´ÉÉʹÉÇEò |ÉÊiÉ´ÉänùxÉ ANNUAL REPORT 2017-2018
CSIR-National Institute for Interdisciplinary Science & Technology (NIIST) ´ÉÉʹÉÇEò |ÉÊiÉ´ÉänùxÉ 2017-2018 ANNUAL REPORT
Published by : The Director National Institute for Interdisciplinary Science & Technology, Thiruvananthapuram
Editorial Committee : Dr A Ajayaghosh Dr A Sundaresan Dr P Prabhakar Rao Dr K Harikrishna Bhat Dr Elizabeth Jacob Dr B S Dileep Kumar Dr. Raghu K G Dr Luxmi Varma Dr C Chandrasekhara Bhat Dr K Madhavan Nampoothiri Mr C K Chandrakanth Mr R S Praveen Raj Mr V Moni Dr Deepa Balan
Hindi Translation : Mrs K S Lathidevi Mr Vishnu Gurjar
Photography : Mr G Nagasrinivasu
Design & Printing : Akshara Offset Thiruvananthapuram
ºÉÒ BºÉ +É<Ç +É®ú - ®úɹ]ÅõÒªÉ +ÆiÉ̴ɹɪÉÒ Ê´ÉYÉÉxÉ iÉlÉÉ |ÉÉètÉäÊMÉEòÒ ºÉƺlÉÉxÉ
CSIR–National Institute for Interdisciplinary Science and Technology (NIIST) c onte n t s
05 Foreword
07 Significant Achievements
14 Agro Processing & Technology Division
26 Microbial Processes & Technology Division
41 Chemical Sciences & Technology Division
63 Materials Science & Technology Division
82 Environmental Technology Division
94 S&T Services
154 General Information
प्रस्鄾वना
टीम सीएसआईआर-एनआईआईएसटी की तरफ से आपको वर㔷 2017- ईआईए अध्यन के माध्म से पर्यवरण संरकण और निगरानी की हमारी 18 की वार्षक रिपोर् प्रस्त酁 करने मᴂ मझेु बहुत खशीु और विशेषाधिकार प्रतिबद्धता का पालनकिय ा जाता है । यह उल्लखनीय है कि सीएसआईआर- है । पिछले कु छ वरषों मᴂ सीएसआईआर-एनआईआईएसटी अपना ध्यन, एनआईआईएसटी केरल मᴂ एकमात संगठन है, जिसे श्रेणी ए परियोजनाओ ं मᴂ प्रतिबद्धताओ,ं कामकाज और वै煍ञानक गतिविधियⴂ के निष्पदन को एक ईआईए परामर्दाता के 셂प मᴂ एनएबीईटी / एमओईएफ मान्ता प्राप्तहै । राष絍री तथा सीएसआईआर मिशन व जनादेश के साथ संरेखित कर रहा है । हमारी परिष्क त परीकण और वि�लेणात्क सविधु ाए ं इन-हाउस आर एडं डी सीएसआईआर-एनआईआईएसटी ने इस गतिशील 셂प से बदलते पर्यवरण गतिविधियⴂ को आगे बढ़ने मᴂ सहायता प्रदान करने के साथ ही साथ बाहरी को सफलतापर्ू क अनकु ू लित किया और अनमाु नित ल啍ष् और परिणामⴂ को 嵍रहकⴂ के लिए परीकण और वि�लेणात्क सेवाओ ंकी एक विस्त श्रखलांृ पराू किया । इस अवधि के दौरान उच㔚 प्रभाव सअनु ंधान, आईपी उत्पदन, प्रदान करतीहै ।ंस ्थन मᴂ एक समर्पत डाइऑक्सइन परीकण सविधु ा भी औ饍योगक गठबंधन, मानव संसाधन विकास तथा नए सहयोगी भागीदारⴂ और है। एसीएसआईआर के तहत पीएचडी कार्क्रम, कौशल विकास कार्क्रम, एमएससी और एम.टेक. परियोजना कार् आदि के माध्म से छा配र, उद्यमⴂ, हितधारकⴂ को आकर्षत करते हुए संस्थन ने महत्पर्ू योगदान देना जारी अकादमिक और उ饍यगⴂ को लाभान्वत करते हए मानव ससाधन विकास हमारे रखा । हमारी टीम के वै煍ञानकⴂ, तकनीकी कर्मारियⴂ, प्रशासनिक कर्मारियⴂ ु ं सस्थन का ध्यन कᴂ द섿त एक और प्रमख 啍षे है । और छा配र के अथक और समर्पत प्रयासⴂ की वजह से और सीएसआईआर- ं ु मख्ु यलय से समय पर प्राप्त समर्न से यह संभव हो पाया था । उ饍शद ्ⴂ और वर㔷 2017-18 की अवधि के दौरान संस्थन 饍वरा कई महत्पर्ू कार्क्रम ल啍ष् को प्राप्त करनेमᴂ कड़ मेहनत और सहयोग दिये सभी सहयोगियⴂ को मℂ आयोजित किए गए। प्रौ饍योगकी हस्तातरण / लाइसᴂसिंग को सकम करते हुए इस अवसर पर धन्वाद देता हू ं । उ饍यगⴂ, उद्यमⴂ, एमएसएमई और अन् हितधारकⴂ के लिए एक आम मचं प्रदान करने के लिए आर एडं डी- उ饍यग बैठक, कार्यत्क रंगⴂ और उन्त संस्थन के जोरदार 啍ष配र मᴂ रसायन, ऊर्ज (पारंपरिक और गैर परंपरागत), सामग्रⴂ पर 8 वĂ पर्ू एशिया सगो�ठ, वि煍ञन तथा प्रौ饍योगकी म配रलय, पथृ ्व कार्यत्क खाद पदार्, सर啍ु ष अनप्रु योगⴂ के लिए फ्लरोसᴂट साम嵍र, ं ं वि煍ञन म配रलय और वि煍ञन भारती 饍वरा सयक्तु 셂प से आयोजित आउटरीच न्絍य रस्ूटय कल्, फसलोत्तर टेक्नलॉजीज, डायग्नोस्क प्रोब, ड्रग ं ं कार्क्रम "विभा", सीएसआईआर और के न्द् वि饍यलय के बीच की एक इटरमीं डिएट्स, पॉलिमर कं पोजिट्स, हल्क मिश्र धात ु और कम㔪्टेशनलय पहल "जि煍ञसा" ध्यन देने योग् कार्क्रम हℂ। "विभा" और "जि煍ञसा" मॉडलिंग शामिल हℂ । फास् 絍रक ट्रसलेशन और फास् 絍रक व्यवसायीकरण कार्क्रमⴂ का उ饍शद ् यवा छा配र के बीच वै煍ञानक अनसधान और विकास की (एफटीटी और एफटीसी) मोड के माध्म से अच्छ तरह से निर्धरित ल啍ष् ु ु ं दिशा मᴂ जाग셂कता और 셁चि पैदा करना था । और परिणामⴂ के साथ इन डोमेन पर काम जारी रखने के लिए हम प्रयास करᴂगे । -ग अवधि के दौरान परस्कर और प्रशसा जीत सीएसआईआरﴂरिपोर् वर㔷 2017-18 हमारे लिए एक उत्तेजक वर㔷 था, हमारे बाहरी नकदी प्रवाह, वर㔷 ु ं एनआईआईएसटी के सभी को मℂ बधाई देता ह और मझे आशा है कि तीव्र शोध ु ंू ग अवधि मᴂ प्रयोगशाला रिजर् मᴂﴂके दौरान 27% था, अब रिपोर् 2016-17 लगातार वद्धिृ के साथ बाहरी नकदी प्रवाह 31% हो गया है। सरकार, निजी प्रयासⴂ के माध्म से वे अपनी रचनात्कता को बनाए रखᴂगे। सीएसआईआर और शैक्षक 啍ष配र मᴂ शामिल हमारे हितधारकⴂ के समर्न से ही यह संभव हो मख्ु यलय, अन् वित्त पोषण एजᴂसियⴂ और उ饍यगⴂ से प्राप्त समर्न के लिए पाया । हमारे प्रकाशनⴂ का औसत प्रभाव कारक सबसे उच㔚 स्र 4.16 तक मℂ आभारी हू ं । समाज को प्रभावित करने वाले ल啍ष् को प्राप्त करनेमᴂ समान ब褼 गया । विचारधारा के वै煍ञानक और औ饍योगक समदाु य के साथ सहयोग करने के लिए हम तत्र हℂ । खनन और बंदरगाह 啍ष配र से संबंधित पर्यवरण प्रभाव आकलन (ईआईए)मᴂ शभकामनाु सहित, सीएसआईआर-एनआईआईएसटी एक मजबत स्थित रखता है । हमारे 嵍रहक ू ए अजयघोष की बैठक, जो ईआईए की अनिवार् आवश्कता है, को सनिशु 椿त करते हुए निदेशक Foreword
On behalf of Team CSIR-NIIST, it gives me immense pleasure protection and monitoring is adhered to while ensuring our and privilege to present the Annual Report of 2017-18 to you. customer’s meeting, the mandatory EIA requirement. It may Over the past few years CSIR-NIIST has been aligning its focus, be noteworthy that CSIR-NIIST is the only organization in commitments, functioning and execution of scientific activities Kerala with NABET/MOEF accreditation as an EIA consultant with National as well as CSIR Missions and Mandates. CSIR- in category A projects.Our sophisticated testing and analytical NIIST had successfully adapted with this dynamically changing facilities offers a wide range of testing and analytical services to environment and accomplished the projected targets and the external clients while pursuing in house R&D activities. The outcomes. During this period the Institute continued to make Institute also has a dedicated dioxin testing facility. The human significant contributions in high impact research, IP generation, resource development is another major area of focus of our forging industrial alliance, human resource development, Institute through Ph.D. Programs under the aegis of AcSIR, skill attracting new collaborating partners and stake holders. This development programs, M.Sc. and M.Tech. project works etc. was possible due to the untiring and dedicated efforts of our benefiting students, entrepreneurs, academia and industries. team of scientists, technical staff, administrative staff, students Several important programs were organized by the Institute and the timely support from CSIR-HQ. I take this opportunity to during the period 2017-18. Noteworthy are the R&D industry thank all my colleagues for their hard work and cooperation in meet for providing a common platform for industries, achieving the objectives and the targets. entrepreneurs, MSMEs and other stake holders enabling The thrust areas of the Institute comprise of chemicals, energy technology transfer/licensing, 8th East Asia Symposium on (conventional and non conventional), functional foods, functional dyes and advanced materials, outreach program fluorescent materials for security applications, nutraceuticals, “VIBHA”jointly organized by Ministry of Science and Technology, post harvest technologies, diagnostic probes, drug Ministry of Earth Science and Vijgnana Bharati, “Jigyasa” an intermediates, polymer composites, light metal alloys and initiative between CSIR and Kendriya Vidyalaya. “VIBHA” and computational modeling. It will be our endeavor in continuing to “Jigyasa” programs were aimed at generating awareness and work on these domains with well laid out targets and outcomes interest towards scientific research and development among through fast track translational and fast track commercialization young students. modes (FTTs and FTCs). When we look back on the exciting year I congratulate all at CSIR-NIIST who had won awards and of 2017-18, our external cash flow rose from 27% during 2016- accolades during the reporting period and I hope they will 17 period to 31% for the reporting period along with a steady sustain their creativity through intensified research efforts. Let increase in lab reserve. This was possible by the support from me also acknowledge the support received from CSIR Head our stake holders comprising of the Government, private and Quarters, other funding agencies and industries. We look academic sectors. The average impact factor of our publications forward to having collaboration with like minded scientific and rose to an all-time high of 4.16. industrial community in achieving the targets that impacts the CSIR-NIIST holds strong position in Environment Impact society. Assessment (EIA) pertaining to the Mining and Port Sectors. With best wishes Through our EIA studies, our commitment towards environment A Ajayaghosh Director महत्पूर㔣 उपलब्鴿यां 2017-2018
सीएसआईआर- राष絍री अतं र्विषी वि煍ञन तथा प्रौ饍योगकी संस्थन व्यवसायिक 셂प से महत्पर्ू कई कार्यत्क साम嵍र का बाहरी 嵍रहकⴂ 饍वरा (एनआईआईएसटी) वर㔷 1975 मᴂ अपनी स्थपना से उच㔚 गणवु त्ता वाले आगे मल्ू याकन किया गया और उनके फीडबैक के आधार पर प्रौ饍योगकी वि煍ञन तथा प्रौ饍योगकी अनसु ंधान एवं विकास मᴂ अपनी स्थित को बनाए हस्तातरण को सकम करने के लिए कई तकनीकी पहलओु ंको परिष्क त किया रखने मᴂ हमेशा सफलतापर्ू क प्रयास किया है । वर्मान मᴂ संस्थन का जा रहा है । हरे मार् के माध्म से इल्मनाइट के इष्टतमीकरण केलि ए पायलट ध्यन, सामाजिक ज셂रतⴂ और राष絍री मिशन के साथ संरेखण मᴂ प्रौ饍योगकी स्र पर स्थनांतरित प्रक्रिया अब प्रौ饍योगकी हस्तातरण के लिए पाइपलाइन संचालित और व्यपार अनकु ू ल पारिस्थितक तंत के निर्मण मᴂ कᴂ द섿त है । मᴂ है । एनआईआर परावर्क ब् ल पिगमᴂट प्रौ饍योगकी का स्क ल अप किया एक अतरं ्विषी अनसु ंधान संस्थन होने के कारण, अनसु ंधान मᴂ रसायन जा रहा है । बायोरफिनरियⴂ के लिए बायोमास हाइड्रोलिसिस के लिए β शास्त्र, साम嵍र, कृ षि प्रसंस्रण, माइक्रोबियल और पर्यवरण प्रौ饍योगिकिⴂ बड़ पैमाने पर -ग्कोल सिडेस एजाइमं के उत्पदन की प्रक्रिया जानकारी बाजार के लिए जल् ही तैयार हो जाएगी । आयर핇दिक मक्तशेष साम嵍र का ु ु गﴂजैसे अनसु ंधान विषयⴂ का एक व्यपक स्पेकम शामिल है। वर्मान रिपोर् मल् वर्न, आयर핇दिक उ饍यग से कच्च माल के योगⴂ की मान्ता आदि अवधि के दौरान, समदु तट खनिज प्रसंस्रण, रेयर एअर् पिगमᴂट, कृ षि ू ु उल्लखनीय अन् उपलब्धिⴂ मᴂ से कु छ हℂ । नगरपालिका ठोस अपशिष्ट को प्रसंस्रण, आयरु 핇द के लिए फाइटोके मिकल्, अपशिष्ट उपचार, जैव ईधं न, कम करने के लिए तथा नगरपालिका ठोस अपशिष्ट ंधप्रब न के लिए संस्थन सौर ऊर्ज, कोटिंग्, सर啍ु ष स्यही, नैदानिक जांच, दवा मध्वर酀 जैसे आला एक एकीकृ त बायोड्राइगं प्रक्रिया के विकास मᴂ है । सर啍ु ष अनप्रु योगⴂ के 啍ष配र की पहचान के साथ संस्थन ने अपने वि焼न और रोड मैप को आगे ग अवधि के दौरान आलाﴂलिए नई फ्लरोसᴂट साम嵍र और स्यही, रिपोर् सधु ार किया । 啍षे विकास मᴂ की गयी महत्पर्ू गतिविधियⴂ मᴂ से एक है । बाहरी रतⴂ से राजस् पैदा करने मᴂ काफी वद्धिृ प्रदान करने वाली अत्याुनध क खनन और बंदरगाह 啍ष配र के लिए किए गए पर्यवरण प्रभाव आकलन के अनसु ंधान परियोजनाओ ं तथा औ饍योगक, निजी और सार्जनिक 啍ष配र माध्म से पारिस्थितकी और पर्यवरण की निगरानी के लिए सीएसआईआर- शामिल नए सहयोग मᴂ वद्धिृ के साथ सीएसआईआर-एनआईआईएसटी एनआईआईएसटी प्रतिबद्धहै । सीएसआईआर-एनआईआईएसटी केरल ने वर㔷 2017-2018 के दौरान अपने निष्पदन मᴂ उत्क ष्टता जारी रखी । मᴂ एनएबीईटी-मान्ता प्राप्त श्रेणी “ ए” परामर्दाता संगठन है । इसके ग अवधि के दौरान निम्नलिखत विषयⴂ के तहत एनसीपी (आलाﴂरिपोर् अलावा, इलाके के स्क लⴂ मᴂ अपनी सिद्ध एनारोबिक डाइजेस्र प्रौ饍योगकी निर्मण परियोजनाए),ं एफबीआर (कᴂ द섿त मलू शोध), एफटीटी (फास् 絍रक पेश करते हुये संस्थन भारत सरकार की “स्च् भारत पहल” को भी पराू ट्रसलेशन) और एफटीसी (फास् 絍रक व्यवसायीकरण) योजनाओ ं की करता है । नव विकसित एनारोबिक डायजेस्र कचरे को कं पोस् खाद के 셂प पहचान पर अधिक जोर दिया गया था : खनन, खनिज, धात और साम嵍र ु मᴂ स्थाी करता है और उत्पत्त के रत पर बायोमास अपशिष्ट से मीथेन 2. रसायन (चमड़ और पे絍रके मिकल् सहित) 3. ऊर्ज (परपरागत और गैर ं समद्धृ बायोगैस को उत्न् करता है । सीएसआईआर- एनआईआईएसटी परंपरागत) और ऊर्ज उपकरणⴂ 4. पारिस्थितकी, पर्यवरण, पथृ ्व वि煍ञन ने केरल के कु छ स्थनⴂ पर भजलू के परक्लरेट संदषू ण को एक गंभीर और जल 5. कृ षि पोषण और जैव प्रौ饍योगकी 6. हेल्के यर । सार्जनिक स्वस्थ समस्य के 셂प मᴂ पहचान की है, जहां परक्लरेट सीएसआईआर-एनआईआईएसटी को सीएसआईआर से मिशन मोड थोक मा配र मᴂ निपटाया जाता है । इस पषृ भमिू मᴂ, सीमांत अनसु ंधान के एक ग और चनौतीपु र्ू अतरं ्विषी वातावरण मᴂ अपनी भविष् कीﴂकार्क्रम के तहत स्वस्थ देखभाल के लिए नैनो-बायोसᴂसरⴂ और जोरदार चार् माइक्रोफ्इल डिक् पर तथा सतत विकास के लिए कटैलिसीस पर दो प्रतिष्त योजनाओ ं के साथ संरेखित करते हुए वर㔷 2017-2018 की वार्षक रिपोर् परियोजनाए ं मिलĂ । रिपोर् अवधि के दौरान संस्थन ने अपनी कई महत्पर्ू सीएसआईआर- एनआईआईएसटी 饍वरा किए गए नवाचार, उपलब्धिⴂ, प्रौ饍योगिकिⴂ को भी स्थनांतरित कर दिया । पिछले वरषों के दौरानवि कसित प्रगति और इपैकं ् को निर्धरित करता है । अनुसधां न एवं विकास कार्क्रम मᴂ प्रगति और प्रदर्न गतिकी) 3. फाइटो फार्मस्ूटय कल् और ड्रग इटरमीं डिएट्स (औषधीय पौधⴂ का जैव मल्ू याकन और उन्त फार्मस्ुटय कल इटरमीं डिएट्स)। इसके अच्छ तरह से योजनाबद्ध और कᴂ द섿त गतिविधियⴂ के माध्म से, सभी पांच अलावा, प्रभाग 饍वरा इन 啍ष配र मᴂ भविष् वि煍ञन और कमता निर्मण का प्रभागⴂ ने इस रिपोर् की अवधि के दौरान उत्पद विकास, प्रक्रिया फॉरलेशन,म् कार् भी करता है। अकादमिक उत्क ष्टता और सअनु ंधान सहयोग मᴂ महत्पर्ू प्रगति हासिल की है। इस रिपोर् मᴂ रसायनⴂ, सामग्रⴂ, माइक्रोबियल प्रक्रियाओ,ं कृ षि पदार् वि煍ञन तथा प्रौ饍योगकी प्रभागमᴂ सअनु ंधान के फोकस 啍षे है- उन्त प्रसंस्रण और पर्यवरण प्रौ饍योगिकिⴂ के 啍ष配र की गतिविधियⴂ और कार्यत्क सामग्रⴂ का विकास,खनिजⴂ का इष्टतमीकरण और सामरिक, उपलब्धिⴂ का सं啍षप किया जाता है । कृ षि प्रसंस्रण तथा प्रौ饍योगकी ऑटोमोबाइल, ऊर्ज और सामाजिक अनप्रु योगⴂ के लिए घटक । प्रभाग प्रभाग एक ुआबह यामी कᴂ द है जिसमᴂ कृ षि उपज और पादप संसाधनⴂ पर मᴂ, वर㔷 2017-18 के दौरान खनिज इष्टतमीकरण, ऊर्ज बचत के लिए जोर देते हुये, प्रक्रिया (शेल् लाइफ एन्हासमᴂट, स्टरेज, वैल् य एडिशन) और बहुआयामी वर्क, प्रकाश व्वस्थ अनप्रु योगⴂ के लिए लमेनसᴂटु साम嵍र, उत्पद विकास (न्絍य रस्ूटय कल्, कार्यत्क खाद पदार्, आहारीय परक,ू कार्न डाइ ऑक्सइड अधिशोषण के लिए छिदपर्ू सिरेमिक साम嵍र, डाई फाइटोफर्मस्ूटय कल्, बायो-उर्रक और बायो-कीटनाशकⴂ) पर मखु ् निम्नकरण के लिए नैनो फोटो उत्प्ररक, मदु 섿त इलेक絍रॉनक् के लिए साम嵍र, ध्यन दिया जाता है । इस प्रभागमᴂ ृ षि क प्रसंस्रण के 啍षे मᴂ प्रमखु पायलट चबकींु य और चबकंु प्रशीतन साम嵍र, बहुलक और बहुलक आधारित नैनो संयंत सविधु ाए ं और एक प्रौ饍योगकी व्वसाय ऊष्मान कᴂ द (टीबीआईसी) कं पोजिट, रणनीतिक और मोटर वाहन अनप्रु योगⴂ के लिए हल्क मिश्र धात ु है। प्रभाग की गतिविधियⴂ मᴂ समद्धृ जैव विविधता की खोज करके का विकास जैसे 啍ष配र मᴂ अत्याुनध क प्रौ饍योगिकिⴂ के विकास पर काम न्絍य रस्ूटय कल् और फाइटोफार्मम्ूटय कल् का विकास और सत्यपन, श셂ु किया गया है । एडोफें टिक स啍ू ष जीवⴂ से जैव उर्रकⴂ और जैव कीटनाशकⴂ का विकास, पर्यवरण प्रौ饍योगकी प्रभाग, प्रदषू ण नियंतण और 啍षे के प्राकृ तिक संसाधनⴂ मसालⴂ और फलⴂ से सक्रिय साम嵍र के अलगाव के लिए औ饍योगक 셂प के मलू ्वर्न के लिए स्देशी प्रौ饍योगिकिⴂ के सजनृ मᴂ सक्रिय 셂प से लगे से महत्पर्ू एजाइमⴂं के उत्पदन करने मᴂ सकम नतनू स्देशी माइक्रोबियल हुए है । प्रभागीय गतिविधियां तीन मखु ् 啍ष配र मᴂ यानि अपशिष्ट ंप्रबधन, जल उपभेदⴂ का खनन आदि शामिल हℂ । यौगिकⴂ के इन वि絍र स्क्रीनंग के लिए उपचार और पर्यवरण प्रभाव आकलन (ईआईए) । ऐसे समय मᴂ, जब मौजदाू तथा मधमेह,ु दय रोग, कℂसर और गैर- एल्कहॉलिक फैटी यकृ त रोगⴂ के प्रणालियⴂ और प्रक्रियाओ ंकी वजह से हमारे नाजकु पर्यवरण मᴂ अपरणीू य लिए मैके निजम आधारित अध्यन के लिए प्रभागमᴂ विध सु ाए ं उपलब् हℂ । क्ष होती रहती हℂ, इस 嵍पर ने शमन उपायⴂ के लिए अपशिष्ट जल और माइक्रोबियल प्रक्रिया तथा प्रौ饍योगकी प्रभाग (एमपीटीडी) माइक्रोबियल प्रदषू ण उपचार, फ् ल गैसⴂ की सफाई, मि絍ट के उपचार और अपशिष्ट ंप्रबधन संसाधनⴂ की खोज और दोहन करके जैव प्रक्रिया और उत्पद विकास समाधान मᴂ अपनी विशेषजता के माध्म से पहले से ही गठित दषिू त पदार्थो के कᴂ द섿त 啍ष配र के अनसु ंधान मᴂ सक्रिय 셂प से शामिल है । अनसु ंधान को हटाने के लिए प्रौ饍योगिकिⴂ का एक आला बना दिया है । के वर्मान ध्यन कᴂ द섿त 啍ष配र मᴂ शामिल हℂ- i) औ饍योगक एजाइमं और डीएसआईआर-एनआईआईएसटी-सीआरटीडीएच: एमएसएमई मᴂ पर्यवरण मलू ्वर्धत रसायनⴂ ii) जैव ईधं न और बायोरिफाइनरी (iii) जैव सक्रिय हस्啍षप के लिए एनआईआईएसटी मᴂ (आम अनसु ंधान व प्रौ饍योगकी अण ु iv) स्वस्थ और जीनोमिक् (v) पादप स啍ू षजीव इटरैकं ्न और (vi) विकास हब) स्थापत किया गया है। सखाु ये हुये नारियल, मछली भोजन प्रोबायोटिक और एल्ल न्絍य रस्ूटय कल् । दसरीू पीढ़ बायोइथेनॉल पर और चावल मिल उ饍यग के लिए प्रौ饍योगकी तथा परामर् सेवाए ं प्रदान विशेष अनसु ंधान एवं विकास के लिए प्रभागमᴂ एक समर्पत "जैव ईधं न की गई हℂ । कᴂ द" है। लिग्नसेल्लोय सिक बायोइथेनॉल के उत्पदन का पायलट संयंत उ饍यग और शैक्क सस्थनⴂ से नमनⴂ के परीकण से राजस् पैदा करने के अब ओन-साइट ठोस-अवस्थ किण्न एजाइमं उत्पदन पायलट संयंत से ं ू अलावा सभी प्रमख सविधाओ के साथ परी कमता पर काम कर रही सस्थन समर्थत है, जो लागत प्रभावकता औरहℂड लिंग के लिए बेहतर अवसर ु ु ं ू ं प्रदान करता है। की वि�लेणात्क सविधु ा का इन-हाउस आर एडं डी कार्क्रमⴂ के लिए बड़ पैमाने पर उपयोग किया गया । रसायन वि煍ञन तथा प्रौ饍योगकी प्रभागंस ्थन के निम्नलिखत तीन प्राथमिक 啍ष配र पर ध्यन कᴂ द섿त कर रहा है : 1. कार्बनक और हाइब섿ड सीएसआईआर-एनआईआईएसटीटी की डाइऑक्सइन वि�लेण अनसु ंधान ग अवधिﴂसविधा, प्रभाग की महत्पर् गतिविधियⴂ मᴂ से एक है। इस रिपोर् इलेक絍रॉनक् (ऊर्ज उत्पदन और भडारण,ं ठोस अवस्थ प्रकाश व्वस्थ, ु ू के दौरान बाहरी अनदान मᴂ हुयी लगातार वद्धिृ के साथ सीएसआईआर क्रोमोजेनिक कोटिंग् और कम㔪्टेशनलय रसायन वि煍ञन) 2. फ्लरोसᴂट ु से प्राप्त निरतर आर्थक सहायता ने उच㔚 गणवत्ता वाले प्रकाशनⴂ के साथ साम嵍र (सर啍ु ष अनप्रु योग, डायग्नोस्क्, इमेजिंग प्रोब् और अल絍रफास् ं ु समझौता किए बिना स्थनांतरणीय अनसु ंधान और प्रौ饍योगकी विकास पर सम्मलन (एनसीएलए-2018) आदि इनमᴂ से कु छ हℂ। संस्थन मᴂ राष絍री ध्यन कᴂ द섿त करने मᴂ हमारी मदद की है । वि煍ञन दिवस, राष絍री प्रौ饍योगकी दिवस और सीएसआईआर स्थपना दिवस भी मनाया गया । इन अवसरⴂ पर प्रयोगशाला 饍वरा खलाु दिन मनाया गया 2017-2018 की अवधि के दौरान, सीएसआईआर-एनआईआईएसटी और बड़ संख्य मᴂ छा配र और संकायⴂ ने संस्थन का दौरा किया वै煍ञानकⴂ मᴂ कई महत्पर्ू घटनाओ ं का आयोजन हुआ । पारस्रिक हित के म饍ु द के साथ विचार-विमर् किया । प्रयोगशाला मᴂ हिदीं सप्ताह और सतर् ता की पहचान करने के लिए और एमएसएमई सहित निजी, सार्जनिक 啍ष配र जाग셂कता सप्ताह आयोजित किया गया था। संस्थन मᴂ स्च् भारत मिशन से उ饍यगⴂ के साथ गठबंधन बनाने के लिए संस्थन ने 23 फरवरी 2018 से संबंधित गतिविधियां श셂ु हुई।ं प्रयोगशाला और उसके आसपास के 啍ष配र को एक दिवसीय आर एडं डी- उ饍यग बैठक आयोजित की । श्री टी के को कर्मारियⴂ और छा配र की भागीदारी के साथ साफ कर दिया गया था । जोस, आईएएस, अपर मखु ् सचिव (स्थनीय स्शासन विभाग), केरल सरकार ने, डॉ एम बीना, आईएएस, प्रबंध निदेशक, केएसआईडीसी, पद्मश्री वै煍ञानकⴂ और शोध छा配र ने कई प्रतिष्त परसु ्कर, सम्मन और मान्ता हरीदन नायर, संस्थपक एवं प्रबंध निदेशक, पंकजकस्रीत और डॉ राम के माध्म से संस्थन के लिए ख्यात लायी । प्रयोगशाला मᴂ हिदीं सप्ताह चद,ं मखु ् कार्कारी अधिकारी, सैक्सन लाइफ साइसेजं प्रा. लिमिटेड की और सतर् ता जाग셂कता सप्ताह का आयोजन किया गया। संस्थन मᴂ स्च् प्रतिष्त उपस्थित मᴂ आर एडं डी उ饍यग बैठक का उ饍घटन किया । कई भारत मिशन से संबंधित गतिविधियां श셂ु की गयी और कर्मारियⴂ और उ饍यग प्रतिनिधियⴂ ने बैठक मᴂ भाग लिया और कई एमओय ू निष्पादत छा配र की भागीदारी मᴂ प्रयोगशाला और इसके आसपास के 啍ष配र को साफ किए गए। रिपोर् की अवधि के दौरान कई महत्पर्ू राष絍री और अतरं ्रा絍री किया गया।वै煍ञानकⴂ और शोध छा配र ने कई प्रतिष्त परसु ्कर, सम्मन और कार्क्रम भी आयोजित किए गए । कार्यत्क रंजकⴂ और उन्त सामग्रⴂ मान्ता के माध्म से संस्थन के लिए ख्यात अर्जत की । शोध छा配र ने (ईएएस 8) पर 8 वĂ पर्ू एशिया संगो�ठ, डाइऑक्सइन वि�लेण मᴂ उन्त प्रतिष्त सेमिनार और संगो�ठ मᴂ सर्वश्रे पोस्र, सर्वश्रे मौखिक प्रस्ति酁 वि�लेणात्क समाधान, लमेनसᴂसु और इसके अनप्रु योगⴂ पर राष絍री और शोध पत परसु ्कर प्राप्त करतेु हए अपनी जीत का दौर जारी रखा । बजट / ईसीएफ / एलआर (लाखⴂ मᴂ) वै煍ञानकⴂ की स्थित BUDGET/ECF/LR (in lakhs) SCIENTIST POSITION
कर्मारियⴂ की संख्य औसत प्रभाव कारक STAFF STRENGTH AVERAGE IMPACT FACTOR SIGNIFICANT ACHIEVEMENTS 2017-2018
CSIR- National Institute for Interdisciplinary Science & further evaluated by external clients and based on Technology (NIIST) since its inception in the year 1975 the feedback several technical aspects are being fine- has always endeavored successfully in upholding its tuned for enabling technology transfer. A process for the position in high-quality science and technology research beneficiation of Ilmenite through green route is transferred and development. The Institute is currently focused at pilot level and is now in pipeline for technology transfer. on creating technology driven and business-friendly The NIR reflecting blue pigment technology is being ecosystem aligning with the societal needs and national scaled up. Process know-how for large-scale production mission. Being an interdisciplinary research Institute of β-glucosidase enzyme for biomass hydrolysis for bio the broad spectrum of research topics encompassing refineries will also be market-ready soon. Value addition chemistry, materials, agro processing, microbial and of ayurvedic spent materials, validation of raw material environmental technologies. During the current reporting formulations from ayurvedic industry are some of the period, the vision and road map were further fine-tuned other achievements worth mentioning. To mitigate identifying niche areas in the field of beach mineral municipal solid waste, the Institute is in the process of processing, rare earth pigments, agro processing, developing integrated biodrying process for municipal phytochemicals for Ayurveda, waste treatment, biofuels, solid waste management. New florescent materials and solar energy, coatings, security inks, diagnostic probes inks for security applications is also one of the important and drug intermediates. niche area development activity carried out during the reporting period. CSIR-NIIST continued to excel in its performance during the year 2017-2018 securing cutting edge research projects, CSIR-NIIST is committed to the monitoring of ecology and upsurge in new collaborations involving industrial, private environment through Environment Impact Assessment and public sectors which lead to a substantial increase in carried out for the mining and port sectors. CSIR-NIIST is generating revenue from external sources. During the a NABET- Accredited Category A consultant organization reporting period, greater emphasis was laid on identifying in Kerala. In addition, the Institute also caters to Swachh NCP (Niche creating projects), FBR (Focused Basic Bharat initiative of Govt. of India by introducing its proven Research), FTT (Fast Track Translational) and FTC (Fast anaerobic digester technology to schools in the locality. Track Commercialization) schemes under the following The newly developed anaerobic digester stabilizes wastes themes: 1. Mining, Minerals, Metals and Materials 2. as compost manure and generates methane rich biogas Chemicals (including leather and Petrochemicals) 3. from biomass wastes at the source of generation. CSIR- Energy (Conventional and non-conventional) and Energy NIIST has identified perchlorate contamination of ground devices 4. Ecology, Environment, Earth Sciences and water as a serious public health issue at few places in Water 5. Agri. Nutrition and Biotechnology 6. Healthcare Kerala where perchlorate is handled in bulk. CSIR-NIIST received two prestigious projects under the Against this backdrop, the Annual Report for the period mission mode program from CSIR on Nano-Biosensors 2017-2018 sets out the innovation, achievements, and Microfluidics for Health Care and on Catalysis for progress and impact made by CSIR-NIIST aligning with sustainable development. The Institute also transferred its future plans in a vigorously charging and challenging several of its important technologies during the period interdisciplinary environment of frontier research. under report. Commercially important functional Progress and Performance in R&D Programs materials developed over the past few years have been Through well planned and focused activities, all the five divisions have made significant progress in 1. Organic and Hybrid Electronics (Energy generation product development, process formulations, academic and storage, solid state lighting, chromogenic coatings excellence and research collaborations during the and computational chemistry) 2. Fluorescent materials period of this report. Activities and achievements in (Security applications, diagnostics, imaging probes and the areas of chemicals, materials, microbial processes, ultrafast kinetics) 3.Phyto-pharmaceuticals and Drug agro-processing and environmental technologies are Intermediates (Bio-evaluation of medicinal plants and summarized in this report. advanced pharmaceutical intermediates). In addition, the team also focus on futuristic sciences and capacity Agro Processing and Technology Division is a building in such areas carving out a niche. multidisciplinary centre with main focus on process (shelf life enhancement, storage, value addition) and Development of advanced functional materials, mineral product development (nutraceuticals, functional beneficiation and components for strategic, automobile, foods, dietary supplements, phytopharmaceuticals, energy and societal applications has been the focus areas bio-fertilizers & bio-pesticides) emphasizing on agri of research in the Materials Science and Technology produce & plant resources. This division has major pilot Division. In the year 2017-18, the division has embarked plant facilities and a Technology Business Incubation on the development of cutting edge technologies in centre (TBIC) in the area of agro processing. They are the areas of mineral beneficiation, multifunctional also involved in the development and validation of pigments for energy savings, luminescent materials for nutraceuticals and phytopharamceuticals exploring lighting applications porous ceramic materials for CO2 rich biodiversity, development of bio-fertilizers & bio- adsorption, nano photo catalysts for dye degradation, pesticides from endophytic microbes, mining of novel materials for printed electronics, magnetic and magneto indigenous microbial strains capable of producing refrigeration materials, polymers and polymer based industrially important multiple enzymes for the active nano composites and light alloys development for ingredients isolation from spices and fruits. The division strategic and automotive applications. is also equipped with facilities for in vitro screening of The Environment Technology Division is actively engaged compounds and mechanism based studies for diabetes, in creating indigenous technologies for pollution control cardiovascular, cancer and non-alcoholic fatty liver and value addition to the region’s natural resources. The diseases. divisional activities converge into three main areas of Microbial Processes and Technology Division (MPTD) waste management, water treatment and Environment is actively involved in research in the focussed areas for Impact Assessment (EIA). At a time, when existing systems bioprocesses and products development by exploring and processes are causing irreparable damage to our and exploiting the microbial resources. The current fragile environment, the group has made a niche in focus of research are in the areas of i) Industrial enzymes “end of the pipe” technologies for mitigation measures, and value added chemicals ii) Biofuels and biorefinery through its expertise in waste water and effluent (iii) bioactive molecules iv) Health and genomics (v) treatment, cleanup of flue gases, soil remediation and plant microbe interactions and (vi) probiotic and algal waste management solutions. nutraceuticals. The Division has a dedicated “Centre for The DSIR-NIIST-CRTDH (Common Research and Biofuels” for exclusive R&D on 2nd generation bioethanol. Technology Development Hub) for environmental The pilot plant for the production of lignocellulosic interventions in MSMEs has been set up at NIIST. bioethanol is now supported by on-site solid-state Technology and consulting services have been offered to fermentation enzymes production, bringing better cost- desiccated coconut, fishmeal and rice mill industries. effective and handling opportunities. The analytical facility of the Institute was extensively The Chemical Sciences and Technology Division has utilized for the in-house R&D Programs with all major been focusing on three priority areas of the Institute: facilities working to the full capacity, besides generating revenue from testing of samples and tailor-made Many important national and international events also analytical services for industry and academia. Dioxin were organized during the period of this report. The 8th analysis research facility of CSIR-NIIST is one of the East Asia Symposium on functional dyes and advanced important activity of the division. The sustained funding materials (EAS8), Advanced Analytical Solutions in Dioxin from CSIR during this reporting period along with a Analysis, national conference on Luminescence and its steady rise in external funding, have helped in focused applications (NCLA-2018) etc. to name a few. The Institute translational research and technology development also celebrated the National Science Day, National without compromising on high quality publications. Technology Day, and CSIR Foundation Day and one-day science outreach programme. Open day was observed by During the period 2017-2018, several important events the Laboratory on these occasions and large number of were organized in CSIR-NIIST. The Institute organized a one- students and faculty visited the Institute, interacted with day R&D Industry meet on 23rd February 2018 to identify the scientists. Hindi Week and Vigilance Awareness Week the issues of mutual interest and to forge alliances with were conducted in the Laboratory. Activities related to industries from private, public sectors including MSMEs. the Swacchh Bharat Mission started in the Institute. The The R & D Industry meet was inaugurated by Shri T.K. Jose, laboratory and its neighboring areas were cleaned with IAS Additional Chief Secretary (Local Self Government the involvement of staff and students. Department), Govt. of Kerala in the esteemed presence of Dr. M. Beena, IAS Managing Director, KSIDC, Padmashree The scientists and research fellows brought many laurels to the institute through several prestigious awards, Hareendran Nair, Founder & MD, Pankajakasthuri, Dr. honours and recognitions. The research scholars Ram Chand Chief Executive Officer, Saksin Lifesciences continued their winning streak by achieving best poster, Pvt. Ltd. Many industries attended the meet and several best oral presentation and paper awards in prestigious MoUs were executed. seminars and symposia. Agro Processing and Technology Division Annual Report 2017-18
कृ षि प्रससं ्रण तथा प्र셌饍योगकी प्रभाग कृ षि प्रससं ्रण तथा प्रौ饍योगकी प्रभाग एक बह-ु विषयक कᴂ द है, जो कृ षि उपज और पादप ससां धनⴂ पर जोर देते हएु प्रक्रिया (शेल् लाइफ एन्हसमᴂट,ा भडारण,ं मलू ्वर्न) तथा उत्पद विकास (न्絍य रस्ूटय कल्, कार्यत्क खाद पदार्, आहारीय परक,ू फाइटोफार्मस्ूटय कल्, बायो-उर्रक और बायो-कीटनाशक) पर मखु ् ध्यन देता है । प्रभाग के मखु ् उ饍शद ्ⴂ मᴂ से एक है- वै煍ञानक तथा तकनीकी नवाचार के माध्म से अपने उपज के लिए उच㔚 लाभ प्रदान करातेए हु किसानⴂ के सामान् कल्यण मᴂ सधु ार । प्रभाग मᴂ कृ षि प्रससं ्रण के 啍षे मᴂ प्रमखु पायलट सयं तं सविधु ाए ं और एक तकनीकी व्यपार ऊष्मान कᴂ द (टीबीआईसी) वर्मान है । प्रभाग की गतिविधियⴂ मᴂ समद्धृ जैव विविधता की खोज तथा इस 啍षे मᴂ प्रचरु मा配र मᴂ उपलब् पारंपरिक 煍ञन और प्रभाग की विशेषजता का उपयोग करते हएु न्絍य रस्ूटय कल् और फाइटो फार्मस्ूटय कल् के विकास और सत्यपन शामिल हℂ । एडोफें टिक स啍ू ष जीवⴂ से जैव उर्रक और जैव कीटनाशकⴂ का विकास तथा मसालⴂ और फलⴂ से सक्रिय तत् के अलगाव के लिए औ饍योगक 셂प से महत्पर्ू एजाइमⴂं के उत्पदन मᴂ सकम नतनू स्देशी माइक्रोबियल उपभेदⴂ के खनन पर प्रभाग सक्रिय है । यौगिकⴂ के इन वि絍셋 स्क्रीनगं के लिए तथा मधमेह,ु दय रोग, कℂसर और गैर- एल्कहॉलिक फैटी यकृ त रोगⴂ के लिए मैके निजम आधारित अध्यन के लिए प्रभागमᴂ विध सु ाए ं उपलब् है । प्रभागमᴂ मानवसा सं धन विकास के लिए अकादमिक कार्क्रम है (पीएचडी) और उ饍यगⴂ और अकादमिक ससं ्थनⴂ की आवश्कता के लिए खाद वि煍ञन और जैव चिकित्स वि煍ञन के तहत भी कार्क्रमहै ।
हाइलाइट $ उत्पद और प्रक्रिया विकास, प्रौ饍योगकी उन्नन और स्वस्थ लाभ के वै煍ञानक सत्यपन के लिए आर एडं डी, उ饍यग इटरफेसं कार्क्रम (प्रायोजित और परामर्) $ विटामिन ए की कमी के लिए रेड पामओलेन (आरपीओ) आधारित कार्यत्क खाद उत्पद (कार्यत्क वनस्पत तेल और मलाु यम जेल) $ चयापचय विकारⴂ और कℂसर के लिए पौधⴂ से बायोएक्टव यौगिकⴂ का फार्मकोलॉजिकल मल्ू यकना $ देशी स啍ू षजीव से औ饍योगक 셂प से महत्पर्ू एजाइमⴂं के माध्म से सक्रिय घटकⴂ के निष्र㔷ण के लिए वानस्पतकⴂ का जैव प्रससं ्रण $ एडोफाइं टिक जीवⴂ पर विशेष जोर देने के साथ स啍ू षजीव से जैव उर्रक और जैव कीटनाशक $ प्राकृ तिक उत्पदⴂ के साथ 絍रइफिनाइल फॉस्फोनिम के सयं ोग के माध्म स माइटोकॉन्ड्रिल एटीऑकं ्सडᴂट का विकास $ चयापचय वर्क के 셂प मᴂ कृ षि / खाद प्रससं ्रण अवशेष साम嵍र से आहार फाइबर $ खाद पदार्थो मᴂ एक्रिलमाइड और शमन रणनीतियⴂ $ पोषण और बायोएक्टव घटकⴂ के लिए गैर-डेयरी पेय पदार् और वितरण प्रणाली
National Institute for Interdisciplinary Science & Technology 15 Annual Report 2017-18 Agro Processing and Technology Division
AGROPROCESSING AND TECHNOLOGY DIVISION
Agro Processing and Technology Division is a multidisciplinary centre with main focus on process (shelf life enhancement, storage, value addition) and product development (nutraceuticals, functional foods, dietary supplements, phytopharmaceuticals, bio-fertilizers & bio-pesticides ) emphasizing agri produce & plant resources. One of the main objectives of division is improvement of general welfare of farmers through high returns of their produces via scientific and technological innovation. This division has major pilot plant facilities and a Technology Business Incubation centre (TBIC) in the area of agro-processing. We are also involved in the development and validation of nutraceuticals and phytopharamceuticals exploring rich biodiversity, availability of abundant traditional knowledge in this region and available expertise in the division. We are also working on development of bio-fertilizers & bio-pesticides from endophytic microbes, mining of novel indigenous microbial strains capable of producing industrially important multiple enzymes for the active ingredients isolation from spices and fruits. This division is also equipped with facilities for in vitro screening of compounds and mechanism based studies for diabetes, cardiovascular, cancer and non-alcoholic fatty liver diseases. We have academic programmes (Phd) for human resource development in the field of food science and biomedical sciences for meeting the needs of industries and academic institutes.
