑनलाइन प्र�नत्तरी 2) हिदीं प्र�नत्तरी और महत्ता पर बताया और विभिन्न प्रतियोगिताओं के सफल भागीदारों 3) हिदीं अतं ाक्ी को पुरस्कार वितरित किया । 4) क्봾 सोशल मीडिया लोकतंत के लिए एक बड़ चनु ौती है विषय पर वाद- विवाद इसके अलावा संस्थन के कर्चारि्रों के स्क ल छा配रों के लिए (क啍ष-1 से क啍ष-XII के छा配रों ) 19 सितंबर को हिदीं प्र�नत्तरी प्रतियोगिता चलायी गयी । सभी प्रतियोगिताओ ंमᴂ अनसु ंधान छा配रोंहि स त तथा स्टफ सदस्यों ने बडी संख्봾 मᴂ तथा अत्यत उत्सह के साथ भाग लिया । 21 सितंबर 2018 शाम को समापन समारोह व पुरस्कार वितरण आयोजित डॉ. सशाु त कु मार साहू “अक्षय ससाधनⴂं से जैव-आधारित किया गया । समारोह के अध्यक्ष ने हिंदी सप्ताह समारोह के दौरान बहुलकⴂ पर ” अपनी पस्तुतिदेते हुये प्रतियोगा मᴂ भाग लेते हुये प्रभागियॉ �रीआर. कृ ष्दास, आईबीएस, उप महानिदेशक, ,दूरदर्न कᴂद्र ति셁वनंतपुरम, सभा का सबं ोधन करते हुये सीएसआईआर स्थपना दिवस दिन को एक खलेु दिन के 셂प मᴂ मनाया गया और विभिन् शैक्षक संस्थनरों के लगभग 400 छा配रों ने आर एडं डी सवु िधाओ ं का दौरा किया। सीएसआईआर-एनआईआईएसटी के निदेशक डॉ ए अजयघोष ने स्वगत भाषण दिया और सीएसआईआर स्थपना दिवस समारोह की अध्यता की। डॉ वी के रामचद्रन,ं उपाध्य, के रल राज् योजना बोर्, के रल सरकार, ति셁वनंतपरु म, समारोह मᴂ मखु ् अतिथि थे और उन्होंने सीएसआईआर स्थपना दिवस व्봾ख्봾न दिया । वर् 2017-18 के दौरान सीएसआईआर-एनआईआईएसटी के सेवानिवत्तृ कर्चारि्रों मुख㔯 अतिथि डॉ वी.के. रामचंद्रन सी एस आई आर स्थपना दिवस और सीएसआईआर मᴂ 25 साल की सेवा परू ी करने वाले कर्चारि्रों पर भाषण दे रहे हℂ को सम्मानत किया गया और वर् 2017-18 का छात्तिृ परु स्का सीएसआईआर-एनआईआईएसटी मᴂ 27 सितंबर 2018 को सीएसआईआर- वितरित किया गया। अकादमिक कार्क्रम समिति की अध्啍ष डॉ आर स्थपना दिवस मनाया गया। संस्थन की गतिवि啍ध्रों को दिखाने के लिए उक ल啍ष् वर्म ने धन्यवद प्रस्ता दिया। 154 National Institute for Interdisciplinary Science & Technology 154 Annual Report 2018-19 एनआईआईएसटी स्थपना दिवस को दिखाने के लिए उक दिन को एक खलेु दिन के 셂प मᴂ मनाया गया और विभिन् शैक्षक संस्थनरों के लगभग 350 छा配रों ने आर एडं डी सवु िधाओ ं का दौरा किया। सीएसआईआर-एनआईआईएसटी के निदेशक डॉ ए अजयघोष ने स्वगत भाषण दिया और सीएसआईआर स्थपना दिवस समारोह की अध्यता की। श् केशवेनद्रु कमार, आईएएस, सचिव, आयषु विभाग व निदेशक, राज् मिशन, रा�絍री स्वस्थ मिशन, के रल सरकार, ति셁वनंतपरु म समारोह के मखु ् अतिथि थे। उन्होंने संस्थन की वै煍ञानक उपलब्धियों की सराहना की । मखु ् अतिथि 饍वार वर् 2017- एन आई आई एस टी स्थपना दिवस के दौरान वार्षक 18 के सीएसआईआर-एनआईआईएसटी की वार्षक रिपोर् जारी की रिपोर्टका विमोचन गई । डॉ टी पी डी. राजन, संयोजक, अकादमिक कार्क्रम समिति, 6 अक्टूब 2018 को सीएसआईआर-एनआईआईएसटी मᴂ सीएसआईआर- सीएसआईआर-एनआईआईएसटी, ति셁वनंतपरु म ने धन्यवद प्रस्ता एनआईआईएसटी स्थपना दिवस मनाया गया। सस्थन की गतिवि啍ध्रों ं दिया । सतर्का जाग셂कता सꥍताह संस्थन मᴂ सतर् ता जाग셂कता सप्ताह 29 अक्टूब से 2 नवंबर 2018 तक मनाया गया। सतर् ता जाग셂कता सप्ताह हिदीं और अ嵍ं रजी दोनरों मᴂ प्रति煍ञ के प्रशासन के साथ श셂ु हुआ। कर्चारि्रों को सीवीसी की साइट पर जाकर ई-प्रति煍ञ लेने के लिए प्र셋त्साहत किया गया। श् थॉमस के कु रीकोस, भडं ार एवं खरीद नियंतक饍वार सभी स्टफ सदस्यों और छा配रों के लाभ के लिए "टᴂडरिंग - इन विजिलᴂस परिप्रे啍ष" पर एक बातचीत आयोजित की गई। । सप्ताह के दौरान विभिन् प्रतियोगिताओ ं को आयोजित किया गया, अर्थत ् "व्啍鄿गत या प्रणाली भ्रष्टाचार को जन् देती है?" विषय पर बहस, "भ्रष्टाचार �रीबी.एस. मोहम्द यासीन, आईपीएस, एडीजीपी (सतर्का) ने दर्कⴂ को मिटाओ-नया भारत बनाओ" विषय पर नारा लेखन पर एक प्रतियोगिता सबं ोधित करते हुए आयोजित की गई थी। 2 नवंबर 2018 को मान् समारोह आयोजित किया विरोधी और सतर् ता पर एक जानकारीपर्ू भाषण दिया। उन्होंने विभिन् गया था और अध्यता श् बी.एस. मोहम्द यासीन, आईपीएस, एडीजीपी प्रतियोगिताओ ंके विजेताओ ंको परु स्का भी प्रदान किए। (सतर् ता) मखु ् अतिथि ने अन् राज्यों की तलनु ा मᴂ के रल मᴂ भ्रष्टाचार वै煍ञानक और औ饍योगक अनुसधानं परिषद (सीएसआईआर) के महानिदेशक का दौरा को पदभार गहण करने के बाद, 16 -17 नवंबर, 2018 को सी एस आई आर - एन आई आई एस टी का दौरा किया। । एन आई आई एस टी की अनसु ंधान गतिवि啍ध्रों से परिचित होने के लिए 16 नवंबर 2018 को वे अनसु ंधान परिषद की बैठक मᴂ शामिल हुए। 17 नवंबर 2018 को उन्होंने कर्चारि्रों और छा配रों को संबोधित किया और रा�ट और समाज के लिए सीएसआईआर के योगदान के बारे मᴂ जानकारी दी। उन्होंने बा褼 राहत गतिवि啍ध्रों मᴂ स啍क्र् 셂प से शामिल होने के लिए सीएसआईआर-एनआईआईएसटी के कर्चारि्रों और 16 नवंबर 2018 को आर सी की तीसरी बैठक के अवसर पर सी एस आई आर-एन आई आई एस टी के स्टफ, छात्रऔर आर सी सदस㔯ⴂ को सबं ोधित करते हुए डी जी, सी एस छा配रों की सराहना की जब राज् तबाही का सामना कर रहा था। आई आर डॉ शेखर सी मℂडे सिस्म मᴂ आने वाली चनु 셌啍त्रों के बारे मᴂ चर्च करने के लिए उन्होंने डॉ शेखर सी मांडे सचिव, डी एस आई आर और महानिदेशक, वै煍ञानक और वै煍ञानकरों, प्रशासनिक कर्चारि्रों और छा配रों के साथ अलग-अलग औ饍योगक अनसु ंधान परिषद (सी एस आई आर), नई दिल्ल ने 16 अक्टूब 2018 इटं रेक्टि सेशन किया। National Institute for Interdisciplinary Science & Technology 155 155 Annual Report 2018-19 युवा शोधकर्तओ ंके लिए बहुलक रसायन आईआईटीएम, चेन्ई ने इसका उ饍घटन किया । डॉ सधु ा जे डी ने परू े कार्क्रम का संयोजन किया । इस सम्मलन मᴂ पॉलिमर के सं�लषण, संशोधन, और अभिलकण, बहुलक मिशणरों, कं पोजिट और पॉलिमर के प्रसंस्कण, स्मार पॉलिमर, चालक पॉलिमर् और बायोपॉलिमर् के ऑप्ट इलेक絍रॉनक गणु और अनप्रु योगरों, पॉलिमर के जैव-संबंधित अनप्रु योग, पॉलिमर स्थिता और निम्नकरण, पॉलिमिरों की भौतिकी (सिद्धत, मॉडलिंग और सिमलेशन)ु पर हाल के 셁झानरों और घटनाक्रमरों पर चर्च की गई। इस सम्मलन के माध्म से, यवाु शोधकर्तओ ंको प्रतिष्ठित दर्करों के सामने आमत्ं त व्봾ख्봾न देने का एक अनठू ा अवसर मिला उ饍घटन का एक 饃श㔯 इसके अलावा, सम्मलन ने यवाु वै煍ञानकरों को पोस्ट प्रस्त करने और सीएसआईआर-एनआईआईएसटी, ति셁वनंतपरु म तथा एसपीएसआई, बहुलक वि煍ञन और प्र셌饍योगकी के 啍षे मᴂ उनके काम और 煍ञन पर चर्च ति셁वनंतपरु म के संयकु तत्वाधान मᴂ 17 नवंबर 2018 को पीसीवाईआर- करने के लिए एक आदर् मचं प्रदान किया। इस कार्क्रम से लगभग 300 2018 का आयोजन किया गया और प्रख्봾तप्र 셋फेसर अभिजीत पी देशपांडे, छात लाभान्वत हुए। सपिं ण्न वि煍ञन और पससं ्रण (आईसीएसएसपी7) पर सातवां अंतर्रा絍रीयसम्मलन आईसीएसएसपी 2018 का समापन सत सीएसआईआर-रा�絍री अतं र्वषयी वि煍ञन तथा प्र셌饍योगकी (सीएसआईआर- शखलर् ा मᴂ, आईसीएसएसपी7 सम्मलन की अध्यता प्र셋फेसर जॉन बानहार्, एनआईआईएसटी) और भारतीय प्र셌饍योगकी संस्थन, मद्रास के संयकु तकनीकी विश्ववि饍봾लय, बर्लन, जर्नी 饍वार की गयी । डॉ यटीएसू पिल्ल, तत्वाधान मᴂ 19-22, नवंबर 2018 के दौरान ति셁वनंतपरु म मᴂ संपिण्न सीएसआईआर-एनआईआईएसटी इसके संयोजक थे, डॉ टी.पी.डी. राजन वि煍ञन और प्रसंस्कण (आईसीएसएसपी7) पर सातवां अतं र्र�絍री और डॉ एस सावि配र सह संयोजक थे और डॉ ए श्रीनिसन कोषाध्य सम्मलनआयोजित किया गया । आईसीएसएसपी, जो एक त्रिवारक थे । आईसीएसएसपी7 मᴂ 啍षे के प्रख्봾त शोधकर्तओ ं की 71 आमत्ं त अतं र्र�絍री सम्मलन है, का आयोजन वर् 2001 से किया जा रहा है और मौखिक प्रस्ुतित ॉ और विभिन् देश के यवाु शोधकर्तओ ं की 67 पोस्ट इसका उ饍शद ् शोधकर्तओ ंको ठोसकरण के व्봾पक 啍षे मᴂ हाल के अग्मरों प्रस्ुतित ॉ शामिल थĂ पर अपने 煍ञन का आदान-प्रदान करने के लिए अवसर प्रदान करना है । इस 156 National Institute for Interdisciplinary Science & Technology 156 Annual Report 2018-19 वि煍ञन, ꥍ셌饍योगकी और अनुप्रग मᴂ इलेक絍रन माइक्र셋स्कप के उभरते 셁झान (एसटीएईएम-2018) पर राष絍रीयसम्मलन और माइक्र셋स्कप वि煍ञन तथा ꥍ셌饍योगकी अकादमी की 5 वĂ वार्षक बैठक (एएमएसटी) प्र셌饍योगकी अकादमी (एएमएसटी), भारत के संयकु तत्वाधान मᴂ 19 - 21, दिसंबर 2018 के दौरान तीन दिवसीय रा�絍री सम्मलन का आयोजन किया गया । सम्मलन का उ饍शद ् उन्त साम嵍र की माइक्र셋स्कपी मᴂ वै煍ञानक जानकारी की अत्봾धनिु क स्थित और वि煍ञन तथा प्र셌饍योगकी के 啍षे मᴂ हाल के विकास का आदान-प्रदान करना था। संगोष्ठी ने प्रतिभ봾啍ग्रों को 煍ञन का आदान-प्रदान करने और रा�絍री ख्봾ति प्राप्त वरिष्ठ वै煍ञानक के साथ एसटीएईएम 2018 का उ饍घटन सत सीएसआईआर-रा�絍री अतं र्वषयी वि煍ञन तथा प्र셌饍योगकी (सीएसआईआर- बातचीत करने के लिए एक मचं प्रदान किया ताकि संबंधित 啍षे मᴂ नवीनतम एनआईआईएसटी), ति셁वनंतपरु म और माइक्र셋स्कप वि煍ञन तथा परि饃श् से परिचित हो सकᴂ। डायोक्सन इडियं ा 2019 विकास कार्क्रम केहि स्स के 셂प मᴂ आयोजित की गई थी। नमनू ा तैयार करने और वि�लषण मᴂ नवीनतम 셁झानरों को श셂ु करने और डाइऑक्सन उत्सरन को कम करने के लिए वै煍ञानक ठोस अपशिष्ट प्रबंधन की आवश्कता पर जोर देने के लिए कार्क्रम को विशेष 셂प से नियामक एजᴂ啍स्रों (पर्यावण और खाद 啍षे) और अनसु ंधान संस्थनरों के वि�लषकरों और इजीं 啍न्िरों को प्रशि啍षत किया गया था। सीएसआईआर-एनआईआईएसटी के निदेशक डॉ ए अजयघोष ने कार्शाला का उ饍घटन किया। कार्शाला ने डायऑक्सन की निगरानी के सभी पहलओु ं जैसे नमनू ाकरण, नमनू ा तैयार करना, नमनू ा ग को कवर किया और नियामकﴂसाफ करना, परिमाणीकरण और रिपोर् डाइऑक्सन इडियं ा 2019 उ饍घटन आवश्कताओ ंपर ध्봾न दिया। इसके अलावा, नगरपालिका ठोस कचरे के खलेु जल से डाइऑक्सन के उत्सरन पर सीएसआईआर-एनआईआईएसटी अध्यन के मखु ् परिणाम भी कार्शाला के दौरान प्रस्त किए गए। डॉ के पी प्रतीश, वै煍ञानक - प्रभारी, डाइऑक्सन रिसर् लेबोरेटरी ने कार्शाला का समन्व किया और आतरिकं संसाधन व्啍鄿 और कार्शाला के आयोजक थे। अन् संसाधन व्啍鄿 और उनकी प्रस्ुतत का विषय डॉ अनपू कृ ष्न, सहायक निदेशक, निर्यत निरीकण एजᴂसी, कोच्च, भारत सरकार ने खाद और फ़ड निर्यत बाजार मᴂ विनियमरों पर व्봾ख्봾न दिया; श् अभिजीत पथक, वै煍ञानक, एयर लैब, सीपीसीबी, नई दिल्ल एयर सℂपलिंग पर व्봾ख्봾न दिया; श् चद्रशेखं र कं दस्वमी, वै煍ञानक- GC / MS, एजीलᴂट टेक्नलॉजीस ने GC-MS परिमाणीकरण और साधन विधि मान्ता पर ससाधन व㔯क鄿 饍वरा पदर्न ं भाषण दिया और GC प्रजातंत पर श् प्रभाकरन, अनप्रु योग वै煍ञानक, एजीलᴂट सीएसआईआर- एनआईआईएसटी ने 19-21 फरवरी 2019 के दौरान टेक्नलॉजीस, ने भाषण दिया । सश्ु एजें लिका कॉपफ, प्रधान, विक्रय, एल एजीलᴂट टेक्नलॉजीस के सहयोग से "डायोक्सन और पीसीबी मॉनिटरिंग सी टेक, जर्नी ने ऑटोमेटेड सℂपल प्रिपरेशन सिस्म पर भाषण दिया और डॉ के लिए उन्त वि�लषणात्क समाधान" पर तीन दिवसीय डायोक्सन इडियां प्रशांत राजंकर, प्र셋嵍रम कोऑर्डनेटर, पर्यावण संबंधी समस्봾ओ ंसे निपटने 2019 कार्शाला का आयोजन किया। कार्शाला सीएसआईआर के कौशल के लिए एनजीओ संगठन ने विषाक लिंक पर भाषण दिया। National Institute for Interdisciplinary Science & Technology 157 157 Annual Report 2018-19 भारतीय बायोमेडिकल साइसेजं अकादमी की आठवाँ वार्षक बैठक अवार् से सम्मानत भारतीय वि煍ञन संस्थन, बᴂगल셁ु के डॉ सथेस राघवन 饍वार प्लनरी व्봾ख्봾न दिए गए थे। कनाडा के यनिवर्सू टी ऑफ सस्क चवान मᴂ पैथोलॉजी के प्र셋फेसर डॉ जय कालरा ने 絍रड ऑन मेडिकल 配ुटर प्रकटीकरण और इसके निहितार्- एक वैश्विक 饃ष्टिकोण पर बात की। डॉ हरि एस शर्म 饍वार पर्ू व्봾ख्봾न वायमु ार् सजनू और सीओपीडी के ि셋啍ग्रों मᴂ ऊतक रीमॉडेलिंग पर था। भारतीय चिकित्स पद्ध, महामारी वि煍ञन, कℂसर, प्राकृ तिक उत्पदरों और पोषक तत्वों, मधमेह,ु औषधि खोज, सीवीडी और तपेदिक के 啍षे से संबंधित 啍ष配रों के विभिन् चिकित्स वि饍봾ल्रों और अनसु ंधान संस्थनरों के दर्कⴂ को सबं ोधित करते एपीटीडी के पमुख डॉ के.जी. रघु प्रतिष्ठित वै煍ञानकरों 饍वार व्봾ख्봾न दिए गए थे। यवाु शोधकर्तओ ं饍वार पोस्ट भारतीय बायोमेडिकल साइसेजं अकादमी की आठवाँ वार्षक बैठक और मौखिक प्रस्ुतियोंत पर एक समानांतर सत था। सीएसआईआर- एनआईआईएसटी, ति셁वनंतपरु म मᴂ 25 - 27 फरवरी 2019 से मनाई गई। सम्मलन का उ饍घटन डॉ ए अजयघोष निदेशक, सीएसआईआर प्लनरी स्पकर सहित 330 प्रतिभागी थे। भारत के 22 राज्यों से हमारा एनआईआईएसटी 饍वार डॉ चरू मनी सरोज गोपाल और अन् गणमान् प्रतिनिधित् था। इस सम्मलन के दौरान 80 आमत्ं त व्봾ख्봾न, 79 लघ ु व्啍鄿्रों की उपस्थित मᴂ किया गया। उ饍घटन समारोह के बाद न셁लू इस्लम मौखिक प्रस्ुतियत ँ और 80 पोस्ट प्रस्ुतियत ँ हुई।