Highlights $ R & D, Industry interface programmes (sponsored & consultancy) for product and process development, technology up-gradation and scientific validation of health benefits $ Red Palm Olein (RPO) based functional food products (functional vegetable oil & soft gel) for vitamin A deficiency $ Pharmacological evaluation of bioactive compounds from plants for metabolic disorders and cancer $ Bio-processing of botanicals for active ingredient extraction through industrially important enzymes from native microbes $ Bio-fertilizers and Bio-pesticides from microbes with special emphasis on endophytic organisms. $ Development of mitochondrial antioxidant through conjugation of triphenyl phosphonium with natural products $ Dietary fibre from agri/food processing spent materials as metabolic enhancers $ Acrylamide in foods and mitigation strategies $ Nondairy beverages and delivery systems for nutritional and bioactives components
16 National Institute for Interdisciplinary Science & Technology Agro Processing and Technology Division Annual Report 2017-18
Post harvest operations for value addition of (antidiabetic, cardiovascular protection etc properties) indigenous fruits and vegetables for scientific validation. Post-harvest management of agro produce is very The ultimate target of the programme will be to support significant for the sustainable development of the MSME’s engaged in agri produce sector through agriculture and related sectors. Shelf life enhancement development & transfer of customized technologies. using various food processing technologies offers FSSAI sponsored programme on food safety tremendous scope for value addition of indigenous fruits &security and vegetables which are otherwise underutilized. The focus is to process maximum quantity of the raw material Actively contributing in the ongoing programme during the peak harvest period and keep available stock sponsored by FSSAI on “Occurrence of acrylamide, a in a safe processed condition for the whole year. Cost heat induced food toxicant, in processed food products effective dehydration through appropriate mechanism for of India: mitigation strategies and health risks”. The main the selected crops is one of the simple & direct approach objectives of which are: for preserving in a stable and safe condition and provides $ Study, survey & generate a data base on acrylamide extended shelf life. Most of the cash crops such as fruits, content in Indian foods vegetables, flowers, spices, mushrooms etc can be thus Mitigation strategy: Solutions for reducing acrylamide processed through this route by selecting the tailor made $ content in foods (changes in formulation, processing, drying mechanisms standardized for the selected crop. other practices) The available technologies for dehydration are either not cost effective or the quality of the final product is of $ Increase the public awareness on the toxicity & dietary inferior quality. CSIR-NIIST has designed and developed exposure of acrylamide an innovative drying model, Refrigeration Adsorption $ Inputs for policy decisions to FSSAI to identify any Dehumidified Drier (RADD), for the low temperature drying specific recommended level or action level for of agri crops for further value addition. This dryer can be acrylamide. used for the shelf life enhancement of fruits, vegetables, spices, flowers etc. of the state during peak harvest season $ Input for growers, product manufacturers & service when there is a surplus production of the crop. Other operators on how to reduce the acrylamide content in models for driers such as freeze drier, spray drier, Fluid processed foods Bed Drier, Tray Drier, Vacuum Drier etc are also available Need based research with industry linkages in the institute for the research on selection of the drying A large number of sponsored industrial projects were models for different crops. The unit operations for the recently undertaken under the functional food & dehydration process for ginger, nutmeg, cardamom, raw nutraceuticals programme of the division. The major banana and raw jackfruit have already been optimized in projects include: pilot scale level. (a) Sponsored programme initiated with M/s Tata In this context, a sponsored project has been initiated Chemicals Mumbai, for pre-biotic efficacy and health with Govt. of Kerala, with an objective to undertake benefits of identified products. process development studies for the value addition for (b) Development of speciality emollient from marine indigenous fruits (ripe banana, ripe jack fruit and any resources is shark liver oil in collaboration with leading other seasonal fruits available) and vegetables (leafy fish product manufacturers M/s Arbee Bio Marine vegetables, Cucurbitaceae family vegetables, bitter gourd, Extracts Ltd, Mysore. The work envisages the product ridge gourd, Coccinia grandis, long beans etc) that are development & optimization in the pilot scale level important for the agricultural economy of the state, using and quality evaluation. above mentioned post-harvest operations . The project also envisages establish their nutritional & health benefits (c) Product development for formulated functional foods
National Institute for Interdisciplinary Science & Technology 17 Annual Report 2017-18 Agro Processing and Technology Division
(Collaborator: M/s Sreedhareeyam Speciality Eye Short chain fatty acids produced during Hospital). fermentation of dietary fibre from Musa (d) Technology up-gradation for the existing breakfast paradisiaca inflorescence promotes free mixing unit for leading foods product manufacturer radical induced apoptosis in HT29 colon M/s Brahmins Food Products Pvt. Ltd. cancer cells (e) Scientific validation of antidiabetic products It was reported earlier that the plantain inflorescence is developed by leading nutraceutical company M/s a rich source of dietary fibre with prebiotic properties. Arjuna Natural Extracts Limited, Cochin. The prebiotics are associated with lowering the risk Micro encapsulation of Red Palm Olein (RPO) of colorectal cancer (CRC) owing to the production of and flax seed oil blends for food enrichment short chain fatty acids. In order to establish the efficacy applications: Optimization studies of plantain inflorescence dietary fibre (PIF) in prevention Health benefits associated with the consumption of red and management of CRC, we have carried out anticancer palm oil has been previously established and reported studies using HT29 colon cancer cells. The fermentation earlier. In order to deliver optimum composition of fatty supernatant enriched with short chain fatty acids acids, blends of RPO (rich is carotenoids and tocotrienols) (SCFA) obtained by the fermentation of soluble dietary and flax seed oil (rich in polyunsaturated fatty acids) were fibre from Musa paradisiacal inflorescence (PIF) using blended and microencapsulated for fortification and food Lactobacillus casei and Bifidobacterium bifidum, LS and enrichment applications. The encapsulation efficiency BS respectively. The studies using LS and BS were found was tuned by varying the wall material compositions and to be inducing DNA damage and ROS production in HT29 inlet air temperatures of spray drying conditions. Trials cells leading to apoptosis. The apoptosis was facilitated by were carried out in order to find out the best wall material the reduction in the mitochondrial membrane potential combination with maximum encapsulation efficiency at and ATP production; enhanced cytochrome c release the same time offering the best bioactive stability. The and interference with the expression of pro/anti-apototic oil powders were characterized for moisture content, proteins. BS, which exhibited better activity, was analyzed water activity, bulk density, particle morphology (SEM), further to elucidate the total profile of HT29 proteins by and encapsulation efficiency. A combination of whey performing 2D-PAGE and peptide mass fingerprinting protein and gum arabic as core materials yielded 40% oil for identification of differentially expressed proteins and encapsulation efficiency. Baked products were prepared was found the exposure upregulated the expression of using the encapsulated blends by replacing 15% of the fat apoptosis inducing factor-AIFM1 leading to apoptosis of and 50g of the final product supplemented 50% RDA for HT29 cells. vitamin A. Fortified products were similar in appearance to control and had similar organoleptic properties as evaluated by sensory analysis. The Further studies are under way to improve the efficiency >50% by various technological interventions. Process development studies for valorisation of spent Turmeric and Amla Studies were carried out to valorise spent turmeric and amla generated from industries and were found to be rich source of dietary fibre and bioactive phytochemicals. Preliminary studies to establish the prebiotic properties indicated excellent prebiotic potential of the dietary fibre
18 National Institute for Interdisciplinary Science & Technology Agro Processing and Technology Division Annual Report 2017-18
factors like place, the variety of palm, mode and season of its collection. The study of phytoconstituents other than macronutrients is a great challenge from this matrix as they are present in minor quantities and isolating them from a sugar matrix is extremely difficult. In the present study we explored isolation of phytoconstituents from a sugar rich matrix; palm sap of Borassuss flabellifer. HPLC- Diode Array Detector (DAD) analysis was performed for both organic acids profiling and amino acids profiling. Isolation of other phytoconstituents was performed by adopting 3 different protocols in which lyophilized palm sap was subjected to solvent extractions followed by purification using different stationary phases viz., Amberlite XAD7 HP, Sephadex LH 20 columns and silica gel. The isolated compounds were then characterized and identified by 1H, 13C NMR, and HR-ESI-MS techniques. The chromatogram for organic acids showed the presence of tartaric acid, ascorbic acid, lactic acid, citric acid, succinic acid. Amino acid profiling showed the presence extracted from these spent materials. The antioxidant, of aspartic acid, serine, glutamic acid, and alanine. antidiabetic and cardiovascular protection properties of Protocol 1 yielded L-tryptophan and phenylalanine. While the extracts was also evaluated using in vitro biochemical protocol 2 yielded fructose, tyrosine, isoleucine, and analysis. We have also done preliminary studies to phenylalanine, tryptophan and 4-hydroxy benzaldehyde. develop functional foods by incorporating dietary fibre Aliphatic hydrocarbon, triacylglyceride, fatty acids, and extracted from amla. However, the process needs to be a diacylglyceride were isolated following protocol 3. further fine-tuned for scale up operations as well as for We have successfully isolated 26 compounds for the economic viability. In order to utilize the dietary fibre and first time from Palmyra palm sap by adopting different bioactive extracts for functional food and nutraceutical chromatographic techniques. application, further detailed investigation using in Optimization of Palm Syrup Development vitro cell lines and in vivo studies needs to be done to from Palm Sap of Borassuss Flabellifer (Linn.) establish its health benefits. Studies in this direction are Using Response Surface Methodology progressing. In the present study, we have optimized the combination Isolation of Phytoconstituents in Palmyrah of process parameters for the production of shelf stable Palm Sap Using Chromatographic Techniques syrup from the sap of Borassus flabellifer Linn. The process and Identification by 1H, 13C NMR, And HR- optimization trials were done using response surface ESI-MS methodology in terms of Brix value and liquid glucose. Borassus flabellifer Linn. (Palmyra palm) belonging to The quadratic model was used to explain the variability in Arecaceae family grows ubiquitously throughout India color, appearance, aroma, taste and overall acceptability and widely distributed in tropical Asian countries. Its in terms of process parameters. Kruskal-Wallis one-way inflorescence (spathes) produces a sweet oyster colored Analysis of Variance (ANOVA) was carried to see the effect sap called Neera which is a popular beverage. The male of storage days on sensory attributes of the product and female inflorescence are carried on separate trees. The and also on non-sensory attributes (color, water activity sap is collected from both male and female inflorescence. (aw) and non enzymatic browning) of the product. The The chemical composition of sap depends on various product was also observed for its microbial stability and
National Institute for Interdisciplinary Science & Technology 19 Annual Report 2017-18 Agro Processing and Technology Division
crystallization behavior. The optimized syrup developed Cinnamic acid ameliorates glucotoxicity was found to retain overall stability as indicated by color in H9c2 cells via maintaining redox status, values, aw, non enzymatic browning, microbial study mitochondrial dynamics and preventing and absence of crystals. It was also observed that the sorbitol accumulation quality of syrup stored under refrigeration to simulate consumer use was comparable to that of syrup stored at Alterations in various pathways like the innate antioxidant room temperature. However, since the syrup prepared system, polyol pathway, mitochondrial integrity, is without preservative storage under refrigeration is dynamics, calcium homeostasis and apoptosis were recommended to overcome the abuse at the consumer investigated during hyperglycemia. Hyperglycemic insult level which can cause spoilage of the product. Ferulic acid protects H9c2 cells from hyperglycemia mediated injury through its antioxidant potential One of the early markers of diabetic cardiomyopathy is the hyperglycemia induced oxidative stress through multiple pathways, and our present study is to elucidate the role of oxidative stress in evoking cardiac injury during hyperglycemia and evaluate the efficacy of ferulic acid (FA). For induction of hyperglycemic condition, H9c2 cells were treated with high glucose (33Mm) for 48 hrs. Then we evaluated the alteration in cell morphology, oxidative stress and the downstream markers like ANP, BNP, lipid peroxidation, protein carbonylation, intracellular calcium overload and superoxide dismutase with hyperglycemia. significantly depleted the antioxidant activity, enhanced Hyperglycemia caused an increase in overall cell size, reactive oxygen species (ROS) generation, and caused surplus ROS generation, depletion of SOD, significant alterations in mitochondrial functions, finally leading release of injury markers BNP and ANP and simultaneous to apoptosis. Cinnamic acid was beneficial to prevent treatment with FA significantly reversed these effects. the genesis of the adverse effect of hyperglycemia most Overall results revealed that alteration in the redox status probably through its antioxidant properties. The overall of cells via hyperglycemia leads to cell injury and FA study reveals for the first time the sequence of alterations could be an attractive bioactive for further exploration for in various pathways and cross talk between them during cardiac protection during diabetes. hyperglycemia. These novel findings will be useful for planning future strategies for therapeutic intervention of hyperglycemic cardiomyopathy. Chlorogenic acid protects H9c2 cells from glucotoxicity via inhibition of glycation and PKC α upregulation and safeguarding innate antioxidant status Various parameters like free radical generation, alteration in innate antioxidant system, lipid peroxidation, AGE production and PKC α- ERK axis were investigated during hyperglycemia and with chlorogenic acid. Hyperglycemia has significantly enhanced reactive oxygen species (ROS - 4 fold) generation, depleted SOD activity (1.3 fold) and
20 National Institute for Interdisciplinary Science & Technology Agro Processing and Technology Division Annual Report 2017-18
L1 adipocytes by treating with TNF-α (10 ng/mL) and various concentrations of PA (5, 10, 30 μM) were incubated simultaneously. After 24 h, we found that TNF-α treatment increased mRNA expression of SOCS3, PTP1B and a decrease in IRS1 causing diminished glucose uptake. Further, it showed significantly increased transcriptional activity of NFκB and leptin secretion while PA maintained leptin levels normal. Additionally, PA prevented the over- expression of phosphorylated JNK in a dose dependent manner during IR. PA also ameliorated significantly the upregulation of proinflammatory cytokines. From the results, we conclude that PA is effective to ameliorate TNF-α induced IR and also we recommend the intake of PA for control and management of IR and its associated complications.
expression of enzymes particularly CuZnSOD (SOD1) and MnSOD (SOD2), increased production of AGE (2.18 fold). Besides, PKC α dependent ERK signaling pathway was found activated (1.43 fold) leading to cardiac dysfunction during hyperglycemia. Chlorogenic acid (CA) was found beneficial against hyperglycemia most probably through its antioxidant mediated activity. The outcome of this preliminary study reveals the importance of integrated approach emphasizing redox status, glycation and Insulin resistance through inflammatory signaling pathways like PKCα - ERK axis for control and markers during hypoxia in 3T3-L1 adipocytes management of diabetic cardiomyopathy (DCM) and is ameliorated with curcumin potential of bioactives like CA. The role of phytochemicals in general well-being has been recognized. Curcumin is an ideal example. Hypoxia Punicic acid is a potent insulin sensitizer in in adipose tissue is a major cause of inflammation and 3T3-L1 adipocytes acts through upregulation insulin resistance in obesity. Herein we mainly explored of insulin signalling pathway and inflammation, insulin resistance and angiogenesis in 3T3- endocrine function, and downregulation of L1 adipocytes and possible reversal with the curcumin proinflammatory cytokines during hypoxia. Hypoxia for 24 h significantly increased (P Insulin resistance (IR) has become a major threat to ≤ 0.05) the secretion of monocyte chemotactic protein-1 public health due to its role in metabolic syndrome. (4.59 fold), leptin (2.96 fold) and reduced adiponectin Inflammation associated IR is an interesting area of (2.93 fold). mRNA level of resistin (6.8 fold) and toll-like biomedical research in recent years and is expected to receptor-4 (TLR-4) (8.8 fold) was upregulated. Increased affect insulin signalling pathway via downregulating serine phosphorylation of insulin receptor substrate 1 glucose transporters. In the present study, we evaluate (IRS-1) (1.9 fold) and decreased expression of insulin the potential of punicic acid (PA), a nutraceutical found in receptor substrate 2 (IRS-2) (0.53 fold) in hypoxic group pomegranate seed oil, against TNF-α induced alteration were observed. Hypoxia significantly increased (P ≤ in 3T3-L1 adipocytes on glucose metabolism, endocrine 0.05) basal glucose uptake (3.3 fold), GLUT-1 expression function and inflammation. IR was induced in 3T3- and angiogenic factors but down regulated GLUT-4.
National Institute for Interdisciplinary Science & Technology 21 Annual Report 2017-18 Agro Processing and Technology Division
significantly (P ≤ 0.05) increased basal glucose uptake (3.3 fold) as well as GLUT-1 expression in adipocytes indicating GLUT-1 mediated glucose uptake. Hypoxia for 24 h significantly increased (P ≤ 0.05) the expression of angiogenic factors. Bilobalide protected adipocytes from hypoxia induced inflammation and insulin resistance mainly by reducing inflammatory adipokine secretion, improving adiponectin secretion, reducing NF-κB/JNK activation, and inhibiting serine phosphorylation of IRS-1 receptors of insulin signalling pathway.
Curcumin protected adipocytes from hypoxia induced inflammation and insulin resistance via reducing inflammatory adipokine, nuclear factor-κB (NF-κB)/c-jun N-terminal kinase (JNK) and serine phosphorylation of IRS-1 receptors and improving adiponectin secretion.
Bilobalide abates inflammation, insulin resistance and secretion of angiogenic factors induced by hypoxia in 3T3-L1 ZI-OH, a Peroxisome Proliferator-Activated adipocytes by controlling NF-κB and JNK Receptor γ (PPARγ) modulator with strong activation insulin sensitizing property Obesity leads to inflammation and insulin resistance Adipocyte differentiation plays a pivotal role in in adipose tissue. Hypoxia, observed in obese adipose maintaining the production of small-size adipocytes tissue is suggested as a major cause of inflammation and insulin resistance in obesity. However, the role of with insulin sensitivity, and impaired adipogenesis is hypoxia in adipose tissue during obesity and insulin implicated in insulin resistance. Indole functionalized resistance was not well established. Here we mainly zerumbone (ZI-OH), a phytochemical component explored the crosstalk between hypoxia induced of Zingiber zerumbet possesses diverse biological inflammation, and insulin resistance and also secretion properties such as anti-inflammatory, antidiabetic, of angiogenic factors in 3T3-L1 adipocytes and possible and antitumor. In the present study, we investigated reversal with bilobalide. Hypoxia for 24 h significantly the effects of ZI-OH on adipocyte differentiation. ZI-OH (P ≤ 0.05) increased the secretion of MCP-1 (4.59 fold), promoted lipid accumulation in 3T3-L1 cells, upregulated leptin (2.96 fold) and reduced adiponectin secretion (2.93 both peroxisome proliferator-activated receptor (PPAR)-γ fold). In addition, the mRNA level of resistin (6.8 fold) and TLR4 receptors (8.8 fold) was upregulated in hypoxic adipocytes. The release of inflammatory cytokines and expression of TLR4 receptors led to activation of JNK and NF-κB signalling. We further investigated the effects of JNK and NF-κB activation on insulin signalling receptors. The present study showed increased (P ≤ 0.05) serine 307 phosphorylation of IRS-1 (1.9 fold) and decreased expression of IRS-2 (0.53 fold) in hypoxic group showing hypoxia induced impairment in insulin signalling. Hypoxia
22 National Institute for Interdisciplinary Science & Technology Agro Processing and Technology Division Annual Report 2017-18 protein expression, and acted as a ligand for PPARγ Syzygium cumini seeds effectively reduced the in competitive binding and fluorescent polarization production of nitric oxide (NO) and pro- inflammatory assay. Moreover, Zi-OH increased the mRNA and cytokines (IL-6, IL-10, INF-γ, IL-β, TNF-α). Syzygium protein expression levels of adiponectin. Additionally, cumini fractions also inhibited LPS-activated LOX and it promoted insulin-dependent glucose uptake into reduced the levels of iNOS and COX-2 mRNA expression 3T3-L1 adipocytes and increased Akt phosphorylation in murine macrophages. These effects were mediated and glucose transporter (GLUT) 4 protein expression. by impaired translocation of nuclear factor (NF)-κB In summary, these findings suggest that ZI-OH, which and inhibition of the phosphorylation of JNK, ERK and promoted adipogenesis and insulin sensitivity in 3T3-L1 p38 in LPS-stimulated RAW264.7 cells. This study gives cells, might be a phytochemical with potent anti-diabetic scientific evidence that Syzygium cumini seeds inhibits effects. the LPS-induced expression of inflammatory mediators via suppression of JNK, ERK and p38 mediated NF-κB Syzygium cumini seed attenuates LPS pathway as well as down regulation of iNOS and COX-2. induced inflammatory response in murine macrophage cell line RAW264.7 through NF- Evaluation of hypoglycemic potential κB translocation of resveratrol based compounds from The anti-inflammatory activity of Syzygium cumini seeds Dipterocarpaceae family for stimulated using lipopolysaccharide (LPS) stimulated RAW264.7 cells glucose uptake in skeletal muscle cell lines was investigated. Our study focused on anti-inflammatory and ER stress induced generation of beta effects of Syzygium cumini seeds through the modulation cells of key inflammatory mediators, such as, expression of Diabetes mellitus is characterized by chronic pro-inflammatory molecules like cyclooxygenase (COX), hyperglycemia due to insulin resistance and defect lipoxygenase (LOX), inducible nitric oxide synthase (iNOS), in insulin secretion and/or insulin action caused by tumor necrosis factor-α (TNF- α), interleukin-1β (IL-1β), Langerhans islets’ β-cell failure. This disease is one of the interleukin-10 (IL-10), interleukin-6 (IL-6) and interferon-γ most important worldwide health problems that show (INF-γ). Moreover, we also monitored the signaling an increasing prevalence. According to the International pathways including nuclear factor-κB (NF-κB), mitogen- Diabetes Federation’s (IDF) report there are approximately activated protein kinases (MAPKs), extra cellular signal- 381 million diabetic patients worldwide, a figure that regulated kinase (ERK), Jun N-terminus kinase (JNK), p38, expects to rise to 592 million by 2035. The current therapies to explicate the mechanism of action of Syzygium cumini for type 2 diabetes include mainly oral antidiabetic drugs, seeds in LPS induced macrophages. which are used as monotherapy or in combination. However, these oral agents have many undesirable side effects and ultimately cannot control the glycemic level. Therefore, safer and more effective antidiabetic drugs are still urgently needed. Traditional medicines derived from medicinal plants are used by about 60% of the world’s population. There are various approaches to reduce the ill effects of diabetes and its secondary complications. Dependence on natural products for managing diabetes mellitus is increasing due to its easy availability and low cost with often wrongly perceived reduced toxicity. Polyphenols, constituting oligomers of resveratrol ranging from dimer to octamer are found abundantly in plants belonging to Vitaceae, Dipterocarpaceae, Leguminosae and Cyperaceae families. The biological activities such
National Institute for Interdisciplinary Science & Technology 23 Annual Report 2017-18 Agro Processing and Technology Division
Investigation of the modulatory effect of active compounds in Momordica charantia Linn on pancreatic beta cell autophagy and its associated implications in the management of Type 2 diabetes mellitus Type 2 diabetes mellitus is characterized by insulin resistance and failure of pancreatic β-cells producing insulin. Recent findings suggest that ER stress act as a pathological component of both type 1 and type 2 diabetes and results in β cell apoptosis/ loss. One form of physiological stress, which leads to ER stress, occurs when these cells are exposed to high glucose. Under high glucose conditions, increased insulin biosynthesis as anti-bacterial, anti-HIV, anti-inflammatory, anti- can overwhelm the ER folding capacity, causing an proliferative property makes resveratrol a potential drug imbalance in homeostasis and leading to ER stress. candidate. The evaluation of the mechanism underlying Chronically elevated ER stress, therefore, may also play the biological activities of resveratrol oligomers would a role in glucose toxicity which contributes to potentially provide a substantial clue in the development of new drug irreversible β cell damage/apoptosis leading to diabetes. leads. It is evident from the literature that resveratrols are Pancreatic autophagy plays an important role in the also accountable for antidiabetic activity and the recent pathogenesis of insulin resistance and maintaining works by Sharma et al. proved the efficacy of resveratrol pancreatic beta cell function can be considered as a as an effective therapeutic adjuvant for diabetes mellitus. strategical approach for the prevention and treatment Herein, we had screened about seven resveratrol of diabetes. Momordica charantia is a popular fruit oligomers isolated from different plants belonging to the used as an agent to treat DM. Experimental studies Dipterocarpaceae family for its antidiabetic efficiency. suggested that the vegetable has a role in glycaemic The present study explored the antidiabetic activity of control. However, the exact mechanism of M. charantia these resveratrol oligomers in rat skeletal L6 cell lines is unknown. Phytochemical anlaysis had shown that and a mouse beta insulinoma cell line (βTC6). The results fruit contains certain active compounds like momordin, found that these oligomers can act as potent antidiabetic charantin, polypeptide –P and seed fat contains agents in skeletal cell lines as well as in beta cell lines. eleostearic acid (αESA) which have an industrial value. Further, molecular studies to elucidate the mechanistic The active components of M. charantia are reported to role of these compounds are in progress. have antidiabetic effect and have a potency to induce autophagy. However to date there is no reports showing the efficacy of these bioactives in inducing autophagy in β-cells. The present study analyzed the role of active compounds of M. charantia in the amelioration of β cell ER stress and associated autophagy process in the management of diabetes. MTT assay was carried out to check the toxicity of αESA in beta TC6 cells. Flow cytometry anlaysis was carried out to examine the oxidative stress, mitochondrial potential and apoptotic profile of the cells. Western blot analysis was carried out to confirm the involvement of autophagy markers, LC3-I & II.
24 National Institute for Interdisciplinary Science & Technology Agro Processing and Technology Division Annual Report 2017-18
By examining the efficacy of αESA in inducing autophagy Biaryl derivatives of diindolyl methane in beta cells, it was found that it can ameliorate oxidative induced apoptosis in triple negative stress in beta cells induced by hyperglycemic stress. metastatic breast cancer cells in 2D and 3D culture condition Three dimensional culture systems are widely used in drug discovery due to their ability to provide physiologically relevant data which can be translated to in vivo conditions. Three dimensional cancer cell culture models are used for preclinical studies to validate the drug molecule and studying the physiological response. Diindolyl methanes are the degradation products of indole 3 carbinols, the main pharmacological scaffold present in cruciferous vegetables. The cellular response of the biological effects of crucifereous vegetables is attributed to the diindolyl methanes. Here we have studied two DIM derivatives (DIM-1 and DIM-2) for the anticancer potential in triple negative breast cancer cells (MDA-MB-231). From the studies we have observed that the compounds exerted cytotoxicity, significant alteration The bioactive is found to have a potential in maintaining in cell morphology and reduced uptake of calcein in 2D the mitochondrial membrane potential in cells and as well as 3D culture conditions. The activity of caspase 3, also have the capacity to inhibit apoptosis induced by expression of Bax and cleaved PARP are increased in 2D hyperglycemia in beta cells. Moreover it was found that and 3D models on treatment with DIM-1 and 2. But the αESA can activate autophagy markers expression in production of MMP-2 and 9 decreased in 2D models on beta cells. This study confirms the potential of αESA in treatment with DIM-1 and DIM-2, but did not change in inhibiting apoptosis and its associated events in beta 3D model. This may be due to the effective interactions cells thus to protect the cells from hyperglycemic stimuli. of cells with the extracellular matrix in 3D condition This study unravels the protective effect of aESA from compared to 2D condition. hyperglycemia induced apoptotic effects in pancreatic beta cells, showing its efficacy for therapeutic approaches.
National Institute for Interdisciplinary Science & Technology 25 Annual Report 2017-18 Agro Processing and Technology Division
Quinoa and Amaranth seed protein upon simulated digestion after heat denaturation released more essential amino acids and bioactive peptides with antioxidant and anti-inflammatory properties Pseudocereals are the seeds produced by non-grass family plants which are consumed as grains. They are gluten free and contain a high amount of proteins, making them forefront among cereals in the food industry. Dietary proteins are the source of essential amino acids and the protein denaturation and digestibility are the main determinants of protein quality. In the present study, activity of the peptides released were also significant in we have isolated the proteins from the pseudocereals the heat denatured and subsequent digested samples. quinoa and amaranth seeds. Simulated digestion was The in vitro anti-inflammatory activities like inhibition done in raw and heat denatured proteins and compared of albumin denaturation and trypsin action were also the digestibility, essential amino acid release, antioxidant found to be more in the digested protein samples after and anti-inflammatory activities in vitro. Simulated heat denaturation. In conclusion, quinoa and amaranth digestion under controlled condition increased the are good source of dietary protein rich in many of the release of bioactive peptides and essential amino acids essential amino acids, easily digestible and the digested from the protein samples when it is heat denatured. peptides have good antioxidant and anti-inflammatory Total antioxidant activity and free radical scavenging activity.
26 National Institute for Interdisciplinary Science & Technology Microbial Processes & Technology Division Annual Report 2017-18
माइक्रोबियल प्रक्रिया तथा प्र셌饍योगकी प्रभाग
माइक्रोबियल प्रक्रिया तथा प्रौ饍योगकी प्रभाग (एमपीटीडी) का जनादेशजैव प्रौ饍योगकी के विशिष्ट अगणी 啍配ष र मᴂ उच㔚 गणवु त्ता वाले अनसु धं ान एव ं विकास का सचं ालन करना है। पर्यवरणीय स्थरता सनिशु 椿त करते हएु 啍配ष री जैव रतⴂ की खोज और मलू ्वर्न मᴂ ग के माध्म से प्रभाग की सअनु धं ान एव ं विकास तथा ﴂमहत्पर्ू जोर दिया जाता है । राष絍री और अतरं ्रा絍री सगठनⴂं के साथ नेटवर् औ饍योगक परामर् गतिविधिया ं राष絍री महत् के कार्क्रमⴂसे जडु ़ हएु हℂ । माइक्रोबियल ससां धनⴂ की खोज और दोहन करके जैव प्रक्रियाअⴂ और उत्पद विकास के कᴂ द섿त 啍配ष र के अनसु धं ान मᴂ प्रभागक्रिय स 셂प से शामिल है । अनसु धं ान के वर्मान ध्यन कᴂ द섿त 啍配ष र मᴂ शामिल हℂ i) औ饍योगक एजाइमं और मलू ्वर्धत रसायनⴂ (ii) जैव ईधं न और बायोरिफाइनरी (iii) जैव सक्रिय अण ु (iv) स्वस्थ और जीनोमिक् (v) पादप स啍ू षजीव इटरैकं ्न और (vi) प्रोबायोटिक और एल्ल न्絍य रस्ूटय कल् । दसरीू पीढ़ बायोइथेनॉल पर विशेष अनसु धं ान एव ं विकास के लिए प्रभागमᴂ एक समर्पत "जैव ईधं न कᴂ द" है। लिग्नसेल्लोय सिक बायोइथेनॉल के उत्पदन का पायलट सयं तं , अब ओन-साइट ठोस-अवस्थ किण्न एजाइमं उत्पदन पायलट सयं तं से समर्थत है, जो लागत प्रभावकता औरहℂड लिगं के लिए बेहतर अवसर प्रदान करता है। प्रभाग के डआर एं डी मᴂ विभिन् माइक्रोबियल बायोप्रोसेस के विकास शामिल हℂ और किण्न प्रौ饍योगकी पर तथा प्रोबायोटीक, जैव-कीटनाशकⴂ और जैव उर्रक आदि के लिए माइक्रोबियल फॉरलेशनम् पर काम करने के लिए मजबतू उ饍यग सबं धं भी है ।
हाइलाइट $ जलीय दो चरण निष्र㔷ण का उपयोग कर 90% शद्धताु के साथकिण्व त शोरबा से 1, 3- प्रोपैनडियोल का अलगाव और शद्धीु करण $ 絍셇प्टमाइजिस अल्넿डोफ्व쥁 स से कैराटीनस जीन को क्लन किया गया और ईकोलाई मᴂ अभिव्क्तकिय ा गया। एजाइमं उत्पदन मᴂ 20 गनाु सधु ार के साथ कैराटीनस उत्पदन प्रक्रिया अनकु ू लित की गयी $ समद्ु स啍ू षजीव नन्नक्लरोप्सस ओश्यानका मᴂ प्लटा 嵍रथ रेगलेटरु (पीजीआर) के मॉड्यलेशनु 饍वरा ओमेगा 3 फैटी एसिड, ईपीए के स्र को बढ़ने के लिए एक बायोप्रोसेस विकसित की । इसके बाद, एक वाणिज्यक फर्, अबान जैव प्रौ饍योगकी मᴂ 1000 लीटर् का स्क ल अप अध्यन श셂ु किया गया $ सेलेनोप्रोटीन टी (एसईएलटी) जीन की भविष्वाणी की गई और नन्नक्लरोप्सस ओश्यानका सीएएसएसीसी 201 से इसके अनक्रमⴂु की पष्टिु की गयी $ समद्ु स啍ू षजीव नन्नक्लरोप्सस ओश्यानका मᴂ कार्बनक सेलेनियम साम嵍र का सवं र्न किया गया और उपपादन 饍वरा यग्मु त प्लाज् मास स्पे絍रमे絍र (आईसीपी- एमएस) 饍वरा इसकी पष्टिु की गयी $ कार्यत्क 셂प से स्ततं दो प्लटा 嵍रथ रेगलेटर,ु किनेटीन और जीए 3 का नन्नक्लरोप्सस ओश्यानका सीएएसएसीसी 201 मᴂ विकास, लिपिड उपज, पीयएफएू और ईपीए सचयं पर प्रभाव केलि ए व्यक्तगत 셂प से या सयं ोजन मᴂ मल्ू यकना किया गया
National Institute for Interdisciplinary Science & Technology 27 Annual Report 2017-18 Microbial Processes & Technology Division
$ मा配रत्क पीसीआर 饍वरा एसएपी 1 और एसएपी 2 की विभेदक अभिव्यक्त का अभिलकण किया गया । एसएपी 1 और एसएपी 2 की समय सारिणी ΔΔ सीटी वक्रवि�लेण से पता चला कि 48 घटें के दौरान नाइ絍रजन तनाव प्रेरित नमनेू का एलएजीएलआईडीएडीजी होमिगं एडोन्ं कय ्लएज (एलएचई) नाइ絍रजन समद्धृ (नियतं ण) नमनेू से 4.2 गनाु ऊं चा था । रिबोसोमल प्रोटीन एल 23 भी विनियमित किया गया और नियतं ण की तलनाु मᴂ 6 घटें के नाइ絍रजन तनाव प्रेरित नमनेू मᴂ 2.6 गनाु वद्धिृ देखी गई $ परू 핋पचार किय े मिर् के फसलोत्तर अवशेषⴂ के एजाइमें टिक शर् रीकरण के बाद प्राप्त बायोमास हाइड्रोलाइजेट को बायोइथेनॉल, बायोपॉलिमर (पॉली-3-हाइड्रॉक्सब्ूटय रेट) और एजाइमं जाइलानेस के उत्पदन के लिए उपयक्तु पाया गया $ “लोकतक झील के फ्लोटगं बायोमास (फु मडीस) का मलू ्वर्न” नामक परियोजना के तहत बायोइथेनॉल उत्पदन के लिए बायोमास के गीले प्रससं ्रण को प्रयोगशाला पैमाने पर प्रदर्शत किया गया $ बायोमास हाइड्रोलाइजिगं एजाइमⴂं के उत्पदन का प्रारंभिक लागत वि�लेण किया गया और सेल्लेजय और बीटा ग्कोल सिडेस दोनⴂ के लिए प्रतिस्पर मलू ्ⴂ का सकेतं दिया $ 16 एस आरआरएनए अनक्रमणु और पॉलीफासिक वर्करण के आधार पर, एक नतनू पादप फायदेमदं फ्쥈वोबैक्रट ियम उपभेदⴂ की पहचान की और इसका नाम फ्쥈वोबैक्रट ियम पोक्काी स्पसीज नव. के 셂प मᴂ प्रस्तावत किया $ सभां वित जीवाणरोु धी और कℂसर विरोधी गतिविधि के साथ शक्तिशाली नतनू हेलोफिलिक एक्टनोमाइसेज की पहली बार पहचान की गई $ एक नतनू पादप फायदेमदं स्फन्मोनस का सपं र्ू ड्राफ् जीनोम अनक्रमु रा पू किया गया
28 National Institute for Interdisciplinary Science & Technology Microbial Processes & Technology Division Annual Report 2017-18
Microbial Processes and Technology Division (MPTD)
The mandate of the Microbial processes and Technology Division (MPTD) division is to conduct high quality R & D in specific frontier areas of Biotechnology. Significant emphasis is put in exploration and value addition of regional bioresources while ensuring environmental sustainability. The divisional R & D and industrial consultancy activities are linked with programmes of National importance through networking with National and International organizations. The division is actively involved in research in the focussed areas for bioprocesses and products development by exploring and exploiting the microbial resources. The current focus of research are in the areas of i) Industrial enzymes and value added chemicals ii) Biofuels and biorefinary (iii) bioactive molecules iv) Health and genomics (v) plant microbe interactions and (vi) probiotic and algal nutraceuticals. The Division has a dedicated “Centre for Biofuels” for exclusive R&D on 2nd generation bioethanol. The pilot plant for the production of lignocellulosic bioethanol is now supported by on-site solid-state fermentation enzymes production pilot plant, bringing better cost-effective and handling opportunities. The Division is involved in R & D on developing different microbial bioprocess and has strong industry linkages to work on fermentation technology, microbial formulation for probiotic, biopesticides and biofertilizers etc.
Highlights
$ 1,3-Propanediol was separated and purified from the fermented broth with 90% purity using aqueous two phase extraction.
$ Keratinase gene from Streptomyces albidoflavus was cloned and expressed in E coli. Keratinase production process was optimized with 20-fold improvement in yield of the enzyme
$ Developed a bioprocess to enhance the level of essential omega3 fatty acid, EPA in marine microalga Nannochloropsis oceanica by modulating the plant growth regulators. Subsequently, a scale up study of 1000 L was initiated at ABAN biotechnology, a commercial firm.
$ Selenoprotein T (SelT) gene was predicted and its sequences confirmed from Nannochloropsis oceanica CAS CC201.
$ Enriched the organic selenium content in marine microalgae Nannochlorpsis oceanica and confirmed by Inductively Coupled Plasma Mass Spectrometry (ICP-MS).
$ Two functionally independent plant growth regulators Kinetin and GA3 was evaluated individually or in combination for its effect on growth, lipid yield, PUFAs and EPA accumulation in Nannochloropsis oceanica CASA CC201.
National Institute for Interdisciplinary Science & Technology 29 Annual Report 2017-18 Microbial Processes & Technology Division
$ The differential expression of SAP1 and SAP2 were characterized by quantitative PCR. The time course ΔΔCt curve analysis of SAP1 and SAP2 revealed that LAGLIDADG Homing Endonuclease (LHE) was 4.2 fold elevated during 48 hours of nitrogen stress induced samples than nitrogen rich (control) samples. Ribosomal protein L23 was also up regulated and 2.6 fold increment was observed at 6 hours of nitrogen stress induced samples compared to control.
$ Biomass hydrolysate obtained after enzymatic saccharification of pretreated chili post- harvest residue was found to be suitable for the production of bioethanol, biopolymer (poly-3- hydroxybutyrate) and enzyme xylanases .
$ Wet processing of biomass for bioethanol production was demonstrated at lab scale under the project on value addition of Loktak lake floating biomass (Phumdis).
$ Preliminary cost analyses of the production of biomass hydrolyzing enzymes was performed which indicated competitive values for both cellulase and beta glucosidase.
$ Based on the 16S rRNA sequencing and polyphasic taxonomy, identified a novel plant beneficial Flavobacterium strain and proposed its name as Flavobacterium pokkali sp nov.
$ Potential novel halophilic actinomycetes with potent antibacterial and anticancer activity were identified for the first time.