ं शोधकर्तओ ं के बीच परु स्का और IABS परु स्का डॉ अजयघोष 饍वार वितरित किए गए थे। मजबतू और प्रभावी चर्च हुई जो 煍ञन को अदतन करने के साथ-साथ अनसु ंधान की गणु वत्ता मᴂ सधु ार के लिए उपयोगी पाई गई। सम्मलन का सीडीआरआई लखनऊ के परू 㔵 निदेशक डॉ मध ु दी啍षत, शांतीश्व셂प भटनागर समापन 27 फरवरी 2019 को वेलेडिकोरी समारोह के साथ हुआ। राष絍रीय व煍ञन दिवस समारोह सीएसआईआर-नेशनल इसं ्टट्यटू फॉर इटं रडिसिप्लनरी साइसं एडं टेक्नलॉजी (CSIR-NIIST), 28 फरवरी, 2019 को रा�絍री वि煍ञन दिवस मनाया गया। CSIR-NIIST के निदेशक डॉ ए अजयघोष ने स्वगत भाषण दिया और मखु ् अतिथि का परिचय दिया। वि煍ञन और प्र셌饍योगकी विभाग के परू 㔵 सचिव डॉ टी रामासामी ने रा�絍री वि煍ञन दिवस व्봾ख्봾न दिया। रा�絍री वि煍ञन दिवस की उत्पत्त " रामन प्रभाव" जो फोटॉन के बिखरने की घटना है, जो भारतीय वै煍ञानक महोदय चद्रशेखं र वᴂकट रामन 饍वार खोजे गए। इस उल्लखनीय खोज के लिए उन् ᴂ 1930 मᴂ नोबेल परु स्का मिला और यह भारत का पहला नोबेल परु स्का था वि煍ञन के 啍षे मᴂ । उनकी प्रसिद डॉ। टी। रामासामी पूर्वसचिव, वि煍ञन और ꥍ셌饍योगकी घटना की खोज को चिहꄿत करने के लिए भारत मᴂ प्रत्यक वर् रा�絍री वि煍ञन विभाग, राष絍रीय व煍ञन दिवस व्यख्यन देते हℂ दिवस मनाया जाता है। रा�絍री वि煍ञन दिवस के दौरान डॉ टी रामासामी ने "भारतीय वि煍ञन: एक परिप्रे啍ष" विषय पर व्봾ख्봾न दिया। डॉ टी.पी.डी. राजन, अकादमिक 158 National Institute for Interdisciplinary Science & Technology 158 Annual Report 2018-19 EVENTS AND CELEBRATIONS Jigyasa - Scientist-Students Connect Programme Jigyasa - Scientist-Students Connect Programme Programme was inaugurated by the Director, CSIR- was conducted at CSIR-NIIST on April 18, 2018. The NIIST, Dr. A. Ajayaghosh. The programme comprised of interaction with scientists and research scholars and visit to departments to know the R & D infrastructure and facilities of the laboratory. Around 85 students and teachers from six Kendriya Vidyalaya Sangathan schools in Thiruvananthapuram city attended this programme. It was coordinated by Dr. C. H. Suresh, Principal Scientist and Dr. R. Luxmi Varma, Sr. Principal Scientist & Head, Chemical Sciences and Technology Scientists interacting with students Division. National Technology Day CSIR-NIIST celebrated the National Technology Day on May 11, 2018. Dr. A. Ajayaghosh, Director, CSIR-NIIST delivered the welcome address and introduced the Chief Guest of the day. The National Technology Day Lecture was delivered by the chief guest Padma Shri. M. C. Dathan, Scientific Advisor, Government of Kerala & Former Director, VSSC, Trivandrum. He highlighted the opportunities and challenges faced by the industrial sector in Kerala and emphasised the importance of introducing new cost- effective technologies to be competitive in the respective Padma Shri. M. C. Dathan, Scientific Advisor, Government of sectors. Dr. R. Luxmi Varma, Chairperson, Academic Kerala & Former Director, VSSC, Trivandrum addressing the Programme Committee proposed the vote of thanks. audience Felicitation Ceremony of Padma Shri Lakshmikutty Amma Padma Shri Lakshmikutty Amma fondly referred to as ‘Vanamuthassi’ (Grandmother of the jungle in Malayalam) from Kallar forest area at Thiruvananthapuram in Kerala, India who received India's fourth-highest civilian honour Padma Shri for her breakthrough in practising traditional medicine was felicitated at CSIR-NIIST on May 22, 2018 by Dr. A. Ajayaghosh, Director, CSIR-NIIST. She is a famous poison healer practising traditional medicine. She gave a lecture on traditional medicines for diseases like psoriasis, diabetes, migraine etc. from forest plants. Dr.K.G.Raghu, Head, Agro Processing and Dr. A. Ajayaghosh, Director, CSIR-NIIST felicitating Padma Shri Lakshmikutty Amma Technology Division coordinated the event. National Institute for Interdisciplinary Science & Technology 159 159 Annual Report 2018-19 Technology sourcing fest for MSMEs: MSME – Technology Developers Interface Programme presence of Dr. A. Ajayaghosh, Director CSIR-NIIST and Shri P.V.Velayudhan, Director MSME-DI, Thrissur. Shri S.Sivagnanam, AIA, Ministry of MSME, delivered the keynote address and Shri Damodar Avanoor, State President KSSIA felicitated the programme. The programme included technology presentation, an exhibition of technologies by R&D Institutions, Dr.Ajayaghosh A, Director CSIR-NIIST addressing the audience during inaugural session presentation on technology requirements of MSMEs MSME Development Institute, Thrissur, Ministry and interactive meetings. of MSME in association with CSIR- NIIST, The programme was beneficial to MSMEs to adopt Thiruvananthapuram and other stakeholders new technologies in the field of Food & Agro- organised “Technology Sourcing Fest for MSMEs”: processing, Environment and waste management, MSME – Technology Developers Interface Energy-efficient technologies and composites Programme on June 12, 2018. The programme was developed by Scientific organization and it not convened as a Southern Summit of MSMEs, R&D only help them for technological up-gradation and Institutes and Technology providers from southern modernization besides the opportunity for value states. The programme was intended to showcase addition. Scientific organizations such as KFRI, Peechi, technology sources for MSMEs and to facilitate RRII, Kottayam, IWST, Bengaluru, IICT, Hyderabad, technology transfer for better technology management Kerala Agricultural University, Vellayani, SCITMST, in association with technology providers. KSCSTE, CCRI, Alappuzha, VSSC, CPCRI, Kasargode, Shri K.Biju IAS, Director of Industries & Commerce, C-DAC, CIPET, CFTRI, Mysore etc. Around 250 MSME inaugurated the Technology Fest for MSMEs in the units participated in the programme. International Yoga Day NIIST family practicing yoga As per instructions from CSIR, the Institute organized a mass drill and yoga practice on the occasion of International Yoga day observed on June 21, 2018. 160 National Institute for Interdisciplinary Science & Technology 160 Annual Report 2018-19 Hindi Workshop / Orientation Program on e-Tools A workshop cum orientation program was organized The workshop comprised of the introduction of on July 25, 2018, to give awareness and practical the self-learning packages ie, Leela Hindi Prabodh, training on effective tools to work in Hindi on the Praveen and Pravaah courses developed by the computers, such as Sruthlekhan, Mantra, Pravachak, Department of Official Language for learning Hindi voice to typing etc. Mr. Anil Kumar, Chief Manager online, the procedure for downloading Indic Language (Rajbhasha), State Bank of India, Local Head Office, input tools from Bhasha India’s site. During the Thiruvananthapuram was the resource person. 23 workshop the participants were introduced to the employees having proficiency in Hindi participated in machine-derived translation system -Mantra, with the the workshop. help of which documents related to administrative, financial, agricultural, small scale industries, Information Technology, health, defence, education and banking sectors could be translated from English to Hindi. Participants were introduced to the tool Sruthlekhen- Rajbhasha which is a landmark in the field of speech technology. Sruthlekhen- Rajbhasha is a Hindi Speaker Free, continuous speech recognition system, which enables the computer to recognize human speech and to provide output in Hindi Unicode. Thereafter the participants were introduced to the e-dictionary developed by the Department of Official Language. The guest speaker appealed to the participants to download all these software on their Mr. Anil Kumar, Chief Manager (Rajbhasha), State Bank of India, giving lecture on e-tools in Hindi desktop and make use of them in their daily activities. The workshop ended with a quiz programme. Hindi Week The Institute observed September 14, 2018, as Hindi Day and the week succeeding up to September 21, 2018, was observed as Hindi week. A formal inauguration ceremony of Hindi Week was organized on September 14, 2018. Dr. P. Prabhakar Rao, Chairman, Organizing Committee welcomed the participants. In his welcome address, he gave brief information on the relevance of organizing Hindi Divas and Hindi Week in Central Government Dr. P. Prabhakar Rao, Chairman Organizing Committee welcoming the participants Offices. Dr. A. Ajayaghosh, Director, CSIR-NIIST chaired the inaugural session and offered the presidential were shown the Honorable Home Minister Shri address and announced the formal inauguration of the Rajnath Singh’s Hindi Day message with the help of a Hindi Week of 2018. During the function, participants projector. National Institute for Interdisciplinary Science & Technology 161 161 Annual Report 2018-19 After the inauguration session, Dr. Sushanta Kumar Sahoo, Scientist, gave a scientific presentation on "Bio- based polymer from renewable resources" in Hindi. Staff members participating in the competition The concluding ceremony and prize distribution were organized on September 21, 2018. Mr. R. Krishnadas, IBS, Deputy Director-General, Doordarshan Kendra, Dr. Sushanta Kumar Sahoo giving presentation on" Thiruvananthapuram presided over as the chief guest. Bio-based polymers from renewable resources” The Chief Guest in his address justified the importance of learning Hindi as the language of the general The following competitions were organized public and distributed prizes to the winners of various throughout the week for the staff and students of the competitions. Institute namely Hindi Online Quiz, Hindi Quiz, Hindi Antakshari, Hindi Debate on “Is social media a big challenge for democracy”. Apart from this, a Hindi Quiz Competition was conducted exclusively for the school students of the staff members of the institute (Class-I to Class-XII students). Staff members, including research students, participated in all competitions in large numbers and Mr. R. Krishnadas, IBS, Deputy Director, Doordarshan Kendra, with full enthusiasm. Thiruvananthapuram addressing the gathering CSIR Foundation Day institutions visited the R&D facilities. Dr. A. Ajayaghosh, Director, CSIR-NIIST delivered the welcome address and presided over the CSIR Foundation Day function. Dr. V.K. Ramachandran, Vice Chairman, Kerala State Planning Board, Government of Kerala, Trivandrum, the Chief Guest for the function, delivered the CSIR Foundation Day lecture. The superannuated Address by chief guest Dr. V.K. Ramachandran on employees of CSIR-NIIST during 2017-18 and the CSIR Foundation Day employees who completed 25 years of service in CSIR CSIR Foundation Day was celebrated at CSIR-NIIST were felicitated and the studentship award 2017-18 on September 27, 2018. The day was observed as an was distributed. Dr. R. Luxmi Varma, Chairperson, open day for showcasing the activities of the institute Academic Programme Committee proposed the vote and about 400 students from various educational of thanks. 