$ Whole draft genome sequence of a novel plant beneficial Sphingmonas was completed
30 National Institute for Interdisciplinary Science & Technology Microbial Processes & Technology Division Annual Report 2017-18
Report On R&D Activities showed the highest level of similarity with a serine S. albidoflavus 1.Bio-Processes And Products Development protease from Fea-10 was selected for further studies. The gene was cloned in PET28A expression 1.1. Industrial enzymes vector and was expressed from E-coli. Clones expressing the gene were selected by screening on gelatin plates and 1.1.1. Production of Keratinase using Streptomyces 5 clones among the 16 was found to be positive. (Fig 2) albidoflavus and whole genome sequencing of the actinomycete Agarose gel electrophoresis of double digested recombinant pTZ57R/T and pET28a+, compared with As part of the DBT funded project with JNTBGRI on undigested plasmids and PCR amplified Salb_S13A5_ker Keratinase enzyme production from Streptomyces albidoflavus, optimizations of the process parameters for Agarose gel electrophoresis of plasmids isolated from production of the enzyme was continued and there was colonies 7, 13 and 15, amplified using gene-specific a 20-fold improvement in the yield of keratinase through forward and reverse primers solid state fermentation (Fig. 1). M : 1kb DNA ladder K : Salb_S13A5_ker (1083 bp) D1 : Recombinant pTZ57R/T with Salb_S13A5_ker dD1 : Double digested D1 plasmid P : pET28a+ (5369 bp) dP : Double digested pET28a+M : 1kb DNA ladder K : Salb_S13A5_ker (1083 bp) E1-E3 : Amplicons of keratinase gene using specific primers from clones E7, E13 and E15 The amplicons were sequenced to confirm identify.
Fig 1: Improvement in Keratinase production by S. albidoflavus by >7PETF_F01.ab1 process optimization AAGGAGATATACCATGGGCAGCAGCCATCATCATCAAC ATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCATATGGCCA Whole genome shotgun sequencing of the organism RCATGACTGGTGGACAGCAAATGGGTCGCGGATCCGAAT was performed by NGS and the sequence was deposited TCGTGAACCACCGACGCATACCCAAACGGCGGGTCGCCGTG in NCBI with accession No. PIBK00000000.1. Since ACCGGTGCCGGCATCGCCGCACTGGTCGCCGCCGGGCT Keratinase is a serine protease, the genome of S. GACGTTCCAGACGGCCAACGCCAGCGAGCCGCAGAGCGCCGA albidoflavus was analysed for serine protease genes and ACCGCGCACCCTCTCGGTCGCCTCCGCGGGCAAGCTCGC} among the 13 short listed genes, “ctg7180000009487_ CGACACCCTCGCCGGTGACCTCGGCAAGGCGGCCGCCGGGA orf00002_822_1904”, (Named as Salb_S13A5_ker) which CGTACTACGACGCCAAGGCGAAGAACCTGGTGGTGAACG TCCTCGACGAGGCCGCCGCCACCGAGGTCGAGGCGTCCGGT GCCCAGGCCAGAATCGTCGAGCACTCCCTCACCGCGCTG AACGACGCCCGGGCCACCCTCAAGGACCGGGCCAGCATCGC GGGCACCTCGTGGGCGATCGACCCGACCAGCAACAAGGTCGT CGTCACCGCCGACCGCACGGTCGAGGGCAAGGAGCTGG CGAAGCTCACCAAGGTGGTGGACGCGCTCGGTTCCAAG GCCGAACTCAAGCAGACCAAGGGTGAGTTCAAGCGGTTCATC GCGGGTGGCGACGCCATCCACGGTGACGGCGGCCGCTG Fig 2: Confirmation of Kertinase gene amplification and cloning CTCCCTCGGCTTCAACGTGGTGAAGGGCGGCGAGCCGTACTT
National Institute for Interdisciplinary Science & Technology 31 Annual Report 2017-18 Microbial Processes & Technology Division
CCTCACCGCCGGTCACTGCACCGAGGGCATCTCCAGCTG using a filamentous fungusPenicillium janthinellum. Solid GTCCGAGACCTCGGGCGGTTCGGAGATCGGCACCACGGTCG state fermentation process was used for production of AGTCGAACTTCCCCGGCGACGACTACGGGCTGGTCCAG enzymes and P. janthinellum cellulase production trials TACACCGGCTCCACCGAGCACCCCAGCGAGGTGAACCTGTAC were conducted in production scale trays (each 1kg Assay for keratinase activity were conducted for the moldy bran capacity) to a maximum level of 20 kg in SSF culture extracts of positive clones to confirm the identity pilot plant. Optimized conditions gave an average yield of cloned protease as keratinase (Fig 3) of 40-45 IU/gDS for cellulase. Based on above, and the cost for individual unit operations, a preliminary cost of production for cellulase was calculated. The estimate cost of production was ~Rs 246 Rs /Kg (60000 FPU) of enzyme. Interestingly, the highest cost factor for medium including its sterilization was contributed by the cost of cellulose. Of the total cost of Rs 59.86 Rs/Tray (kg), the cost of cellulose alone was Rs 50 (~84%). So any replacement for pure cellulose as inducer would make a tremendous impact on reducing the cost of medium. Fig 3: Confirmation of Salb_S13A5_ker protein expression by Scaling up of Beta glucosidase (BGL) production from transformed colonies Aspergillus niger 1.1.2. Microbial Lipase BGL is a critical component in biomass hydrolyzing Lipases find applications in a variety of biotechnological enzymes it aids in improving the efficiency of biomass fields such as food and diary industries, detergent, hydrolyzing enzymes. NIIST was initially sanctioned agrochemical and oleo chemical industries. A newly an FTT project for scaling up BGL production and to isolated lipase producing cultures identified as develop a technology for production of this enzyme Pseudomonas guariconesis was capable of hydrolyzing using solid state (SSF)and submerged fermentation substrates like castor oil with an initial activity of 22 IU/ (SmF) technologies. During the first year of the project, ml determined by pNPP assay (Fig.4.). Further process the production was improving ~3fold from 80 IU/gDS to parameter optimizations were in progress. 240IU/gDS and process was demonstrated at semi-pilot scale (50g capacity) trays. The experiments were extended to full scale trays (1kg capacity) and trials were conducted in the SSF pilot plant (Fig 5). Yield of enzyme was 150 IU/ gDS which was lower than what was obtained in lab scale trials. Parameters specific to production scale trials (eg Bed height, relative humidity) are now being optimized to increase the yield.
Fig 4. Lipase production by Pseudomonas guariconesis 1.1.3. Biomass hydrolyzing enzymes 1.1.3.1. Preliminary Cost Analyses of Biomass Hydrolyzing Enzymes BGL production in production scale BGL production in NIIST 2G ethanol process uses multiple enzyme sources trays (Day 0) production scale trays (Day 5) and the in-house enzyme production is accomplished Fig 5: BGL production in Pilot scale
32 National Institute for Interdisciplinary Science & Technology Microbial Processes & Technology Division Annual Report 2017-18
Submerged fermentation production of the enzyme was Later the partition co-efficient was improved using dual also attempted in both shake flasks and in small capacity inorganic salts, K2CO3 and K2HPO4 with an optimum fermenters. While the enzyme yield in shake flasks concentration of 45% and 15% respectively. Using Central were ~3.6 IU/ml on days 6 and 7, the yields obtained in Composite Design, pH and temperature on partition and fermenter were lower at a maximum of ~2 IU/ml (Fig 6). recovery of 1,3-PDO was evaluated. With the optimized This is mostly due to aggregation of mycelia on baffles physical conditions and inorganic salts concentration, resulting in dead zones and the process is now being ATPS extraction was carried out in synthetic solution optimized to improve yields. as well as fermented broth resulting in maximum 1,3- PDO partition co-efficient value of 42.46 and 56.93 and recovery yield of 97.69 and 98.27% respectively. A fair partition was observed with organic acids and 1,3-PDO, with removal of lactic acid and acetic acid up to 93.29 and 90.42 % respectively.
Fig. 6 a. BGL production under SmF
Fig 7: Schematic representation of fermented broth obtained from the upstream process and aqueous two
phase extraction of 1,3-propanediol using K2CO3+K2HPO4/ Isopropanol system
1.2.2. Whole cell based biocatalytic production of 2,5 furan dicarboxylic acid Fig. 6 b. SmF Production of BGL, fermenter trials 2,5-furandicarboxylic acid (FDCA), is a valuable 1.2 Biopolymers and Biosurfactants hydroxymethyl furan derivative which is reported as one of the top 12 green chemicals for the future by the 1.2.1. Purification of 1, 3-propanediol from the US Department of energy. This valuable building block fermented broth using aqueous two phase systems monomer is combined with mono-ethylene glycol and
An aqueous two phase extraction using K2CO3:K2HPO4/ the polymer obtained through the esterification process Isoproponal was investigated for the recovery of is known as polyethylene furanoate (PEF). Polyethylene 1,3-propanediol from the fermented broth (Fig.7). furanoate polymer can be used as analogs of petroleum
Initially, the concentration of K2CO3 on phase formation, based products such as polyethylene terephthalate the partition co-efficient and recovery of 1,3-PDO was (PET) and polybutylene terephthalate (PBT). So the FDCA evaluated with a optimum salt concentration of 60%. based PEF can reduce the dependence of nonrenewable
National Institute for Interdisciplinary Science & Technology 33 Annual Report 2017-18 Microbial Processes & Technology Division
energy sources and can reduce the PET and PBT use by when fermenting biomass hydrolysates, which may 45-55 %. FDCA monomers can be used for the synthesis of contain fermentation inhibitors. NIIST-MPTD has isolates polyesters, polyamides and polyurethanes. The polymers of Saccharomyces cerevisiae which were demonstrated made of FDCA are valuable for the synthesis of bottles, to perform efficiently in biomass hydrolysates and containers, nylons and films. It is used as an ingredient process employing these cultures were optimized for 2G of fire foams, plastics and resin coatings also. The ethanol production process optimization have resulted in current method of production of 2,5-furan dicarboxylic improvement of efficiency to reach 90% conversion (Fig 10) acid (FDCA) using chemicals pose lot of environmental hazards. So there is a need for an alternative method for its production with less hazardous to environment and microbial biotransformation seems to be promising method for the production of FDCA. In the present study, several soil isolates were evaluated for the production of FDCA and one isolate, Enterobacter sp., showed positive for the conversion of 5-(hydroxymethyl)furfural (HMF) to FDCA with an yield of 0.07g/L FDCA from 0.5g/L HMF in mineral salt media at 14 days of incubation (Fig .8). Fig. 9. Fermentation of SCT hydrolysate by S.cereviseae RPP-03N Changing the production media with 0.25% glucose and 0.25% glycerol showed an inhibition in the FDCA production by seven times and two times respectively.
Fig. 10: Improvement in fermentation efficiency by process optimization 2.2. Loktak lake biomass based biorefinery for fuels and chemicals Fig 8: FDCA production by Enterobacter sp in different carbon sources Loktak Lake is the largest fresh water lake in North Eastern Fermentation of Sugar Cane Trash (SCT) hydrolysates India and it is unique due to the presence of floating mass were performed after concentrating the hydrolysates of vegetation locally known as phumdis. Currently the (by vacuum evaporation in lab scale and by RO in semi lake eocsystem is under threat due to invasive growth of pilot scale). Results of study are given below. Under the an introduced fodder plant – the Para Grass (Brachiaria optimized conditions of fermentation, the yield was 90 % mutica). Efforts are underway to protect this unique of the theoretical maximum (Fig.9). habitat and involve clearing of non-native grasses and invasive aquatic plants from the lake. A new Project was 2. Biofuels and Biorefineries sanctioned to NIIST and IIP for value addition of such 2.1.Biofuel Research biomass removed from the lake. Under this project, work Fermentation of biomass hydrolysates to ethanol is the was initiated for converting the invasive grass biomasses final step in lignocellulosic ethanol production. Current to bioethanol. Wet Phumbi biomass Samples were strains of yeast used in distilleries, though can ferment collected from Loktak lake and were brought to NIIST for molasses and free hexose efficiently, are underperformers studies
34 National Institute for Interdisciplinary Science & Technology Microbial Processes & Technology Division Annual Report 2017-18
Hydrolysis of the acid and alkali pretreated WPB was carried out in screw capped flasks in a total volume of 20ml with a biomass loading of 10% and enzyme loading of 20 FPUs/g dry weight of pretreated biomass at 50 °C with shaking (100rpm) in a shaking water bath. Samples Loktak lake showing Sample collection Phumdi biomass floating biomass were withdrawn 0, 12, 24, 36 and 60hrs and were analyzed @ Keibul Lamjao scavenged from lake National Park dumped on shore for total reducing sugars (TRS) by DNS method (Miller et al, 1959). The reaction conditions and sugar yields were Unlike conventional process of pretreatment where dried as given in Table 2. and milled biomass samples are used for pretreatment, the project required processing of wet biomass, since Table 2: Hydrolysis of pretreated WPB and efficiencies drying (even sun-drying) may not be a feasible option attained at Loktak, as the days with good sunlight may be lesser. Reaction Component/ Acid Pretreated Alkali Pretreated Condition WPB WPB The WPB was therefore subjected to wet grinding for Biomass (g) 2.23 (2g dry wt) 2.26 (2g dry wt) size reduction and biomass loadings for pretreatment were adjusted calculating for the water content (Fig 11). 1M Citrate buffer stock PH 1 1 4.8 (ml) The WPB slurry was subjected to dilute acid and alkali pretreatment following standard conditions established Tween 80 (µl) 100 100 at NIIST. Antibiotic Solution (µl) 200 200 Enzyme (Zytex Cellulase 650 650 (20FPU/g) 62FPUs/ml) (20FPU/g) Water (ml) 15.83 15.79 Total Volume (ml) 20 20 Total Reducing Sugars @ 28.3 63.98 36h(TRS) (mg/ml) Wet ground WPB Acid Pretreated WPB Alkali Pretreated WPB (AcWPB) (AlWPB) Total Reducing Sugars 283 639.8 @36h (TRS) (mg/g) Fig 11: Wet ground and pretreated phumdi biomass Theoretical Maximum 618.6 896.5 Analysis of the biochemical composition was performed Sugar Yield (mg/g) by NREL methods and the carbohydrate content in Efficiency (% of Theor. Max) 45.75 71.37 biomass was established (Table 1) The study indicated that alkali pretreatment is better Table 1: Composition of native and pretreated WPB for wet phumdi biomass as it gave higher conversion efficiency. Component ↓/ Sample Native Acid Alkali → 2.3. Comparison of different alternative Cellulose % 34.82 42.37 57.04 strategies for pretreatment of chili post harvest Hemicellulose % 18.58 13.24 23.51 residue Lignin % 32.01 37.32 24.82 Among the different alternative strategies of pretreatment Ash % 3.90 2.05 0.37 of chili post harvest residue, sono-assisted acid Total % 89.31 94.98 105.74 pretreatment gave the better reducing sugar yield (0.465 g/g). Biomass hydrolysate obtained after enzymatic The native mixed phumdi biomass had a high lignin saccharification of pretreated chili post-harvest residue content of 32% whereas the cellulose and hemicelluloses was found to be suitable for the production of bioethanol, content was ~35% and 19% respectively. While acid biopolymer (poly-3-hydroxybutyrate) and xylanases. pretreatment removed about 29% of hemicelluloses, Table 3 gives an overview of the optimum conditions of the lignin removal as expected was low. For alkali different alternative strategies of pretreatment developed pretreatment ~22% of lignin was removed. for chili post-harvest residue.
National Institute for Interdisciplinary Science & Technology 35 Annual Report 2017-18 Microbial Processes & Technology Division
Table 3. Pretreatment of Chili Post Harvest Residue (CPHR)
Reducing Sugar Pretreatment type Pretreatment conditions Reference Yield (g/g)
Surfactant –Sssisted BL – 5% w/w Transition Metal Pretreatment Surfactant Conc. - 2% w/w Sindhu et al., Journal of Energy and 0.245 Environmental Sustainability 2017 FeSO4 Conc. – 2% w/w (SATMP CPHR) PT time – 20 min
Crude glycerol assisted BL – 25% w/w surfactant pretreatment Surfactant Conc. - 4.5% w/w 0.459 Sindhu et al., Biofuels 2017 CG Conc. – 0.55% w/w (CGASP CPHR) PT time – 60 min
BL – 15% w/w Sono-assisted acid pretreatment US time- 4 min Sindhu et al., Bioresource Technology 0.465 Acid Conc. – 4% w/w 2016 (SAAP CPHR) PT time – 60 min BL – 5% w/w Microwave-assisted surfactant MW time- 1 min pretreatment Sindhu et al., Journal of Energy and MW Power – 550 W 0.316 Environmental Sustainability 2016 Surfactant Conc. – 4% w/w (MWASP CPHR) PT time – 45 min Ultrasound-assisted alkali BL – 15% w/w pretreatment US time- 5 min Sindhu et al., Bioresource Technology 0.402 Alkali Conc. – 4% w/w 2017 (USAAP CPHR) PT time – 15min
Surfactant – assisted BL – 20% w/w Sindhu et al., Bioprocess and hydrothermal pretreatment Surfactant Conc. – 3% w/w 0.445 Biosystems Engineering 2018 SAHTP CPHR PT time – 30min
Ultrasound assisted BL – 25% w/w Sindhu et al., Annals of Agricultural hydrothermal pretreatment US time- 10 min 0.436 and Crop Sciences 2017 USAHTP CPHR PT time – 45min
3. Health and Genomics 3.1. Algal nutraceuticals envelope membrane protein (Chloroplast) and (4) ATP 3.1.1.Biochemical and molecular characterization synthase β subunit of Acutodesmus obliquus. of nitrogen stress mediated lipid accumulation in $ SAP1 and SAP2 were confirmed at gene level in S. Scenedesmus quadricauda CASA CC202 quadricauda as LAGLIDADG Homing Endonuclease $ Stress Associated Proteins (SAP) were identified from (orf 42) and Ribosomal protein L23. total protein samples of nitrogen rich and nitrogen $ The differential expression of SAP1 and SAP2 were stressed Scenedesmus quadricauda by MALDI-TOF characterized by quantitative PCR. analysis. The time course ΔΔCt curve analysis of SAP1 and SAP2 $ Nitrogen stress associated proteins were identified as revealed that LAGLIDADG Homing Endonuclease (LHE) (1) mitochondrial orf151, (2) ribosomal protein L23, (3) was 4.2 fold elevated during 48 hours of nitrogen stress
36 National Institute for Interdisciplinary Science & Technology Microbial Processes & Technology Division Annual Report 2017-18 induced samples than nitrogen rich (control) samples induction in microalgae such as nutrient stress including (Fig.12) . Ribosomal protein L23 was also up regulated and nitrogen stress and phosphorous starvation, combined 2.6 fold increment was observed at 6 hours of nitrogen stress factors, irradiance, high salinity, pH, temperature, stress induced samples compared to control. exposure to heavy metals and other chemicals, etc. Plant growth regulators are natural or synthetic chemical messengers affecting plant growth and development. These compounds are active at very low concentration even in the picomolar concentration. Marine microalgae as primitive eukaryotic plant cells have a close evolutionary relationship with plants and were often used for the production of high-value products. Microalgae share physiological similarities with higher plants. The physiological role of Plant growth regulators is mainly focused on higher plants. Particular research interests are made on microalgal genus Nannochloropsis due to its ability to synthesize omega 3 fatty acids, mainly EPA. In
Fig. 12. The time course ΔΔCt curve analysis of SAP1 and SAP2 the present research work, major plant growth regulators were used as biochemical agents for the selective 3.1.2. Kinetin and GA3 act synergistically to enrichment of EPA in marine microalgae N. oceanica CASA produce Eicosapentaenoic acid (20:5n-3; EPA) in CC201. Nannochloropsis oceanica CASA CC201 Kinetin (KIN) and gibberellic acid (GA3), functionally Long chain poly unsaturated fatty acids (LC-PUFAs) different plant growth regulators, were evaluated including omega 3 and omega 6 fatty acids are a individually and in combination for their effect on necessary component of the growth of higher eukaryotes. growth, lipid yield, poly unsaturated fatty acids (PUFAs) Arachidonic acid (AA, 20:4 ω-6), Eicosapentaenoic acid and eicosapentaenoic acid (EPA) accumulation in (EPA, 20:5, ω-3) and Docosahexaenoic acid (DHA, 22:6, Nannochloropsis oceanica CASA CC201. It was observed ω-3) are the most nutritionally important essential that the treatment of KIN at a concentration of 0.215 bioactive compounds belonging to omega 3 (n-3) ppm resulted in higher cell number (521×106cells per ml) fatty acids. Eicosapentaenoic acid, a typical Omega-3 than the control (398×106 cells per ml), when compared Polyunsaturated fatty acid (PUFA) which has many with GA3, which had an adverse effect on cell number. beneficial effects for humans and prevention of various KIN increases the specific growth rate to 0.24/day and human diseases Marine fish and its oil are the major doubling time to 2.86 days than control (4.38 days) (Table dietary sources of EPA. But fish oil possesses a number of 4). Treatment of GA3 at a concentration of 50ppm gives disadvantages like instability, odor, high purification cost, the highest cellular lipid accumulation (61.5% DCW) and the presence of environmental contaminants in fish. compared to the control (35.5% DCW). The combinationof There are a number of alternative EPA sources like plants, KIN and GA3 exhibited a synergistic effect on total lipid fungi, bacteria and microalgae which are exploited for commercial production. yield (246.25 mg/L) compared to control (121.5 mg/L). A four-fold increase of EPA was noted due to the addition of Microalgae are the primary producers of EPA in KIN as compared to the control. the marine ecosystem and fish get these PUFA by consumption of microalgae. Moreover, microalgae can Table.4. Specific growth rate and doubling time grow fast under different culture conditions with high of N.oceanica CASA CC201 grown under different potential of Omega-3 fatty acid synthesis. There are concentrations of Kinetin (0.215ppm-1.075ppm), GA3 several biochemical engineering methods used for lipid (10ppm-50ppm) and control.
National Institute for Interdisciplinary Science & Technology 37 Annual Report 2017-18 Microbial Processes & Technology Division
Kinetin Concentration (ppm) GA3 concentration (ppm)
Control 0.215 0.43 0.645 0.86 1.075 10 20 30 40 50 Specific growth 0.15±0 0.24±0.01*** 0.21±0.01** 0.21±0.01** 0.21±0.02** 0.22±0.02* 0.08±0.002*** 0.08±0.02*** 0.080±0.001*** 0.08±0.002*** 0.07±0.001*** rate
Doubling 4.38±0 2.86±0.11*** 3.23±0.13** 3.37±0.2** 3.28±0.28** 3.05±0.45* 8.7±0.18*** 8.75±0.17*** 8.62±0.17*** 8.15±0*** 9.02±0.05*** time (day)
specifically predicts the presence of selenoproteins. It also predicted the all the proteins those are the parts of the sophisticated machinery involved in the biosynthesis of Selenoproteins. The prediction of SelT was confirmed by PCR amplification and sequencing of a small region (323 bp) of SelT gene (Fig. 2). For the production of selenium enriched microalgal biomass, the alga was exposed to different levels of Sodium selenite concentrations. The accumulation of organic selenium in Nannochloropsis with respect to addition of inorganic selenium was determined by ICP MS analysis Table 2. Figure 13: Cell size comparison of N.oceanica CASA CC201 after plant growth regulator supplementation. SEM images of N.oceanica CASA CC201. (a) Control, (b) Kinetin 0.215ppm, (c) GA3 10ppm. SEM images >G18SELTRPRUN3-20182011- were taken at 5000X and 7000X magnification 04-29-11-17-1111-17-11.ab1 CTCCMCCCTYYTTTTTCTAATTAC CTCRGSTTGWACAATACKGCACMARA AKGKGSGGGKGTTGACRAAWKTTTTT 323bP 3.1.3. Identification of selenoprotein T from GCCTCCYCCCGCRRTCGGAAA Nannochloropsis oceanica Fig. 14. Gel image showing PCR amplification of an internal region (323 Selenium is a trace element and its importance as a bp) of SelT gene with characteristic feature of TGA (encircled) coding for micronutrient is realized recently. Se executes its biological Selenocystine. functions, such as acting as anti-oxidants, mainly through Table 5. Enrichment of Selenium content in Nannochloropsis as a class of proteins called Selenoproteins, in which Se exists determined by ICP MS. in the form of an unusual amino acid; Selenocysteine Nannochloropsis oceanica CASA CC201 (encoded by TGA, the universal stop codon). The main Control Enriched selenoprotein families which are characterized so far are Glutathione peroxidases (GPX1-8, of these 5 are selenium 0.108 ppm 460.72 ppm dependent) Iodothyronine Deiodinases and Thioredoxin 3.2. Probiotics and nutraceuticals reductases. Other selenoproteins discovered are SelP, SelH, SelW, SelR/X, SelN, SelS, SelK, SelM, SelT SelO, SelV 3.2.1. Exopolysaccharide (EPS) from food grade etc. The current study is trying to reveal the potential of lactic acid bacteria Nannochloropsis oceanica, a marine microalga which Food grade Lactic acid bacteria (LAB) produce a great is rich in poly unsaturated fatty acids, as source of variety of EPSs with different chemical composition and Selenium enriched microalgal biomass. The present structure, thus providing useful functional properties in study detected the presence of Selenoprotein T from food systems. EPS production from two different isolates the whole genome of Nannochloropsis oceanica by using were standardized and Fig 15 shows the properties of a bioinformatic pipeline called Selenoprofiles3, which purified EPS
38 National Institute for Interdisciplinary Science & Technology Microbial Processes & Technology Division Annual Report 2017-18
programs looking at the construction of recombinant Corynebacterium glutamicum strains for the production of above said chemicals and work is in progress 3.4. Plant-Microbe Interaction
3.4.1 PGPR tools for improving crop productivity in stressed agricultural systems: • Purified from Lb. • Purified from Plantarum Weissella confusa 3.4.1a Plant beneficial properties of a novel brackish Flavobacterium • Composed of Glucose • White, Dextran like adapted . and mannose EPS, composed of Microbial community compositions in plant roots/ residues glucose rhizosphere determined by culture dependent methods • Light brown coloured • Pseudoplastic are often bias, contrary to the abundant bacterial phyla’s powder behaviour represented using molecular tools in various microbiome • Temperature • 1% EPS can prevent studies. Flavobacterium is one such underestimated tolerance up to nearly 75% syneresis 225˚C. genus wherein several studies have proved their • Temperature • Non toxic to normal tolerance up to 260˚C rhizosphere or root abundance especially during cell lines early plant growth stages whereas the cultured based • Non toxic to normal • Yield : 2.5-3.5 g/L cell lines estimations fail to support this findings. In fact, their rich • Has potential • Yield: 16-17 g/L gene reservoir for carbohydrate utilization or breakdown health applications potential is poorly investigated in-vivo, which can open –antioxidant, • Can be used in food cholesterol absorbing industry new avenues in plant-microbe interactions. Therefore, to understand the existence and ecology of this less
Fig.15. Comparison of exopolysaccharide (EPS) obtained studied genus, we targeted isolating Flavobacterium from two different isolates from roots of saline-tolerant rice plant, pokkali grown in brackish water flooded fields. We could isolate novel 3. 2. Corynebacterium glutamicum as the cell factory and diverse members belonging to this genus since 2014 for the production of value added products from which confirmed the indigenous nature of these novel lignocellulosic derived sugars isolates relative to the adaptation towards brackish The study targets on the production and scale up of conditions where the closest reference strains failed to pentonic acids, α,ω diamines and amino acids from do so. Among the many novel Flavobacterium strains lignocellulosic biomass using appropriate recombinant C. glutamicum strains. Global environmental concerns and depleting petroleum resources have stimulated the development of renewable bio-based alternatives. C. glutamicum is able to co-utilize mixed carbon sources, making it a preferential host for utilization of complex carbon sources such as second generation biomass ( plant biomass that does not have any value as food and no or less value as fodder) for the production of commodity chemicals. Xylonic acid is a promising Fig. 16: The positive plant growth effect of L1I52T on pokkali rice VTL-2 organic acid with important application as a green variety; (a) L1I52T treated and untreated pokkali seeds after 7 days of incubation in 0.8% water agar plates, (b) root images showing L1I52T solvent and effective biocatalyst and precursor for bio treated and untreated seedling roots after 4 weeks of incubation in pots plastic and polymer synthesis. The α,ω- diamines and filled with autoclaved soil, (c) table showing plant growth parameters amino acids serves as potential C5 building blocks of between L1I52T treated and untreated plants (n = 24 plants) after 27 days of growth in pots filled with autoclaved paddy soil. the valuable polyamides like nylon. Initiated a research
National Institute for Interdisciplinary Science & Technology 39 Annual Report 2017-18 Microbial Processes & Technology Division
isolated, L1I52T (Flavobacterium pokkalii sp. nov) isolated primary factors required for the successful colonization in 2014 was chosen for in-depth study as it showed of microbes to a plant rhizosphere. The genome contains positive plant growth effect on young pokkali seedlings complete set of flagellar genes required for motility as proved through in-planta studies (Fig. 16 (a), (b), (c)). and genes related to chemotaxis, motility observed Saline-dependent root attachment behavior of L1I52T under microscope prove the functionality of these was found to be an eco-specific trait where the isolate genes. Adhesion is possibly mediated by a lectin type failed to attach in non-saline conditions (Fig. 17 (a), (b)). hemagglutinin and type II secretion system and tight Further studies are underway to trace the diversity of adherence genes. Other challenges faced by a microbe Flavobacterium members in this complex ecosystem and in the rhizosphere environments is ROS produced by the to confirm the molecular factors involved in this unique plant and competitors. To survive within the oxidative plant-microbe interaction phenomenon. environment in the rhizosphere, strain L3B27 encode for various genes include superoxide dismutase, catalase and peroxidase. In addition, the strain is positive for catalase test. Some of the plant beneficial functions are also identified through genome analysis and are confirmed by phenotypic characterization as well. Plant growth hormone IAA production is one of the major plant growth promoting trait in PGPR strains and strain L3B27 produces IAA which confirmed by Salkowski assay. In complement, genome analysis revealed the presence of a tryptophan independent IAA production pathway. Volatile compounds acetoin and 2,3-butanediol produced by plant associated bacteria are also known to enhance plant growth. Set of genes required for the production Fig. 17: Scanning electron micrographs showing the root attachment of L1I52T in presence of natural seawater after; mild wash (a) and heavy wash (b) and in distilled water after; mild wash (c) and heavy wash
3.4.1b Genome analysis of a novel plant beneficial Sphingomonas A draft genome of a novel plant beneficial Sphingomonas was performed to understand its plant associated lifestyle wherein the genomes of plant associated sphingomnas are poorly documented. The draft genome of L3B27 consists of 18 contigs having genome size of 4223965 bp with N50 of 4171419 bp. The average G+C content of the strain L3B27 was 66.18%, a value which falls within the G+C content range of Sphingomonas strains. Annotation of the genome using RAST server revealed 3885 protein coding sequences, 52 number of tRNA genes, 3 rRNA operons. The draft genome analysis Fig. 18. Genomic representation of the Sphingomonas strain L3B27 shows that the genome encode for various genes related genome. Rings from inside; 1-GC content, Ring 2-GC skew, Ring 3-5 Genomic sequencing identity with genomes of closely related type to their plant association and brackish adaptation (Fig strains of S pituiosa and S azotifigens with Sphingomonas strain L3B27. 1). Chemotaxis, motility and adhesion are the major Figure prepared using BRIG.
40 National Institute for Interdisciplinary Science & Technology Microbial Processes & Technology Division Annual Report 2017-18 of these compounds are identified in the genome. The strain L3B27T has developed various mechanism for efficient uptake of iron from the environment. It includes ferrichrome-iron receptors, iron uptake proteins and TonB dependent receptors. In addition, we have identified a siderophore vibrioferrin biosynthetic cluster, which is a marine type siderophore originally identified from Vibrio parahaemolyticus. Interestingly, vibrioferrin biosynthetic Figure 19: Strain NRK ACT 143 and Molecular structure of cluster not present their closely related strain, suggests Actinomycin D acquisition of the gene cluster from marine environment. the presence of Natural Seawater or Sea salts. From the 16s The strain L3B27 is positive for siderophore test, supports rRNA gene sequence results the strain showed sequence the functionality of the genes. Since L3B27 is isolated similarity with Streptomyces caeruleatus (99.41%), the from a brackish environment, we have analysed genes crude extract has been prepared from the strain mycelia related to osmoregulation. The osmoregulation is free culture filtrate (MFC) in large volume of 75 L and 2.8 mediated by various types of sodium ion channels, g of crude extract was generated. The final purification choline dehydrogenase BetA, high affinity choline uptake of crude compound was achieved through Recycling protein BetT and an aquaporin Z. HPLC, the results obtained from both 1 D and 2D NMR and HRMS showed that this compound is Actinomycin D 3.5. Bioprospecting and taxonomic studies (Fig 19) with the molecular formula of C H N O and of marine microorganisms in search of novel 62 86 12 16 molecular mass of 1255.45. Purification, Characterization anti-infectives. and Identification of molecule was carried out in help Among 600 actinomycetes were screened for antibacterial with Dr. Ravi Shankar, Organic Chemistry Lab, CSTD, CSIR- activity, 56 potential actinomycetes strains which showed NIIST. maximum zone of inhibition against the quality control strains. Out of which 28 strain’s crude antimicrobial Antifungal, antibacterial, anticancer, anti-inflammatory, compound has been extracted by using Ethyl acetate, and anti-angiogenic studies were conducted for all 18 extracts the activity of the each extracts tested at 50 µg/ml. Only sent to CSIR-CDRI, Lucknow. In that 7 extracts are more 18 extracts shown maximum (>20 mm Zone of inhibition) potential and showed antibacterial and anticancer activity. Those 18 crude extracts been sent to CSIR-CDRI activity respectively. All these 18 strains were identified for further analysis. The strain NRK ACT 143 was found as through 16s rRNA gene sequence (Table 6). Further a potential which showed activity with maximum zone of metabolite characterizations of the potential 7 crude inhibition (>25 mm) against S. aureus (MCC 2408) only in extracts were ongoing.
Table 6: CDRI Antibacterial and Anticancer screening report of potential marine actinomycetes:
S.NO Strain ID No Extract code Antibacterial activity Anticancer activity (%) Strain similarity (% of similarity)
NRK Act 060 NRK-NIIST1/C94-S2/E1 <1 µg/ml - Streptomyces pulveraceus (99.42)
NRK Act 114 NRK-NIIST1/C60/C95-S1/E1 <25 µg/ml 94% Streptomyces griseoincarnatus (100)
NRK Act 143 NRK-NIIST1/C71-S1/E1 <1 µg/ml 98% Streptomyces caeruleatus (99.41)
NRK Act 203 NRK-NIIST1/C96-S1/E1 - 94% Streptomyces enissocaesilis (100)
NRK Act 221 NRK-NIIST1/C97-S1/E1 - 99% Streptomyces ghanaensis (99.66)
NRK Act 406 NRK-NIIST1/C99-S1/E1 <1 µg/ml 87% Streptomyces caeruleatus (99.35)
NRK Act 446 NRK-NIIST1/C100-S1/E1 <1 µg/ml 84% Streptomyces parvulus(100)
National Institute for Interdisciplinary Science & Technology 41 Annual Report 2017-18 Chemical Sciences & Technology Division
रसायन वि煍ञन तथा प्र셌饍योगकी प्रभाग रसायन वि煍ञन तथा प्रौ饍योगकी प्रभागंस ्थन के निम्नलिखत तीन प्राथमिक 啍ष配र पर ध्यन कᴂ द섿त कर रहा है : 1. कार्बनक और हाइब섿ड इलेक絍रॉनक् (ऊर्ज उत्पदन और भडारणं , ठोस अवस्थ प्रकाश व्वस्थ, क्रोमोजेनिक कोटिंग् और कम㔪्टेशनलय रसायन वि煍ञन) 2. फ्लरोसᴂट साम嵍र (सर啍ु ष अनप्रु योग, डायग्नोस्क्, इमेजिंग प्रोब् और अल絍रफास् गतिकी) 3. फाइटो फार्मस्ूटय कल् और ड्रगटरमी इं डिएट्स (औषधीय पौधⴂ का जैव मल्ू याकन और उन्त फार्मस्ुटय कल इटरमीं डिएट्स)। इसके अलावा, प्रभाग 饍वरा इन 啍ष配र मᴂ भविष् वि煍ञन और कमता निर्मण का कार् भी करता है। सीएसआईआर की विभिन् विषयगत गतिविधियⴂ मᴂ, अर्थत ् ऊर्ज (पारंपरिक और अपरंपरागत) और ऊर्ज उपकरण, हेल्के यर तथा रसायन मᴂ प्रभाग सक्रिय 셂प से भाग लेता है । इसके अलावा, सीएसआईआर की मिशन मोड परियोजनाओ ंमᴂ तथा हेल्के यर और न्絍य रस्ूटय कल् मिशन के लिए नैनोबायोसᴂसर् और माइक्रोफ्इल डिक् पर प्रभाग प्रमखु भमिू का निभाता है । बड़ संख्य मᴂ विभिन् उ饍यगⴂ और अन् सरकारी एजᴂसियⴂ 饍वरा वित्त पोषित महत्पर्ू परियोजनाओ ं के लिए भी प्रभाग ने पहल की है । उच㔚 प्रभाव कारक के साथ अतरं ्रा絍री स्र पर प्रतिष्त सहकर्-समी啍ष पत्काओ ंमᴂ प्रभाग से इस वर㔷 75 से अधिक प्रकाशन हो चकेु हℂ । वर㔷 2017-18 के दौरान प्रभाग की गतिविधियⴂ और उपलब्धिⴂ की मखु ् विशेषताए ं नीच े दी गई हℂ।
हाइलाइट कार्बनक तथा हाइब섿ड इले啍絍셉निक् $ व्वहार्ता प्रदर्शत करने के लिए विभिन् सᴂसर के साथ विशाल प्रकाश एकतण स्देशी डीएसएससी सौर मॉड्यलू सफलतापर्ू क एकीकृ त किया गया $ िात ु ऑक्सइड के क्रिस्लीय नैनोशीट का उपयोग करके बहुआयामी इलेक絍रोक्रोमक गिलासⴂ का विकास किया, जहां ऑप्टकल मॉड्यलेशनू ऊर्ज भडारणं के साथ जोड़ जा सकता है, जो 饃श् सीमा (600 एनएम पर 63.2%) और अल絍र उच㔚 निकट-आईआर शील्डिग (1200 एनएम पर 77.3% ) पर व्यपक एरियल कैपेसिटᴂस (4 एमएफ / से.मी 2) का प्रदर्न करता है $ कार्न कपड़ पर,एक बाइडर-मं क्तु लचीला पीएएनआई / Fe3O4 नैनो कं पोजिट इलेक絍रड बनाया गया, जो 1V से 0 वी- के एक स्थर पⴂटᴂशल विंडो मᴂ 4000 चार्-डिस्चार चक्र के बाद भी 91% की साइकिल चालन स्थरता बनाए रखते हुए 365 एफ जी -1 की अधिकतम विशिष्ट कमता का प्रदर्न करता है $ सपरु कैपेसिटर् के लिए स्-संयोजन पॉलीएनीलाइन नैनो वयर् से चिपका 嵍रफीन-3-पᴂटा डिसिलफिनाइल फॉस्फ ट संकर नैनोकं पोजिट आधारित हरे टिकाऊ इलेक絍रड विकसित किए गए
$ मिथाइल अमोनियम बिस्थम आयोडाइड (CH3NH3)3Bi2I9, एक लेड-굍र, शनू ्-आयामी संकर पेरोव्स्इट साम嵍र का उपयोग करके एक इलेक絍रके मिकल डबल-लेयर कैपेसिटर फै ब섿केटेड किया गया
42 National Institute for Interdisciplinary Science & Technology Chemical Sciences & Technology Division Annual Report 2017-18
सर啍ु ष अनुप्रयोगⴂ और निदान के लिए फ्लरोसᴂट साम嵍र $ पारस्रिक 셂प से सहायता प्राप्त डीएनएस 絍रड्स के स्त: समच㔚ु य $ एक ठोस अवस्थ कार्बनक उत्सरक 饍वरा विशिष्टमैकनोरेस ्पॉन्व के लिए तथा फु लेरिन नैनोक्स्टर का अर्धालक नैनोवयर् लमिु नेसेन्, थर् क्रोमिसम, वापो क्रोमिसम और क्लरीन गैस मᴂ 셂पांतरण के लिए एक सरल और नई योजना का प्रदर्न किया सᴂसिंग का निदर्न किया गया गया $ लैसोसोम मᴂ Zn2+ और पीएच विविधताओ ं को एक साथ पता • एनआईआर उत्सरन के साथ मैकनोरेस्पॉन्व जेल का विकास लगाने के लिए एक फ्लरोसᴂट अण ु आधारित नैनोप्रोब विकसित कम㔪्टेशनल रसायन वि煍ञन किया गया य • डीएफटी अध्यन के माध्म से गबब् ओलेफिन मेटाथेसिस $ कℂसर स्क्रीनंग के लिए डायग्नोस्क एसईआरएस- नैनोप्रोब उत्प्ररण मᴂ बॉन् खिचं ाव आइसोमेरिज् की घटना का पता लगाया विकसित किया गया गया है $ लक्त दवा वितरण प्रणाली (टीडीडीएस) और थेरोनोस्टक • बᴂजीन और पाइरीडिन व्तय ्न् के सं�लेण के लिए गबब् और नैनोप्रोब का विकास होवेडा-गब उत्प्ररक के लिए पर्ू उत्प्ररक चक्र स्थापत किया गया भविष् वि煍ञन और कमता निर्मा और नई उत्प्ररक डिजाइन रणनीतियॉ प्रस्तावत है $ साइक्ल डेक्सटन की थर्ल नियंत्त चरण-वार रिलीज के लिए • फ्लरिनेटेड सगु ंधित स्क फोल्स के आधार पर नोबल गैस, एक समन्व बहुलक आधारित जेल स�लेषत किया गया ं हाइड्रोजन और नाइ絍रजन को पकड लेने के लिए एक गैर $ सर啍ु ष और फोरᴂसिक अनप्रु योग के लिए एक उपयोगी एनआईआर सहसंयोजक बाध्कारी रणनीति विकसित की फल्र का विकास पादप दवाइयⴂ एवं औषधि मध्वर酀 $ एल्ुमना के सतह सशोधन 饍वरा एक नई सपर हाइड्रोफोबिक य ं ु • क्मता यक्तु जैविक गतिविधि के साथ अणओु ंके प्रति विषम और साम嵍र सजातीय उत्प्ररक परिवर्न $ रकरल π-प्रणाली, जो कोलेजन जैसेछ क बायोपॉलिमर् के ु • नई एटीं कℂसर और एटीबां योटिक लीड की तलाश मᴂ औषधीय समान सपर हेलीकल सरचनाए बनाती है ु ं ं रसायन अनसु ंधान के लिए औषधीय 셂प से प्रासंगिक अणओु ंका $ जैव अण ु के पदानक्रु मित स्- सम्मलन के माध्म से स्थाी सं�लेण जीवाणरोधी अनप्रयोगⴂ के लिए बायोजेल का डिजाइन और ु ु • प्रचरु मा配र मᴂ उपलब् प्राकृ तिक संसाधनⴂ का केमो प्रोफाइलिंग विकास और स्थाी उपयोग: औषधीय पौधⴂ से विविध स्क फोल्स के $ न्रोय ट्रसमीटर का एक साथ संसचू न के लिए पीईडीओटी- लिए रासायनिक 셂प से अलगाव और अर् सिंथेटिक संशोधन टाइटेनिया-पॉली (डाइमिथाइल सिलोक्सन) (पीटीएस) के • मधमेहु और कार्डिोवैस्क लर विकार जैसे जीवन शैली से संबंधित आधार पर लचीला इलेक絍रके मिकल ट्सडयसर विकसित किया र ् ू विकारⴂ के लिए पादप अणओु ं की जैविक जांच। $ सेरोटोनिन का संसचू न के लिए पीईडीओटी- अपचित 嵍रफीन ऑक्सइड-सिल्र संकर नैनो कं पोजिट संशोधित ट्रसड्यसरू विकसित किया
National Institute for Interdisciplinary Science & Technology 43 Annual Report 2017-18 Chemical Sciences & Technology Division
CHEMICAL SCIENCES AND TECHNOLOGY DIVISION
The Chemical Sciences and Technology Division has been focusing on the following three priority areas of the Institute: 1. Organic and Hybrid Electronics (Energy generation and storage, solid state lighting, chromogenic coatings and computational chemistry) 2. Fluorescent materials (Security applications, diagnostics, imaging probes and ultrafast kinetics) 3. Phytopharmaceuticals and Drug Intermediates (Bio-evaluation of medicinal plants and advanced pharmaceutical intermediates). In addition, we work on futuristic sciences and capacity building in such areas. The division actively participates in various thematic activities of CSIR, namely Energy (conventional and nonconventional) and Energy Devices, Healthcare and Chemicals. In addition, the division plays a major role in CSIR Mission Mode projects in Nanobiosensors and Microfluidics for Healthcare Nutraceuticals and Agro Mission. The division is also undertaking a large number of important projects funded by various industries and other government agencies. More than 75 research publications from the division have appeared in internationally reputed peer-reviewed journals with high impact factor. The highlights of the activities and achievements of the division during the year 2017-18 along with brief abstracts of important developments are given below. Highlights Organic & Hybrid Electronics $ Ambient light harvesting indigenous DSSC solar modules have been successfully integrated with various sensors to demonstrate the feasibility $ Developed and demonstrated methods to understand the recombination mechanism in DSSCs using various perturbation techniques $ Synthesized a range of cobalt and copper based alternate redox electrolytes with greater positive - - redox potentials compared to conventional I /I3 for attaining more voltage $ Solution processable carbazole derivatives developed for dopant-free single molecule white electroluminescence by room temperature phosphorescence $ Addressed the efficiency roll-off in a fluorescent OLED by facile electron transport layer doping and carrier confinement $ Attractive thermoelectric performance shown by Solution processable novel TE composites comprising of p-type fused thiophene-based polymers and carbon nanotubes and flexible free
standing films made by combining fused thiophene- based polymers with Bi2Te3 nanoparticles $ Developed multifunctional Electrochromic glasses using crystalline nanosheets of metal oxides where optical modulation can be combined with energy storage, exhibiting high value of areal capacitance (4mF/cm2) with broad optical modulation at visible range (63.2% at 600 nm) and ultra high near-IR shielding (77.3% at 1200 nm) $ Demonstrated dual electrochromic (transmissive-to-black) and electrofluorochromic (greenish
44 National Institute for Interdisciplinary Science & Technology Chemical Sciences & Technology Division Annual Report 2017-18
yellow-to-dark) response of a solution processable, $ Development of an NIR filter useful for security and electrochemically stable cross-linked polymer forensic application $ Electrode materials for supercapacitors were made $ A new superhydrophobic material by the surface using Fe3O4 and Zn-doped Fe3O4 (Zn/Fe3O4) modification of alumina nanoparticles by a simple co-precipitation method $ Chiral π-system that forms super helical structures $ A binder-free flexible PANI/Fe3O4 nanocomposite similar to certain biopolymers such as collagen. electrode was fabricated over carbon cloth, exhibiting $ Designed and developed Biogel through hierarchical a maximum specific capacitance of 365 F g-1 retaining self-organisation of biomolecule for sustainable a cycling stability of 91% even after 4000 charge- antibacterial applications discharge cycles in a stable potential window from -1V to 0 V $ Flexible electrochemical transducers based on PEDOT- titania-poly(dimethylsiloxane) (PTS) for simultaneous $ Self-assembled polyaniline nanowires stippled detection of neurotransmitters developed graphene-3-pentadecylphenyl phosphate hybrid nanocomposite based green sustainable electrodes $ PEDOT-reduced graphene oxide-silver hybrid developed for supercapacitors nanocomposite modified transducer developed for $ Fabricated an electrochemical double-layer the detection of serotonin capacitor using methylammoniumbismuthiodide $ Demonstrated a simple and new strategy for the (CH3NH3)3Bi2I9, a lead-free, zero-dimensional hybrid mutually assisted self-assembly of DNA strands and perovskite material fullerene nanoclusters into semiconducting nanowires Fluorescent Materials for Security $ Development of mechanoresponsive gel with NIR Applications and Diagnostics emission $ Demonstrated that confining a large number of Computational Chemistry fluorophores in a small volume can result in their high $ The phenomenon of bond stretch isomerism in local concentration and concerted emission from the Grubbs olefin metathesis catalysis is discovered organic-inorganic hybrid fluorophore ensemble which through DFT studies can be further amplified by Forster Resonance Energy Transfer $ Full catalytic cycles for Grubbs and Hoveyda-Grubbs catalysts for benzene and pyridine derivative synthesis Heat-induced interconversion of molecular packing $ have been established and proposed new catalyst in acceptor–donor–acceptor type divinylbenzene design strategies derivatives and related luminescence shift studied $ A noncovalent binding strategy to capture noble Demonstrated distinct mechanoresponsive $ gases, hydrogen and nitrogen is developed based on luminescence, thermochromism, vapochromism, and fluorinated aromatic scaffolds chlorine gas sensing by a solid-state organic emitter $ Developed a fluorescent molecule based nanoprobes Phytopharmaceuticals and Drug Intermediates to simultaneously detect Zn2+ and pH variations in $ Heterogeneous and homogeneous catalytic lysosome transformations towards molecules with potential $ Development of Diagnostic SERS-Nanoprobe for biological activity cancer screening $ Synthesis of pharmaceutically relevant molecules $ Targeted drug delivery system (TDDS) and theranostic for medicinal chemistry research in search for new nanoprobe development anticancer and antibiotic leads $ Chemoprofiling and sustainable utilization Futuristics and Capacity Building of abundant natural resources: Isolation and A coordination polymer based gel for the thermally $ semisynthetic modifications for chemically diverse controlled step-wise release of cyclodextrins was scaffolds from medicinal plants synthesised
National Institute for Interdisciplinary Science & Technology 45 Annual Report 2017-18 Chemical Sciences & Technology Division
$ Biological screening of phytomolecules for life style investigate in detail the effect of structural variations and related disorders such as diabetes and cardiovascular steric hindrance of organic triphenylamine dyes which disorders differs in the number and nature of binding groups and The details of research in each of the above areas are peripheral hole accepting units on the recombination given below. reactions and mass transport variations employing two different cobalt electrolytes [Co(bpy)3]3+/2+ and Organic and Hybrid Electronics [Co(phen)3]3+/2+ having variable driving force for Photovoltaics & Lighting recombination. The detailed photovoltaic analysis gives Renewable Energy Activities at Chemical Sciences and us the information that modification of the architecture Technology Division are now linked to the Energy theme of organic dyes plays a decisive role in determining of CSIR and comprise of research activities in the areas the performance, in particular, employing along with of Dye-Sensitized Solar Cells (DSSCs) and Organic Light alternate one electron outer sphere redox systems. From Emitting Devices (OLEDs). Major research outputs are our analysis, for both the dyes the charge recombination given below. with the oxidized cobalt species was found to happen in the Marcus normal region which is attributed to the Photovoltaics shift in conduction band (CB) which influenced the Probing Recombination Mechanism and Realization driving force for recombination. The current observation of Marcus Normal Region Behavior in DSSCs was quite exciting since it was documented before Employing Cobalt Electrolytes and Triphenylamine that both the redox systems have shown to exhibit Dyes Marcus inverted recombination behavior. The impact of structural variations of dyes, change in conduction band, effect of nature of electrolyte species and its interaction with semiconductor on the recombination reactions was explored in detail using a range of small and large perturbation techniques. A detailed evaluation of charge recombination dynamics in dye solar cells based on starburst triphenylamine dyes Understanding the charge transfer dynamics in dye solar cells (DSSCs) is imperative for the development of highly efficient devices. The loss in photocurrent due to recombination can be alleviated by removing holes formed in the oxidized dye molecules away from TiO2 surface and also by preventing the approach of the oxidized species in the electrolyte coming near to Cobalt-based outer sphere one electron redox shuttles the semiconductor. Focusing on elucidating these two represent an exciting class of alternative electrolyte to parameters we fabricated I-/I3- electrolyte based dye be used in dye-sensitized solar cells. The flexibility of solar cells with two novel branched propeller shaped redox potential tuning by varying the substituents on triphenylamine dyes TPAA4 and TPAA5 with broader peripheral organic ligands renders them the advantage of absorption and higher molar extinction coefficient, which achieving higher photovoltage. But higher recombination showed power conversion efficiencies of 6.52% and experienced in these systems by employing diffusion 4.60% respectively. The bulkiness of the co-donor along limited cobalt species prevents attaining higher with the triple bond bridges provided further rigidity to photovoltage. The focus of this work is to systematically the structure, thereby reducing aggregation of the dyes
46 National Institute for Interdisciplinary Science & Technology Chemical Sciences & Technology Division Annual Report 2017-18
Organic Light Emitting Diodes Solution processable carbazole derivatives developed for dopant free single molecule white electroluminescence by room temperature phosphorescence White electroluminescence from a single molecule is a challenging topic in organic light emitting diode (OLED) research. Herein, we report the white light emission from a carbazole derivative, 9-ethyl-3,6-bis(4-(trifluoromethyl) phenyl)-carbazole (Cz(PhCF3)2), by harvesting both singlet and triplet emissions. The blue fluorescence and a broad emission from room temperature phosphorescence resulted in white light electroluminescence (EL) with a colour coordinate of (0.31, 0.44). We successfully synthesized another molecule namely 1,1'-(4,4'-(9-ethyl- 9H-carbazole-3,6-diyl)bis(4,1-phenylene))diethanone on the TiO2 surface. Both the dyes were structurally Cz(PhBz)2 and achieved a four-fold increase in the engineered in such a way to avoid the recombination of efficiency of the EL with a substitution change from −Ph- electrons from TiO2. Detailed charge transfer dynamics CF3 to −Ph-CO-Ph with a colour coordinate of (0.29.0.35). of the devices were studied by employing extensive The present route for the generation of white light perturbation techniques such as electrochemical emission from a solution processable single organic impedance spectroscopy (EIS), charge extraction (CE) and molecule utilizing both singlet and triplet excitons offers intensity-modulated photovoltage spectroscopy (IMVS). a promising way to improve the efficiency of future white Enhancement of the photovoltaic performance OLEDs. in D3A porphyrin-based DSSCs by incorporating an electron withdrawing triazole spacer In this study, we report the preparation of two novel zinc- porphyrin derivatives (ZnP-3DoH-click-CNCOOH and ZnP-3DoH-click-COOH) and two reference compounds (ZnP-3DoH-CNCOOH and ZnP-3DoH-COOH) as sensitizers in DSSCs. The photo-physical and electrochemical measurements along with the computational studies suggest that the four synthesized porphyrin derivatives exhibit appropriate light absorption characteristics as well as suitable molecular orbital levels for their use as sensitizers in DSCs. Following this strategy, four fold and eight fold increase of the device performance was Addressing the efficiency roll-off in a observed regarding ZnP-3DoH-click-CNCOOH and ZnP- fluorescent OLED by facile electron transport 3DoH-click-COOH, respectively, when compared to the layer doping and carrier confinement efficiencies achieved with the reference compounds Organic light emitting diodes (OLEDs) often face the issue (ZnP-3DoH-COOH and ZnP-3DoH-CNCOOH). A more of decreasing power efficiency with increasing brightness. detailed interpretation of the charge dynamics in these Loss of charge carrier balance is one of the factors devices was carried out using charge extraction (CE) and contributing to the efficiency roll-off. We demonstrate open-circuit voltage decay (OCVD) measurements. that by using a combination of doped electron transport
National Institute for Interdisciplinary Science & Technology 47 Annual Report 2017-18 Chemical Sciences & Technology Division
layer (ETL) and a specially chosen electron blocking layer (EBL) having high hole mobility, this efficiency roll-off can be effectively suppressed. A tris-(8-hydroxyquinoline) aluminium (Alq3) based OLED has been fabricated with 2,3,6,7-Tetrahydro-1,1,7,7,-tetramethyl-1H, 5H,11H-10- (2-benzothiazolyl) quinolizino-[9,9a, 1n gh]coumarin (C545T) as the emissive dopant. Bulk doping of the ETL Photographs of free standing TE films with lithium fluoride (LiF) was optimized to increase the skills were needed to be developed from the ground- luminous intensity as well as the current efficiency. An up for addressing the essential factors like adopting a EBL with high hole mobility introduced between the materials/device fabrication scheme with better batch EML and the hole transport layer (HTL) improved the reproducibility, innovation in device design to maximize performance drastically, and the device brightness at power conversion and finding the right interconnects for 9 V got improved by a factor of 2.5 compared to that of a low loss transport. the control device. While increasing the brightness from Initially, an action plan was established where we 2 2 100 cd/m to 1000 cd/m , the power efficiency drop was explored a three-point strategy to develop the hybrid TE 47% for the control device whereas only a drop of 15% nanocomposites that led to some novel TE composites was observed for the modified device. comprising of p-type fused thiophene-based polymers and Thermoelectric Materials and Devices carbon nanotubes. The composites display encouraging thermoelectric performance. Additionally, we fabricated Fused thiophene based thermoelectric flexible free standing films by combining fused thiophene- materials for energy generation/refrigeration based polymers with Bi2Te3 nanoparticles. Both p and This is a major energy R&D activity that got the full n-type legs could be fabricated using this process. The funding support from the Gas Authority of India Ltd. identified p-type composites from strategy-II have been (GAIL). Polymer nanocomposite based thermoelectric modified by doping with inorganic oxidising agent that (TE) materials are a new class of functional materials that increases both electrical conductivity and Seebeck have immense potential for waste heat utilization, power coefficient due to the overlap of Fermi energy with the generation and micro-refrigeration at a commercial valance band. For doped PBDTT-FTTE:45wt% MWCNT at scale. Devices based on these materials typically operate T=300K, the electrical conductivity is increased 6.68 times < 350 °C and could be used for on-the-spot sustainable than the undopednanocomposite. The highest power power generation from thermal sources like hot water factor and ZT value obtained till date stands at 48.21 released by process plants, automotive exhausts, and µW/m.K2 and 0.08 respectively. Several prototypes of the even human/mammal body heat. The R&D is intended miniaturized in-plane TEGs have been fabricated and the to generate relevant knowhow about the fabrication and output power has been analyzed (TRL-4). All developed implementation of these devices. Additionally, specialized nanocomposites were completely solution processable, making the TE device fabrication compatible with printing/dispensing technique. This should lead to the realization of flexible TE devices for easy implementation and installation.
(a) Schematic diagram of the experimental set-up (b) Image of measurement set-up
48 National Institute for Interdisciplinary Science & Technology Chemical Sciences & Technology Division Annual Report 2017-18
A phase-II of the project is sanctioned to promote direct growth of active materials over carbon cloth. The these outputs to TRL-6 level leading to full scale carbon cloth substrate, with its three-dimensional porous commercialization. structure, provides more electrolyte accessibility and acts Energy Storage as an effective conductive pathway for efficient electrical transport between the active materials and the current Improvement in the electrochemical performance of collector. The PANI/Fe3O4nanocomposite electrode Fe3O4 nanoparticles by Zn doping exhibits a maximum specific capacitance of 365 F g-1 in In the present study, we report the synthesis of Fe3O4 and a stable potential window ranging from -1V to 0 V. Also it retains a cycling stability of 91% even after 4000 charge- Zn-doped Fe3O4 (Zn/Fe3O4) nanoparticles by a simple co-precipitation method. The morphology, structure and discharge cycles at a constant current density of 5 A g-1. optical properties of the samples are characterized by These results indicate that PANI/Fe3O4 nanocomposite Transmission Electron Microscopy (TEM), X-ray Diffraction, electrode has a significant potential as an inexpensive UV-visible spectroscopy, Fourier transform infrared anode for future electrochemical energy storage systems. spectroscopy (FTIR), energy dispersive spectroscopy Self-assembled polyaniline nanowires stippled graphene- (EDS) and UV-visible spectroscopy. 3-pentadecylphenyl phosphate hybrid nanocomposite The electrochemical energy storage and photocatalytic based green sustainable electrodes for supercapacitors properties of the nanoparticles are studied in detail, and the results are discussed. The electrochemical energy storage performances of the nanoparticles are tested in a symmetric two-electrode configuration, and the measurement demonstrated that Zn doping nearly doubles the energy storage properties of the
Fe3O4 nanoparticles. The study of the photocatalytic degradation of methyl blue (MB) dye under UV irradiation in the presence of pure and doped Fe3O4 nanoparticles reveals that both nanoparticles act as ideal catalysts for degradation of MB dye.
Conductive polymers have been extensively studied in supercapacitors since they are having excellent pseudocapacitive behaviour, light weight, flexible and easy processability. However its low cyclic stability limits its applications as supercapacitors.20-21 Among the conductive polymers such as polyaniline (PANI), polypyrrole, polythiophene and their derivatives, PANI is considered the most promising material because of its high capacitive characteristics, low cost, simple preparation and environmental stability.22-24 Thus, the combination Development of a High-Performance Flexible of conducting polymer intercalated graphene layers Supercapacitor Anode Based On Polyaniline/Fe O 3 4 are expected to exhibit excellent electrical conductivity, Composite @ Carbon Cloth good surface area and cycling stability and anticipated Herein, we report for the first time, the synthesis of a to exhibit high performance as cathode for double layer binder-free flexible Polyaniline (PANI) and Iron Oxide supercapacitors. Self-assembled polyaniline nanowires
(Fe3O4) nanocomposite (PANI/Fe3O4) electrode by the stippled graphene-3-PDPPnanocomposite (PGPC) was
National Institute for Interdisciplinary Science & Technology 49 Annual Report 2017-18 Chemical Sciences & Technology Division
prepared by in-situ polymerisation of aniline in presence high surface area for the electrolyte to access. As a result, of 3-pentadecylphenol phosphate (3-PDPP) modified the charge transport resistance is reasonably low, which graphene sheets.3-PDPP is a amphiphilic dopant is advantageous for delivering excellent performance. derivative of cardanol which is obtained as a by-product from cashew industry. 3-PDPP serves multifunctional Multifunctional chromogenic devices role as liquid crystalline template, surfactant and dopant In the industrialized countries, people spend ~80% of during the formation of PGPC hybrid nanocomposite their time in the indoors, mostly in buildings and vehicles. which is manifested from the studies made by XRD, The developing countries would also plunge on the FTIR morphology and electrical conductivity. The formed same trend with the advancing industrial growth. About PGPC were further characterised for pore volume, BET 30-40% of world’s primary energy is used for providing a surface area, TGA, electrical conductivity (2.3 x 10-3 S/cm) comfortable indoor environment, out of which >30% is and electrochemical stability. Further,supercapacitors wasted due to inefficient windows. We initiated a research were fabricated with configuration (ITO-PGPC/Na SO / 2 4 program to develop low-cost smart windows that can cut PGPC-ITO) and measured optimal specific capacitance down the radiation losses (Intelligent coatings, 12th FYP). (181.99 F/g) and energy density (58.23 Wh/kg) and cycling In addition, these tunable glasses are widely used for stability (> 2000) constructing smart mirror and energy efficient displays. Zero-dimensional methylammonium bismuth During this program, our research group developed a iodide-based lead-free perovskite capacitor variety of nanomaterials based electrochromic systems, Symmetrical electrochemical capacitors are attracting which are highly efficient and compatible/better than immense attention because of their fast charging− the current state of the art. The devices we developed till discharging ability, high energy density, and low cost of now, have the advantages that are matching the industry production. The current research in this area is mainly requirements, focused on exploring novel low-cost electrode materials Cheap and scalable processing with higher energy and power densities. In the present High modulation of light throughput (better than the work, we fabricated an electrochemical double-layer current state of art/standard imported device)- We capacitor using methylammoniumbismuthiodide attained a high "effective" coloration efficiency of 210 (CH NH ) Bi I , a lead-free, zero-dimensional hybrid 3 3 3 2 9 cm2/C at 600 nm wavelength for WO3 based devices perovskite material. A maximum areal capacitance of (>highest reported) 5.5 mF/cm2 was obtained, and the device retained 84.8% of its initial maximum capacitance even after 10000 High switching speed (better than SOA/standard charge−discharge cycles. Impedance spectroscopy imported device) measurements revealed that the active layer provides a Uniformity of coating Good cycling performance In addition, we developed multifunctional EC glasses where smart function of optical modulation can be combined with energy storage. We fabricated a single active layer asymmetric transparent multifunctional smart device (MFSD) using crystalline nanosheets of metal oxides. This device can block near- infrared and visible spectrum by varying the applied potential upto -2.8 V. The MFSD showeda high value of areal capacitance (4mF/ cm2) and in situ transmittance measurements proved its remarkable electrochromic function with broad optical
50 National Institute for Interdisciplinary Science & Technology Chemical Sciences & Technology Division Annual Report 2017-18 modulation at the visible range (63.2% at 600 nm) and electrofluorochromic dual behavior. The electrochromic ultra high near-IR shielding (77.3% at 1200 nm). The device polymer switches between a highly transmissive, light exhibited high coloration efficiency (97.8 cm2/C at 900 yellow colored neutral state (L*= 97, a*= -5, b*= 16) and nm) and excellent cycling stability (sustaining the similar a black coloured oxidized state (L*= 41, a*= 2, b*= 8) with optical modulation after 1000 cycles as an electrochromic high optical contrasts (up to 50%∆T) and reasonably low device and retaining ≈ 87% of its initial capacitance after switching times (<10 s) were demonstrated over 1500 1000 continuous cycles). cycles using a basic electrochromic device design [FTO/ EC layer/ gel electrolyte/ FTO]. Synthetic accessibility through simple routes, solution processability and favorableelectrochromic switching parameters render these electrochromic materials as potential candidates for both smart window and signage applications. Switching and UV-Vis-NIR through put of a MFSD. The stored charge can be functional for providing input power to a Fluorescent materials for security and different device (in this case lighting up a LED diagnostics and imaging probes Tetraphenylethene-diphenylamine based dual Reversible Switching of Solid-State Luminescence by electrochromic and electrofluoro-chromic Heat-Induced Interconversion of Molecular Packing devices Dynamic switching of solid-sate luminescence with Electrochromic (EC) materials, which exhibit reversible high contrast and reproducibility is a challenging task change in their optical properties by electrochemical but important for several optoelectronic applications. redox reactions, have been extensively investigated due One promising approach towards this end is to control to their potential applications in multicolor displays, the mode of solid-state packing of luminescent smart windows, camouflage materials, E-paper, organic chromophores with an external stimulus. sunglasses, switchable rear-view mirrors etc. A major Herein, we present the heat-induced interconversion challenge in the design of electrochromic materials of molecular packing in acceptor–donor–accept or for automotive and building applications is their color type divinylbenzene derivatives. This interconversion is tuning to achieve aesthetically pleasing color states. associated with the switching of solid-state luminescence Though multicolorelectrochromism is desirable for from red to greenish-yellow (Δλ = 95 nm). A detailed display applications, neutral shades such as gray and investigation of the photophysical properties provided black are favored for smart window, rear view mirror, molecular and supramolecular level comprehension ophthalmic and signage applications. Obtaining of the factors guiding the luminescence switching. The gray/black electrochromic coloration either in the transition between different packing modes is associated neutral or in the redox states of organic EC materials with a highly transmissive complementary state is a challenging problem and is often achieved through strategies such as mixing and/or co-polymerization of multicolorelectrochromic components. A major reason for this is the lack of identified single component, organic electrochromic materials with redox states having absorption throughout the visible region. Herein, we reported cross-linkable, diphenylamine- tetraphenylethene derivative (TPOSt) with terminal styryl units, that can form stable electrochromic polymer films on conducting electrodes and exhibits transmissive- to-black electrochromic and fluorescent- to-dark
National Institute for Interdisciplinary Science & Technology 51 Annual Report 2017-18 Chemical Sciences & Technology Division
with differential excited state coupling and excitation energy migration efficiencies due to the variance in the chromophore organization. Viewed more broadly, our findings illustrate that subtle control over energy migration processes in molecular assemblies by heating may result in functional organic materials with switchable luminescence. Polymorphism in Sn(IV)- Tetrapyridyl Porphyrins with Halogenated Axial Ligand: Structural, Photophysical, and Morphological Study
bio-imaging possible with low cost and benchtop instruments which reduces overall cost of analysis. In principle, the brightness is directly proportional to the number of fluorophores in the observer volume. In the present work, a new model for the preparation of brightly In this study, we report the first example of polymorphic fluorescent material has been demonstrated through an Sn(IV)-tetrapyridylporphyrins axially armed with halogen organic-inorganic hybrid nanoparticle approach. Initially, (Cl, Br)-substituted carboxyphenyl ligands (structural spherical and highly fluorescent organic nanoparticles
formula [Sn(tPyP)2+(A−)2], where A is the axial ligand = (FONPs, Φf = 0.38) were prepared by self-organisation 3,5-dichloro/dibromo benzoic acid). The two polymorphs of oligo(phenyleneethynylene) (OPE) molecules. of chloro-substituted Sn(IV)-tetrapyridylporphyrin (1α This organic core was then decorated with a shell of and 1β) displaydistinctphotophysical and morphological fluorescent CdSe/ZnS core-shell quantum dots (QDs) properties in the solid state. X-ray diffraction study (
52 National Institute for Interdisciplinary Science & Technology Chemical Sciences & Technology Division Annual Report 2017-18 pH Controlled Nanoparticles Formation and Tracking of Lysosomal Zinc Ions in Cancer Cells by Fluorescent Carbazole–Bipyridine Conjugates Fluorescent probes for simultaneous detection of multiple organelle specific analytes in cancer cells are essential for bioimaging applications. During the cellular abnormalities, among others important parameters (reactive oxygen species (ROS), enzymes, etc.) pH and Zn2+ are also altered in cells.We report the formation of nanoparticles of the fluorescent molecule CBL2 and its use as nanoprobes to simultaneously detect Zn2+ and pH variations in lysosome. Upon increasing the pH from 4-6, these probe form nanoparticles with increased size and enhanced fluorescence.Nanoparticles of CBL2 upon Zn2+ binding, exhibit pH responsive intensity change state quantum yield (0.90), singlet oxygen generation only at lysosomal pH window of 4-6 in the far red region quantum yield (0.71 at pH 4) and long life time (1.47µs). at 610 nm and becomes silent above pH 7. Fluorescent Interestingly, Ir-Bp-Ly localized mostly in the lysosome imaging experiments on cancer cells revealed that the because of the presence of morpholine units, suggesting CBL2nanoprobe is capable of localizing at lysosomes its potential as a lyso-tracker. Ir-Bp-Ly displayed notable and facilitates the detection of endogenous Zn2+ and PDT effect in C6 glioma cells, as these PS efficiently pH variations. Furthermore, the lysosomal Zn2+ variation generated ROS owing to the close proximity energy levels with external stimuli induced programmed cell death was between triplet energy states of Ir-Bp-Ly and molecular effectively tracked using the nanoprobe. 3 oxygen ( O2). The mechanism of cell death was studied through caspase-3/7 and flow cytometry analysis that clearly established the apoptotic pathway. Unveiling NIR Aza-Boron-Dipyrromethene (BODIPY) Dyes as Raman Probes: Surface- Enhanced Raman Scattering (SERS) - Guided Selective Detection and Imaging of Human Cancer Cells The development of new Raman reporters has attracted immense attention in diagnostic research based on surface enhanced Raman scattering (SERS) techniques, A CyclometalatedIr(III) Complex as Lysosome Targeted Photodynamic Therapeutic Agent for Integrated Imaging and which is a well-established method for ultrasensitive Therapy in Cancer Cells detection through molecular fingerprinting and imaging. Organelle targeted photosensitizers (PSs) having We unveiled for the first time, a set of six efficient Raman luminescence properties are potential theranostic active aza-BODIPY dyes and their distinctive attribution agents for simultaneous luminescence imaging and could be extended at the molecular level detection photodynamic therapy. Herein, we report a water soluble through SERS techniques upon adsorption onto nano- luminescent cyclometalatedIr(III) complex, Ir-Bp-Ly as roughened gold surface. Among the newly revealed lysosome targeted theranostic probe. Ir-Bp-Ly exhibits Raman reporters, the amino substituted derivative 4 exceptional photophysical properties of good triplet showed high signal intensity at very low concentrations
National Institute for Interdisciplinary Science & Technology 53 Annual Report 2017-18 Chemical Sciences & Technology Division
(ca. 0.4 mm for 4-Au). Interestingly, an efficient nanoprobe correlation to experimental data on the structures, has been constructed by using gold nanoparticles as properties, and reactive behavior of chemicals. NIIST SERS substrate, and 4 as the Raman reporter (4-Au@ activities in this area are focused on the simulation PEG), which unexpectedly showed efficient recognition of homogeneous organometallic catalytic systems, of three human cancer cells (lung: A549, cervical: HeLa, optoelectronic systems, and functional organic molecules Fibrosarcoma: HT-1080) without any specific surface and reactions using abintio quantum mechanical (QM) marker. We observed well reflected and resolved Raman and density functional theory (DFT) based methods. mapping and characteristic signature peaks whereas, such recognition was not observed in normal fibroblast Bond Stretch Isomerism (BSI). The phenomenon of (3T3L1) cells. To confirm these findings, a SERS nanoprobe existence of molecules in two isomers differing only in was conjugated with a specific tumor targeting marker, certain bond lengths is termed as BSI. Many BSI systems EGFR (Epidermal Growth Factor Receptor), a well-known known in the literature are hypothetical models, and targeted agent for human Fibrosarcoma (HT1080). only a few are known characterized by crystallography This nanoprobe efficiently targeted the surface marker techniques. A truly organometallic complex showing of HT1080 cells, there by demonstrating its use as an BSI due to metal-carbon bond length changes is ultrasensitive Raman probe for detection and targeted never reported in the literature. Our DFT studies on the imaging, leaving normal cells unaffected. dissociative and associative mechanisms of Grubbs first and second generation olefin metathesis catalysis revealed that ruthenacyclobutane intermediate (BSI- 1) observed in the celebrated Chauvin mechanism is not unique as it can change to a non-metathetic ruthenacyclobutane (BSI-2) via the phenomenon of bond
stretch isomerism. BSI-1 and BSI-2 differ mainly in RuCα,
RuCβ, and CαCβ bond lengths of the metallacycle. BSI-1 is metathesis active due to agostic bonding-assisted
imultaneous activation of both CαCβ bonds, giving
hypercoordinate character to Cβ whereas absence of such bonding interactions in BSI-2 leads to normal CC single bond distances and metathesis inactivity. The new mechanistic insights provided a strong basis for the use of bulky phosphine and N-heterocyclic carbene ligands in Grubbs catalyst design as this strategy promotes ligand dissociation and the formation of more stable BSI-1 than BSI-2. The study lifts the status of BSI from a concept of largely theoretical interest to a phenomenon of intense A) Schematic representation of the targeted SERS importance to describe an eminent catalytic reaction. imaging using aza-BODIPY attached to NPs. B) Structures of the halogenated (first row) and N-substituted (second row) aza-BODIPY derivatives 1–6.
Computational Chemistry Research Computational chemistry is the branch of chemistry that simulate the behavior of chemical systems on a computer with the equations of quantum and classical physics. The information generated from simulation shows strong BSI-1 BSI-2
54 National Institute for Interdisciplinary Science & Technology Chemical Sciences & Technology Division Annual Report 2017-18
A noncovalent binding strategy: Fluorinated and non- within a quasi-solid state. The work demonstrated may fluorinated aromatic scaffolds have been designed pave the way towards thermally controlled delivery to capture noble gases, H2 and N2 by maximising and monitoring of otherwise spectroscopically silent noncovalent interaction in them. These scaffolds made molecules such as cyclodextrins. with two-, three-, four- and five-fluorinated benzene cores, linked with methelene units viz. RI, RII, RIII and RIV as well as the corresponding non-fluorinated hydrocarbons viz. RIH, RIIH, RIIIH and RIVH showed a steady and significant increase in binding energy (Eint) with increase in the number of aromatic rings in the receptor. A stabilizing “cage effect” is observed in the cyclophane type receptors
RIV and RIVH which is 26–48% of total Eint for all except the larger sized Kr, Xe and N2 complexes. The Eint of the cage receptors is one of the highest interaction energy ranges The Helix to Super-Helix Transition in the reported for noble gases, H2 and N2 for a neutral carbon Self-Assembly of π-Systems: Superseding of framework. Synthesis of such systems is promising in the Molecular Chirality at Hierarchical Level study of molecules in confined environment. Higher-order super-helical structures derived from biological molecules are known to evolve through opposite coiling of the initial helical fibers, as seen in collagen protein. A similar phenomenon is observed in a π-system self-assembly of chiral oligo(phenyleneethylene) derivatives (S)-1 and (R)-1 that explains the unequal formation of both left- and right- handed helices from molecule having a specific chiral center. Concentration- and temperature-dependent circular dichroism and UV/Vis spectroscopic studies revealed that the initial R …Ar R …H IVH IVH 2 formation of helical aggregates is in accordance with Futuristics and Capacity Building the molecular chirality. At the next level of hierarchical self-assembly, coiling of the fibers occurs with opposite Stepwise Control of Host–Guest Interaction Using a handedness, thereby superseding the command of Coordination Polymer Gel the molecular chirality. This was confirmed by solvent- Precise control of host–guest interaction as seen dependent decoiling of super-helical structures and in biological processes is difficult to achieve with concentration-dependent morphological analysis. artificial systems. In this work, we have exploited the thermodynamic benefits of a system in equilibrium to achieve controlled stepwise release and capture of cyclodextrin (guest) using a coordination polymer (Mg- CP) as the host and temperature as the stimulus. Since temperature is not a precision stimulus for artificial host– guest interaction, the present system is a distinct prototype that manifests temperature-controlled natural host– guest interaction. The described coordination polymeric host system, when incorporated into a hydrogel matrix, provides a microenvironment that facilitates the stepwise release of α-CD in response to temperature variation
National Institute for Interdisciplinary Science & Technology 55 Annual Report 2017-18 Chemical Sciences & Technology Division
Creation of “Rose Petal” and “Lotus Leaf” are important requirements from the safety view points. Effects on Alumina by Surface Functionalization These are possible by using camera fitted with near and Metal-Ion Coordination infrared (NIR) transparent filters. Currently available NIR Functional differences between superhydrophobic filters are based on inorganic materials that are expensive surfaces, such as lotus leaf and rose petals, are due to the and brittle. We have developed a supramolecular dye subtle architectural features created by nature. Mimicry based nanocomposite as NIR transparent filter that has of these surfaces with synthetic molecules continues to very good UV-Vis light cut-off ability and flexibility. This be fascinating as well as challenging. In this work, we filter can be fitted with commercially available camera demonstrate how inherently hydrophilic alumina surface for night vision photography, reading hidden information can be modified to give two distinct superhydrophobic and barcodes and also for viewing blood-stain on dark behaviors. Functionalization of alumina with an organic fabrics. ligand resulted in a rose-petal-like surface (water pinning) An Unprecedented Amplification of Near- with a contact angle of 145° and a high contact angle Infrared (NIR) Emission in a Bodipy Derived hysteresis (69°). Subsequent interaction of the ligand with π-System by Stress or Gelation Zn2+ resulted in a lotus-leaf-like surface with water rolling NIR emitting small organic molecules are relatively rare behavior owing to high contact angle (165°) and low- when compared to UV-Vis light emitting molecules, contact-angle-hysteresis (2°). In both cases, coating of however they are important in the fields of materials an aromatic bis-aldehyde with alkoxy chain substituents and biology. In this work, we report an unprecedented was necessary to emulate the nanowaxycuticular feature strategy to generate and amplify near-infrared emission in of natural superhydrophobic materials. an organic chromophore by mechanical stress or gelation pathways. A greenish-yellow emitting film of π-extended Bodipy-1, obtained from n-decane, became orange-red upon mechanical shearing, with a 15-fold enhancement in NIR emission at 738 nm. Alternatively, a DMSO gel of Bodipy-1 exhibited a 7-fold enhancement in NIR emission at 748 nm with a change in emission color from yellow to A Supramolecular Nanocomposite as a Near- orange-red upon drying. The reason for the amplified NIR Infrared-Transmitting Optical Filter for Security emission in both cases is established from the difference and Forensic Applications in chromophore packing, by single crystal analysis of a Seeing an object under dark, hiding an information from model compound (Bodipy-2), which also exhibited a near naked eye but can be seen with a special device or spotting identical emission spectrum with red to NIR emission (742 a blood stain on a dark fabric obtained from a crime site nm). Comparison of the emission features and WAXS and FT-IR data of the sheared n-decane film and the DMSO xerogel with the single crystal data supports a head-to- tail slipped arrangement driven by the N–H/F–B bonding in the sheared or xerogel states, which facilitates strong exciton coupling and the resultant NIR emission.
56 National Institute for Interdisciplinary Science & Technology Chemical Sciences & Technology Division Annual Report 2017-18
Design and Development of Biogel through Fullerene Cluster Assisted Self-Assembly Hierarchical Self-Organisation of Biomolecule of Short DNA Strands into Semiconducting for Sustainable Antibacterial Applications Nanowires This work describes the design and development DNA nanotechnology has expanded over the last two of biogel (PPG) through self-organisation of 3- decades to incorporate strategies to harness the sequence pentadecylphenoxirane grafted polyglucopyranose programmability of DNA for the construction of hierarchical and demonstration of its antimicrobial applications. nanostructures and subsequent use to organize functional 3-pentadecylphenoxirane (PO) is an epoxy derivative motifs in an ordered fashion.Of several nanostructures of 3-pentadecylphenol which is prepared from cashew nut shell liquid, an industrial waste of cashew industry. Polyglucopyranose (PG) is isolated from abundantly available under utlilised jackfruit seed starch. During grafting epoxy converted to hydroxyl group and the grafted molecule is endowed with large number of hydroxyl group, aromatic ring and long hydrocarbon chain which undergo supramolecular organized structures through various noncovalent interactions such as electrostatic layer by layer assembling (ESLBL) interactions, π- π interactions and van der Waals interactions to form columnar and lamellar phases which are confirmed by microscopy, rheology and XRD. developed, DNA-based 1D nanowires are anticipated to Later demonstrated its antimicrobial screening studies be pertinent materials for smart connections between against Gram positive and Gram negative bacteria and metal electrodes in nanodevices. Herein, we report a dose and time dependent activity of the hydrogels. ROS simple and general strategy, in which nanoclusters of production is also done to determine the antibacterial a fullerene derivative act as stapler motifs in bringing activity of PPG. This developed design strategy can be ordered nanoscale assembly of short oligonucleotide exploited for generating macroscopically self-organised duplexes into micrometer-sized nanowires. The optimum biogel systems from small biomolecules for futuristic cluster size, availability of DNA anchoring motifs and high performing multifunctional applications. A plausible the nature of the DNA strands controls the structure of mechanism for the formation of various self-organised these nanomaterials.For the construction of appropriate- structures were proposed from the studies made from sized nanoclusters, we have designed three fullerene FTIR, PLM, XRD and rheology and are shown in Figure. derivatives, F-Py, F-An and F-PTz, consist of a pyridinium (Py), aniline (An) or phenothiazine (PTz) end group respectively, linked through a triethylene glycol chain, and possess unique hydrophobic–hydrophilic balance, which imparts amphiphilic character and significant solubility in polar solvents.The morphological analysis of F-Py, F-An andF-PTz in 10% DMSO-PBS by HRTEM reveals the self-assembly and nature of the aggregates. Among the three derivatives, F-An results in the formation of more or less uniform, spherical nanoclusters with sizes ranging from 3 to 5 nm. Due to the desirable size range (<5 nm) of the F-Annanoclusters, we have chosen F-An clusters Mechanism for the formation supramolecular organized structures formed in 10% DMSO-PBS for further investigation of
National Institute for Interdisciplinary Science & Technology 57 Annual Report 2017-18 Chemical Sciences & Technology Division
the interactions with dsDNA. Interactions between modified electrode can be exploited in pharmaceutical F-Annanoclusters and dsDNA investigated through UV/ and medical fields. Vis absorption spectroscopy and circular dichroism Flexible Electrochemical Transducer Platform spectroscopy confirms possible groove-binding and the for Neurotransmitters intact B-form structure of the duplex. AFM analysis reveals This work discusses on the development of a flexible the formation of nanowires that extend over several electrochemical transducer film based on PEDOT-titania- micrometres in length, with uniform thicknesses of about poly(dimethylsiloxane) (PTS) for simultaneous detection 80 or 120 nm (joined bundles) and an average height of 2 of neurotransmitters. PTS films were characterized using nm. Further, TEM studies confirmed the formation of long, various techniques using TEM, SEM, AFM, electrical uniform nanowires with an average thickness of about conductivity, AC-impedance and thermo-mechanical 12 nm. Results of the photophysical and morphological stability. The electrocatalytic behaviour of the flexible investigations of F-Annanoclusters in the presence of PTS film towards the oxidation of neurotransmitters dsDNA support the mutually assisted self-assembly of was investigated using cyclic voltammetry (CV) and F-Annanoclusters and dsDNA, resulting in extended differential pulse voltammetry (DPV). The fabricated nanostructures. Furthermore, horizontal conductivity transducer measured limit of detection of 100nm ±5 measurements through conductive AFM confirmed the with a response time of 15s, and sensitivity of 63µAmM- charge transport properties of these nanowires. 1cm-2. The fabricated transducer film demonstrated for PEDOT-reduced graphene oxide-silver hybrid the simultaneous determination of epinephrine (EP), nanocomposite modified transducer for the dopamine (DA), ascorbic acid (AA), and uric acid (UA) with detection of serotonin no interference between the analyte molecules. Further, PEDOT- reduced graphene oxide- silver hybrid transducer performance is validated by performing nanocomposite (PEDOTNTs/rGO/Ag NPs) modified with real samples. Results suggested that the fabricated electrode as a transducer for the detection of serotonin. Structure and properties of the nanocomposites were characterized by XPS, XRD, SEM, TEM, FT-IR, UV-Visible, and Raman spectroscopy. The electrochemical impedance spectroscopic (EIS) results showed a very low charge transfer resistance (198 Ω) for the modified electrode and its sensing performance towards serotonin were studied by various electro-chemical techniques such as cyclic voltammetry (CV), differential pulse voltammetry (DPV) and chronoamperometry (CA). PEDOTNTs/rGO/ AgNPs/GCE showed better performance by DPV with a lower detection limit of 0.1 nM with high operational Distinct Mechanoresponsive Luminescence, stability, reproducibility (inter- and intra-electrode - 2.3%) ThermochromismVapochromism, and Chlorine Gas Sensing response time (8s) and sensitivity (14.304 μAmM-1/cm2). by a Solid-State Organic Emitter It also showed a liner range from 1 nM to 0.5 mM (linear regression equation y=6.33 e-6 x +0.153 e-6). The kinetics of serotonin oxidation was studied by chronoamperometry and the catalytic rate constant calculated as 1.647 x 103 mol-1Ls-1. Later, the modified electrode demonstrated as a transducer for the selective detection of serotonin in the presence of ascorbic acid, uric acid and tyrosine. Real sample analysis and interference studies suggested the
58 National Institute for Interdisciplinary Science & Technology Chemical Sciences & Technology Division Annual Report 2017-18 flexible PTS transducer with superior electrocatalytic therapeutic formulations draw on an impressive array activity, stability and low response time can be exploited of plants. These have not been scrutinized by modern for the sensing of neurotransmitters and hence can scientific methods. Although several lead molecules be exploited at in vitro and in vivo conditions for the and drug molecules have already been discovered from early detection of the various diseases. The efficient medicinal herbs, further scientific exploration in this area electron transfer process observed with the present PTS3 along with verification and standardization according electrode system can be explained from the fundamental to the modern system of medicine is required. Herbal band alignment. The mixed phase of titania is the core drug development includes various steps, starting from driving force for enhanced transport of charge carriers in collection of raw materials in the right growth stage the composite electrode. In PTS electrode, upon electrical of the plants, correct identification, pharmacognostic and chemical quality standardization. Addressing the excitation, the charge carriers will efficiently move from standardization is very important and needs broader the LUMO of PEDOT (~-2.4 eV) which is higher than that consideration. New methods have to be developed to of the conduction band of titania (~-4.2 eV), and this will enforce and regulate quality control and standardization create an energy barrier for the back electron transport. of phytomedicines. In order to achieve an international The effective interaction of PEDOT chains on the surface acceptance to Ayurveda as an alternative, preventive of hierarchical titania can enhance the amount of charge and treatment modality, it becomes necessary to have carriers on the surface of the electrode. scientific validation of new formulations and products In this study, we report a synthetically simpledonor− being introduced. In this area we are focussing on the acceptor (D−A)-type organic solid-state emitter detailed phytochemical evaluation of plants that are thatdisplays unique fluorescence switching under reported to have medicinal activity or plants that are mechanicalstimuli. Orange and yellow emissive being traditionally used as herbal medicines or as part of crystals of 1 (1O, 1Y)exhibit an unusual “back and forth” herbal formulations. fluorescence response tomechanical force. Gentle Developing green and synthetic protocols for organic crushing (mild pressure) of theorange or yellow emissive transformations towards molecules of interest in biology crystal results in hypsochromicshiftto cyan emissive and fine chemicals is another important area of the fragments (λem = 498−501 nm) with a large wavelength activity. shift Δλem = −71 to −96 nm, while furthergrinding results in bathochromic swing to green emissive powder λem = The main objectives of this program are 540−550 nm, Δλem = +40 to 58 nm. Single-crystal X-ray $ Research and Development in the area of diffraction study reveals that molecules are packed phytochemicals byweak interactions, such as C−H···π, C−H···N, and $ To provide scientific support/validation to Ayurvedic C−H···F, which facilitate intermolecular charge transfer industry/products in the crystal. Withthe aid of structural, spectroscopic, $ Sustainable utilization of abundant natural resources for and morphological studies, we established the interplay value added products between intermolecular andintramolecular charge- $ Development of green processes towards molecules of transfer interaction that is responsible for this elusive interest in biology mechanochromic luminescence. Moreover, we havealso demonstrated the application of this organic material for Lewis-Acid-Catalyzed Activation of Zerumbone chlorine gas sensing in solid state. towards Sesquiterpenoid Derivatives: Sustainable Utilization of Abundant Natural Phytopharmaceuticals and drug intermediates Resources for the Synthesis of Chemically The tropical position and high ranges of Western Ghats, Diverse Architectures close to sea level endow Kerala with abundant flora. The plethora of flora seen in Kerala gave way to unique ethnic We have developed Lewis-acid-catalyzed cyclization preparations that are highly sought after for chronic reactions of zerumbone and its derivatives to access diseases by patients worldwide. Traditional and Ayurvedic structurally diverse polycyclic compounds. The core
National Institute for Interdisciplinary Science & Technology 59 Annual Report 2017-18 Chemical Sciences & Technology Division
structures of the synthesized molecules, that is, [5.7] and bound to a cyclopentenylated ring system. Preliminary [5.8] fused-ring systems, are found in many biologically investigations to check the reactivities of other fulvenes active natural products. The highlight of the new method such as triafulvenes and heptafulvenes are in progress is its utilization of renewable resources to generate complex fused skeletons. Notably, Zingiberzerumbet (also known as bitter ginger) can be cultivated on a large scale, and can produce a mature rhizome within a seven-month period. Under Lewis acid catalysis, we readily synthesized an indole-substituted isodaucane moiety from the zerumboneindole adduct, as well as a [5.8] fused ring system from zerumbone and indole. Efficient synthesis of pharmaceutically relevant Furthermore, aziridinated zerumbone also underwent indolo[2,3-b]quinolines, chromeno [2,3-b] Nazarov cyclization to afford a [5.8.3] fused-ring system. indoles, 3-alkenyl-oxindoles, diindolylketones This strategy opens new opportunities for the synthesis of from 3,3'-diindolylmethanes chemically diverse natural-product scaffolds that contain An easily accessible 3,3'-diindolylmethanes (DIMs) were heterocyclic/carbocyclic appendages. utilized to generate a focussed library of indolo[2,3-b] quinolines, chromeno [2,3-b] indoles and 3-alkenyl- oxindoles under DDQ mediated oxidative conditions and diindolylketones under PIDA oxidative conditions. The mild conditions and excellent yields of the products make this method a good choice to access a diverse library of bioactive molecules from a common starting material.