162 National Institute for Interdisciplinary Science & Technology 162 Annual Report 2018-19 NIIST Foundation Day Dr. A. Ajayaghosh, Director, CSIR-NIIST delivered the welcome address and presided over the CSIR-NIIST Foundation day function. Shri Keshvendra Kumar IAS, Secretary, Department of Ayush and State Mission Director, National Health Mission, Government of Kerala, Thiruvananthapuram was the Chief Guest for the function. He appreciated the scientific achievements of Release of Annual report during NIIST Foundation day the laboratory. The Annual Report of CSIR-NIIST for the CSIR-NIIST Foundation Day was celebrated at CSIR- year 2017-18 was released by the Chief Guest. Dr. T.P.D. NIIST on October 6, 2018. The day was observed as Rajan, Convener, Academic Programme Committee, an open day and about 350 students from various CSIR-NIIST, Thiruvananthapuram proposed the vote of educational institutions visited the R&D facilities. thanks. Vigilance Awareness Week Vigilance Awareness week was observed in the Institute from October 29 to November 2, 2018. The vigilance awareness week commenced with the administration of pledge in both Hindi and English. The staff were also encouraged to take e-pledge by visiting CVC’s site. A talk on “Tendering – In the vigilance perspective” was held for benefit of all staff members and students by Shri. Thomas T. Kuriakose, Controller of Stores and Sri B.S. Mohammed Yasin, IPS, ADGP (Vigilance) Purchase. Various competitions were held during addressing the audience the week namely elocution competition, debate on and presided over by Sri B.S. Mohammed Yasin, IPS, the topic “Individual or system breeds corruption?”. ADGP (Vigilance). The chief guest gave an informative A competition on slogan writing was held on the speech on Anti-Corruption and vigilance in Kerala in theme “Eradicate corruption–build a new India”. The comparison with other states. He also gave away the valedictory function was held on 2nd November 2018 prizes to the winners of various competitions. Visit of Director General, Council of Scientific & Industrial Research (CSIR) Dr. Shekhar C Mande, Secretary, DSIR & Director General, Council of Scientific & Industrial Research (CSIR), New Delhi after taking charge on 16th October 2018, visited CSIR-NIIST on 16th -17th November 2018. He attended the Research Council meeting on 16th November 2018 to get acquainted with the research activities of NIIST. On 17th he addressed the Dr. Shekhar C Mande, Secretary, DSIR & Director General, Council of staff and students and gave insight into the Scientific & Industrial Research (CSIR) addressing the NIIST members contributions of CSIR for the nation and society. National Institute for Interdisciplinary Science & Technology 163 163 Annual Report 2018-19 He appreciated the staff and students of CSIR-NIIST for interactive session with Scientists, administrative actively involving in the flood relief activities when the staff and students to discuss regarding the challenges state was facing a catastrophe. He also had a separate faced in the system. Polymer Chemistry for Young Researchers PCYR-18 was jointly organized by CSIR-NIIST, Trivandrum and SPSI Trivandrum chapter on 17th November 2018 and was inaugurated by the eminent Prof. Abhijit P. Deshpande, IITM, Chennai and Dr. Sudha JD convened the whole program. This conference envisaged discussing recent trends and developments in the field of synthesis, modification, and characterization of polymers, polymer blends, composites and processing of polymers, Smart polymers, conducting polymers and biopolymers, Optoelectronic properties and Inauguration applications of polymers, Bio-related application of polymers, Polymer stability and degradation, Moreover, this conference provided an ideal platform Physics of polymers (theory, modelling and for young scientists to present posters and discuss simulation). Through this conference, the young their work and knowledge of polymer science and researchers got a unique opportunity to deliver technology. About 300 students were benefitted by invited lectures in front of an august audience. this program. Seventh International Conference on Solidification Science and Processing (ICSSP7) Concluding session of ICSSP 2018 The Seventh International Conference on Interdisciplinary Science and Technology (CSIR-NIIST) Solidification Science and Processing (ICSSP7) was and the Indian Institute of Technology Madras and organized jointly by the CSIR-National Institute for held in Thiruvananthapuram during November 19– 164 National Institute for Interdisciplinary Science & Technology 164 Annual Report 2018-19 22, 2018. ICSSP, a triennial international conference, University, Berlin, Germany. The ICSSP7 had 71 invited is being organized since 2001 to allow researchers to oral presentations by eminent researchers in the field exchange their knowledge on recent advances in the and 67 poster presentations