Lower Rim-Modified Calix[4]arene–Bentonite Lewis Acid Promoted Regioselective Double Hybrid System as a Green, Reversible, and Hydro(hetero)arylation of 6,6′-Dialkyl- Selective Colorimetric Sensor for Hg2+ Substituted Pentafulvenes: A Facile Approach Recognition to Bisindole Derivatives Researches leading to design and development of reliable Bisindoles are recognized as an important structural and economic organic-inorganic hybrid systems as motif in many natural products, pharmaceutical agents, sensors that can recognize hazardous metal ions by direct and advanced functional materials. We have unraveled visual observation are of primary importance. Based on a unique reactivity of alkyl-substituted pentafulvenes our previous experiences in developing calixarene based for the synthesis of alkylidenecyclopentene-fused molecular sensors for selective detection of hazardous/ bisindoles. The results reveal that Lewis acid catalysis environmentally benign metal ions, we initiated research could be an easy method for the double endocyclic in these lines, on developing an organic-inorganic activation of pentafulvenes with indoles. The present hybrid sensor for the detection of Hg2+. Bentonite, a methodology is an effective alternative to Bronsted cheap support material, was chosen as the inorganic acid/superacid catalysis, which leads to the self- counterpart for developing the hybrid system which was polymerization of pentafulvenes. The protocol also intercalated with a modified calixarene derivative which offers bisindole derivatives with an isoprenyl moiety selectively bound with Hg2+ ions. This hybrid system
60 National Institute for Interdisciplinary Science & Technology Chemical Sciences & Technology Division Annual Report 2017-18
(QHQCalBen) successfully performed as a colorimetric Oxidative cross-coupling reaction of primary alcohols solid-state Hg2+ sensor. The sensor was found to be with ketones catalyzed by Au-MPBen thermally stable, environmentally benign, economically Emergence of Gold-Mesoporous Silica Hybrid affordable, reversible, portable and reusable. Nanotheranostics: Dox-Encoded, Folate Targeted Chemotherapy with Modulation of SERS Fingerprinting for Apoptosis Towards Tumor Eradication Strategically fabricated theranostic nanocarrier delivery system is an unmet need in personalized medicine. We developed a versatile folate receptor (FR) targeted nanoenvelop delivery system (TNEDS) fabricated with gold core silica shell followed by chitosan–folic acid conjugate surface functionalization by for precise loading of anti-cancer drug doxorubicin (Dox), resembled as Au@SiO2-Dox-CS-FA. TNEDS possesses up to 90% Dox Photograph showing naked eye detection of Hg2+ with loading efficiency and internalized through endocytosis QHQCalBen and its reversibility with iodide solution. pathway leading to pH and redox-sensitive release An Efficient and Environmentally Benign kinetics. The superior FR-targeted cytotoxicity is Bentonite–Gold Nanohybrid-Catalyzed evaluated by the nanocarrier in comparison with US Oxidative Cross-Coupling of Ketones with Food and Drug Administration (FDA)-approved liposomal Benzylic Primary Alcohols. Dox conjugate, Lipodox. Therefore, this futuristic TNEDS The highly efficient, environmentally benign and reusable is expected to be a potential alternative as a clinically heterogeneous bentonite-gold nanohybrid catalyst relevant theranosticnanomedicine to effectively combat (AuMPBen) developed as part of the 12th FYP project neoplasia. (CSC00135) was found to successfully catalyse the oxidative C-C coupling of ketones and primary alcohols to produce α,β-unsaturated ketones in the presence of Cs2CO3 as base. The cascade C-C bond formation strategy using the catalyst is environmentally benign, economical, selective, easily separable and reusable, and works under mild reaction conditions. This nanohybrid system afforded a wide variety of α,β-unsaturated ketones in excellent yield with water as the only by-product. In addition, this heterogeneous catalyst was well applicable for the gram scale synthesis of α,β-unsaturated ketones.
Schematic representation of a) Various steps involved in the fabrication of Au@SiO2-Dox-CS-FA starting from AuNPs. b) Chemical structure of chitosan–folic acid (CS-FA) and Dox. c) Biological evaluation after i.p. administration of TNEDS on tumor-bearing mice.
National Institute for Interdisciplinary Science & Technology 61 Annual Report 2017-18 Chemical Sciences & Technology Division
A Ratiometric Near-Infrared Fluorogen for the with various natural products and pharmaceuticals. The Real Time Visualization of Intracellular Redox medicinal properties of these compounds are associated Status during Apoptosis with their bi- and tricyclic molecular hybrids. The Direct monitoring of apoptotic progression is a major step generation of hybrid pharmacophore through the fusion forward for the early assessment of therapeutic efficacy of medicinally active chromenones / pyranones and of certain treatments and the accurate evaluation of the pyridines will undoubtedly enrich the structural template. spread of a disease. The regulatory role of glutathione (GSH) is explored as a potential biomarker for tracking apoptosis. For this purpose, a nearinfrared (NIR) squaraine dye is introduced that is capable of sensing GSH in a ratiometric manner by switching its emission from NIR (690 nm) to visible region (560 nm). The favorable biocompatible attributes of the probe facilitated the real- time monitoring of apoptotic process in line with the Therefore, the development of these enriched structural conventional apoptotic assay. Furthermore, the robust templates through the multiple bond-forming nature of the probe was utilized for the quantitative transformations involving multicomponent reactions estimation of GSH during different stages of apoptosis. (MCRs) in one-pot is the key to generating molecular Through this study, an easy and reliable method of diversity. Owing to the aforementioned biological assaying apoptosis is demonstrated, which can provide importance of pyridines and related hybrids, recently valuable insights in translational clinical research. we have unraveled a one-pot multicomponent cascade synthesis of pyridine appended heterocycles from the readily accessible arylidenones, alkynes and nitriles
via BF3.OEt2 mediated cascade annulation. This simple protocol has led us to report the diverse library of chromeno[3,4-c]pyridines, thiochromeno[3,4-c]pyridines, pyrano[3,4-c]pyridines and thiopyrano[3,4-c]pyridines. Epoxyazadiradione purified from the Azadirachtaindica induced mitochondrial apoptosis and inhibition of NFκB nuclear translocation in HeLa cells
Epoxyazadiradione (EAD) is an important limonoid present in Neem (Azadirachtaindica) plant. In the present Schematic illustration of the Sq dye for the ratiometric study, we have purified EAD from neem seed and studied sensing of GSH during apoptosis. its anticancer potential in human cervical cancer (HeLa) BF •OEt Mediated Tandem Annulation: cells. Cell proliferation inhibition studies indicated that the 3 2 GI value of EAD as 7.5±0.0092 µM in HeLa cells, whereas A Strategy to Construct Functionalized 50 Chromeno-, and Pyrano- Fused Pyridines upto 50 µM concentrations EAD did not affect the growth Chromone is an essential class of oxygen-containing of normal H9C2 cells. The control drug cisplatin inhibited the growth of both HeLa and H9C2 cells with a GI heterocyclic compounds. Chromones are among the 50 most exciting discoveries in the field of natural products value of 2.92±1.192 µM and 4.22±1.568 µM respectively. which have successfully led to the development of many Nuclear DNA fragmentation, cell membrane blebbing, approved drugs and clinical trial agents. On the other phosphatidylserine translocation, upregulation of Bax, hand, pyridine as privileged N-heterocycle is associated caspase 3 activity and PARP cleavage and downregulation
62 National Institute for Interdisciplinary Science & Technology Chemical Sciences & Technology Division Annual Report 2017-18
Heteroannulation of 3‑Nitroindoles and 3‑Nitrobenzo[b]thiophenes: A Multicomponent Approach toward Pyrrole-Fused Heterocycles The inherent nucleophilicity of indole can be reversed by the installation of electron-withdrawing groups on the N-atom and C-2 or C-3 carbon atoms. We were interested in exploiting the reactivity of electrophilic indoles for the development of a facile method for fusing the pyrrole moiety onto the indole core. In this of BCl2 in HeLa cells on treatment with EAD indicated line, we have developed a general method for the the apoptotic cell death. Increase in caspase 9 activity heteroannulation of N-protected 3-nitroindoles and and release of active cytochrome c to the cytoplasm on 3-nitrobenzo [b]thiophenes. The methodology was treatment with EAD confirmed that the apoptosis was applied for the synthesis of a number of pyrroloindoles mediated through the mitochondrial pathway. EAD also starting from different cyclic and acyclic ketones, primary inhibited the nuclear translocation of NFκB in HeLa cells. amines, and 3-nitroindoles and it was applied for the Thus our studies demonstrated EAD as a potent and safe “pyrroloindolization” of natural products. We have also chemotherapeutic agent when compared to the standard demonstrated the applicability of the heteroannulation drug cisplatin which is toxic to both cancer as well as strategy for the generation of pyrrolo[3,2-b]indoles on a normal cells equally. gram scale.
National Institute for Interdisciplinary Science & Technology 63 Annual Report 2017-18 Materials Science & Technology Division
पदार् वि煍ञन तथा प्र셌饍योगकी प्रभाग पदार् वि煍ञन तथा प्रौ饍योगकी प्रभागमᴂ सअनु ंधान के फोकस 啍षे हℂ- उन्त कार्यत्क सामग्रⴂ का विकास,खनिजⴂ का इष्टतमीकरण और सामरिक, ऑटोमोबाइल, ऊर्ज और सामाजिक अनप्रु योगⴂ के लिए घटक । प्रभागमᴂ, वर㔷 2017-18 के दौरान खनिज इष्टतमीकरण, ऊर्ज बचत के लिए बहुआयामी वर्क, प्रकाश व्वस्थ अनप्रु योगⴂ के लिए लमेनसᴂटु साम嵍र, कार्न डाइ ऑक्सइड अधिशोषण के लिए छिदपर्ू सिरेमिक साम嵍र, डाई निम्नकरण के लिए नैनो फोटो उत्प्ररक, मदु 섿त इलेक絍रॉनक् के लिए साम嵍र, चबकींु य और चबकंु प्रशीतन साम嵍र , बहुलक और बहुलक आधारित नैनो कं पोजिट, रणनीतिक और मोटर वाहन अनप्रु योगⴂ के लिए हल्क मिश्रध ात ु का विकास जैसे 啍ष配र मᴂ अत्याुनध क प्रौ饍योगिकिⴂ के विकास पर काम श셂ु किया गया है । प्रभाग ने एससीआई पत्काओ ं मᴂ 80 शोध पत प्रकाशित किए हℂ और दो विदेशी पेटᴂट के लिए मजं रीू प्राप्तहै और बीस शोध छा配र को पीएचडी प्राप्तु हई । इस अवधि के दौरान प्रभाग केु कछ शोध हाइलाइट नीच े दिए गए हℂ- हाइलाइट $ ऊर्ज बचत अनप्रु योगⴂ के लिए उच㔚 आईआर परावर्न के साथ बहुकार्यत्क अकार्बनक कोलोरंट्स $ औ饍योगक परिसर मᴂ एनआईआईएसटी ब् ल वर्क का प्रदर्न $ एलईडी अनप्रु योगⴂ के लिए एकल चरणबद्ध सफेद और लाल फॉस्फरस का विकास $ नतनू वाणिज्यक उत्पदⴂ और स्थाी व्यपार के लिए सिलिका रेत और सिरेमिक अवशेष का मलू ्वर्न $ इलेक्टकल पोर्सलेन इन्लेटस र् के लिए हाइड्रोफोबिक चमक कोटिंग् का विकास $ उच㔚 प्रदर्न उत्प्ररक के 셂प मᴂ ZIF-8 / आयरन-嵍रफीन नैनो कं पोजिट से व्तय ्न् आयरन शामिल एन-डोप् छिद कार्न $ चबकींु य पी.डी.-Fe3O4-फ्लई ऐश कं पोजिट कणⴂ का उपयोग करके जलीय विलयन से कार्बनक सिंथेटिक-रंगⴂ को हटाने के लिए एक कु शल और लागत प्रभावी 饃ष्टिकोण के 셂प मᴂ सिनर्जिस्क पर्ल्फ ट सक्रियण $ पॉली प्रोपेलीन के उल्लखनीय 셂प से वर्धत क्रिस्लाइजेशन दर और थर्ल स्थरता के लिए अति उच㔚 विशिष्ट सतहषे 啍 के साथ स्रित डबल हाइड्रोक्सइड नैनोप्लटलेट्स $ प्रा㔚ीन पॉली (मिथाइल मेथाक्राइलेट) बहुलक की तलनाु मᴂ सिल्र से सजा हुआ हेक्सगोनल के योग के साथ 363% की एक प्रभावशाली थर्ल चालकता वद्धिृ (टीसीई) प्राप्तु हई $ एक ई आकार का पहनने योग् माइक्रो स्टप पैच वाईमैक् एटीनां का डिज़इन किया गया और पॉलिएस्र कपड़ पर उसे फै ब섿केट किया गया, जो भौगोलिक 饃ष्टि से दरदराजू इलाकⴂ मᴂ फं स गये व्यक्तिⴂ और वस्ओ酁 ं का पता लगाने के लिए उपयोगी है । $ रसंडियोटैक्टक पॉलीस्टरिन आधारित एरोजेल् के लिए, रिपोर् की गयी सबसे कम पार饍ुतय क स्थरांक (के= 1.03 ±
64 National Institute for Interdisciplinary Science & Technology Materials Science and Technology Division Annual Report 2017-18
0.02) की रिकॉर् तोडनेवाली पार饍ुतय क स्थरांक प्राप्तु हई, जो हवा के पार饍ुतय क स्थरांक (के = 1) के बहुत करीब है । $ लचीले सबस絍रट्स पर प्रिंट करने योग् कार्न नैनोट्यबू आधारित स्यही स्क्रन विकसित किया, जो न्नतमय सतह खरदरापनु (<65 एनएम) के साथ 0.5 - 13 Ω / वर् की रᴂज मᴂ शीट प्रतिरोध का प्रदर्न करता है $ निम् 嵍रड इल्मनाइट के उन्नन पर पायलट संयंत पैमाने के परीकणⴂ का सफल समापन और वीवी मिनरल् के लिए विदेशी 嵍रहकⴂ 饍वरा अतिं म उत्पदⴂ का मल्ू याकन $ एयरोस्पस अनप्रु योगⴂ के लिए ज़िक्रोनिम/मℂगनीज संयोजन के साथ एल्ूमिनिय म-मैग्नीशिम मिश्रध ात ु विकसित की गयी । $ उच㔚 यांत्क और सं啍षरण गणⴂु के साथ मैग्नीशिम- एटीमोनीं - सिलिकॉन मिश्रध ात ु विकसित की गयी $ डᴂडर्रइट परिष्रण के साथ कं पोकास्टिग तकनीक 饍वरा संसाधित उच㔚 शक्ति एल्ूमय ना नैनोपार्टकल परिक्प्त एल्ूमिनिय म- सिलिकॉन मिश्र धात ु ने इटरफें सियल बंधन और विस्थपन झकावु मᴂ वद्धिृ की
National Institute for Interdisciplinary Science & Technology 65 Annual Report 2017-18 Materials Science & Technology Division
MATERIALS SCIENCE AND TECHNOLOGY DIVISION Development of advanced functional materials, mineral beneficiation and components for strategic, automobile, energy and societal applications has been the focus areas of research in the Materials Science and Technology Division. In the year 2017-18, the division has embarked on the development of cutting edge technologies in the areas of mineral beneficiation, multifunctional pigments for energy savings, luminescent
materials for lighting applications, porous ceramic materials for CO2 adsorption, nano photo catalysts for dye degradation, materials for printed electronics, magnetic and magneto refrigeration materials, polymers and polymer based nano composites and light alloys development for strategic and automotive applications. This division has published 80 papers in SCI journals, granted two foreign Patents and has resulted in twenty PhDs. Some of the research highlights of the division during the period are given below Highlights $ Multifunctional inorganic colorants with high IR reflectance for energy saving applications. $ Demonstration of NIIST blue pigment in the industrial premises. $ Development of single phased white and red phosphors for LED applications. $ An industry sponsored project supported by M/s English Indian Clays Ltd.,, Trivandrum for value addition of EICL silica sand and clay residue for novel commercial products and sustainable business. $ MOU was signed with the company M/s Aditya Birla Insulators, Kolkatta for the development of hydrophobic glaze coatings for electrical porcelain Insulators $ Fe Incorporated N-doped Porous Carbon Derived from ZIF-8/Fe-GrapheneNanocomposites as high performance catalysts . $ Synergistic persulfate activation as an efficient and cost-effective approach for removal of organic
synthetic-dyes from aqueous solutions using magnetic pd-fe3o4-flyash composite particles. $ Layered Double Hydroxide Nanoplatelets with Ultrahigh Specific Surface area for significantly enhanced crystallization rate and thermal stability of polypropylene. $ An impressive thermal conductivity enhancement (TCE) of 363 % compared to pristine Poly(methyl methacrylate) polymer with the addition of Ag decorated hexagonal. $ An E-shaped wearable microstrip patch WiMAX antenna was designed and fabricated on polyester fabric, which is useful for locating persons and goods trapped in geographically remote terrains. $ A record breaking lowest reported dielectric constant (κ=1.03±0.02), which is very close to the dielectric constant of air (κ=1) was reported for syndiotactic polystyrene based aerogels. $ Developed carbon nanotube based ink screen printable on flexible substrates, exhibiting a sheet resistance in the range of 0.5 - 13 Ω/sq with minimum surface roughness (<65 nm). $ Successful completion of pilot plant scale trials on upgradation of low grade ilmenite for VV Minerals and evaluation of the final products by the overseas customers. $ Al-Mg Alloys with Zr/Mn additions developed for Aerospace applications. $ Mg-Sb- Si alloys developed with high mechanical and corrosion properties. $ High strength alumina nanoparticle dispersed Al-Si alloy processed by compocasting technique with dendrite refinement, enhanced interfacial bonding and dislocation bowing.
66 National Institute for Interdisciplinary Science & Technology Materials Science and Technology Division Annual Report 2017-18
Brief report of the division's activities highlighting major A new series of high near-infrared (NIR) reflecting achievements pigments with colors ranging from yellow to red by tuning the Bi Ce O with rare earth ion substitutions on both Multifunctional Inorganic Pigments 2 2 7 A and B sites were synthesized by a solid state reaction Synthesis and characterisation of eco-friendly method. The absorption edge is gradiently red shifted on Yellow pigments based on (LiLa)1/2WO4- BiVO4 substitution from Y to Tb resulting colors yellow to red. for energy saving applications: The XPS analysis surmises the presence of the elements with trends of reduction in Ce3+ concentration on both substitutions. These results suggest that the color shift is mainly due to charge transfer band shift of the O2- to Ce4+ (4f-5d) and deep red shift is due to introduction of additional energy level by terbium ions. A brilliant yellow * hue was obtained for Bi1.75Y0.25Ce2O7 (b = 51.4), whereas * Bi2Ce1.50Tb0.50O7 (a = 15.0) exhibited a red color.High NIR solar reflectance of 93% and 88% were obtained for
Bi0.5Y1.5Ce2O7 yellow and Bi2Ce1.50Tb0.50O7 red pigments respectively. The application study of these selected New eco-friendly yellow inorganic pigments based pigments was investigated in the polymer matrix which on BiVO having high NIR solar reflectance have been 4 demonstrates their coloring performance and hence successfully designed. Doping of Li+, La3+ and W6+ into suitable candidate materials for cool roof applications. the trivalentand pentavalent site of the BiVO4 system causes not only changes in the absorption properties Value added Building Materials from clay but also in the improvement in its optical and reflective contaminated silica sand: properties. The pigments prepared by conventional The industry M/s English Indian Clays Ltd., (EICL), solid-state reaction method yielded uniform morphology Trivandrum produces about 36000 T/ per month clay and reduction in particle size resulting in significant contaminated silica sand during the beneficiation of improvements of NIR reflectance. Typically the pigment kaolin mineral. This sand with both fine and coarse size
[(LiLa)0.125Bi0.75][W0.25V0.75]O4 displayed intense yellow fractions is contaminated with approximately 17 to 22 color (b* = 83.53) with near-infrared reflectance of 90%, wt.% of clay residue. A flowsheet has been developed much higher than the commercial sicopal yellow. These for the removal of clay from contaminated silica sand colorants demonstrated good coloring performance to obtain construction grade sand. The beneficiation with high solar reflectance in cement blocks and on process has resulted in 17% coarse sand [>500 µm] metal sheets. These compositions containing less toxic and 77% fine-sand [<500 µm] along with 3-4% clay. elements can be used as sustainable pigments in surface Value addition was made on the fine and coarse sand coating applications as energy saving products. to develop color sand; cool-tile; silica flour and sand Pigmentary Colors from yellow to red in reinforced composite polymer tiles. The products were demonstrated in lab scale and some of the value added Bi2Ce2O7 by rare earth ion substitutions as possible high NIR reflecting pigments for products are shown in Fig.1 energy saving applications Construction grade Color
National Institute for Interdisciplinary Science & Technology 67 Annual Report 2017-18 Materials Science & Technology Division
Color sand reinforced epoxy polymer composite Narrow-band red emitting phosphor is a decisive component to develop phosphor-converted light emitting diodes with good CRI and low CCT for highly efficient illumination-grade lighting which are urgently needed to retrofit the incandescent tungsten–halogen lamps in the 3+ market. A narrow band red emitting Gd3Zn2Nb3O14:Eu phosphor was synthesized and characterized in order to Fig. 1 Value added building materials from clay improve the color qualities of warm white light emitting contaminated silica sand diodes. The developed phosphor exhibits a strong red An intense purple chromophore based on emission peaking at 613 nm with af whm of merely ~ 3.50 nm under the 392 nm excitation. The enhanced electric Co2+ in distorted tetrahedral coordination: dipole transition intensity arises from the symmetry distortion of Eu3+ ions caused by the introduction of Zn2+ ions in the lattice. The distortion of the A site symmetry and the red shift of the charge transfer energy leads to an 5 7 intense D0 – F2 hypersensitive electric dipole transition under 392 nm excitation. The rigid and ordered network in the structure decreases the nonradiative relaxation leading to a sufficiently narrow band red emitting phosphors. The relative emission intensity was found
An intense purple, cost-effective inorganic pigment LiZn1-x to be maximum at x = 0.40 and is 3.9 times higher than
CoxPO4 (0.1 ≤ x ≤ 0.8) was synthesized by solid-state that of the commercial red phosphor under the 392 ceramic route. Development of exotic intense purple nm excitation. These phosphors with remarkable CIE colour of these pigments was investigated by means chromaticity coordinates (0.64, 0.35), good CCT values of crystallographic as well as optical spectral studies. along with high color purity (94.2%) might be potential Structural refinement showed that chromophore of the candidates in display devices as an efficient red phosphor. pigment CoO , formed with highly distorted geometry due 4 Enhanced intrinsic greenish-yellow to significantly shorter Co-O bonds. Structural changes luminescence in CaMoO by Si4+acceptor doping attributed strongly on the spectral features leading to 4 as potential phosphors for white light emitting an excellent purple colour which is unusual for CoO 4 diode applications: tetrahedral coordination. The hue of the purple colour can be controlled by tuning the Co content.Composition with Intense broad greenish-yellow luminescence has 2+ 4+ very low Co concentration (3.5 atomic wt%) exhibited been observed in CaMoO4by Si acceptor doping. The intense purple colour, a* = +25.25, b* = -52.32, with an broad luminescence is attributed to the charge transfer 2- impressive NIR Solar reflectance (R* = 68%) and good transitions in MoO4 groups and defect luminescence. 4+ chemical stability. The colour delivering performance The Si doping acts on two fronts, distorting the MoO4 of these purple pigments have also been evaluated by tetrahedron and inducing oxygen vacancies promoting pigment incorporation in polymer matrix. Further these acceptor levels near the VB edge. The XPS core level pigments can be a potential candidate for cool pigment spectra analysis confirms to the binding energies of the by coating onto roofing materials like aluminum roofing elements and also indicates asymmetric broadening with sheets and concrete block. increase of fwhm suggesting defects and oxygen vacancies in the system. Consequently, the distortion and disorder Luminescent materials in the lattice generate intermediate energy levels within 3+ Narrow-Band Red-Emitting Phosphor, Gd3Zn2Nb3O14:Eu the band gap facilitating the enhanced luminescence with High Color Purity for Phosphor-Converted White of absorption and emission processes. The defect and Light Emitting Diodes: charge transfer luminescence increases competitively
68 National Institute for Interdisciplinary Science & Technology Materials Science and Technology Division Annual Report 2017-18 with Si4+ doping. The lifetime of the defect luminescence increases with Si4+ doping which suggests the increased radiative emission transitions without quenching. These factors broadened the luminescence covering the entire visible region (425 nm to 625 nm) enhancing the fwhm from 127 nm to 133 nm with emission intensities 1.5 times greater than the undoped one. The calculated CIE chromaticity coordinates falls in the greenish yellow region with values (0.31, 0.45).
Novel self-activated full color emission phosphor 3+ in Y doped Sr3Bi(VO4)3 system: Synthesis and Luminescence Properties:
Synthesis and Photoluminescence Properties of New Perovskite Type Orange
Red Emitting Phosphors: Sr Gd(0.5-x)Nb0.5O3 : x Development of self-activated vanadate phosphor 3+ Eu for WLED Applications: Sr Bi(VO ) and tune the color from yellow to near 3+ 3 4 3 Eu doped SrGd Nb O phosphors were synthesized 3+ (0.5-x) 0.5 3 white by doping with Y ions was attempted. The using a high temperature solid state method. Powder host can be efficiently excited by ultraviolet (UV) light, XRD results confirm the orthorhombic phase and and exhibits an orange emission peaking at 530 nm detailed investigations on the photoluminescence and originating from VO 3- groups. For color tuning Y3+ ions 3+ 4 UV absorption studies indicated that Eu doped SrGd0.5 were doped into the Sr3Bi(VO4)3 phosphors which gave Nb O phosphors has a strong absorption in theUV 0.5 3 broad excitation and emission spectra. With increase region. Intense orange red emission is observed for both in Y3+ ion concentration, we could obtain the full color near UV (392 nm) excitation and Blue (465 nm) excitations emission covering the whole visible spectrum, with broad matching with the output wavelengths of UV and blue emission peaks in the blue-green region. As the prepared LED chips, which can be attributed to the magnetic dipole phosphors have their excitation wavelength in the near transition (5D -7F ) of Eu3+. Concentration quenching 0 1 UV region and the emission spectra covers the entire 3+ is observed at 0.075 mol% Eu doping. The phosphor visible spectrum, it is promising to be a possible full color samples exhibit better efficiency values compared to emitting phosphor for WLED functions. many phosphor materials reported in the literature. The results obtained suggests that the intense orange red Oxide Ionic conductors for SOFC Applications emitting phosphors with better efficiency could be a Enhanced Ionic Conductivity of Samarium doped Ceria promising phosphor candidate for white light emitting Solid Electrolyte through stabilization of Ce4+ Oxidation diode applications. states by Zr substitution:
National Institute for Interdisciplinary Science & Technology 69 Annual Report 2017-18 Materials Science & Technology Division
compositions. As the substitution, increase the lattice parameter increase which is in line with the Vegard’s law. The conductivity of the samples measured using the impedance spectroscopy is of the order 10-4 S/cm which is high compared to the other compositions similar to this.
Enhancing the ionic conductivity of cerium oxide system is vital for low temperature solid oxide fuel cells (LT-SOFCs). A simple chemical sol-gel technique was employed to synthesis Zr substituted Samarium doped ceria (SDC) to enhance the ionic conductivity by stabilizing majority ceria as Ce4+. The particle size was found to be ~20 nm. The valence state of the cations and the concentration of Ce4+ were established through X-ray photo electron spectroscopy (XPS). The results confirmed an increase in tetravalent cerium concentration from POROUS CERAMIC MATERIALS 56 % to 84%. Among the investigated compositions,(x = 0.075) exhibited higher ionic conductivity which was Heteroatom doped Heteroporous Carbon found to show a maximum value of 5.28 x101(S/cm) at Catalysts for Oxygen Reduction Reaction: 750°C. The substitution of Zr4+ in SDC stabilizes the cubic Alkaline Fuel cells are recognized as highly efficient fluorite structure and it may hold back the ordering of and green power generating sources with high power oxygen vacancy which enhances ionic conductivity. The conversion rates for stationary/residential applications. high ionic conductivity value and stability of Ce4+ in the The efficiency of such devices are however dependent present work proposes that the materials of this kind are on the effectiveness of oxygen reduction reaction (ORR). promising good ionic conductors. The sluggish cathodic reaction kinetics and the extensive Study of structural and electrical properties of use of Platinum (Pt) based catalyst are major obstacles pyrochlore type compositions with multivalent for the wide spread applications of alkaline fuel cells. environment: The immense scientific interest generated recently on Pyrochlore type compounds form an important class of heteroatom doped heteroporous carbon materials materials in the field of material science which belongs (mainly nitrogen and transition metals) testifies their
to the space group Fd3m with a general formula A2B2X6Y, significance as emerging Pt alternative catalysts for where A and B sites are occupied by the metal atoms ORR. Doped nitrogen provides basic sites on porous having oxidation states 3+ and 4+ or 2+ and 5+ and the carbon surface increasing the polarity and improving the X and Y sites are anions. These oxides possess intrinsic adsorption and electrochemical capabilities, enabling oxide ion vacancies through these ordered vacancies them to be employed for catalysis. When a metal species conduction of oxide ion become feasible reducing is introduced in porous carbon structures, enhancement the activation energy. Pyrochlore compositions with of ORR activity is effected both in terms of activity and multivalent environment are a less explored area in stability. This is primarily accomplished due to the this regard. A new series of Pyrochlore compositions, generation of higher number of activities that eventually
Sm2Zr(1-x)(YNb)xO7 (x = 0,0.25,0.5,0.75,1) are prepared via enhances adsorption. Fe plays a vital role in increating conventional solid state reaction route. The XRD confirms active site for ORR while Fe–N combination amplifies the the formation of the pure pyrochlore structure in these ORR activity due to the interactions between the Fe and
70 National Institute for Interdisciplinary Science & Technology Materials Science and Technology Division Annual Report 2017-18
N species on the carbon substrates. The modification of pore characteristics and engineering the morphological features of the carbon structures will lead to improved active site density that favourably contributes towards ORR. In the present study, two different precursor compositions that provide in-situ doping of heteroatoms in a porous carbon matrix is designed and the Figure: Tem image of the catalyst and the LSV plots depicting the electrocatalytic behaviour in comparison with Pt/C and electrochemical properties are evaluated accelerated durability test showing the stability of the catalyst 1. Fe Incorporated N-doped Porous Carbon Derived 2. Chitosan Intercalated Metal Organic Gel as from ZIF-8/Fe- Graphene Nanocomposites: a Green Precursor of Fe Distributed N-Doped Morphological ensembles of carbon in the form of Mesoporous Graphitic Carbon: graphene, carbon nanotubes and carbon frameworks Chitosan a nitrogen rich (6.89%) naturally occurring are thus developed by the carbonisation of Fe/Graphene/ biopolymer with chelating property is found to be a good ZIF-8 composite precursor. The in-situ synthesis of ZIF-8 precursor for N-doped carbon. Upon treatment with an in dispersions of Fe3+ and graphene nanosheets yielded iron containing Metal Organic Gel (Fe-MOG), chitosan Fe doped frameworks with graphene dispersions. The intercalated MOG with 3D gel network is obtained. high temperature pyrolysis of the as synthesized Fe-ZIF-8/ Pyrolysis of the derived network in an inert atmosphere graphene composites at 900°C resulted in the formation resulted in the formation of Fe, N-doped carbon with of Fe, N- co-doped carbon structures. The iron species higher surface area of 565 m2g-1 and with heteroporous such as Fe/Fe C are accommodated in the carbon matrix 3 architecture (micro and mesoporosity). The amount of with the formation of nanotubes. The derived carbon heteroatom was estimated to be 0.15 % Fe and 1.58 % structures have more mesopores that resulted in more nitrogen. Among the nitrogen species present, greater active site density and improved mass transfer. More over than 60 % is found to be in the form of graphitic nitrogen the Fe incorporation led to the formation of Fe-N sites with higher activity. The ORR activity is expressed in that contributed favourably to the catalyst performance. terms of onset and half wave potential. These parameters
Figure: Schematic showing the formation of Fe, N co-doped carbon of varying morphologies from Fe-ZIF-8/graphene composite.
The electrocatalyst prepared using Zn/Fe ratio of 10 displayed enhanced electrocatalytic properties with an onset potential of 0.95 V and an half wave potential (E1/2) of 0.82 V. The potential was maintained for the tested 5000 cycles with a minimal shift of 9 mV in its 1/2E . In comparison, the commercial Pt/C sample showed a reduction of 32 mV in (E1/2) after 5000 cycles in alkaline conditions. Micro-meso porous architecture together with various morphological forms of carbon and the Figure: Schematic illustration of the formation of Fe, N doped carbon. presence of active sites of Fe-Nx, Fe/Fe3C contributed to XPS analysis showing N-doping accelerated durability analysis. the favourable catalytic properties.
National Institute for Interdisciplinary Science & Technology 71 Annual Report 2017-18 Materials Science & Technology Division
were found to be 0.925 V and 0.78 V respectively for the By employing a microwave sol-gel approach, needle
developed carbon which is also comparable with that shaped structures of germanium incorporated Li4SiO4 that
of the state of the art Pt catalyst. A better durability up displayed enhanced CO2 absorption with significantly to 5000 cycles with a four-electron transfer makes it a improved kinetics was realised. Absorption capacity of promising catalyst towards ORR. 324 mgg-1 at the rate of 117 mgg-1 was attained at 680 °C for the samples with the Si: Ge molar ratio of 1:0.183. Germanium Incorporated Lithium Silicate as Moreover, an appreciable capacity of 49 mgg-1 at the Highly Efficient Low Temperature Sorbents for rate of 36 mgg-1 min-1 was obtained at temperatures as CO Capture: 2 low as 300 °C. The study thus highlights the possibility of Carbon dioxide emission from massive point sources such employing germanium incorporated lithium silicates for as industries and power plants increased the atmospheric the absorption of CO at a wide range of temperatures, CO concentration to the value of ~400 ppm. This has, in 2 2 including the in-situ removal of CO from chemical and turn, created severe environmental issues like global 2 petrochemical reactions such as water gas shift reaction. warming inducing undesirable weather patterns and natural calamities. It is, therefore, necessary to develop
sustainable technologies for the effective removal of CO2 from the point sources to reduce carbon foot prints in the atmosphere.
Out of the various CO2 sorbents, Li4SiO4 qualifies as a potential material for commercial viability by virtue of its high absorption capacity (8 mmolg-1)with appreciable kinetics in the temperature range of 500-700 oC. However, it suffers from kinetic limitations during the sorption process at temperatures below 500 °C. CSIR- NIIST in collaboration with Noritake Co. Ltd. Japan has developed a patented process for the development of Figure: Isothermal absorption studies of Ge incorporated high performing Li4SiO4sorbents for CO2 capture in the temperature range of 350-700 oC. In order to lower the samples in the temperature range of 300-680°C
sorption range of Li4SiO4 and to enhance the kinetics as well as the absorption capacity of Li SiO material, Hydrothermal Synthesized Magnetically 4 4 γ Separable Mesostructured H2Ti3O7/ - germanium incorporated Li4SiO4 nanostructures are developed. Fe2O3Nanocomposite for Organic Dye Removal via Adsorption and Its Regeneration / Reuse
Through Synergistic Non-Radiation Driven H2O2 Activation:
Hydrogen titanate (H2Ti3O7) nanotubes (HTN) are emerging class of adsorbent which also possess unique property
of activating hydrogen peroxide (H2O2) to generate the reactive oxygen species (ROS), such as superoxide radical •- • ions (O2 ) and hydroxyl radicals ( OH), effective in the decomposition of surface-adsorbed dye. However, HTN are non-magnetic which create hurdle in their effective separation from the treated aqueous solution. To Figure: Schematic showing the preparation of Ge containing Li SiO 4 4 overcome this issue, magnetic nanocomposites (HTNF) by microwave assisted sol gel process. TEM images of synthesised γ needle like structures. Dynamic thermogram of samples with composed of HTN and maghemite ( -Fe2O3) nanoparticles varying Si:Ge ratio have been processed by subjecting core-shell magnetic
72 National Institute for Interdisciplinary Science & Technology Materials Science and Technology Division Annual Report 2017-18
γ- electroless and inverse co-precipitation techniques, photocatalyst consisting of Fe2O3/silica (SiO2)/titania have been utilized earlier for the removal of industrial (TiO2), which is synthesized via combination of sol-gel and modified Stober processes, to the hydrothermal azo reactive dyes from the aqueous solutions. The mechanism of dye-removal involves advanced oxidation conditions. The amount of TiO2 in the shell has been varied by chaning the number of sol-gel coating cycles process (AOP) such as the activation of costlier and
(1, 3, 5, and 7). The hydrothermal treatment results in the hazardous oxidizer such as hydrogen peroxide (H2O2). formation HTNF magnetic nanocomposite containing The process also requires further backing-up with the adsorption treatment of activated carbon (AC) to control H2Ti3O7 with different morphologies such as nanosheets, nanotubes, and mixed-one. HTNF-5 magnetic the enhanced chemical oxygen demand (COD) level of treated aqueous solution which not only increases the nanocomposite consisting of 31 wt% H2Ti3O7, typically having nanotube morphology with the highest specific number of steps involved in the dye-removal process but surface-area (133 m2 g-1) and pore-volume (0.22 cm3 g-1), also results in the generation of large amount of sludge. -1 exhibits the highest capacity (74 mg g ) for the adsorption There is an urgent need to replace H2O2 with an efficient, of cationic methylene blue (MB) dye from an aqueous cost-effective, and non-hazardous oxidizer which can solution involving electrostatic attraction mechanism resolve the aforementioned issues in the present dye- and pseudo-second-order kinetics. Very fast magnetic removal application. From this point of view, we utilized separation followed by regeneration of HTNF-5 magnetic the magnetic flyash-Fe3O4-Pd composite particles for the nanocomposite has been demonstrated via non- decoloration of aqueous solutions containing industrial azo reactive dye such as Corafix Red ME4B, via synergistic radiation driven H2O2 activation. It has been ascertained 2- for the first time that the underlying mechanism of dye- activation of persulfate anions (S2O8 ) involving the decomposition involves the synergy effect between the catalytic and thermal contributions. In contrast to the 2- constituents of HTNF magnetic nanocomposite. (Shukla activation of H2O2, the synergistic activation of S2O8 et al., Environ. Sci. Pollut. Res. 2017, doi: 10.1007/s11356- anions is noted to significantly reduce the COD level 017-8381-2) almost in a single step which reduces the dependency on the post adsorption treatment of AC. Moreover, the regeneration of AC in the present dye-removal application has been demonstrated using the synergistic 2- activation of S2O8 anions. The latter, hence, appears to be an efficient, cost-effective, and non-hazardous approach for the removal of organic synthetic-dyes from
aqueous solutions by using the magnetic flyash-Fe3O4-Pd composite particles as catalyst.
Synergistic Persulfate Activation as an Efficient and Cost-Effective Approach for Removal of Organic Synthetic-Dyes from Aqueous Solutions using Magnetic Flyash-Fe3O4-Pd Composite Particles as Catalyst:
Magnetic flyash-magnetite (Fe3O4)- palladium (Pd) composite particles, synthesized via combination of
National Institute for Interdisciplinary Science & Technology 73 Annual Report 2017-18 Materials Science & Technology Division
Silver decorated boron nitride nanosheets theoretical model that showed good agreement. Dielectric as hybrid filler in PMMA for high thermal measurements performed at radio and microwave conductivity frequencies revealed that the nanocomposites show a low dielectric constant (<5), low loss (10-2) and very low ac conductivity (10-7S/cm). The results suggest that silver decorated BNNS is a promising hybrid filler for effective thermal management. Printed microstrip patch antenna on homemade substrate made of ‘quench free’ glass-ceramic composite
Fig. Dramatic variation thermal conductivity of PMMA with Ag decorated h-BN addition
In consumer electronics, managing the circuit heat dissipation is a vital issue that needs to be addressed urgently to improve the reliability and performances of devices. Over the last few decades, polymers gained pronounced attention as substrates, owing to their excellent design freedom, light weight and low cost. But, they have genuine drawbacks like high coefficient of thermal expansion (40- 200 ppm/K) and low thermal conductivity (< 0.5 Wm-1K-1), which debilitate their wide range electronic applications. The low thermal conductivity of the substrate leads to inadequate heat dissipation, which adversely affect the performance Fig. (a) Schematics of the designed patch antenna (b) return loss (S11) and lifetime of circuits. Hence high thermal conducting of measured and simulated patch antenna with photograph of the fabricated antenna (inset), (c) and (d) measured radiation pattern of and low dielectric loss polymer nanocomposites have patch antenna along E- plane and H- plane respectively. gained tremendous attention in microelectronics technology. Against this background, Electronic In order to design compact wireless devices, it is Materials group in NIIST has developed a high thermal necessary to miniaturize the antenna size accordingly. conducting, low dielectric constant and low loss polymer There are several strategies used for antenna’s size nanocomposite based on silver nanoparticle (AgNP) reduction. Among them, introduction of high dielectric decorated boron nitride nanosheets (BNNS) as the constant materials as the substrates is most effective filler in polymethyl methacrylate (PMMA) matrix. The for miniaturization in patch antennas. However, the nanocomposites were prepared through a facile solution use of high dielectric constant material will result in the blending process. Elemental mapping of the prepared reduction of band width and radiation efficiency of the nanocompositeindicates the uniform distribution of filler developed antenna. Hence, for the practical application, particle in PMMA matrix. An impressive high thermal the desired range of dielectric constant suitable for conductivity (TC) enhancement of around 363% was patch antenna fabrication falls within the range 2.2 to
achieved for nanocomposite of 0.35 Vf of hybrid filler 12. Polymers are unsuitable as substrates for achieving (1.48 W/mK), compared to pristine PMMA (0.32 W/mK). high dielectric constant, while there exist plenty of high The addition of AgNPreduces thermal contact resistance dielectric constant ceramic materials. However, the (Rc) by bridging individual BNNS, thereby improves realization of MPAs on ceramic substrate is challenging thermal transport. Measured TC values were fitted with a both from the design as well as practical perspectives. It
74 National Institute for Interdisciplinary Science & Technology Materials Science and Technology Division Annual Report 2017-18 should be noted that, thereare only very few reports on POLYMER NANOCOMPOSITES realizing microstrip patch antennas on high dielectric Layered Double Hydroxide Nanoplatelets with constant hard ceramic substrates. This is primarily Ultrahigh Speci fic Surface Area for Significantly because, besides addressing ceramics’ inherent narrow Enhanced Crystallization Rate and Thermal bandwidth, the fine machining of the hard substrate Stability of Polypropylene: and subsequent metallic cladding requires a lot of Appropriate selection of additives for the semicrystalline optimization. One of the most viable solutions is to go for polymers helps the polymer industries to develop plastics printed antennas, which can minimize the problems of with improved durability and cost effective. One of our debonding of the radiating patch from the substrate. main focuses is to develop the multifunctional nanofillers Our group in NIIST has developed a facile model to for semicrystalline polymers. We have demonstrated synthesize glass ceramic composites and their subsequent that sonication-assisted delamination of layered double use as a low loss, low firing substrate for printed patch hydroxides resulted in the ultrathin nanosheets with antennas. ‘Quench free glass’ ceramic slurry and their drastically improved surface activity. We have showed crack free tapes were developed for low temperature that the lateral size of the LDH has a significant influence co-fired ceramics (LTCC) applications. The structural, on the thermal stability and crystallization rate of microstructural, mechanical and dielectric properties of polypropylene. We also investigated the influence of the developed green and sintered tapes were investigated LDH intralayer metal constituents on the properties using the non-conventional method (NC) and compared of polypropylene. Our results demonstrated that the with those developed from conventionally prepared nanocomposites prepared using three-metal-LDH composites (C). Interestingly, the novel method yielded showed better thermal and flame retardant properties tapes with more uniform and narrower microstructures. compared to that of the nanocomposites prepared using Further micro hardness analysis of sintered tape showed two-metal-LDH. In continuation to that work, a facile an improved value of 3.12 ± 0.01 GPa for SZT+ZBPT (NC) method for the simultaneous delamination and the lateral compared to 2 ± 0.01 GPa of SZT+ZBPT (C), indicating a size reduction of LDH is developed in our group. This more homogenized distribution of glass phase in ‘quench method directly resulted in the delaminated mesoporous free glass’ composite. The microwave dielectric properties LDH nanoplatelets (nanodot LDH) with the high specific of tapes synthesized through the non-conventional surface area (lateral 1 nm). Such prepared LDH was used method that were sintered at 900 oCupto a densification as fillers for isotactic polypropylene. The incorporation of 95%, showed an εr of 11.64 and a tanδ of 0.0024 at 5GHz. For the realisation of compact wireless devices, judicial selection of high dielectric constant substrate that can miniaturize size of the antenna, is necessary. The present material, SZT+ZBPT (NC), is an ideal choice for hard ceramic substrate applications due to its Schematic illustration of simultaneous delamination and size interesting dielectric properties. A prototype of micro reduction of layered double hydroxides. strip path antenna operating at 2.5 GHz was designed and of nanodot LDH showed a remarkable improvement in fabricated on an accurately machined sintered LTCC tape the polymer properties with only 1 wt % loading. The based on SZT+ZBPT (NC) by creating patch and ground uniformly dispersed LDH particles have a significant through flatbed screen printing technique. The radiation effect on the nucleation ability, thermal stability and parameters of the newly designed ceramic antenna mechanical properties of iPP. The nucleation ability of iPP showed very good agreement between simulated and in the presence of nanodot LDH is the best compared to measured results, reiterating the efficacy of the new other iPPnanocomposites reported using LDH as fillers method to develop microelectronic and microwave in the literature. Furthermore, the microstructure of the communication substrates. iPPnanocomposites was systematically investigated at
National Institute for Interdisciplinary Science & Technology 75 Annual Report 2017-18 Materials Science & Technology Division
multiple length scales in the presence of different-sized the films were transparent in acetone. The differences in LDH, which is a key to understand the polymer properties. the transparency could be attributed to the differences in Process Development for the Preparation of morphology as well as the surface roughness. Transparent Crystalline Biodegradable Polymer Natural Fibers (Coir) and Composites Films (Nanoporous Films): Process Development for Surface Modification The role of a nonsolvent in controlling the crystallization of Coir Fibers and morphology of solvent-crystallized poly(L-lactide) (PLLA) films was investigated using various microscopy The development of renewable and biodegradable techniques and small- and wide-angle X-ray scattering materials has attracted significant attention in terms (SAXS/WAXS). PLLA films crystallized in THF and acetone of meeting the growing demand for sustainable had 40-80 µm spherulites. When water was present in the development, given the increase in environmental solvent, a completely different morphology was observed awareness. The use of reinforced composites with natural in acetone and THF, and nanosized voids were observed. fibers is growing, but still in a small way because of the The surfaces of the films were smooth. In contrast, SEM poor compatibility with polymer matrix. Therefore, their studies revealed that the films crystallized in acetone and application was limited compared to synthetic fibers. THF which had macroporous structures, had larger voids Further, poor moisture resistance of natural fiber leads and film surfaces were rough because of the presence of to incompatibility and poor wettability with hydrophobic globular structures. Voids appeared within the spherulites polymers, results weak interaction at fiber/polymer in THF/water treated film, whereas crystal nucleated at the interface. The solution for this issue is still an open surface of the nanosized voids in acetone/water treated scientific debate, with many different kinds of treatments PLLA films. The formation of such voids is attributed to being tested by different research groups. Among these the interface-enhanced crystal nucleation in a solvent/ methods, plasma treatment of natural fibers is considered nonsolvent system where the nonsolvent increases as a very promising and the environmentally friendly the polymer crystal nucleation and the subsequent method. This method has many advantages in surface evaporation of the nonsolvent. The method described in modification including its effective alteration of surface this work can be extended to other polymers to control properties and reducing the usage of environmentally the morphologies of polymer films during the solvent- hazardous chemicals. We have developed a process induced crystallization. PLLA films crystallized in THF for the surface modification of coir fibers using plasma and acetone were optically opaque. When water was treatment method. present in the solvent, the films were translucent in THF, Rapid, Acid Free Synthesis of Graphene Oxide and had a completely different rod-like morphology and Quantum Dots as Excellent Fluorescent Probe for Bio-imaging and Environmental Monitoring: Graphene Oxide Quantum Dots (GQDs) are a new class of carbon nanomaterials that have emerged recently and have attracted tremendous attentions for their potentials in sensing, catalysis, optoelectronic, bioimaging and energy related applications. Compared to other fluorescent materials, this carbon-based material, GQD possess several advantages like high photo stability, high aqueous dispersibility, tunable band gap, good biocompatibility and low cytotoxicity. GQDs consists of an atomic layer of nano-sized graphite which shows excellent properties of graphene like large surface area, Surface morphologies of PLLA films crystallized in acetone and high carrier transport mobility, superior mechanical acetone/water mixture.
76 National Institute for Interdisciplinary Science & Technology Materials Science and Technology Division Annual Report 2017-18 flexibility, and excellent thermal and chemical stabilities. component of total entropy (and temperature) of a We reported a rapid, acid-free, one-pot synthesis of size- material upon the application or removal of magnetic tunable GQDs from graphene oxide (GO) by sonochemical field. Magnetic refrigerants, such as Gd-Si-Ge, Ni-Mn-Z method with intermittent microwave heating, keeping (Z= In, Sn, Sb, Ga) based Heusler alloys and oxide based the reaction temperature constant at 90 °C. The GQDs manganites have come to research focus of NIIST were synthesized by oxidative cutting of GO using KMnO4 Trivandrum. as an oxidizing agent within a short span of time (30 min) Intermetallics in an acid-free condition. The as-synthesized GQDs were Research on Gd-Si-Ge compounds are of special interest of high quality and exhibited better quantum yield, high in NIIST owing to the existence of a strong correlation product yield, and lower cytotoxicity. Furthermore, the between its crystal structure and magnetic properties. GQDs were demonstrated as excellent fluorescent probes Giant MCE in Gd-Si-Ge system has been attributed to for bioimaging and label-free sensing of Fe(III) ions, with a the coupled magneto-structural transition from the high detection limit as low as 10 µM. temperature monoclinic paramagnetic phase to the low temperature orthorhombic ferromagnetic phase that occurs in the vicinity of the magnetic ordering temperature. In addition to intermetallics, electron- doped manganites have also been found to exhibit large MCE under moderate applied fields. Magnetocaloric properties of Nd substituted Gd5Si2Ge2 with x=0, 0.05, 0.1 and 0.2 were evaluated in NIIST. The composition with x = 0.05 crystallizes in monoclinic Gd5Si2Ge2 structure with P1121/a space group and Figure. Schematic illustration of synthesis of GQDs for bioimaging and label-free sensing of metal ions undergoes a first order phase transition with a Curie temperature of 275 K. With increase in Nd content to x = Magnetic Materials 0.1, the compound is found to stabilize in orthorhombic Gd5Si4 phase with Pnma space group. The compounds Structural, Magnetic and Magnetocaloric with x = 0.1 and 0.2 undergoes a second order magnetic studies in intermetallics and Oxides based transition at 300 K and 293 K, respectively. A maximum materials for Room Temperature Magnetic entropy change for Gd5-xNdxSi2Ge2 alloys with x = 0.05, Refrigeration Applications 0.1, and 0.2 are 12.8, 7.6, and 7.2 J/kg K respectively, for Green and sustainable energy is the prime motivation of a field change of 50 kOe. A large relative cooling power present-day research. Magnetic refrigeration based on of 295, 205, and 188 J/kg are obtained for x = 0.05, 0.1, magnetocaloric effect, has evolved as an environment- and 0.2, respectively, fulfilling the required criteria for a friendly and efficient alternative to conventional gas potential magnetic refrigerant in the room temperature based compression refrigeration by eliminating the use regime. of greenhouse gases and hazardous chemicals. Although Oxides numerous magnetic materials have been reported to Rare-Earth manganites based on perovskite structures are show very high values of magnetocaloric effect (MCE) another class of materials, have turned out as promising but still the practical utilization of this effect has not materials for room temperature magnetocaloric been realized since at room temperature and ambient applications. Among these, A1-xA̛xMnO3 (A = trivalent conditions only a few materials exhibit this phenomenon. rare earth elements, A̛= divalent alkaline earth elements) MCE is the thermal response of the magnetic material to has gained attention, particularly owing to its wide an applied magnetic field and is induced by the coupling application area covering colossal magneto resistance to of magnetic sub lattice with an external magnetic field. magnetocaloric applications. Recently, we have studied It is defined as the reversible change in the magnetic
National Institute for Interdisciplinary Science & Technology 77 Annual Report 2017-18 Materials Science & Technology Division
metric tonnes ( 350 tonnes each ) of 2 grades of ilmenites ( 45% TiO2 and 55% TiO2 ). It was also planned to hire a commercial sponge iron rotary kiln of suitable capacity for the metallisation of ilmenite and set up a pilot plant at the premises of M/s. VV Titanium Limited, Tuticorin for further chemical processing such as rusting and leaching of metallised ilmenite. An agreement between CSIR-NIIST and VV Mineral was signed on July 07, 2016 to this effect. Details of the plant scale reduction of 2 grades of ilmenite in a commercial DRI rotary kilns and erection and commissioning of 5 MT/batch capacity rusting reactor and 2 MT/batch leaching reactor were reported in 2016- 17 along with the initial results. During the period under report, the pilot plant trials were completed at VV Titanium Pigment Pvt.Ltd., at Tuticorin, Tamil Nadu and all the required technical services were rendered by CSIR- NIIST during the entire course of pilot plant trials. Rusting of metallised ilmenite and its subse- quent leaching in the pilot plant: Aeration Rusting: the magnetocaloric properties of [REMIX]0.67Sr0.33MnO3 All the rusting experiments were carried out in a stirred , in which an inexpensive mixed rare earth oxides tank reactor of 14 M 3 volume capacity to handle 5 tonnes precursors derived from the Monazite sand have used. of metallisedilmenite /batch.
This compound is found to have significant values With a few initial rusting experiments carried out at of entropy change (ΔS) and adiabatic temperature 2 metric tonnes per batch, subsequent experiments change (∆Tad) around 310K (shown in the figure) which were carried out at the rated capacity of the rusting is advantageous from an applied perspective of room reactor, namely 5 MT/batch. The solid to liquid ratio was temperature magnetic refrigerators. Interestingly, maintained at 1:2.5 (w/v). Though, initial few trials were the material studied is cheaper in compared to the carried out using freshly prepared ferrous chloride as conventional RE based perovskites.We evidently present the catalyst, the same was replaced by ferrous chloride new information on the direct use of mixed rare earth oxides derived from monazite sand for the magnetic leach liquor recycled from the leaching reactor in the later refrigeration applications and a very detailed study trials. Rusting plant was commissioned on 14.01.2017. has been done to probe this phenomenon through Rusting and acid leaching operations were completed magnetization. on 22.05.2017. Following are the highlights of the rusting reactor operation: MINERALS Total quantity of reduced ilmenite handled = 346MT Pilot plant scale trials on upgradation of low Quantity of rusted product obtained: grade ilmenite by VV Minerals: TVP grade = 71MT Based on the encouraging results of earlier laboratory scale and higher scale of studies on metallisation and HT grade = 62MT rusting of 2 low grades of ilmenite, VV Mineral came Mixed product = 3MT forward to set up a pilot plant facility to process about 700 Iron Oxide obtained = 170MT
78 National Institute for Interdisciplinary Science & Technology Materials Science and Technology Division Annual Report 2017-18
The results of the chemical analysis of the few samples of ilmenite containing more than 90% TiO2 which is the the rusted product are given below: feedstock for the production of rutile grade TiO2 pigment. RESULT However, during some of the production campaign, Trial No pH Total Iron (%) TiO2 (%) when the reduction roasting parameters were slightly 20 4.30 9.54 87.41 changed, the resultant product from the roaster showed 21 4.10 9.75 87.26 poor leachability and thereby resulting a substandard 39 4.70 9.96 85.60 product of beneficiated ilmenite. KMML then approached 54 4.90 9.98 85.74 CSIR-NIIST for a detailed analysis of the raw materials and 58 4.70 10.01 85.46 intermediates and the final product from the point of 71 4.40 10.26 85.32 view of mineralogy and morphological changes. 73 4.35 9.78 86.54 The scope of present investigation covers mineralogical, The average composition of the final leached product geo chemical and morphological investigations of from different grades of ilmenite are as follows: KMML samples of raw ilmenite, reduced ilmenite, leached product and the final beneficiated ilmenite Ilmenite grade TVP Grade HT Grade produced under changed process conditions and TiO2 88.80% 90.30% compare the results with the samples generated under Fe O 9.34% 6.88% 2 3 normal campaign conditions. It is proposed to employ Post Pilot Plant Activities: characterization tools such as optical microscopy for mineralogical investigations. After the successful completion of pilot plant trials, M/s. VV Minerals has sent the final product samples to their METALLIC MATERIALS existing overseas customers for the feedback in terms of Al-Mg Alloys with Zr/Mn Additions for Aerospace product quality and commercial evaluation. applications: M/s. VV Minerals had also carried out a few experiments Aluminium alloys that exhibit an optimal combination on iron oxide by-product for sponge iron production in of strength, formability, fatigue resistance and corrosion collaboration with a sponge iron manufacturer. Initial resistance are desirable for the aerospace applications. results are quite encouraging. The addition of magnesium to aluminium increases the strength through solid solution strengthening and The customer feedback about the pilot plant product has improves their strain hardening ability. These alloys been very favourable in terms of TiO content and radio 2 are the high strength non heat-treatable alloys and are activity levels. therefore, used extensively for aerospace structural M/s. VV Minerals informed NIIST that they shall look into applications. These alloys derive their strength from the commercialization of the technology after finalizing the solid-solution strengthening due to magnesium. the commercial evaluation of the technology and a Other alloying elements such as scandium, chromium, scheme for iron oxide by-product utilization. manganese, and zirconium are added for the control of grain and subgrain structures, which also contribute to Mineralogical, geochemical and morphological strengthening. The trace elements (Sc and Zr) precipitate characterisation of raw ilmenite, reduced the dispersive distribution of Al (Sc, Zr) phase, which refine ilmenite, leached ilmenite and synthetic rutile: 3 the casting structure of the Al–Mg alloy and increases the Kerala Minerals and Metals Limited ( KMML) produce strength notably. The effect can be more remarkable by beneficiated ilmenite from ilmenite by adopting BCA partially replacing Sc with Zr to produce intermetallicsof process involving partial reduction of ilmenite followed Al3(Sc,Zr) dispersoids. Several experiments have been by 2 - stage pressure leaching using 18-20% regenerated carried out to verify the feasibility of Sc and Zr additions HCl acid in digesters for the selective removal of iron in for making high strength cast Al-Mg alloys. In this work, the the reduced ilmenite for the production of beneficiated role of alloying effects of Zr and Mn on the microstructure
National Institute for Interdisciplinary Science & Technology 79 Annual Report 2017-18 Materials Science & Technology Division
and mechanical properties of Al-Mg wrought alloys were Microstructure, Mechanical Properties and investigated to improve their mechanical properties so as Corrosion Behavior of Mg-Sb and Mg-Sb-Si to find cheaper alloying elements to replace scandium. alloys Al-Mg alloys containing 4-8% Mg were prepared with The effect of the microstructure, mechanical properties varying amounts of Zr and Mn (0.1 to 08% addition) as well as corrosion behavior of newly designed Mg- and the cast ingots were rolled to make plates and Sb (2, 4, 6, and 8 wt. %) and Mg-4Sb-Si (2, and 4 wt. %) sheets (6 mm and 2 mm). The mechanical properties, alloys were investigated. The results showed that the microstructure and the fracture behaviour of Zr containing microstructure of binary alloys were composed of α-Mg
alloys were characterised to find the alloys possessing and Mg3Sb2 whereas that of ternary Mg-4Sb-Si (2, 4 wt. %)
higher strength coupled with higher ductility refined alloys (consisted of α-Mg, Mg3Sb2 and Mg2Si intermetallic microstructure on addition of 0.2%Zr. The mechanical phases. Mg-4Sb-4Si alloy exhibited superior tensile, creep properties, microstructure and the fracture behaviour and corrosion properties in comparison to that of other and studies on the weldability and corrosion behaviour studied alloys. The significant improvement in tensile of Mn containing alloys under progress. properties at ambient temperature was associated with the dendrite refinement and presence of optimum
amount of Mg3Sb2 intermetallics along with Mg2Si intermetallics. Moreover, the presence of thermally stable
Mg3Sb 2 and Mg2Si intermetallic phases in the ternary alloys restricted the grain boundary sliding and dislocation movement at high temperature and thus improved the creep resistance. The intermetallics played a key role in
Fig.1 Rolled sheets (upto 2mm) of Al-Mg alloys containing Zr
Table.1 Role of Zr additions on the mechanical properties of Al-Mg alloys
Yield strength UTS Elongation Sl. No. Alloy (MPa) (MPa) (%)
1 Al-4Mg 195 245 30
2 Al-6Mg 251 335 24
3 Al-8Mg 261 360 21
4 Al-4Mg-0.2Zr 200 255 16
5 Al-6Mg-0.2Zr 260 315 20
6 Al-8Mg-0.2Zr 270 375 24
Figure 1: Microstructures of (a) Mg-8Sb (b) Mg-4Sb-2Si (c) Mg-4Sb-4Si showing morphology and distribution of different intermetallics
corrosion behavior of Mg alloys. Increase in the volume of
Mg3Sb2 in Mg-Sb alloys reduced the corrosion resistance
(a) Al-4Mg alloy (b) Al-4Mg-.2Zr alloy whereas Mg2Si intermetallics improved the corrosion Fig.2 Role of 0.2% Zr additions on the Microstructure of Al-4Mg alloys resistance of the Mg-Sb-Si alloys.
80 National Institute for Interdisciplinary Science & Technology Materials Science and Technology Division Annual Report 2017-18
Development of alumina nanoparticle that the contribution of Hall-Petch is predominant strengthened Al-Si alloy using compocasting followed by Orowan and solid solution strengthening. process through dendrite refinement, interfacial bonding and dislocation bowing Aluminum alloys with nanodispersions are gaining considerable attention as lightweight metallic materials in high-performance application areas of aerospace and defense sectors. Aluminum Nanocomposites (ANC) exhibits excellent mechanical properties, resistance to creep at the higher temperature and good fatigue strength compared to base aluminium alloys.The present investigation had evaluated the effect of varying percentage of alumina nanodispersions in strengthening and interfacial bonding with cast A356 aluminum alloy by modified compocasting followed by solidification using squeeze casting. Addition of 0.5 wt% Al2O3 nanoparticles to cast alloy shows remarkable enhancement in the yield strength from 204 to 323 MPa. They also exhibit higher hardness, UTS, compressive strength, thermal, tribological and corrosion properties. HRTEM image showed the insertion of Al lattice into the Al O crystalline 2 3 Fig. 3. HRTEM images of Al-0.5 wt% Al2O3nanocomposite lattice contributing to strengthening of the alloy. The by modified compocasting process showing (a) Al2O3 nanoparticles in aluminium matrix; (b) Crystalline lattice Al2O3 nanoparticles and the β’’ are involved in the Orowan of Al2O3 nanoparticle; (c) Al- Al2O3 interface bonding; (d) strengthening of Al nanocomposite. The presence of hard Dislocation looping and bowing in the Al- Al2O3 nanocomposite. Al O nanoparticles and the stronger bonding between Schematic diagram of (e) Dislocation mechanisms in three 2 3 different types of AMNC. particle and alloy constrain the dislocation motion leading to dislocation bowing. The theoretical estimation Processing of Particle-Assisted Breath Figures of Al -0.5 wt% Al O nanocomposite yield strength shows 2 3 in Polystyrene−Alumina Hybrid Free Standing Film: Polystyrene−alumina hybrid free standing films with amino-functionalized breath figure (BF) cavities were fabricated from a suspension of the amino-functionalized amphiphilic-modified alumina particles in polystyrene/ chloroform solution by employing a one-step casting process. The role of the film thickness and the particle concentration on the BF microstructural aspects such as the pore size, pore density, amino group surface density, etc. was reported. The dry film thickness increased from 0.91 to 5.6 μm on increasing the wet film thickness from 0.2 to 1 mm. The pore size increased with the film thickness, while the pore density and the porosity decreased. Figure 2. UTS and YS of (a) squeeze cast Al A356 alloy; (b) Al-0.25 wt% Relatively uniform pore size was observed for an∼3 μm Al O (c) Al-0.5 wt 2 3 thick film in which the moderately ordered BF pattern was
% Al2O3, and (d) Al-1wt% Al2O3, nanocomposites by more or less maintained up to a particle concentration modified compocasting process. of 5 wt % of the polystyrene content. While the 0.91 μm
National Institute for Interdisciplinary Science & Technology 81 Annual Report 2017-18 Materials Science & Technology Division
thick film exhibited through-pore structure, concavities cavities. The surface density of the amino functionality were formed in thicker films. The particle-assisted BF reduced on increasing the film thickness, whereas the formation favored the formation of amino-functionalized density increased with the particle concentration.
Fig 4. AFM 2D image and height profile of 0.91 μm thick film Fig 5. SEM images of 3 μm thick hybrid film containing different showing pore openings at the film surfaces (A) exposed toward alumina particle concentration of (A) 3 wt %, (B) 4 wt %, (C) 5 wt %, air (corresponding 3D image is shown in inset) and (B) in and (D) 6 wt %. contact with the substrate. The relatively low-size spots seen in B are assumed as surface roughness which might have been caused by particle setting.
82 National Institute for Interdisciplinary Science & Technology Environmental Technology Division Annual Report 2017-18
पर्यवरण प्र셌饍योगकी प्रभाग पर्यवरण प्रौ饍योगकी प्रभाग, प्रदषू ण नियंतण और 啍षे के प्राकृ तिक संसाधनⴂ के मलू ्वर्न के लिए स्देशी प्रौ饍योगिकिⴂ के सजनृ मᴂ सक्रिय 셂प से लगे हुए है । प्रभागीय गतिविधियां तीन मखु ् 啍ष配र मᴂ यानि अपशिष्ट ंप्रबधन, जल उपचार और पर्यवरण प्रभाव आकलन (ईआईए) पर कᴂ द섿त हℂ। ऐसे समय मᴂ, जब मौजदाू प्रणालियⴂ और प्रक्रियाओ ंकी वजह से हमारे नाजकु पर्यवरण मᴂ अपरणीू य क्ष होती रहती हℂ, इस 嵍पर ने शमन उपायⴂ के लिए अपशिष्ट जल और प्रदषू ण उपचार, फ् ल गैसⴂ की सफाई, मि絍ट के उपचार और अपशिष्ट ंधप्रब न समाधान मᴂ अपनी विशेषजता के माध्म से पहले से ही गठित दषिू त पदार्थो को हटाने के लिए प्रौ饍योगिकिⴂ का एक आला बना दिया है । खनन और बंदरगाहⴂ व हार्र के दो 啍ष配र मᴂ मान्ता के साथ एनआईआईएसटी केरल मᴂ एनएबीईटी- श्रेणी-ए मान्ता प्राप्त सलाहकार संगठन है । परियोजनाओ ंकी सांविधिक मजं रीू के लिए सरकारी और निजी 啍ष配र 饍वरा प्रभाग की ईआईए सेवाओ ं का उपयोग किया जाता है ।डीएसआईआर-एनआईआईएसटी-सीआरटीडीएच: एमएसएमई मᴂ पर्यवरण हस्啍षप के लिए एनआईआईएसटी मᴂ आम अनसु ंधान व प्रौ饍योगकी विकास हब स्थापत किया गया है। सखाु ये हुये नारियल, मछली भोजन और चावल मिल उ饍यग के लिए प्रौ饍योगकी तथा परामर् सेवाए ं प्रदान की गईहℂ । एससीआई पत्काओ ं मᴂ प्रकाशनⴂ के अलावा, "विनाश के बिना विकास" का एक पारिस्थितकी तंत बनाने के प्रयास के साथ आर एडं डी प्रयासⴂ को अभिनव, लागत प्रभावी प्रौ饍योगिकिⴂ मᴂ स्थनांतरित किया गया है । 2017-18 के दौरान की गयी प्रमखु परियोजनाओ ंकी मखु ् विशेषताए ं नीच े दी गई हℂ। हाइलाइट • जैविक अपशिष्ट डाइजस्र- सह बायोगैस संयंत के फील् अधि�ठपन और प्रौ饍योगकी हस्तातरण • केरल के लिए नगरपालिका ठोस अपशिष्ट ंप्रबधन समाधान • डाइऑक्सन अनसु ंधान और निगरानी • इडियं न रेअर अर् लिमिटेड, कोल्म, केरल 饍वरा समदु तट रेत खनिजⴂ के खनन के लिए पर्यवरण प्रभाव आकलन • बीपीसीएल कोची रिफाइनरी : एफ़ए् टं 絍रटमᴂट प्लाट • 配रवणकोर देवसम बोर्: को絍टराक्रा मदिं र के प्रवाह उपचार संयंत के डिजाइन के लिए कं सल्ᴂसी • रहदं सु ्तन लाइफके यर लिमिटेड: पीएमएसएसवाई योजना के तहत10 मेडिकल कालेजⴂ मᴂ सीवेज उपचार संयंत के लिए निविदा विनिर्श और मल्ू याकन • मछली कै निंग कारखाना, अल-बद समद्ु भोजन लिमिटेड एसईपीजेड, कोची के लिए गंध नियंतण बायोफिल्र • तकनीकी सलाहकार सेवाएं • शबरीमला सन्निानम 5 एमएलडी सीवेज 絍रटमᴂट प्लाट (एसटीपी)- निरीकण और समस्य निवारण सलाह • पंबा 10 एमएलडी सीवेज उपचार संयंत - प्रक्रिया डिजाइन अवधारणा और डिजाइन गणना का मल्ू याकन • रन絍ट जेलाटीन इडियं ा लिमिटेड - हड्डी के दर्ु लीकरण के लिए हाइड्रोक्लरिक एसिड की खपत को कम करने के तरीके • एनआईआईएसटी लाइसᴂसधारकⴂ- गैलेक्स एनवीरो प्रा. लिमिटेड, कालड़ी तथा एलिक्सर एनवीरोसिस्म प्रा. लिमिटेड के लिए हℂडहोल्डिग सेवा
National Institute for Interdisciplinary Science & Technology 83 Annual Report 2017-18 Environmental Technology Division
ENVIRONMENTAL TECHNOLOGY DIVISION The Environmental Technology Division is actively engaged in creating indigenous technologies for pollution control and value addition to the region’s natural resources. The divisional activities converge into three main areas of waste management, water treatment and Environmental Impact Assessment (EIA). At a time, when existing systems and processes are causing irreparable damage to our fragile environment, the group has made a niche in “end of the pipe” technologies for mitigation measures, through its expertise in waste water and effluent treatment, cleanup of flue gases, soil remediation and waste management solutions. NIIST is a NABET accredited, Category A consultant organisation in Kerala with accreditation in the two areas of Mining and Ports & Harbour. The EIA services are used by government and private sector for statutory clearance of projects. The DSIR-NIIST-CRTDH: Common Research and Technology Development Hub for environmental interventions in MSMEs has been set up at NIIST. Technology and consulting services have been offered to desiccated coconut, fishmeal and rice mill industries. Apart from publications in SCI journals, the R&D efforts have been translated into innovative, cost-effective technologies, striving to create an ecosystem of “development without destruction”.Highlights of the major projects carried out during 2017-18 are enumerated. Highlights $ Field installations and technology transfer of organic waste digester cum biogas plant. $ Municipal solid waste management solution for Kerala $ Dioxin research and monitoring $ Environment Impact Assessment for mining beach sand minerals by Indian Rare Earths, Kollam, Kerala. $ BPCL Kochi Refinery: Effluent Treatment Plant $ Travancore Dewasom Board: Consultancy for design of effluent treatment plant for Kottarakkara temple. $ Hindustan LifeCare Limited: Tender specification and evaluation for sewage treatment plant at 10 Medical Colleges under the PMSSY scheme $ Odour control biofilter for fish canning factory, Al-Badr Seafood Ltd. SEPZ, Kochi $ Technical advisory services $ Sabarimala Sannidhanam 5 MLD sewage treatment plant (STP) – inspection and troubleshooting advice $ Pamba 10 MLD sewage treatment plant – process design concept and evaluation of design calculations $ Nitta Gelatine India Limited – methods to reduce consumption of hydrochloric acid for bone maceration. $ Handholding service to NIIST licensees Galaxy Environ Pvt. Ltd. Kalady and Elixir Enviro System Pvt. Ltd.
84 National Institute for Interdisciplinary Science & Technology Environmental Technology Division Annual Report 2017-18
Comprehensive Municipal Waste produced across the state can be used in just one factory. Management Scheme for Kerala Suitable kiln burner and waste handling system is required for utilization of RDF in cement factory. The capital This project was sanctioned by the Department of investment for cement kiln burner replacement is lower Environment and Climate Change, Government of than that required for establishing a co-firing thermal Kerala, in 2016 with a budget of Rs.1crore. The municipal power station. There is no residual ash for disposal as ash waste management scheme examined various options is incorporated into cement clinker. There is no need for for waste collection, transport, treatment process and exhaust gas treatment because combustion temperature final disposal. Costs (capex and opex) were estimated and gas retention time in cement kiln is sufficient to and the best option was chosen. prevent formation of dioxins. The following collection systems were analyzed: i. Door-to-door collection, wet and dry segregated BMT – biodrying is the key technology for the scheme. household and commercial waste Biodrying is a method of using self-generated heat to ii. Door-to-door collection, mixed household waste dry municipal solid waste. After drying, the solid waste and wet commercial waste; Bin collection – dry is mechanically processed to separate metals and commercial waste; inert materials such as glass and stones, to produce a combustible, high-calorie fraction comprising plastics, Option ii. was optimal. Segregated collection was sub- paper, dry organic materials, textile fabrics, rubber, leather optimal because of the high cost of quality control etc. This fraction is shredded to required size and baled to required to maintain segregation efficiency. Quality produce RDF. It can be used as a fuel in thermal power control requires the waste collector to inspect waste generation. Process parameters required for design of before collection at each household. This requires time a biodrying plant for mixed waste were determined in a alongwith corresponding increase in wages. Without series of biodrying experiments. adequate control over quality of waste, downstream processing operation that assume segregation, will fail. Taking Thiruvananthapuram as a model, the waste transport requirements were estimated. The number of garbage trucks and collection autorickshaws, the fuel and maintenance costs were calculated. The optimal treatment process has the following components: i. BMT plant for biodrying mixed waste and dry waste with recovery of RDF ii. Anaerobic digestion of waste with power generation, dewatering and drying of digestate The following options for utilization of RDF were examined. i. RDF fired thermal power plant ii. Coal fired thermal power with 10% RDF substitution iii. Cement kiln with 25% RDF substitution Option III. Cement kiln is most economical and environmentally preferred option. Kerala has one cement factory which is a State Government Enterprise. The RDF Waste loading in 45 cm diameter reactor vessel
National Institute for Interdisciplinary Science & Technology 85 Annual Report 2017-18 Environmental Technology Division Cement Clinker Revision Fertilizers Cement Plant Discharge This document is the property of NIIST(CSIR) to any third party or usedfor other purpose other than that for which it is supplied or disclosed and shall not be reproduced, copied or disclosed Drying STP Power Landfill / Construction fill ROAD RAIL Government of Kerala Gas Client Inerts Designed AjitHaridas Checked Approved Drawn VijayaP Dewatering RDF Bales AD Plant 200 TPD BMT Plant 50 - 100 TPD Protien Animal Feed Compactor Truck Compactor Truck Compactor Truck CSIR Formerly Rendering Plant Regional Research Laboratory Collection Auto Industrial estate PO,Papanamcode,Trivandrum-695019 Paper/Plastic/Others Dry Fraction of Waste
Food/Veg./Organic Wet Fraction of Waste
Residential Waste Residential NATIONAL INSTITUTE OF INTERDISCIPLINARY SCIENCE & TECHNOLOGY Mixed/Composite Compactor Truck Household AD : ANAEROBIC DIGESTION, BMT BIOLOGICAL MECHANICAL TREATMENT RDF REFUSED DERIVED FUEL STP SEWAGE TREATM ENT PLANT TPD TONS PER DAY Commercial Establishment Slaughter House
86 National Institute for Interdisciplinary Science & Technology Environmental Technology Division Annual Report 2017-18
Various waste compositions were tested. Total of 37 experiments have been completed. Typical drying data is shown.
The temperature in the interior of the pile at various heights is shown, along with air flow, and weight loss. The drying is conducted for 10 d. Air saturated with moisture is pumped through the pile. Hence drying is exclusively by biologically generated heat. S-test refers to stopping air flow for 30 minutes and recording the rise in temperature. This indicates the heat production rate, a direct indicator of aerobic Pile at start of experiment and after 33 days biological activity in the region of the pile.
MSW Management for Kerala towns above 1 lakh population Estimate of investment and user fee for full cost recovery basis: Pop. Source of Waste Size; tpd Capital Rs./cr No. reqd Cost per kg waste Lakh fund Household mixed waste, /kg waste Door-to-door collection Commercial wet and dry source 400 8 14.55 4 Govt A ₹ 2.01 collected separated
Anaerobic Digestion Source separated commercial /kg waste 100 8 52.70 7 Govt B ₹ 0.69 Plant food / vegetable market waste treated
Biological Mechanical Mixed household waste / /kg waste 200 6 56.5 7 Govt C ₹ 1.57 Treatment plant commercial dry waste treated
Slaughterhouse offal / meat / Rendering plant 20 7 10 9 Private sector industry; profit making chicken / fish mart waste
/kg waste Sanitary landfill (36ha) Residue from BMT 54 11 12.5 3 Govt D ₹ 0.79 landfilled
RDF co-processing at Public sector industry RDF utilization - option 528 32 290 1 Malabar Cements Ltd
RDF co-firing 200 MW Thermal power plant RDF utilization - option 487 32 1500 1 Public sector 15% ROE new at Kayamkulam
Total cost = A + B + C + D*54/400 ₹ 4.38 per kg
User fee = Total cost + 15% contractor or operator profit ₹ 5.04 per kg
Monthly user fee per house (4 pa) ₹ 300 per month
Total investment (Government sector) ₹ 860 cr
Total investment (private and public sector industry) ₹ 380 cr
National Institute for Interdisciplinary Science & Technology 87 Annual Report 2017-18 Environmental Technology Division
Based on experiments conducted, the biodrying process with a microfiltration (MF) and a RO unit to guarantee design is formulated as : potable quality water. A demonstration scale unit was fabricated capable of treating ~200L/day. The unit was 1. Waste compostion: At least 60% organic waste tested with environmentally relevant perchlorate conc. with 55% to 60% moisture is suitable for biodrying, (15,000 ppb, similar to contaminated sites), and the with moist air. Wastes with lower organic matter treated water has perchlorate below the permissible and moisture need to be dried physically with level of 15 ppb (~99.93% removal), TDS below 25 mg/L unsaturated air. and without any bacterial cells. The RO reject (containing 2. Air to be supplied in upflow mode. Downflow mode trace perchlorate) will be diverted to the bioreactor where causes bottom layers to compact by wetness, it will be completely treated. causing high back pressure. 3. Air flow required 2 m3/kg waste/d; 4. Saturated air by air recirculation required for wastes with greater than 55% organic content. 5. Drying time 10 d 6. Mixing: Breakup agglomerates without mixing along depth on 4th day.