by young researchers from broader field of solidification. In this series, the ICSSP7 various countries. was chaired by Professor John Banhart, Technical National Conference on Emerging Trends in Science, Technology & Application of Electron Microscope (STAEM-2018) A three-day national conference was organized jointly by CSIR-National Institute for Interdisciplinary Science and Technology, Trivandrum and Academy of Microscope Science and Technology (AMST), India during December 19 – 21, 2018. The objective of the conference was to exchange the latest state of the art and scientific information in microscopy of the Inaugural session of STAEM-2018 advanced materials, and recent development in the and for interacting with Senior Scientists of national field of science and technology. To provide a platform repute so as to get acquainted with the latest scenario to the participants for exchanging the knowledge in the concerned field. Dioxin India 2019 CSIR- NIIST conducted a three-day “DIOXIN INDIA and research institutes, to introduce the latest trends 2019 workshop on "Advanced Analytical Solutions in sample preparation and analysis and to emphasis for Dioxins & PCBs Monitoring" in collaboration with the need for scientific solid waste management Agilent Technologies during 19-21st February 2019. for reducing dioxin emissions. Dr. A. Ajayaghosh, The workshop was conducted as part of the Skill Director, CSIR-NIIST inaugurated the workshop. The Development Programme of CSIR. The programme workshop covered all aspects of dioxins monitoring was specifically focussed to train analysts and engineers such as sampling, sample preparation, sample clean of regulatory agencies (Environmental & Food sector) up, quantification and reporting and touched upon Demonstration by resource person Dioxin India 2019 inauguration National Institute for Interdisciplinary Science & Technology 165 165 Annual Report 2018-19 the regulatory requirements. In addition, the salient Mr. Chandrasekar Kandaswamy, Scientist- GC/MS, outcomes of CSIR-NIIST studies on the emission of Agilent Technologies; Mr. Prabhakaran, Application dioxins from open burning of municipal solid wastes Scientist, Agilent Technologies; Ms. Angelika Kopf, were also presented during the workshop. Head, Sales, LC Tech, Germany and Dr. Prashant Rajankar, Programme Coordinator, Toxic Links. Dr. K. P. Prathish, Scientist – in charge, Dioxin Research The major topics discussed were on Regulations in Laboratory coordinated the workshop and was food and feed export market, air sampling, GC-MS the internal resource person and organizer of the quantification & instrumental method validation, workshop. Other resource persons were Dr. Anoop GC-MS troubleshooting and automated sample Krishnan, Assistant Director, Export Inspection preparation systems. Agency; Shri. Abijit Pathak, Scientist, Air Lab, CPCB; Annual meeting of Indian Academy of Biomedical Sciences The 8th Annual meeting of IABS was celebrated from 25th to 27th February 2019 at CSIR-NIIST, Thiruvananthapuram. The conference was inaugurated by Dr. A Ajayaghosh, Director, CSIR-NIIST in the presence of Dr. Chooramani Saroj Gopal and other dignitaries. The inauguration was followed by Noorul Islam Award Session and IABS award ceremony and the awards were distributed by Dr. A. Ajayaghosh. There were plenary lectures by Dr. Madhu Dixit, former Dr. K.G. Raghu, Head of APTD addressing the audience during inauguration Director of CDRI Lucknow, Dr. Adriaan Ligtenberg, Dr. Sathees Raghavan, from Indian Institute of Science, the poster and oral presentations by young researchers. Bangalore, Dr. Jai Kalra, Professor of pathology at There were around 330 participants including the University of Saskatchewan, Canada and Dr. Hari S plenary speakers. We had representation from 22 Sharma. states of India. There were 80 invited talks, 79 short oral There were invited lectures by eminent scientists presentations and 80 poster presentations during this from various medical schools and research institutes conference. There were strong and effective discussions in the areas pertaining to the Indian system of among the researchers which were found to be useful medicine, Epidemiology, Cancer, Natural products and for updating knowledge as well as improvement of the nutraceuticals, the field of Diabetes, Drug discovery, quality of research. The conference ended with the CVD and Tuberculosis. There was a parallel session on Valedictory function on 27th February 2019. National Science Day The National Science Day was celebrated at CSIR- Guest of the day. Dr. T. Ramasami Former Secretary, National Institute for Interdisciplinary Science and Department of Science and Technology delivered Technology (CSIR-NIIST), Trivandrum on February 28, the National Science Day Lecture. The genesis of 2019. Dr. A. Ajayaghosh, Director, CSIR-NIIST delivered the National Science Day is to commemorate the the welcome address and introduced the Chief “Raman effect”, a phenomenon of scattering of 166 National Institute for Interdisciplinary Science & Technology 166 Annual Report 2018-19 photons discovered by celebrated Indian Scientist Sir Chandrasekhara Venkata Raman which got him Nobel Prize in 1930 for this remarkable