7. Bed height: 2 to 3 m. Lower bed height when waste A perchlorate contaminated community well closed by health moisture content is higher. department in Keezhmad panchayat, Aluva. 8. Air pressure: Varies from 150mm w.g. to 20 mm w.g. 9. Exhaust air odour destruction: Gas biofilter 10. Bed temperature maximum to be limited to 65oC. Mixing breakup of pile agglomerates required if temperature exceeds 65oC. Channels in pile through which dominant air flows occur should be not more than 45oC. 11. Temperature to be held above 50 oC for 24h within 4 days of loading for destruction of fly larve as they hatch Pilot scale bio-physical unit for treating perchlorate Following the laboratory investigations at NIIST, the bio contaminated ground water. drying concept is being proposed as a central technology The developed zero discharge process unit can be directly for comprehensive waste management in Kerala. taken to the contaminated sites for generating potable Bio-physical process for treating perchlorate water from the perchlorate contaminated community contaminated ground water well water. Based on the study of NIIST, three of the heavily contaminated community wells are presently closed CSIR-NIIST is the pioneer in environmental monitoring by the Kerala State health dept. The field installation of and remediation of perchlorate (rocket fuel) in India. An scale up unit can generate drinking water from these integrated bio-physical process unit was developed for contaminated wells for the local community. This will generating potable water from perchlorate contaminated be a sustainable approach compared to the existing ground water. In this process, the NIIST bioprocess with practice of providing alternate drinking water to the perchlorate reducing bacterial system was integrated local people. It has the added advantage of reducing the
88 National Institute for Interdisciplinary Science & Technology Environmental Technology Division Annual Report 2017-18 environmental level of perchlorate at the contaminated site, thus preventing spreading of the pollutant to wider areas. Field installation and Technology transfer of NIIST compact organic waste biogas plants Field installation of four units of NIIST compact organic waste biogas plant was done during the period. Two units were designed for treating up to 50kg food waste (wet weight)/day. One of the units was installed at Regional NIIST biogas unit installed at Kayamkulam Cancer Centre (RCC) Trivandrum. It is generating biogas mainly from the food waste from the hospital wards and canteen. The biogas generated was supplied to the RCC canteen. The biogas yield from the unit was nearly 7000 Lit/day. The official inauguration of the unit was done by Dr T.N. Seema, the chairperson of Clean Kerala Mission. The second unit was installed at Marthoma Charity unit, Thiruvananthapuram. The performance data generated will be used for scaling up of the existing units to handle Small capacity NIIST digester installed at a farmer house for recovering larger capacity. The average biogas yield from these units biogas from cow dung. will be around 170 Lit/kg food waste with >65% methane. This technology was licensed to a Kerala-based industry, The total solid loading was maintained at ~4.5 Kg/M3.day. Swatch Future Energy Solutions,for a fee of Rs. 12 lakhs. The volatile solids (VS) removal was found to be almost As per the agreement with the industry, NIIST will be hand 90%, and the slurry was highly stable without and foul holding the industry for scaling up and field installation smell. It was calculated that the biogas yield from 250 Kg of more units. food waste will be ~ one 19 Kg LPG cylinder or 80 KWh (@160 L/kg food waste). The third unit of medium size is installed at Pathiyoor panchayat in Alapuzha district (Kerala). This was done in a consultancy project mode with CPCRI-ICAR (Kayamkulam unit). The unit was installed at a farmer house for recovering biogas from cow dung. For this purpose, the original design of NIIST digester was customized with design modifications. Around 60 kg per dayof cow dung was loaded into the reactor, and the biogas recovery was about 4000 Lit/day. Technology Document transfer of NIIST organic waste digester Dioxin Research & Monitoring CSIR-NIIST has the state of the art sophisticated analytical testing facilities and technical know–how for the monitoring of dioxins and furans. Ministry of Environment & Forests (MoEF) has recommended CSIR-NIIST as a referral laboratory for dioxin analysis for environmental clearances in sectors such as ship NIIST food waste biogas unit installed at RCC Trivandrum
National Institute for Interdisciplinary Science & Technology 89 Annual Report 2017-18 Environmental Technology Division
breaking yard including ship breaking units, airport, sampling equipments. Isokinetic dioxin stack samplers common hazardous waste treatment plant, storage and were employed for the particulate and vapour sampling. disposal facilities, ports and harbours, CETPs, common In 2- 3 waste dump yards, field sampling was also carried municipal solid waste management facility etc. Kerala out for comparative evaluation with the emission factors State Pollution Control Board has awarded CSIR-NIIST a observed in real field samples. project on “Determination of emission factors of dioxins A series of experiments were carried out to optimize from open burning of municipal solid wastes in Kerala”. the analytical workflow and procedures for the sample The prime objective is to generate authentic data and to extraction, cleanup and quantification. We have focussed create an inventory of dioxin emission from open burning on three types of samples (a) stack air (b) residual ash of municipal solid wastes in Kerala. and (c) real waste dump yard soil. Manual as well as Kerala being one of the most densely populated states automated methods were employed for the extraction in India, solid waste management is a major issue. The and cleanup. A state of the art high resolution gas semi-urban population spread, acute scarcity of land chromatography coupled with triple quadruple mass and inadequate investments in waste management has spectrometer (Agilent Technologies) was employed for created a crisis situation. Kerala generates 6000 T of waste the quantification of dioxins and furans. every day as per the survey done in 2006. The quantum of In a typical experiment, about 10 kg of composite waste waste generated will be much higher in 2017 due to rapid is burned under simulated conditions in the burn hut improvement in quality of life. Unscientific & unhealthy and the stack sample and residual ash samples were practices such as open burning of municipal solid waste collected. A representative quantity of ash (10 g) and are prevailing in the state due to lack of an organized the stack sample were analysed following the optimized waste management plan. Waste incineration is a major workflow. source of unintentional production of dioxins and furans, which are highly toxic and persistent in the environment. For emission factor calculation, we considered only the It is reported that the emission of dioxins and furans emission under wet condition, as MSW open burning is are much higher during open burning of wastes in carried out using wet waste and the average moisture comparison to well-engineered waste incinerators. No level is between 60% and 80%. reports are available in India on the emission factors of The average emission factor of dioxins to air and land dioxins from such open burning practices. is 5.1 & 34.71 µg PCDD-F TEQWHO/ ton respectively of The formation of dioxins depends on combustion waste burned. The estimated annual emission of dioxins conditions and waste composition. The typical waste in Thiruvananthapuram city is 0.19 g TEQ per annum to composition of major cities in Kerala was collected. air and 1.27 g TEQ per annum to residual ash (land). It was A simulated waste burning facility (Burn Hut) was constructed at CSIR-NIIST to carry out the waste combustion experiments. There are several difficulties to determine the emission factor of dioxins by sampling and analysing typical open burn sites. It includes (a) no control on the composition of waste (b) variation in air flow rates and wind direction and (c) dispersion of the target analyte into soil, ash and other sorbents in the waste making it difficult to quantify. The burn hut is equipped with blower fan to discharge desired air flow, platform with load cells to monitor the weight losses, thermocouples to monitor temperature and a stack sampling port to Simulated waste combustion experiments and isokinetic insert the isokinetic probe and a railed platform to set the stack sampling
90 National Institute for Interdisciplinary Science & Technology Environmental Technology Division Annual Report 2017-18
from the mining activity. A purely physical process separates the heaves and no chemicals are used. The mined out heaves are transported to mineral separation plant and the mined voids are refilled simultaneously making space for revegetation / resettlement. The mineral concentrate can be transported by trucks or by waterway using NWAI developed TS canal.
The primary data generation are ongoing for the study area and the buffer area .No major industries exist in the core area except M/s. Kerala Minerals & Metals Limited (KMML) which is about 2.5 km from the IREL Mineral Separation Plant. The monitoring programme shall specify the locations, parameters, and frequency of monitoring of significant aspects. Capacity building in terms of staff, technical expertise and monitoring facilities shall also be suggested. The report shall lay stress on the probable occupational health hazards involved and the remedial measures. Data regarding the existing socioeconomic conditions shall be collected and Social Impact Assessment (SIA) will be prepared. EIA study for the Block-IV and Block IV EE (Total ML area : 220.566 ha.) of Indian Rare Sampling of Dump yard soil for Dioxin emissions Earths Ltd. Chavara, Kollam . calculated assuming an average quantity of 100 tons of The proposed project includes two mine leases, Block- wastes is being openly burned in Thiruvananthapuram. IV and Block Block IV EE. In block –IVEE, IRE proposes to A one day workshop on "Advanced Analytical Solutions in enhance the capacity from 2,37,500 tpa to 7,50,000 tpa . Dioxin Analysis" in collaboration with Agilent Technologies The capacity expansion using two dredgers is mainly due was organized on 5th January 2018 at CSIR-NIIST. The to the pressure from the locals to mine the area at a faster workshop was organized for knowledge dissemination rate and give back the land within three years. and creating awareness to testing laboratories, The core zone of this mining lease areas NK Block-IV: is industries, regulatory bodies, research institutes and 40.566 ha and NK Block-IV EE is 180 ha The buffer zone environmentalists in the latest trends in dioxin analysis. shall be 10 kilometers all around the periphery of the core Environmental Impact Assessment study for zone for ML exceeding 50 ha and buffer zone shall be 5 mining area IREL NK block NK block- II EE. kms in case of ML area up to 50 ha. The scope includes literature survey, field studies, impact assessment and Indian Rare Earths Ltd (IREL) has appointed CSIR-NIIST, preparation of the EIA document. to evaluate the environmental aspects and their possible associated impacts that would arise due to the proposed The EIA report is prepared based on the mining plan and heavy mineral sand mining operations and to work out the method of mining proposed to be adopted for the environmental management plans and environmental area and the production rate proposed for each area. It monitoring programme to prevent, control, minimize or identifies the existing environmental conditions, predict eliminate the adverse environmental impacts envisaged impacts and suggest environmental safeguards and
National Institute for Interdisciplinary Science & Technology 91 Annual Report 2017-18 Environmental Technology Division
develop post project monitoring programme to ensure The dust emission prediction model developed using environment friendly mining and transportation of the Envitrans MINE Fugitive Dust Modelling Pro shows concentrate. incremental increase in pollution but the values are within the CPCB limit prescribed for PM10( 100µg/m3per day). The report looks into the viability of barge economics which appears to be a feasible option for transporting mineral concentrate using TS canal (part of NW3 waterway) to IREL plant. The mining of sand and separation of HM concentrates, eventually contributes to a reduction in the overall level of radiation in the environment, which is a relief to the inhabitants in the area. 550 families were covered under the socioeconomic survey in the project affected areas of Alappad, Panmana PM 10 Mean PM 10 Mean NAAQS and Ayanivelikulangara of Kollam district. An amount of Site name (Present (During Mining) STANDARDS Rs. 159.00 lakhs is earmarked for post-project monitoring conc.) initially which include capital and recurring expenditure. PHC Vella- 53 63 100 The recurring expenditure will be about Rs. 113 lakhs/ nathuruth year. Cheriyazheekal 54 55 100 Testing and Analytical Services Amrithanan- Facility for testing and analysis of water, soil and sediment 49 50 100 damyi Math samples for various physicochemical and water quality Kozhikode 45 45 100 parameters is used by various government departments, research institutions, students from universities and colleges, public & private sector agencies and private individuals. The samples are routed through the testing and analytical cell. Computational Modeling @ NIIST The Computational Modeling group is a centre for interdisciplinary research, applying computational techniques to a wide range of phenomena and processes, leading to the creation of software technologies in diverse areas: metal casting and welding, hydrodynamics of Block IV multiphase chemical reactors like rotary kilns, stirred and Feature (Ha) fluidized bed reactors,systems biology and data analytics. Fallow land 128 This group also provides computational support to other groups within the Institute. Marshy Land 29 AutoCAST X1- FLOW+ software Dried water bodies 93 Virtual Casting is a software package for the simulation Mixed vegetation 29856 of solidification process of industrial castings and was Settlements 19600 developed by CSIR-NIIST. In 2011, the Virtual Casting Solver Technology was transferred to 3D Foundry Tech Water bodies 1630 Pvt. Ltd., (3DFT) a company incubated in the Indian
92 National Institute for Interdisciplinary Science & Technology Environmental Technology Division Annual Report 2017-18
Institute of Technology Bombay. This company maintains AutoCAST X1-FLOW+ is available from 3D Foundry Tech and markets AutoCAST which uses an integrated easy- Pvt. Ltd. 507-C, Ecstasy Business Park City of Joy, JSD to-use environment for casting method design, solid Road, Mulund (W) Mumbai – 400 080, India. Phone: +91 modeling, and simulation. During 2012-13, Virtual 98921 00072 E-Mail: [email protected] Casting Solver was integrated with their casting design SMART Foundry2020 software AutoCAST, giving birth to AutoCAST X1-FLOW+ The project Sustainable Metal Casting by Advanced software. During 2013-18, AutoCAST X1-FLOW+ has Research and Technology was sanctioned by DST for Rs. been showcased at various Indian Foundry Exhibitions. 8.25 crores with a contribution of RS. 1.25 crores from five Till date, More than 150 licenses of AutoCAST-X1 has been sold to various ferrous, non-ferrous foundries and Academic Institutes in India and abroad by 3D Foundry Tech Pvt. Ltd. The focus this year has been on the modification of the novel mold filling algorithm by including the pressure head and inertia effects. This innovative, realistic & quick mold filling software module has been released in the new version of AutoCAST X1- Release 11.9.1. Based on the new MOU which was signed during January 2017, we remain partners for rendering technical support to the private industry 3D Foundry Tech Pvt . Ltd., Mumbai for a period of five years starting from April 2017. The first user meet of AutoCAST was held at Kolhapur on 15 Nov 2017. There were over 50 participants from across Printing, Molding Unit with sand reclamation system India: Kolkata, Belgaum, Shimoga, Kolhapur, Ichalkaranji. private industrial partners, CSIR-NIIST being the project The Customers presented case studies covering quality coordinator and the amount sanctioned for CSIR-NIIST is and yield improvements. Rs. 3.32 crores for a period of three years. The objective is to develop and demonstrate an ultra compact SMART Foundry which will have fully integrated sensor driven systems with unique and novel features to make small intricate metal parts with high quality.
User meet of AutoCAST X1
National Institute for Interdisciplinary Science & Technology 93 Annual Report 2017-18 Environmental Technology Division
The entire facility can be set up as a micro manufacturing unit with very little investment. Computational Biology In silico prediction of ErbB signal activation from receptor expression profiles through a data analytics pipeline The ErbB signaling pathway has been studied extensively owing to its role in normal physiology and its dysregulation in cancer. The popular reductionist approach of reverse engineering with equation-based modelling has succeeded in throwing light on the process of signal transduction, in parts and patches, generating repositories of unconnected data. Re-engineering by analytics and learning models can probe into these databanks to help piece together a system level understanding of signaling networks. Particularly, in an agent-based representation, quantitative link between receptor expression, dimer patterns, structures, and system behaviour emerge by concentrations and signaling outcomes. This knowledge self-organization of interacting heterogeneous agents. can be translated to predict patient-specific ErbB The concept of a pipeline architecture has been used activation and signaling dynamics which can eventually to construct an agent-based model to establish a be used to guide personalized therapies.
94 National Institute for Interdisciplinary Science & Technology Research Planning & Business Development Annual Report 2017-18
RESEARCH PLANNING AND BUSINESS DEVELOPMENT Contract Research Projects 2017-2018 Agro Processing And Technology Division
Client Project Title Project Leader
Dept. of Agricultural Settting up of technology business incubation centre Mr V V Venugopal University, Govt.of Kerala
Dept. of Agricultural Setting up a ginger processing plant at Wayanad Mr V V Venugopal University, Govt.of Kerala
KSCSTE Can enrichment of Palm Neera Syrup cause immunomodulation Dr M V Reshma
Bio processing of two coded anti-diabetic medicinal plants based DBT Dr P Jayamurthy on ethnomedical leads- A molecular pharmacological approach
BisIndolylmethane conjugates of Biaryls: Role in apoptosis, KSCSTE cell cycle regulation and PI3K/AKT/mTOR signalling pathway in Dr S Priya human breast and cervical cancer cells
Occurrence of acrylamide, a heat induced food toxicant, in Food Safety & Standards processed food products of India: mitigation strategies and Dr P Nisha Authority of India health risks
Dept. of Agriculture, Post-harvest operations for value addition of indigenous fruits Dr P Nisha Govt.of Kerala and vegetables
M/s. Arjuna Natural Antidiabetic validation of natural product fractions Dr P Jayamurthy Extracts Limited
M/s. Tata Chemicals Co. In vitro evaluation of nutritional and probiotic activity of Dr P Nisha Ltd., sweeteners
Dissect the function of fundamental cilia-genes associated with DBT Dr Shobi Veleri ciliopathies in patients
Role of mitophagy in cardiac hypertrophy: an in vitro cell line DST Dr Vandana Shankar approach
Evaluation of beneficial effect of Boeravinone-B from Boerhaavia Dept. of Health Research, diffusa against diabetic cardiomyopathy through mitochondria Mr Salin Raj/ New Delhi mediated pathway in H9c2 cardiomyoblast and heart for Dr Raghu K G development of nutraceuticals
Dept. of Health Research, Development of biflavonoid based lead molecule (NIIST –OBT-2) Dr G Sindhu/ New Delhi from Garcinia travancorica for non-alcoholic fatty liver disease Dr Raghu K G
National Institute for Interdisciplinary Science & Technology 95 Annual Report 2017-18 Research Planning & Business Development
MICROBIAL PROCESSES AND TECHNOLOGY DIVISION
Stereoselective synthesis of chiral alcohols of Pharmaceutical DBT importance via microbial oxido reductases: Process development Dr P Binod and scale-up
Integrated technologies for economically sustainable bio- based Dr Rajeev K DST energy Sukumaran Improved cultivation, taxonomy and functional characterization DST of rare and novel rhizobacterial genomes of plants grown in Dr N Ramesh Kumar abiotic stress soils Bioprospecting and taxonomic studies of marine micro Ministry of Earth Sciences Dr N Ramesh Kumar organisms in search of novel anti-infective Dr Rajeev K TIFAC Centre for bio fuels Phase II Sukumaran Characterization, recombinant expression, process scale up Dr Rajeev K DBT validation of selected hydrolases from native action bacteria for Sukumaran commercial exploitation
Bioprospecting of microalgal resources for nutritionally SERB, DST Dr Muthu Arumugham important high value lipid production
Investigation on the synergistic effect of phytohormones on DBT Dr Muthu Arumugham omega -3- fatty acid production from Nanochloropsis sp.
Exploration and exploitation of microflora from Marcha and soil IBSD, Manipur samples from high altitude soils for the production of 2,5-furan Dr P Binod dicarboxylic acid and selected industrially important enzymes
Loktak lake biomass (para- grass) based biorefinery for fuels Dr Rajeev K IBSD, Manipur and chemicals: Value addition through biotechnological and Sukumaran thermochemical platform
Direct utilization of agroresidual biomass for the production of Dr Madhavan DBT α,ω-diamines as well as α,ω-amino acids: strain and process Nampoothiri development using Corynebacterium glutamicum
Molecular approach to enhance folate production in probiotic Dr Madhavan KSCSTE lactic acid bacteria Nampoothiri
Development of a gene expression platform for heterologous Dr Rajeev K DBT protein production in the filamentous fungus Aspergillus unguis Sukumaran
The development of stabilized formulations of biopesticides and Dr Rajeev K M/s. T Stanes & Co. Ltd., biofertilizers Sukumaran M/s. Margosa Biogrow Development of a bioprocess for the commercial production of Dr Madhavan India Pvt. Ltd., Gujarat Gibberellic acid Nampoothiri Development of a sustainable process for the production of poly- DST Dr R Sindhu 3-hydroxybutyrate using kitchen and food waste Holistic processes and practices for clean energy in strengthening DST – INDO - NORDEN Dr. Binod P bio economic strategies
96 National Institute for Interdisciplinary Science & Technology Research Planning & Business Development Annual Report 2017-18
CHEMICAL SCIENCES AND TECHNOLOGY DIVISION
Organic based hybrid thermoelectric materials for low cost M/s. GAIL(India) Ltd., Dr Biswapriya Deb refrigeration usage
Dye Sensitized Solar Cell (DSSC)/ Quantum dot dye sensitized MNRE Dr Joshy Joseph solar cell Design and synthesis of multifunctional organic – DNA conjugates DST Dr Joshy Joseph for biomolecular applications Cucurbit[n] uril homologues and their derivatives as receptors for DST Dr Rakesh Mishra a few ionic and neutral analytes Development of novel organic materials for photovoltaic DST Dr C Vijayakumar applications Silver starch hydrogel hybrid nanocomposite for anti microbial KSCSTE Dr J D Sudha wound healing applications
Synthesis utility of dienaminodioate for synthesis of 1,2- KSCSTE Dihydropyridines and its resulting derivatives for evaluation of Dr L Ravi Shankar their anti-microbial, anti-tuberculosis & anti-malarial potential
DST Solar Hydrogen: An alternative avenue Dr Suraj Soman
Novel protocols for the construction of carbon-carbon and DST carbon- Hetero atom bonds mediated by nucleophilic hetero Dr K V Radhakrishnan cyclic carbenes and phosphines Transition metal/ Lewis acid mediated reactions of strained DST diazanorbornes and carbonyl compounds: Efficient access to Dr K V Radhakrishnan biologically relevant scaffolds
Sulfonimidamides: Its synthesis and applications in organic Dr Ganesh Chandra DST synthesis; Development of new methodologies for the synthesis Nandi of heterocyclic systems Fluorescent molecules and assemblies for sensing and imaging (J DST Dr Ajayaghosh A C Bose Fellowship) Design, synthesis and studies of self-assembling luminescent DST (FAST TRACK) Dr Praveen V K metallo- peptides
Charge carrier transport in polymeric and organic DST semiconducting thin films for application in light emitting diodes, Dr Narayanan Unni field-effect transistors and photovoltaic devices
Investigation of ultra fast dynamics of chromophores involved in Dr Karunakaran DST singlet exciton fission processes towards solar cell applications Venugopal
Synthesis a library of Aza-C KRN 7000 and Aza galacto lipid SERB, DST Dr L Ravi Shankar analogues for immunomodulatory screening Development of synthetic strategies for diverse compound KSCSTE Dr L Ravi Shankar collection of privileged structural motifs for medicinal chemistry
DST New materials for improved, cost-effective perovskites solar cells Dr Joshy Joseph
SERB Nano structured electrodes for energy storage devices Dr Raghy Raghavan
National Institute for Interdisciplinary Science & Technology 97 Annual Report 2017-18 Research Planning & Business Development
Gold nanorod based targeted nanoprobe for cancer theranostics: DBT Diagnosis by Surface Enhanced Ramam Scattering (SERS) and Dr K K Maiti fluorescence imaging and therapy by PDT and PTT
Modulating the morphology and molecular packing of self- SERB assembled organic nanomaterials for efficient photo-induced Dr K Yoosaf electron transfer
Development of flexible solar cells through innovative ISRO Dr J D Sudha photoanode/ Active later systems
DST Low cost photonic device for diagnostic applications Dr Animesh Samanta
Quantum chemical modelling of CC and CN metathesis reactions SERB and functional molecules containing unusual carbon-metal Dr C H Suresh bonds
Development of novel NIR absorbing sensitizers and their nano- DBT Dr Joshy Joseph conjugates for the multi model cancer imaging and therapy
SERB Nature Inspired chemical entities for healthcare applications Dr B S Sasidhar
Ministry of Science & Indigenous development of Semi-automatic equipments for large Dr Narayanan Unni Technology, DST area dye-sensitized solar module fabrication
Design and processing of nano structured hybrid composite DST Dr Narayanan Unni materials for electro chemical energy storage Dynamic molecular, supramolecular and surface chemistry Dr Sreejith Shankar SERB, DST for spatiotemporal modulation of smart advanced functional Pooppannal materials Development of multiplexing detection platform of breast cancer DST markers by non-invasive Surface Enhanced Raman Scattering Dr K K Maiti (SERS)- Nanoprobe Mechanical stimulation induced microscopic crystalline structure SERB changes in molecular materials: Implications on drug formulation Dr Sunil Varughese and mechanochromic behaviour
Development of a condensation/dipolar cycloaddition strategy DBT towards highly functionalized heterocycles and its applications in Dr Jubi John medicinal/ material chemistry & chemical biology
MATERIALS SCIENCE AND TECHNOLOGY DIVISION
Development of photo catalytic reactor based on the wide spectrum nanotitania- organic hybrids for decomposition of dyes BRNS Dr Saju Pillai and recovery of precious additive / solvent on spent laser dye solution
M/s. Noritake Co. Ltd., Adsorbants for gas and vapour molecules. Rational design of Dr S Ananthakumar Japan materials, porous nano structures and surface chemistry
Tailoring of magneto structural phase transitions near the BRNS room temperatures in inter metallic alloys for the magnetic Dr Vasundhara M refrigeration applications
98 National Institute for Interdisciplinary Science & Technology Research Planning & Business Development Annual Report 2017-18
Aluminium –Silicon piston alloy development by squeeze casting DST Dr M Ravi process for strategic application
Delaminated surfactant free layered double hydroxides as DST Dr Bhoje Gowd multifunctional fillers for semicrystalline polymers
M/s. SRF Ltd. Microstructure analysis of industrial yarns Dr Bhoje Gowd
Mineralogical, geochemical and morphological characterisation KMML of raw ilmentite, reduced ilmenite, leached ilmenite and Dr. Harikrishna Bhat synthetic rutile
Alumina based LTCC & HTCC substrate for hybrid microelectronic DST Dr K P Surendran circuits in strategic sector applications
Development of ceramic membranes and setting up of a pre- DST (TSDP) Dr U S Hareesh pilot plant manufacturing facility Developments of environmentally benign inorganic pigments for SERB Dr K G Nishanth energy saving cool roof and anti-corrosive applications Technology development of recycling of aluminium (SARAPS) DST Dr M Ravi alloys for industrial applications
Synthesis and characterization of broad spectrum ultraviolet filter with visible light emission and antioxidant activity: A DST Dr Adersh Ashok potential multifunctional active ingredient with multitude of applications
Process development for enhancing the longevity of coir Coir Board Dr V S Prasad geotextiles (Coir Bhoovastra)
Development of magnetically modulated therapeutically Dr Manoj Raama SERB active layered double hydroxide (LDH) as a nanomedicine with Varma hyperthermia potential for cancer theranostics
Coir Board, Kochi Bio plastic from poly( Lactic acid)/ Coir composites Mr M Brahmakumar Process development for surface modification of coir fibres for Coir Board, Kochi Dr Bhoje Gowd enhanced spin ability SERB Designing green, self-healing coatings for metal protection Dr K G Nishanth
Quantitative assessment of hot tearing characteristics of Aeronautical Research aerospace magnesium alloys using instrumented constrained rod Dr A Srinivasan and Development Board casting (CRC) technique
Development of light weight functionally graded metal- ceramic ARMREB, New Delhi Dr T P D Rajan composite armour materials for defence applications
Investigation of structural, optical, magnetic properties and DST electronic structure of binary inter-metallic alloys for the Dr M Vasundhara spintronic applications Development of novel magnetodielectric materials for Dr. Manoj Raama ISRO miniaturized microstrip patch antennas Varma
National Institute for Interdisciplinary Science & Technology 99 Annual Report 2017-18 Research Planning & Business Development
ICDD Generation of structural data for new ceramic complex oxides Dr. Prabakar Rao
M/s English Indian Clays, Value addition of EICL Silica sand and clay residue for novel Dr S Ananthakumar Trivandrum commercial products and sustainable business
M/s. Aditya Birla Development of hydrophobic glaze for porcelain insulator Dr. S. Ananthakumar Insulators, West Bengal
ENVIRONMENTAL TECHNOLOGY DIVISION
Novel hybrid nanostructured surface modified electrodes for DST Dr K P Prathish sensors and biosensors
Analysis of water samples from Chimery, Vazhavi & Cheerakuzhi KSRSE, Govt.of Kerala Dr. K P Prathish river basins
Common research and technology development- Hub for DSIR Dr Ajit Haridas environmental intervention in the MSME Sector
Algal biomass as a potential renewable resource of energy: Dr Churchil Angel DST Production of fuels & chemicals by heterogeneous catalysis Antony Raj
Kerala State Pollution Determination of emission factors of dioxins from open burning Dr K P Prathish Control Board of municipal wastes in Kerala
Development of chloride free saleable iron oxide from by- DST Dr K P Prathish products of Titanium pigment production via chloride route
Department of Biodrying: A comprehensive model waste management scheme Environment and Climate Dr Ajit Haridas for Kerala Change
SMART FOUNDARY (SMART= Sustainable Metalcasting using DST Dr S Savithri Advanced Research and Technology)
100 National Institute for Interdisciplinary Science & Technology MoUs Agreements Signed ConsultancyAnnua Programmesl Report 2017-18 2017-18
Consultancy Programmes 2017-18
Client Project Title Project Leader
M/s. Omgene Life Sciences Pvt. Synthesis of ER-4 Dr L Ravi Shankar Ltd., Gujarat
M/s. Apicore Pharmaceuticals Pvt. Characterization and confirmation of drug intermediates Dr L Ravi Shankar Ltd. Vadodara
M/s. Western India Cashew Estimation of phenolics in cashew –formulation and validation Dr J D Sudha Company Pvt. Ltd. of procedure
Dept. of Agricultural University, Setting up of a ginger processing facility in Wayanad Mr V V Venugopal Govt.of Kerala
M/s. SRF Ltd., Chennai Microstructure analysis of industrial yarns Dr Bhoje Gowd
Mineralogical, geochemical and morphological KMML, Kollam characterisation of raw ilmenite, reduced ilmenite, leached Dr Harikrishna Bhat ilmenite and synthetic rutile
KMML, Kollam EIA study for KMML pond Dr J Ansari
IRE EIA study for IRE block IV& IV EE, Kollam Dr J Ansari
IRE EIA and EMP study for IREL NK Block-II & NK Block-II EE Dr J Ansari
M/s. HLL Infra Tech Services Ltd., Hospital STP design Dr Ajit Haridas Trivandrum
Analysis of water samples from Peechi and Chalakkudy KSRSEC, Govt.of Kerala Dr K P Prathish irrigation project
Odour control and effluent pre-treatment at Al Badr Fish M/s. WAPCOS Ltd., Cochin Dr Ajit Haridas Canning unit at CSEZ, Kakkanad
Analysis of water samples from Chimery, Vazhavi & Cheera KSRSEC, Govt.of Kerala Dr K P Prathish kuzhi river basins
M/s. 3D Foundry Tech Pvt. Ltd., Additional module for Flow+ for prediction of fill related and Dr S Savithri Mumbai soldification related defects in investment casting process
National Institute for Interdisciplinary Science & Technology 101 हस्鄾Annकuaर किl Repoए एमओयrt 2017-18ू / समझ ौते MoUs Agreements Signed
हस्鄾कर किए एमओयू / समझौते क्र. हस्鄾कर की शीर्क एमओय ू / समझौते 嵍रहक परियोजना प्रधान सं तारीख कास्टिग भरने और ठोसकरण 26.09.2011 को निष्पादत मेसेर् 3डी फाउंडरी टेक प्रा. लि., 507-सी इकटेसी बिजनेस सिमलेशनु के लिए बौद्धिक डॉ. एस सावित् 1 11.04.2017 समझौते के लिए अनपु रकू पार् , सिटि ऑफ जॉय, जेएसडी रोड, मलू ंद (डब््)य मबईंु संपदा का हस्तातरण 400080, भारत
अकादमिक औ饍योगक मेसेर् केएससीएसटीई (केरला स्टट काउंसिल फॉर साइस,ं डॉ. नारायणन उण्ण 2 अनसु ंधान की साझेदारी 12.04.2017 एमओय ू टेकनोलॉजी एडं एवां यरमᴂट) एडं विनविश टेक्नलाजी प्राइवेट -पीआईआरआईआर लिमिटेड
गैस और वाष् अणओु ंके मेसेर् नोरिटेक कं ., लिमिटेड, 1-36 नोरिटेक-शिनमाची 3 डॉ. य ू एस हरीश 3 लिए सिरेमिक एडसोरबᴂट्स का 28.04.2017 셂पांतर विलेख कोमी, निशि-कू , नागोया 451-8501, जापान (नोरिटेक- विकास आरडीसी)
इजीं नियरिंग विषयⴂ मᴂ शि啍ष मेसेर् दी फैकल्ट ऑफ इजिनियं रिंग एडं 嵍रे्एटय स्क ल ऑफ शैक्षक और वै煍ञानक डॉ. विजयकु मार सी 4 और वै煍ञानक अनसु ंधान पर 24.05.2017 इजिनियं रिंग, कयोटो यनिू वर्सटी, कयोटोडाईगाकू -कटसरा,ू सहयोग के लिए एमओयू पारस्रिक सहयोग का बढ़वा । निशिक्य-कू 6158630, कयोटो
फै ब섿केशन सिस्म / तदनकु ू लित मेसेर् एलिक्र टेक्नलॉजी, बℂगलोर एडं मेसेर् ईगेनं डॉ. नारायणन उण्ण 5 01.06.2017 एमओय ू मॉडल कं सल्ᴂट्स प्रा. लि., त्वᴂदम, केरल, भारत
मेसेर् एसआरएफ लिमिटेड, सी-8 सफदरजंग डवलपमᴂट औ饍योगक यार् के स啍ू ष संरचना डॉ. भौजे गौड 6 01.06.2017 परामर् परियोजना एरिया, नई दिल्ल प्रिसिपल ऑफिस: मनाली, इडं स्ट्ल वि�लेण ं एरिया, मनाली, चेन्ई- 600068, भारत
पारस्रिक गैर प्रकटीकरण मेसेर् विबफास् पिगमᴂट प्रा. लि., (‘विबफास्’), सी- एनआईआईएसटी-अकार्बनक डॉ. निशांत के जी 7 14.07.2017 और साम嵍र हस्तातरण 1,91/6, जी.आई.डी.सी., बℂक ऑफ इडियं ा के पीछे, फेज-।, रंजक का मल्ू याकन समझौते वटवा, अहमदाबाद, गजरात,ु भारत
शैक्षक और वै煍ञानक सहयोग डॉ. य ू एस हरीश 8 15.07.2017 एमओय ू मेसेर् शिबौरा इस्टं ट्यटू ऑफ टेकनोलॉजी, टोक्य, जापान के लिए एमओय ू परबॉइल चावल मिल इफ्एल् टं मेसेर् गैलेक्स एनविरोन (एसएसआई यनिू ट के 셂प मᴂ ), डॉ. अजित हरिदास 9 से रंग का निष्कसन 18.07.2017 तकनीकी हस्तातरण एयरपोर् रोड, म絍टर जंक्न, कालडी, एर्नकू लम, केरल, - 683 574
मेसेर् अरजना् नाचरलु एक्絍रक्स लिमिटेड, डोर नं. 7/8, बℂक रोड, आलवा,ु केरल – 683101 प्राकृ तिक उत्पद अशⴂं का सहयोगात्क अनसु ंधान के डॉ. जयमरू ्त पी 10 24.07.2017 एडं एटीडाइबें टिक सत्यपन लिए समझौता आर एडं डी डिविजन,डोर नं. 187/डी, ए셁मथला पीओ, की�माड – 683112, केरल विभिन् औषधीय पौधⴂ मेसेर् सरकारी आयरु 핇द कॉलेज, एमजी रोड, ति셁वनंतपरमु डॉ. के वी राधाकृ ष्न 11 और फोरलेशनम् ् का विस्त 25.07.2017 एमओय ू 695001 वै煍ञानक वि�लेण मोटर वाहन अनप्रु योगⴂ के लिए मेसेर् टाटा मोटर् लि., बॉम्ब हाउस, 24 होमी मोदी स絍रट, डॉ. एम रवि 12 उच㔚 शक्ति एल्मीय नियम मिश्र 11.08.2017 गोपनीय मबईंु – 400 001, महाराष絍र, भारत धात ु का विकास
102 National Institute for Interdisciplinary Science & Technology MoUs Agreements Signed हस्鄾Annकर किuaएl Repoएमओयrt ू 2017-18/ समझ ौते
रबर रसायनⴂ के लिए मेसेर् एसोसिएटेड रबर के मिकल् प्रा. लि., 34/1397 ए, पारस्रिक गैर प्रकटीकरण डॉ. जेडी सधु ा 13 सीएनएसएल आधारित रेजिन 23.08.2017 एसोकेम चℂबर्, एनएच-47 बाइपास, इडप्ल्ल, कोच्च समझौता का विकास 682024
कम्ूनिटय साइज एनारोबिक मेसेर् स्च् फ्ूय र एनर् सॉल्शन,य टीसी-42/1411(1), डॉ. बी कृ ष्कु मार 14 30.08.2017 तकनीकी हस्तातरण डाइजेस्र श्रीपादम 212 संगमम नगर, ति셁वनंतपरमु 695008
15.09.2017 एमओय ू का विस्तर रासायनिक परीकण (एमओय ू (एमओय ू हस्तार मेसेर् एनवायरो डिजायन इको लैब्, इको टॉवर, जनता डॉ. जे असारीं 15 (24.03.2018 तक का विस्तर) करने की तिथि: जंक्न, पलारीवटम, एर्नकु लम, कोच्च – 682025 / 25.03.2013) विस्鄾र
वद्धिृ और लिपिड उत्पदन का मेसेर् अबान इ굍ं रासक㔚र लिमिटेड, बॉयोटेक्नलाजी आकलन करने के लिए 1000 डिविजन, जनप्रिया क्रे स्, 113, पांनथोन रोड, इगमोर, चेन्ई डॉ. मत्तु 酁 अ셁मगमु 16 लीटर कमतावाले खलेु रेसवे 23.10.2017 गैर प्रकटीकरण समझौता – 600008 तालाब मᴂ नैनोक्लरोप्सस स्पसीज की खेती
व�नी, चिमनी और चीराकु ष़ मेसेर् केरल स्टट रिमोट एडं एनवायरनमᴂट सᴂटर सिंचाई परियोजना नदी घाटी का परामर् परियोजना के लिए डॉ. के पी प्रतीश 17 28.10.2017 (केएसआरईसी), विकास भवन, पीएमजी, ति셁. केरल, वि�लेण और पोस् और प्री समझौता 695033 मानसनू जल नमनाकरणू
वाणिज्यक उपयोग के लिए मेसेर् जीजे नेचर के यर एडं एनर् प्रा. लि., XXIV/603 अपशिष्ट प्रसंस्रण पर डॉ. अजित हरिदास 18 30.10.2017 गोपनीय समझौता थोलानिकु न्नल बिल्डिग, ति셁वांकु लम पीओ, कोच्चन, अनसु ंधान और अपशिष्ट का केरल – 682305 ऊर्ज प्रौ饍योगिकिⴂ मᴂ विकास
मेसेर् ओमजीन लाईफ साइसं प्रा. लि., 333 जीआईडीसी मैसर् ओमजेन लिमिटेड को परामर् परियोजना के लिए डॉ. एल रवि शकरं 19 10.11.2017 इडं स्ट्ल एस्टट, मखारपरा,ु वडोदरा, गजरातु 390010, तकनीकी परामर् समझौता भारत
स्देशी फलⴂ और सब्जिⴂ के निदेशक, कृ षि विकास विभाग और किसान कल्यण विभाग, डॉ. पी निशा 20 मलू ् संवर्न के लिए फसलोत्तर 20.11.2017 एमओय ू ति셁वनंतपरम,ु केरल आपरेशन
गैर प्रकटीकरण समझौते के लिए मेसेर् आईटीसी लि., 37, जवाहरलाल नेह셁 रोड, कोलकत्ता डॉ. माधवन नंपतिू रि 21 24.11.2017 गैर प्रकटीकरण समझौता समझौता - 700 071, भारत
पोर्सलेन बिजली के इसं लेटरु पर अकार्बनक / कार्बनक सहयोगात्क / सहकारी के मेसेर् आदित् बिरला इस्ं लेटय र्, प्रभास नगर, रिश्रा, जिला, डॉ. एस अनंतकु मार 22 06.12.2017 हाइड्रोफोबिक सतह कोटिंग् के लिए समझौता हुगली, वेस् बंगाल – 712249, भारत अनप्रु योग
तकनीकी परामर् परियोजना प्रदान करने के लिए समझौता मेसेर् ओमजीन लाईफ साइसं प्रा. लि., 333 जीआईडीसी परामर् परियोजना के लिए डॉ. एल रवि शकरं 23 (सगामाडेकु ् इपं ्रय िटि एसडी-2 12.12.2017 इडं स्ट्ल एस्टट, मखारपरा,ु वडोदरा, गजरातु 390010, समझौता और डाइड्रोजेस्टरॉन इटरमीं डिएट भारत डीजी2)
National Institute for Interdisciplinary Science & Technology 103 Annual Report 2017-18 MoUs Agreements Signed
स्वटनरⴂ की पौष्टिक और मेसेर् टाटा के मिकल् लि., बॉम्ब हाउस, 24 होमी मोदी सहयोगात्क अनसु ंधान के डॉ. निशा पी 24 प्रीबॉयोटिक गतिविधि का वि絍र 20.12.2017 स絍रट, फोर् मबईंु – 400 001, महाराष絍र, भारत लिए समझौता मल्ू याकन
सोलानम नि嵍रम से उत्तरोसिड बी का अलगाव, सरचना राजीव गाधी सᴂटर फॉर बॉयोटेक्नलॉजी, पजप्रा, तायकॉड डॉ. एल रवि शकरं 25 ं 08.01.2018 सहयोगात्क समझौता ं ू प स्पष्टकरण और उत्तराइड बी पीओ, त्वᴂदम अन셂पताओु ंका सं�लेण
मेसेर् ए嵍रकल㔚र स्कल काउंसिल ऑफ इडियं ा डॉ. निशि पी 26 कौशल विकास 05.02.2018 एमओय ू (एएससीआई), 6वां फ्लर, जीएनजीटी टॉवर, बिल्डिग नं- 10, सेक्र-44, ग셁嵍ु रम, हरियाणा – 122004, भारत
मौजदाू समदु तट धोने के खनन और एमएसपी के लिए परामर् सेवाओ के लिए मेसेर् केरल मिनरल एड मेटल्, चवरा, कोल्म – डॉ. जे असारीं 27 23.02.2018 ं ं पर्यवरणीय प्रभाव आकलन समझौते का संशोधन 691583, केरल अध्यन का संचालन
कॉयर जिऑ टैक्स्ईल् की कॉयर बोर् रजिस्टर एट कॉयर हाउस, एमजी रोड, कोच्च डॉ. वी बी मणिलाल दीर्घा बढ़ने के लिए (कॉयर य – 682016 भवस्त्र) प्रक्रिया विकास ु संशोधन दिनांक 06.03.2018 (मलू एमओयू 28 पॉली (लैक्टक एसिड) / कॉयर एमओय का सशोधन / कॉयर बोर् रजिस्टर एट कॉयर हाउस, एमजी रोड, कोच्च डॉ. वी बी मणिलाल 03-08.2016 ू ं कपोजिटस से जैव-प्लास्क – 682016 ं ् को हस्तारित)
वर्धत स्पिनिबिलटी के लिए कॉयर बोर् रजिस्टर एट कॉयर हाउस, एमजी रोड, कोच्च डॉ. वी बी मणिलाल कॉयर फाइबर का सतह – 682016 संशोधन के लिए प्रक्रिया विकास
जिब्बरेलिक एसिड के प्रायोजित अनसधान के मेसेर् मरगोसा बॉयो嵍र इडिया प्रा.लि., 113-सिल्र लाइन, डॉ. माधवन नंपतिू रि 29 वाणिज्यक उत्पदन के लिए 15.03.2018 ु ं ं लिए समझौता सायाजीगज, वडोदरा- 390005, गजरात बायोप्रोसेस का विकास ं ु
मेसेर् एयरपोर् अथारॉटी ऑफ इडिया, त्वᴂदम इटरनेशनल अपशिष्ट धप्रब न के लिए पायलट ं ं डॉ. कृ ष्कु मार बी 30 ं 23.03.2018 एमओय एयरपोर्, ति셁वनतपरम – 695008 परियोजना का कार्यन्वन ू ं ु
फर्नर अनप्रयोगⴂ के लिए मेसेर् नेशनल कॉयर रिसर् एड मैनेजमᴂट इस्टट्यट ु ं ं ू श्री बह्मकु मार एम 31 पॉलिमर / कॉयर कं पोजिट्स का 28.03.2018 एमओय ू (एनसीआरएमआई), (केरल सरकार), कु डप्नाक्क न्,न पीओ, उत्पदन ति셁वनंतपरमु – 695043, केरल
104 National Institute for Interdisciplinary Science & Technology MoUs Agreements Signed Annual Report 2017-18
MoUs / AGREEMENTS SIGNED
SN Title Date MoU/ Agreement Client Project Leaders
Transfer if intellectual Addendum M/s. 3D Foundry Tech Pvt. Ltd., 507-C property for casting to Agreement 1 11.04.2017 ECTASY Business Park, Citi of Joy, JSD Dr.S Savithri filling and solidification executed on Road, Mulund (W) Mumbai 400080, India simulation 26.09.2011
M/s. KSCSTE (Kerala State Council for Partnering Academic 2 12.04.2017 MoU Science, Technology and Environment) and Dr.Narayanan Unni Industrial Research -PAIR Vinvish Technologies Private Limited
Development of ceramic M/s. Noritake Co., Limited., 1-36 Noritake- 3 adsorbents for gas and 28.04.2017 Deed of Variation Shinmachi 3 Chome, Nishi-ku, Nagoya 451- Dr.U S Hareesh vapor molecules 8501, Japan (Noritake-RDC)
Promote mutual MOU for M/s. The Faculty of Engineering and cooperation on education Educational Graduate School of Engineering, Kyoto 4 24.05.2017 Dr.Vijayakumar C and scientific research in and scientific University, Kyotodaigaku-Katsura, Nishikyo- the engineering discipline. cooperation ku 6158530, Kyoto, Japan
M/s. Elixer Technology, Bangalore and M/s. Fabrication system/Tailor 5 01.06.2017 MoU Engen Consultants Pvt. Ltd., Trivandrum, Dr.Narayanan Unni made models Kerala, India
M/s. SRF Limited, C-8, Safdarjung Microstructure Analysis of Consultancy Development Area, New Delhi PRINCIPAL 6 01.06.2017 Dr.Bhoje Gowd Industrial Yarns Project OFFICE: Manali Industrial Area, Manali, Chennai - 600068, India
Mutual Non- M/s. VIBFAST Pigments Pvt. Ltd., Evaluation of NIIST Disclosure and ("VIBFAST"), C-1, 91/6, G.I.D.C., Behind Bank 7 14.07.2017 Dr.Nishanth K G -Inorganic Pigments Material Transfer of India, Phase-I, VATWA, Ahmedabad, Agreement Gujarat, India
MoU for Educational and M/s. Shibaura Institute of Technology, 8 15.07.2017 MoU Dr.U S Hareesh Scientific Cooperation Tokyo, Japan
M/s. Galaxy Environ (as SSI Unit), Removal of colour from Technology 9 18.07.2017 Airport Road, Mattoor Junction, Kalady, Dr.Ajit Haridas parboil rice mill effluent Transfer Ernakulam, Kerala - 683 574
M/s. Arjuna Natural Extracts Limited, Door Agreement for Antidiabetic validation of N o . 7 / 8 , B a n k R o a d , A l u v a , K e r a l a - 6 8 3 1 0 1 10 24.07.2017 Collaborative Dr.Jayamurthy P natural product fractions and R & D Division at Door No. 187/D, Research Erumathala P O, Keezhmad - 683112, Kerala
Detailed scientific analysis M/s. Government Ayurveda College, MG 11 of different medicinal 25.07.2017 MoU Dr. K V Radhakrishnan Road, Thiruvananthapuram 695001 plants and formulations
National Institute for Interdisciplinary Science & Technology 105 Annual Report 2017-18 MoUs Agreements Signed
Development of high M/s. Tata Motors Ltd., Bombay House, 24 strength Aluminum Confidentiatlity 12 11.08.2017 Homi Mody Street, Mumbai - Dr.M Ravi Alloy for Automotive Agreement 400 001, Maharashtra, India Applications
Development of CNSL Mutual Non- M/s. Associated Rubber Chemicals Pvt. Ltd., 13 based resin for rubber 23.08.2017 Disclosure 34/1397 A, Assochem Chambers, NH-47 Dr.J D Sudha chemicals Agreement Bypass, Edapally, Kochi 682024
M/s. Swatch Future Energy Solution, TC- Community size Technology 14 30.08.2017 42/1411(1), Sreepadam, 212 Sangamam Dr.B Krishnakumar Anaerobic Digester Transfer Nagar, Thiruvananthapuram 695 008
15.09.2017 Extension of MoU M/s. Envirodesigns Eco Labs, Eco Chemical Testing (MoU 15 (Extension Upto Tower, Janatha Junction, Palarivattom, Dr. J Ansari (EXTENSION OF MOU) signed date: 24.03.2018) Ernakulam, Kochi - 682025 25.03.2013)
Cultivation of Nannochloropsis sp. M/s. ABAN Infrastructure Limited., in 1000L capacity Nondisclosure Biotechnology Division, Janapriya 16 23.10.2017 Dr.Muthu Arumugam open raceway pond to Agreement Crest, 113, Pantheon Road, Egmore, assess growth and lipid Chennai-600008 production
Post and Premonsoon water sampling and Agreement for M/s. Kerala State Remote and Environment analysis of vazhany, 17 28.10.2017 cunsultancy Centre (KSREC), Vikas Bhavan, PMG, TVPM, Dr.K P Prathish chimony and cheerakuzhy project Kerala 695033 irrrigation project river basins
Research and develop M/s. GJ Nature Care & Energy Pvt. Ltd., waste processing Confidentiality XXIV/603. Tholanikunnel Buildings, 18 and waste to energy 30.10.2017 Dr.Ajith Haridas Agreement Thiruvankulam P O, Cochin, Kerala technologies for - 682305 commercial use.