discovery and this was the first Nobel Prize for India in the field of Science. To mark the discovery of his famous phenomenon National Science Day is celebrated in India on the day each year. During the National Science Day, Dr. T. Ramasami delivered a lecture on “Indian Science: A Perspective”. Dr. T.P.D. Rajan, Convener, Academic Dr. T. Ramasami, Former Secretary, Department of Science and Programme committee proposed the vote of thanks. Technology delivering the National Science Day Lecture National Institute for Interdisciplinary Science & Technology 167 167 Annual Report 2018-19 बा褼 से पीडत केरल के लोगⴂ की मदद के लिए एनआईआईएसटी छात्समुदाय की जोश सदी की सबसे बड़ और सबसे बरु ी बा褼 आपदा का अनभु व करने के बाद के रल राज् सामान् स्थित मᴂ वापस आ रहा है । परू े के रल मᴂ मई 2018 से हुई मसलू ाधार बारिश के कारण सभी जलाश्रों मᴂ भारी मा配र मᴂ बारिश का पानी जमा हो गया जिसके कारण अगस् को राज् के 35 बांधरों को खोलने पडे । भारी और अभतपू रू 㔵 निरंतर मसलधू ार बारिश से स्थित बिग蔼 गई। परिणामस्셂प, अधिकांश नदी अधिक पानी के साथ बह गई और कु छ ही समय मᴂ निचले इलाकरों मᴂ बा褼 आ गई। मि絍ट लथपथ होने से उच् 啍षे बरु ी तरह प्रभावित थे और ढीली मि絍ट ट्गर कर राज् के कई हिस्सों मᴂ विनाशकारी भसू ्लन हुआ । । सैक蔼रों घर तबाह या क्षतस् हो गए, कई सौ लोगरों की जान चली गई और लगभग हर बनियाु दी ढांचा, बिजली और पानी की आपर्तू परू ी तरह से हिरासत मᴂ लिया गया और उखा蔼 दिया गया, जिसके परिणामस्셂प कु ल अराजकता हो सकती है, लेकिन सरकारी और गैर सरकारी मशीनरी के सामजसं ्पर्ू और सिंक्रनाइज तरीके से समय पर हस्啍षप के कारण स्थित जिस सीमा तक संभव हो, नियंतण मᴂ आ गयी । सीएसआईआर- एनआईआईएसटी परिवार तथा संपर्ू सीएसआईआर प्रयोगशालाओ ं ने ज셂रतमदं समय पर जिम्मदारी, प्रतिबदता और समर्ण की उच् भावना के साथ बा褼 प्रभावित 啍ष配रों से आये एसओएस कॉल का जवाब दिया । हमारे आदरणीय निदेशक की अनमु ति, समर्न और निरंतर प्र셋त्सहन के साथ इस संबंध मᴂ सामहिू क प्रयास श셂ु किए गए । राज् के विभिन् हिस्सों मᴂ बा褼 गस् लोगरों को बचाव ऑपरेटिरों से जो蔼ने के उ饍शद ् से संस्थन मᴂ हेल् डेस् की पहल प्रारंभ किया गया । हेल् डेस् के समक कई आवश्कताए ं बताई गई ंऔर निराश섿तरों की सवु िधा के लिए हर संभव सहयोग दिया गया। सदस्यों और स्वंसेवकरों को स्थित के वास्तिक समय अलर् दिया गया । छात संघ के सदस्यों ने ति셁वनंतपरु म के संगह बिंदओु ंपर अधिकारि्रों से संपर् किया और फीडबैक के आधार पर, आवश्क चीजरों की खरीद और आपर्तू श셂ु कर दी,जो बा褼 गस् लोगरों के समर्न के लिए आवश्क थी । जीवन अपे啍षत सामग्रियो को एकत करके प्रभावित स्थनरों पर परिवहन करने के उ饍शद ् से कℂपस के अदं र संगह बॉक् लगाए गए थे और ति셁वनंतपरु म शहर के विभिन् भागरों मᴂ संगह बॉक् लगाए गए थे अर्थत ् रामचद्रनं प सु र स्टोर, पोथीस और बिग बाजार। एकत्त राहत सामग्रियो को छांटकर उन् ᴂ पैक और लेबल किए गए और प्रभावित स्थनरों पर एयर 蕍रप करने के लिए ति셁वनंतपरु म मᴂ स्थापत विभिन् संगह स्थनरों पर ले गये । स蔼करों की बरु ी स्थित के कारण सामानरों का परिवहन सबसे बड़ चनु ौती थी । इस अवसर पर स्टफ और प्रशासन सहायता के लिए आगे आये और लॉजिस्टक के म饍ु द को हल किया और अलप्षप ़, कु टनाडु चᴂगन्ून के कु छ शिवििरों मᴂ अपने निजी वाहनरों मᴂ आवश्क सामग्रियो को पहुँचाया। संस्थन के पिक-अप वैन मᴂ एमजी विश्ववि饍봾लय परिसर के शिविर के लिए सामान के कई लोड पहुँचाया गया । समय पर हस्啍षप से 1000 से अधिक लोगरों को बचाव दलरों के साथ जोड़ सका और उन् ᴂ भोजन और प्राथमिक आवश्कताओ ं को प्रदान किया गया। एनआईआईएसटी कℂटीन ने क셁मम और वेट्क्क ज़ (ति셁वनंतपरु म) मᴂ दो शिवििरों मᴂ भोजन की आपर्तू की गयी। सीएसआईआर परिवार के सदस्यों ने एनआईआईएसटी 饍वार समन्वत बा褼 राहत गतिवि啍ध्रों मᴂ परू े दिल से योगदान दिया । सीएसएमसीआरआई, सीएलआरआई, सीईसीआरआई, आईएमएमटी, नीरी,आईएचबीटी,सिमैप और सीएफटीआरआई जैसे सहोदर प्रयोगशालाओ ं ने कपड़, दवाइयां, खाद साम嵍र, वाटर फिल्ट और मच㔛र निरोधक जैसी सामग्रॉ प्रदान करके मदद दी । सीएसएमसीआरआई से मोबाइल जल शोधन इकाई 10 दिनरों के लिए पीने का पानी प्रदान करके बा褼 प्रभावित 啍ष配रोंमᴂ सेवा की । उनकी सेवा का सबसे ज्봾दा सराहना की गयी क्यों कि उस समय लगभग परू े जल 셋त दषिू त थे और पेयजल एक गंभीर समस्봾 थी । 2 करो蔼 셁पये से अधिक लागत की सामग्रॉ प्रभावित स्थनरों पर वितरण के लिए संस्थन मᴂ पहुचे,ं जिसमᴂ वाटर फिल्ट की 1000 इकाइयाँ (500 इकाइयाँ आईएमएमटी से और 500 नीरी से), मच㔛र रिपेलन्ट् की 50000 इकाइयाँ (सिमैप से ), 200000 यनिू ट के फू ड पैकेट (राजमा, खिचड़, न्絍य रीबा और चिक्क, प्रत्यक के 50000 पैकेट, आईएचबीटी से), शामिल थे । 2 मिनी लोरियां, एनआईआईएसटी के पिकअप वैन और 4 क봾िरों मᴂ विभिन् गंतव्यों के लिए सामग्रियो को बड़ पैमाने पर स्थनांतरण किया गया । संस्थन मᴂ प्राप्त हर एक राहत साम嵍र का सफल वितरण सनिशु 椿त करने के लिए साम嵍र का वितरण अगले दिनरों मᴂ जारी रहा । कड़ मेहनत से कैनके री, रान्न, पथनंथि絍ट, एडत्तवाु , चेरतला, रमनकरी, तकष़, निरनम, पडियरू , मतिलकम, चᴂगन्नश्शेी , कोट्म, डप्नक्क न्,अलन ंगा蔼, नेडुमडी,ु तलवड़, ति셁वल्ल जैसे बा褼 गस् 啍ष配रों तक पहुँचाकर सहायता वितरित रने मᴂ टीम सकम थे । 168 National Institute for Interdisciplinary Science & Technology 168 Annual Report 2018-19 Enthusiasm of NIIST student’s community to help the flood affected Kerala The State of Kerala is springing back to normalcy after experiencing the century’s biggest and worst flood disaster. The torrential rain all over Kerala since May 2018 accumulated huge quantity of rain water in all reservoirs finally forcing the opening of 35 dams in the state in August 2018. The heavy and unprecedented continuous downpour worsened the situation. As a result, most of the riverine swelled with excess water flooding low lying areas in no time. The high range areas were badly affected devastating landslides in many parts of the state. Hundreds of houses were destroyed or damaged, several hundred lives lost and almost every infrastructure, power and water supply were completely destroyed and uprooted. However, timely intervention of Government and non-Government machinery in a harmonious and synchronized manner contained the situation to the extent possible. The CSIR-NIIST family and CSIR as a whole quickly responded to the SOS calls from the flood affected areas depicting high sense of responsibility, commitment and dedication at the neediest hour. With the permission, support and continuous encouragement from our respected Director collective efforts were initiated for flood effect mitigation support activity. A Help Desk initiative with an aim to connect the surrounded people to the rescue operators at various parts of the state was opened at the institute. Several requirements were reported before the Help Desk and all possible support were done to facilitate the destitute. The members and volunteers were given real time alerts of the ongoing situation. Student Association members contacted the officials at the Thiruvananthapuram collection points. Based on their feedbacks and several requests posted from various parts of the state we began to procure and supply things that were essential for rending support. Collection boxes were put up inside the NIIST campus and also at various points in the Thiruvananthapuram city namely, in front of Ramachandran Super Stores, Pothys and Big Bazaar. The collected relief materials were sorted out, packed and labelled and were taken to the collection points at Thiruvananthapuram to air drop at the affected places. Transportation of the collected goods to different affected places was the biggest challenge due to badly affected roads. The staff and the administration rose to the occasion and solved the logistics issue and transported requirement materials in their private vehicles to some of the camps at Alappuzha, Kuttanadu and Chengannur. The NIIST pick-up van transported several load of materials to the camp at MG University campus. With timely interventions it was possible to connect more than 1000 people with the rescue teams and were provided food and primary requirements. NIIST canteen provided food to two camps at Karumam and Vettukkuzhi (Thiruvananthapuram). The members of CSIR family wholeheartedly contributed to the flood relief accomplishments coordinated by NIIST. Sister laboratories CSMCRI, CLRI, CECRI, IMMT, NEERI, IHBT, CIMAP and CFTRI offered helping hands by providing clothing, medicines, food materials, water filters and mosquito repellents. Mobile water purification unit from CSMCRI served the flood hit areas for 10 days by providing drinking water to the areas. Their service was most appreciated as the drinking water was a serious problem at the time with almost every water source contaminated. There were 1000 units of water filters (500 from IMMT and 500 from NEERI), 50000 units of mosquito repellents (CIMAP), 200000 units of food packets (Rajmah, Khichdi, nutribar and chikki each 50000; from IHBT), worth more than 2 Crore rupees reached institute for distribution to affected places. A mass transfer National Institute for Interdisciplinary Science & Technology 169 169 Annual Report 2018-19 of materials to different destinations was made comprising 2 mini lorries, NIIST official pickup and 4 cars. The distribution of materials continued in the following days ensuring the successful delivery of every single item of relief material that was received at the institute. With days of hard-work the team were able to get its hands reached out to areas Kainakary, Ranni, Pathanamthitta, Edathua, Cherthala, Ramankary, Thakazhy, Niranam, Padiyoor, Mathilakam, Chengannor, Changanassery, Kottayam, Kodupunnakkavu, Alangad, Nedumudy, Thalavady, Thiruvalla etc. The final load was transported to Thrissur by means of NIIST official vehicle. The flood relief activities continued for 80 days with every NIIST member making their contribution to the activity. The money collected from NIIST and other CSIR laboratories was handed over to the Government by our respected Director. The team work reminded the spirit of togetherness and aroused the essence of humanity. The team could spread smile on more than 25000 individuals which would be the greatest success of this mission. राहत शिवििरों मᴂ वितरित करने के लिए भोजन पैक करने मᴂ व्स् एनआईआईएसटी टीम Food to be distributed being packed by NIIST team राहत साम嵍र पैक करते हुये एनआईआईएसटी छात समदु ाय Relief materials being sorted out, packed and labelled by NIIST students पेयजल मोबाइल यनिू ट के साथ परू ी तरह से तैयार सीएसआईआर- सीएसएमसीआरआई टीम Mobile water purification unit from CSIR-CSMCRI मखु ्म配ं र की राहत निधि मᴂ संस्थन 饍वार समाहरण की गयी निधि के लिए चैक सपते हुएडॉ ए अजयघोष, निदेशक, सीएसआईआर- एनआईआईएसटी Dr. A. Ajayaghosh, Director, CSIR-NIIST handing over the राहत साम嵍र के साथ प्रस्थन के लिए परू ी तरह से तैयार monetary contributions to Chief Minister's flood relief fund एनआईआईएसटी वाहन Relief materials loaded NIIST vehicle ready for departure 170 National Institute for Interdisciplinary Science & Technology 170 Annual Report 2018-19 172 National Institute for Interdisciplinary Science & Technology 172