Providing technical Agreement for M/s. Omgene Life Sciences Pvt. Lt.d, 19 Consultancy to M/s. 10.11.2017 cunsultancy 333 GIDC Industrial Estate, Makharpura, Dr. L Ravi Shankar Omgene Ltd project Vadodara, Gujarath - 390010, India
Post Harvest operation Director, Department of Agriculture for value addition of 20 20.11.2017 MoU Development and Farmers Welfare Dr.P Nisha indigenous fruits and Department, Thiruvananthapuram, Kerala Vegetables
Agreement for Non- Non Disclosure M/s. ITC Ltd., 37, Jawaharlal Nehru Road, Dr.Madhavan 21 24.11.2017 Disclosure Agreement Agreement Kolkata - 700 071, India Nampoothiri Application of Inorganic/ Organic Hydrophobic Agreement for M/s. Aditya Birla Insulators, Prabhas Nagar, 22 Surface coatings on 06.12.2017 collaborative / Co Rishra, Dist. Hooghly, West Bengal - 712249, Dr.S Ananthakumar porcelain electrical operative India Insulators.
106 National Institute for Interdisciplinary Science & Technology MoUs Agreements Signed Annual Report 2017-18
Agreement is for providing Technical Agreement for M/s. Omgene Life Sciences Pvt. Lt.d, Consultancy project 23 12.12.2017 cunsultancy 333 GIDC Industrial Estate, Makharpura, Dr. L Ravi Shankar (Sugammadex impurity project Vadodara, Gujarath - 390010, India SD-2 & Dydrogesterone intermediate DG2) Vitro Evaluation of Agreement for M/s. TATA Chemicals Limited, Bombay 24 Nutritional and Prebiotic 20.12.2017 Collaborative House, 24, Homi Mody Street, Fort, Mumbai, Dr.Nisha P Activity of Sweeteners Research Maharashtra 400001, India
Isolation, structure elucidation of uttoside B Collaboration M/s. Rajiv Gandhi Centre for Biotechnology, 25 form solanum nigrum and 08.01.2018 Dr. L Ravi Shankar Agreement Poojappura, Thycaud PO, Trivandrum synthesis of Uttroside B analogues
M/s. Agriculture skill council of India (ASCI), 6th Floor, GNGT Tower, Building No-10, 26 Skill Development 05.02.2018 MoU Dr.Nishy P Sector-44, Gurugram, Haryana - 122004, India
Conducting Environmental Amendment of Impact Assessment study Agreement for M/s. Kerala Minerals and Metals, Chavara, 27 23.02.2018 Dr.J Ansari for the Existing beach Consultancy Kollam- 691583, Kerala wash mining & MSP Services
Process developement for enhancing the longivity of Coir Board,Registered at Coir House, M G Dr.V B Manilal coir geo textiles Road, Kochi- 682 016 (COIR BHOOVASTRA) Amendment dtd: 06.03.2018 Bio- Plastics from Amendment of 28 (Original Coir Board,Registered at Coir House, M G poly(Lactic Acid)/ Coir MoU Dr.V B Manilal MoU Road, Kochi- 682 016 Composites signed dtd: 03.08.2016) Process development for surface modification of Coir Board,Registered at Coir House, M G Dr.V B Manilal coir fibers for enhanced Road, Kochi- 682 016 spinnability
Development of a Agreement M/s. Margosa Biogrow India Pvt. bioprocess for the Dr.Madhavan 29 15.03.2018 for Sponsored Ltd., 113-Silver line, Sayajigunj, commercial production of Research Vadodara-390005, Gujarat Nampoothiri Gibberellic acid
Implementation of M/s. Airports Authority of India, Trivandrum 30 pilot project for waste 23.03.2018 MoU International Airport, Thiruvananthapuram Dr.Krishnakumar B management - 695008
M/s. National Coir Research & Production of Polymer/ Management Institute (NCRMI), (Govt. 31 Coir Composites for 28.03.2018 MoU Mr.Brahmakumar M of Kerala), Kudappanakkunnu P.O, Furniture Applications Thiruvananthapuram - 695043, Kerala
National Institute for Interdisciplinary Science & Technology 107 पेटᴂटAnnual Report 2017-18 Patents
पेटᴂट भारत मᴂ दायर पूर् दर् करने की एनएफ सं. शीर㔷क आविष्唾रक आवेदन सं. तारीख डेवलपमᴂट ऑफ़ सुपर हाइ蕍셋फोबिक अय्यपन पिल्ल अजयघोष, 0165NF2017/ कोटिंग् फॉर एन셍煀 सेविंग बलरामन वेधनरायणन, राहुल देव 18/अ啍酂 बर/2017 201711037002 इंडिया मैके निकल मोशन एंड रिलेटेड मुखोपाध्यय अप㔪्लकेशंस शशिधर बालप्प सोमप्प, 0218NF2017/ ꥍ셋सेस फॉर दि प्परेशन ऑफ़ चेट紿याल थोड़ी फाथिमथ 06/फरवरी/2018 201811004385 इंडिया पैरिलियम साल्ट् सल्굀ना, अय्यपन पिल्ल अजयघोष
0219NF2017/ हाइब섿ड प्लनर लाइट कॉन्ᴂ絍रटर विथ आदर㔶 अशोक, अय्यपन पिल्ल 15/मार्/2018 201811008500 इंडिया अडाप्टेल ट्रसपेरᴂसी अजयघोष, अनिमेष एम रामचंद्रन
विदेश मᴂ दायर
पूर् दर् करने की एनएफ सं. शीर㔷क आविष्唾रक आवेदन सं. तारीख
शंकर शशिधरन, राजेश कोम्न, लांथानम फॉस्फ ट बेस् कोटिंग् अब्ल अज़ीज़ पीर मोहमद, 0163NF2014/ द एंड मोनोलिथ् आस नॉन -रिएक्टव सोलाइअप्न अनंतकु मार, 18/अꥍरल/2017 15816254.5 यूरोप सरफेसेस फॉर मोलटेन मेटल् उण्णकृ ष्न नायर, सरस्ती हरीश, कृ ष्ण गोपकु मार वार्र
न्य इनऑर嵇निक ब्ल पिगमᴂट्स 굍रम 0112NF2014/ कोबाल् डोप् मैग्नीशयम हैविंग पडला पभाकर राव, सरस्ती 02/अगस्/2017 15828669.0 यूरोप ट्राीशन एलिमᴂट ऑक्सिᴂस एंड ए दिव्य ꥍ셋सेस फॉर ꥍरपरिंग दि सेइम
भारत मᴂ मंजूर अनमोदित एनएफ स. शीर㔷क आविष्唾रक ु पेटᴂट स. ं तारीख ं
ए ꥍ셋सेस फॉर दि इन -सीटू प्परेशन वडक्क मडत鄿ल �रकु मार, 0352NF2005/ ऑफ़ MgAl O री- इंफोर्स रामन मारीमुत् पिल्ल , बेल्लमुत ् 2 4 26/मई 2017 283590 इंडिया एल्यमीनियम मैट्रि कं पोजिट्स यूसिंग चंद्रशेखर पाई, ताष़ावला पोन् न सॉलिड सिलिका देवराज राजन, मधुसूधन चक्रबोर्
108 National Institute for Interdisciplinary Science & Technology Patents Annual Report 2017-18पेटᴂट
ए ꥍ셋सेस फॉर दि डिटेक्न एंड दानबोईना रामय्य, एलिज़ाबेथ 0015NF2006/ क्वॉन्टेशन ऑफ़ सिंगल स絍रैंड कु 셁विला 19/जून/2017 284314 इंडिया डीएनए यूसिंग फ्लरोसᴂट मार् र अंडर चामी अ셁मुखन, नूयंपडितरईल फिजियोलॉजिकल पीएच कं डीशंस माधवन सौम्य, अरिम्बर रंजीत
आन इमꥍ셋व् ꥍ셋सेस फॉर दि 0098NF2007/ आइसोलेशन ऑफ़ 2, 5-डाइ हाइ蕍셋क्स चामी अ셁मुखन, नूयंपडितरईल 18/जुलाई/2017 285296 इंडिया -1, 4-बᴂज़ोक्वनोन डेरिवेटिव् लाइक माधवन सौम्य, अरिम्बर रंजीत एम्बेलन 굍रम नेचुरल रिसोर्स
मॉलिक्यलर इम्प्टेड पॉलीमर पार्टकल् या माइक्र셋 बीडस फॉर सेलेक्टव 0052NF2009/ ् करमला पसाद, जोसफ मेरी डी- टॉक्सिफकेशन ऑफ़ एंडोसल्फन 01/अगस्/2017 285979 इंडिया ग्लडिस, तलशिला पसाद राव कं टामिनटेड नेचुरल वाटर् एंड ꥍ셋सेस फॉर प्परेशन देरोफ़
मेटल ऑक्सइड मॉडिफाइड एड ं वर्स सौम्य, कृ ष्ण पिल्ल 0169NF2010/ अन्मडिफाइड मोलेक्लरली इम्पटेड य ् पद्मजा कमारी पतीश, तलशिला 05/दिसबर 2017 290312 इडिया कडक्टग पॉलीमर फिल् बेस् एक्स ु ं ं ं ि पसाद राव एमिनोएसिड सᴂसर्
ए ꥍ셋सेस फॉर डीकम्पोीशन ऑफ़ शुक्ल सत्यीत विष्ण, वार्र 0102NF2012/ आर嵇निक सिथेटिक डाइज यूसिग ं ं कृ ष्ण गोपकमार, बाब बबिता 01/ मार् /2018 293723 इडिया सेमीकडक्र -ऑक्साइड नैनो टयब् ु ू ं ं ् ू कन्नपरम्बल वाया डार् कटैलिसीस ु त
दानबोईना रामय्य , सुनीश सी नोवल पोर्फ रीन डेरिवेटिव् फॉर करणकरन, वाडक्नचेरिल एस फोटो डायनामिक थेरेपी (पीड़ीटी ): ए जिशा, तवेरेकरे के चनद्रशेखर, 0147NF2009/ ꥍ셋सेस फॉर दि प्परेशन देरोफ़ एड अलगर �रीनवासन, माधवन ं 14/ मार् /2018 294263 इंडिया देयर यूस आस पीड़ीटी एजᴂट्स एंड राधाकृ ष् पिल्ल, शिवकु मारी फ्लओरेसेन् ꥍ셋ब् फॉर बायोलॉजिकल आशा नायर, सनीश बाबू पी सरस, अप㔪्लकेशन् चिंतलागिरी मोहन राव, कंु चला �रधर राव
सिथेसिस ऑफ़ अल絍रफाइन 셂टाइल जेराल् देवदासगयम सरᴂदर, अनी 0239NF2003/ ं ु फे ज टाइटेनियम डाइऑक्सइड करियम्पनर जॉन, कमारापिल्ल 23/मार्/2018 294839 इडिया ु ू ु ं पार्टकल् राजᴂद्र पसाद, शिवरामन सावित섿
National Institute for Interdisciplinary Science & Technology 109 पेटᴂटAnnual Report 2017-18 Patents
विदेश मᴂ मंजूर
एनएफ सं. शीर्क आविष्करक अनुमोदित तारीख पेटᴂट स.ं
सेमीकं डक्र ऑक्सइड नैनो ट्यूब् -फ्लई ऐश एंड सेमि कं डक्र शुक्ल सत्यीत विष्ण, ऑक्सइड नैनो ट्यूब् -मेटल ऑक्सइड 0022NF2013/ पाडिञ्ञटईल हरीश, कम्पोजट पार्टकल्, देयर ꥍ셋सेसिंग 10/मई/2017 201480002356.7 चीन नारायणी हर्ष, जोस मनु, वाया आयन -एक्चᴂज मैके निजम, एंड क셁णाकरण रम्य मेथड्स फॉर देयर री साइकिलिंग इन दि डाई -रिमूवल अप㔪्लकेशंस देरोफ़
ए ꥍ셋सेस फॉर डीकम्पोीशन ऑफ़ शुक्ल सत्यीत विष्ण, 0102NF2012/ आर嵇निक सिंथेटिक डाइज यूसिंग वार्र कृ ष्ण गोपकु मार, 31/मई/2017 CN 104736485 B चीन सेमीकं डक्र -ऑक्साइड नैनो ट्यूब् बाबू बबिता कु न्नतपरम्बल वाया डार् कटैलिसीस
ए नोवल मेथड ऑफ़ डेवलपिंग नैनो पनंपिल्लल विजयम्म 0188NF2011/ -स्ट्रक सिल्र ऑक्सइड फिल् शुभा , वर्स सौम्य, 30/जून/2017 ZL201380007195.6 चीन बेस् एक्स वोलटामेट्क पेस्टसाइड तलशिला पसाद राव सᴂसर
ए नोवल मेथड ऑफ़ डेवलपिंग नैनो पनंपिल्लल विजयम्म 0188NF2011/ -स्ट्रक सिल्र ऑक्सइड फिल् शुभा , वर्स सौम्य, 30/जून/2017 6167114 जापान बेस् एक्स वोलटामेट्क पेस्टसाइड तलशिला पसाद राव सᴂसर
ए स्क रैन बेस् फ्लरोसᴂट ꥍ셋ब फॉर सेलेक्टव लेबलिंग एंड सᴂसिंग ऑफ़ 0180NF2012/ सिरम एल्ब्यून ꥍ셋टीन्, पीएच अय्यपन पिल्ल अजयघोष, 04/ अ啍酂 बर 2017 3039082 嵍रट ब섿टेन मॉनिटरिंग एंड थिओल इमेजिंग इन पालाप्परवन अनीस सेल् एंड ए ꥍ셋सेस फॉर दि प्परेशन देरोफ़
ए स्क रैन बेस् फ्लरोसᴂट ꥍ셋ब फॉर सेलेक्टव लेबलिंग एंड सᴂसिंग ऑफ़ 0180NF2012/ सिरम एल्ब्यून ꥍ셋टीन्, पीएच अय्यपन पिल्ल अजयघोष, 04/ अ啍酂 बर 2017 3039082 फ्रस मॉनिटरिंग एंड थिओल इमेजिंग इन पालाप्परवन अनीस सेल् एंड ए ꥍ셋सेस फॉर दि प्परेशन देरोफ़
110 National Institute for Interdisciplinary Science & Technology Patents Annual Report 2017-18पेटᴂट
ए स्क रैन बेस् फ्लरोसᴂट ꥍ셋ब फॉर सेलेक्टव लेबलिंग एंड सᴂसिंग ऑफ़ 0180NF2012/ सिरम एल्ब्यून ꥍ셋टीन्, पीएच अय्यपन पिल्ल अजयघोष, 04/ अ啍酂 बर .2017 3039082 डेन्मार मॉनिटरिंग एंड थिओल इमेजिंग इन पालाप्परवन अनीस सेल् एंड ए ꥍ셋सेस फॉर दि प्परेशन देरोफ़
ए स्क रैन बेस् फ्लरोसᴂट ꥍ셋ब फॉर सेलेक्टव लेबलिंग एंड सᴂसिंग ऑफ़ 0180NF2012/ सिरम एल्ब्यून ꥍ셋टीन्, पीएच अय्यपन पिल्ल अजयघोष, 04/ अ啍酂 बर 2017 3039082 यूरोप मॉनिटरिंग एंड थिओल इमेजिंग इन पालाप्परवन अनीस सेल् एंड ए ꥍ셋सेस फॉर दि प्परेशन देरोफ़
ए स्क रैन बेस् फ्लरोसᴂट ꥍ셋ब फॉर सेलेक्टव लेबलिंग एंड सᴂसिंग ऑफ़ 0180NF2012/ सिरम एल्ब्यून ꥍ셋टीन्, पीएच अय्यपन पिल्ल अजयघोष, 17/अ啍酂 बर 2017 9791451 यूएस मॉनिटरिंग एंड थिओल इमेजिंग इन पालाप्परवन अनीस सेल् एंड ए ꥍ셋सेस फॉर दि प्परेशन देरोफ़
ब्ल कलर् इनऑर嵇निक पिगमᴂट्स, हैविंग नियर इं굍ररेड रिफ्लेक्न् , 0009NF2012/ मुण्लपुड़ी ल啍ष्पति बेस् ओण मिक्चर् ऑफ लंथानम 31/अ啍酂 बर /2017 9803063 यूएस रेड्डी, शीतू जोस , स絍रोंन्शयम, कॉपर एंड लिथियम सिलिकेट एंड ꥍ셋सेस देरोफ़
सेल् हीलिंग सिलिका बेस् लो कु ष़चालिल पीतांभरन 0082NF2013/ के डाइइलेक्टक इंक फॉर प्रटेड सुरᴂद्रन, मैलाडिल थॉमस 24/नवंबर /2017 6246938 जापान इलेक絍रॉनक अप㔪्लकेशन् सेबेस्टयन, जोबिन वर्स
ए ꥍ셋सेस फॉर डीकम्पोीशन ऑफ़ शुक्ल सत्यीत विष्ण, 0102NF2012/ आर嵇निक सिंथेटिक डाइज यूसिंग वार्र कृ ष्ण गोपकु मार, 07/ दिसंबर /2017 2013303756 ऑस絍रेलया सेमीकं डक्र -ऑक्साइड नैनो ट्यूब् बाबू बबिता कु न्नतपरम्बल वाया डार् कटैलिसीस
ए नावेल अज़ा बॉडीपी डेरीवेटिव फॉर दि सेलेक्टव डिटेक्न ऑफ़ नाइ絍रइट डनबोईना रामय्य: , नागप्न 0183NF2012/ आयन् इन वाटर : ए ꥍ셋सेस देरोफ़ पिल्ल आदर㔶, मधेश 15/दिसंबर/2017 6258355 जापान एंड इट्स अप्लकेशन इन वेस् वाटर शन्मगसुन्रम मैनेजमᴂट अप्लकेशन
National Institute for Interdisciplinary Science & Technology 111 Annual Report 2017-18 Patents
Patents
FILED IN INDIA COMP. FILING APPLICATION NFNO TITLE INVENTORS DATE NO.
DEVELOPMENT OF 0165NF2017/ SUPERHYDROPHOBIC AYYAPPANPILLAI AJAYAGHOSH, COATINGS FOR ENERGY SAVING BALARAMAN VEDHANARAYANAN, 18/OCT/2017 201711037002 IN MECHANICAL MOTION AND RAHUL DEV MUKHOPADHYAY RELATED APPLICATIONS
SASIDHAR BALAPPA SOMAPPA, 0218NF2017/ PROCESS FOR THE CHETTIYAL THODI FATHIMATH PREPARATION OF PYRYLIUM 06/FEB/2018 201811004385 SALFEENA, AYYAPPANPILLAI IN SALTS AJAYAGHOSH
0219NF2017/ HYBRID PLANAR LIGHT ADERSH ASOK, AYYAPPANPILLAI CONCENTRATOR WITH AJAYAGHOSH, ANIMESH M 15/MAR/2018 201811008500 IN ADAPTABLE TRANSPERENCY RAMACHANDRAN
FILED IN FOREIGN countries COMP. FILING APPLICATION NFNO TITLE INVENTORS DATE NO.
SANKAR SASHIDHARAN, RAJESH LANTHANUM PHOSPHATE KOMBAN, ABDUL AZEEZ PEER 0163NF2014/ BASED COATINGS AND MOHAMED, SOLAIAPPAN 18/APR/2017 15816254.5 MONOLITHS AS NON-REACTIVE ANATHAKUMAR, UNNIKRISHNAN EP SURFACES FOR MOLTEN METALS NAIR SARASWATHY HAREESH, KRISHNA GOPAKUMAR WARRIER
NEW INORGANIC BLUE PIGMENTS FROM COBALT 0112NF2014/ DOPED MAGNESIUM HAVING PADALA PRABHAKAR RAO, 02/AUG/2017 15828669.0 TRANSITION ELEMENT OXIDES SARASWATHY DIVYA EP AND A PROCESS FOR THE PREPARING THE SAME
GRANTED IN INDIA
NFNO TITLE INVENTORS GRANT DATE PATENT NO.
VADAKKE MADATHIL SREEKUMAR, A PROCESS FOR THE IN SITU RAMAN MARIMUTHU PILLAI, PREPARATION OF MGAL2O4 0352NF2005/ BELLAMUTTU CHANDRASEKHARA REINFORCED AL MATRIX 26/May/2017 283590 IN PAI, THAZHAVILAI PONNU COMPOSITES USING SOLID SILICA DEVARAJ RAJAN, MADHUSUDHAN SOURCES CHAKRABORTY
A PROCESS FOR THE DETECTION AND QUANTITATION OF 0015NF2006/ DANABOYINA RAMAIAH, ELIZABETH SINGLE STRAND DNA USING 19/Jun/2017 284314 IN KURUVILLA FLUORESCENT MARKER UNDER PHYSIOLOGICAL PH CONDITIONS
112 National Institute for Interdisciplinary Science & Technology Patents Annual Report 2017-18
AN IMPROVED PROCESS FOR THE ISOLATION OF 2, 5-DIHYDROXY-1, CHAMI ARUMUGHAN, 0098NF2007/ 4-BENZOQUINONE DERIVATIVES NUYAMPADITHARAYIL MADHAVAN 18/Jul/2017 285296 IN LIKE EMBELIN FROM NATURAL SOUMYA, ARIMBOOR RANJITH RESOURCES
MOLECULAR IMPRINTED POLYMER PARTICLES ORMICRO BEADS FOR 0052NF2009/ SELECTIVE DETOXIFICATION OF KARAMALA PRASAD, JOSEPH MARY 01/Aug/2017 285979 IN ENDOSULPHAN CONTAMINATED GLADIS, TALASILA PRASADA RAO NATURAL WATERS AND PROCESS FOR PREPARATION THEEREOF
METAL OXIDE MODIFIED AND UNMODIFIED MOLECULARLY VARGHESE SAUMYA, KRISHNA 0169NF2010/ IMPRINTED CONDUCTING PILLAI PADMAJA KUMARI PRATHISH, 05/Dec/2017 290312 IN POLYMER FILM BASED AQUEOUS TALASILA PRASADA RAO AMINOACID SENSORS
A PROCESS FOR DECOMPOSITION SHUKLA SATYAJIT VISHNU, WARRIER 0102NF2012/ OF ORGANIC SYNTHETIC DYES KRISHNA GOPAKUMAR, BABU 01/Mar/2018 293723 IN USING SEMICONDUCTOR-OXIDES BABITHA KUNNATHUPARAMBIL NANOTUBES VIA DARK CATALYSIS.
DANOBOYINA RAMAIAH, NOVEL PORPHYRIN DERIVATIVES SUNEESH C KARUNAKARAN, FOR PHOTODYNAMIC THERAPY VADAKKANCHERIL S JISHA, (PDT): A PROCESS FOR THE TAVAREKERE K CHANDRASHEKHAR, 0147NF2009/ PREPARATION THEREOF AND ALAGAR SRINIVASAN, MADHAVAN 14/Mar/2018 294263 IN THEIR USE AS PDT AGENTS AND RADHAKRISHNA PILLAI, SIVAKUMARI FLUORESCENCE PROBES FOR ASHA NAIR, SANEESH BABU P BIOLOGICAL APPLICATIONS SARAS, CHINTALAGIRI MOHAN RAO, KUNCHALA SRIDHAR RAO
GERALD DEVDASAGAYAM SYNTHESIS OF ULTRAFINE 0239NF2003/ SURENDER, ANI KARIUMPANOOR RUTILE PHASE TITANIUM DIOXIDE 23/Mar/2018 294839 IN JOHN, KUMARA PILLAI RAJENDRA PARTICLES PRASAD, SIVARAMAN SAVITHRI
GRANTED IN FOREIGN countries
NFNO TITLE INVENTORS GTANT DATE PATENT NO.
SEMICONDUCTOR OXIDE NANOTUBES-FLYASH AND SEMICONDUCTOR OXIDE SHUKLA SATYAJIT VISHNU, NANOTUBES-METAL OXIDE 0022NF2013/ PADINHATTAYIL HAREESH, COMPOSITE PARTICLES, THEIR 10/May/2017 201480002356.7 CN NARAYANI HARSHA, JOSE MANU, PROCESSING VIA ION-EXCHANGE KARUNAKARAN REMYA MECHANISM, AND METHODS FOR THEIR RECYCLING IN THE DYE- REMOVAL APPLICATION THEREOF
National Institute for Interdisciplinary Science & Technology 113 Annual Report 2017-18 Patents
A PROCESS FOR DECOMPOSITION SHUKLA SATYAJIT VISHNU, WARRIER 0102NF2012/ OF ORGANIC SYNTHETIC DYES KRISHNA GOPAKUMAR, BABU 31/May/2017 CN 104736485 B CN USING SEMICONDUCTOR-OXIDES BABITHA KUNNATHUPARAMBIL NANOTUBES VIA DARK CATALYSIS.
A NOVEL METHOD OF DEVELOPING NANO-STRUCTURED SILVER PANAMPILLIL VIJAYAMMMA SUBHA, 0188NF2011/ OXIDE FILM BASED AQUEOUS VARGHESE SAUMYA, TALASILA 30/Jun/2017 ZL201380007195.6 CN VOLTAMMETRIC PESTICIDE PRASADA RAO SENSOR
A NOVEL METHOD OF DEVELOPING NANO-STRUCTURED SILVER PANAMPILLIL VIJAYAMMMA SUBHA, 0188NF2011/ OXIDE FILM BASED AQUEOUS VARGHESE SAUMYA, TALASILA 30/Jun/2017 6167114 JP VOLTAMMETRIC PESTICIDE PRASADA RAO SENSOR
A SQUARAINE BASED FLUORESCENT PROBE FOR SELECTIVE LABELING AND 0180NF2012/ SENSING OF SERUM ALBUMIN AYYAPPANPILLAI AJAYAGHOSH, 04/Oct/2017 3039082 GB PROTEINS, pH MONITORING AND PALAPPURAVAN ANEES THIOL IMAGING IN CELLS AND A PROCESS FOR THE PREPARATION THEREOF
A SQUARAINE BASED FLUORESCENT PROBE FOR SELECTIVE LABELING AND 0180NF2012/ SENSING OF SERUM ALBUMIN AYYAPPANPILLAI AJAYAGHOSH, 04/Oct/2017 3039082 FR PROTEINS, pH MONITORING AND PALAPPURAVAN ANEES THIOL IMAGING IN CELLS AND A PROCESS FOR THE PREPARATION THEREOF
A SQUARAINE BASED FLUORESCENT PROBE FOR SELECTIVE LABELING AND 0180NF2012/ SENSING OF SERUM ALBUMIN AYYAPPANPILLAI AJAYAGHOSH, 04/Oct/2017 3039082 DE PROTEINS, pH MONITORING AND PALAPPURAVAN ANEES THIOL IMAGING IN CELLS AND A PROCESS FOR THE PREPARATION THEREOF
A SQUARAINE BASED FLUORESCENT PROBE FOR SELECTIVE LABELING AND 0180NF2012/ SENSING OF SERUM ALBUMIN AYYAPPANPILLAI AJAYAGHOSH, 04/Oct/2017 3039082 EP PROTEINS, pH MONITORING AND PALAPPURAVAN ANEES THIOL IMAGING IN CELLS AND A PROCESS FOR THE PREPARATION THEREOF
114 National Institute for Interdisciplinary Science & Technology Patents Annual Report 2017-18
A SQUARAINE BASED FLUORESCENT PROBE FOR SELECTIVE LABELING AND 0180NF2012/ SENSING OF SERUM ALBUMIN AYYAPPANPILLAI AJAYAGHOSH, 17/Oct/2017 9791451 US PROTEINS, pH MONITORING AND PALAPPURAVAN ANEES THIOL IMAGING IN CELLS AND A PROCESS FOR THE PREPARATION THEREOF
BLUE COLORED INORGANIC PIGMENTS, HAVING NEAR INFRARED REFLECTANCE, BASED 0009NF2012/ MUNDLAPUDI LAKSHMIPATHI ON MIXTURES OF LANTHANUM, 31/OCT/2017 9803063 US REDDY, SHEETHU JOSE STRONTIUM, COPPER AND LITHIUM SILICATE AND PROCESS THEREOF
SELF HEALING SILICA BASED LOW KUZHICHALIL PEETHAMBHARAN 0082NF2013/ k DIELECTRIC INK FOR PRINTED SURENDRAN, MAILADIL THOMAS 24/NOV/2017 6246938 JP ELECTRONIC APPLICATIONS SEBASTIAN, JOBIN VARGHESE
A PROCESS FOR DECOMPOSITION SHUKLA SATYAJIT VISHNU, WARRIER 0102NF2012/ OF ORGANIC SYNTHETIC DYES KRISHNA GOPAKUMAR, BABU 07/DCE/2017 2013303756 AU USING SEMICONDUCTOR-OXIDES BABITHA KUNNATHUPARAMBIL NANOTUBES VIA DARK CATALYSIS.
A NOVEL AZA BODIPY DERIVATIVE FOR THE SELECTIVE DETECTION DANABOYINA RAMAIAH, 0183NF2012/ OF NITRITE IONS IN WATER: A NAGAPPANPILLAI ADARSH, 15/DCE/2017 6258355 JP PROCESS THEREOF AND ITS MADHESH SHANMUGASUNDARAM APPLICATION IN WASTE WATER MANAGEMENT
National Institute for Interdisciplinary Science & Technology 115 TestingAnnu andal Repoanalyticalrt 2017-18 Services General Information
परीक् और वि�लषणात्क सेवा सेल
परीकण और वि�लेणात्क सेवा सेल, (टीएएससी) केरल और उसके आसपास के अनसु ंधान वि饍वनⴂ, शि啍षावदⴂ और उ饍यगⴂ के परीकण और वि�लेण की आवश्कता का समन्व करता है । अत्याुनध क सविधु ाओ ंवाले अत्यत परिष्क त वि�लेणात्क उपकरण उपलब् होने से सीएसआईआर-एनआईआईएसटी छा配र, लघ ु उ饍यगⴂ और उद्यमⴂ की ज셂रतⴂ को पराू करता है और इस तरह इन अत्याुनध क उपकरणⴂ का अधिकतम उपयोग होता है । यद्य ये उपकरण संस्थन मᴂ हो रही अनसु ंधान एवं विकास गतिविधियⴂ की आवश्कताओ ंके लिए हℂ, एक नीति के 셂प मᴂ एनआईआईएसटी 饍वरा इन सविधु ाओ ंके उपयोग का विस्तर भगतानु के आधार पर सामान् 셂प से आम जनता के लिए और विशेष 셂प से छा配र के लिए किया जाता है । जो संस्थन मᴂ उपलब् परीकण और वि�लेणात्क सविधु ाओ ंका लाभ उठाना चाहता है, उपरयक्त् सेल के समन्वक के साथ एक लिखित अनरोु ध के साथ संपर् कर सकता है और नमनⴂू के वि�लेण और परीकण संचालित करने के लिए आवश्क दिशा निर्श प्राप्त कर सकताहै । जबकि बाहर से छा配र / एजᴂसियⴂ से प्राप्तवि �लेण और परीकण की आवश्कता को पराू करने के लिए संस्थन अपने स्र पर परीू कोशिश करता है, एक विशेष वि�लेणात्क सविधु ा पर अतिरिक्त लोड की परिस्थितिⴂ मᴂ या इस तरह के उपकरण खराब और मरम्त के अधीन होने पर या काम को क्रियान्वत करने के लिए सविधु ा / विशेषजता उपलब् न होने पर बाहरी अनरोु ध को स्वकार या अस्वकार करने का अधिकार एनआईआईएसटी सरु क्त रखता है । इस अवधि के दौरान, बाहरी एजᴂसियⴂ और छा配र से नमनेू के परीकण और वि�लेण से 12.80266 लाख 셁पये का राजस् उत्न् हुआ । लाभार्थिⴂ मᴂ 76 छात, 90 आर एडं डी संस्थन और 16 उ饍यग शामिल हℂ। ट्रसमिशन इलेक絍रन माइक्रोस्कपी (एचआरटीईएम) ने 6.73 लाख 셁पए और एसईएम / एक्आरडी और एनएमआर / एमएस सविधु ाओ ं ने क्रमशः 2.76 लाख और 4.76 लाख 셁पए एकत्त किये । टीएएससी ने चयनित प्रमखु उपकरणⴂ का संकलन भी किया है और व्यपक उपयोग के लिए विवरण सीएसआईआर (एनलिटि सीएसआईआर) और आई-एसटीईएम भारतीय वि煍ञन, प्रौ饍योगकी और इजीं नियरिंग सविधु ाए ं मानचित, https://www.i-stem.ac.in/ के राष絍री पोर्लⴂ मᴂ होस् किए जाते हℂ:
TESTING AND ANALYTICAL SERVICES CELL
Testing and Analytical Services Cell (TASC) coordinates the testing and analysis requirement of research scholars, academicians and industries in and around Kerala. With very sophisticated analytical equipment with state of art facilities , CSIR-NIIST caters to the needs of the students , small scale industries and entrepreneurs and thereby maximize the utilization of these sophisticated equipments. Though these equipments are meant for the requirements of the ongoing R&D activities of the Institute, as a policy NIIST extends utilization of these facilities for the public in general and students in particular on payment basis. During the period, a revenue of Rs.12.80266 lakhs was generated from the testing and analysis of the samples from the external agencies and students. The beneficiary includes 76 numbers of students, 90 numbers of R & D institutions and 16 number of Industries. Transmission Electron Microscopy (HRTEM) collected 6.73 lakhs, SEM/XRD and NMR/MS facilities generated Rs.2.76 lakhs and Rs. 4.76 lakhs respectively. TASC has also made compilation of selected major equipments and the details are hosted in National portals of CSIR (AnalytiCSIR) and I-STEM: Indian Science, Technology and Engineering facilities Map, https://www.i-stem.ac.in/for the wider usage
116 National Institute for Interdisciplinary Science & Technology Knowledge Resource Centre Annual Repo煍ञन rसt सं 2017-18ाधन कᴂद्र
煍ञन ससं ाधन कᴂद्र सचनू ा सेवाएं 煍ञन संसाधन कᴂ द, अतरं ्विषी अनसु ंधान के लिए आवश्क अनसु ंधान के माध्म से उच㔚 गति नेटवर् प्रदान करताहै, के अलावा डेटा सᴂटर को सचू ना संसाधनⴂ और सचू ना प्रौ饍योगकी सेवाओ ं के साथ वै煍ञानक, अप嵍रड किया गया और रसायन वि煍ञन प्रभाग के लिए तीन उच㔚 एडं सर्र तकनीकी कर्मिⴂ और शोध छा配र का समर्न करता है । वर㔷 2017-18 होस् किए गए । सरु क्त और प्रभावी नेटवर् प्रबंधन के लिए सोफोस से की अवधि के दौरान, 13635 किताबⴂ, 10947 मानकⴂ और पत्काओ ं एक नया उच㔚 एडं यटीएमू डिवाइस शामिल किया गया । के 11387 बाउंड वॉल्मय ् के साथ केआरसी ने अपने संगह की वद्धिृ प्रयोगशाला की सभी इटरनेटं आवश्कताओ ंको पराू करने के लिए आईटी की । वर㔷 2017-18 के दौरान, संगह मᴂ 43 हिदीं किताब सहित 112 नई लैब समय - समय पर अपना मौजदाू इटरनेटं बℂडविड्थ को बढ़ता है । किताब शामिल की गई ं। इसके अतिरिक्त, 47 किताब मफु ् मᴂ प्राप्तुई ह ं वर्मान मᴂ, प्रयोगशाला एनकेएन से 100 एमबीपीएस लीज् लाइन और । कᴂ द, विभिन् ई-पत्काओ,ं खलेु संसाधनⴂ और साइफℂडर, वेब ऑफ बीएसएनएल से 26 एमबीपीएस लीज् लाइन से जडु ़ हुई है । वेब साइस,ं डेरᴂट इनोवेशन इडेकं ्, क्पेट,य एएसटीएम जैसे डेटाबेस के लिए आधारित उपकरण का उपयोग करके लिंक की नियमित निगरानी की जाती भी पहुचं प्रदान करता है। एनआईआईएसटी शोधकर्तओ ं की अतिरिक्त हℂ, जो सिस्म और नेटवर् कार्यमता के संबंध मᴂ रियल टाइम और जानकारी की आवश्कताओ ं को अन् सीएसआईआर, डीएसटी संस्थनⴂ एड-टं ू-एडं 饃श् प्राप्त करनेमᴂ सकम बनाता है । आईटी लैब ने नव निर्मत से संसाधन साझाकरण के माध्म से पराू किया जाता है। पारंपरिक सेवाओ ं डिस्ᴂसरी बिल्डिग के लिए नेटवर् कनेक्टिवटी प्रदान की और गेस् हाउस के अलावा, वै煍ञानकⴂ और छा配र के अनरोु ध पर साहित् खोज, पेटᴂट खोज को अतिरिक्त फाइबर केबलिंग भी प्रदान की गयी । इस सविधु ा से, कℂपस मᴂ और प्रशस्त पत वि�लेण किए गए थे। उच㔚 गणवु त्ता वाले पत्काओ ं मᴂ सभी इमारत जिगाबिट फाइबर ऑप्टक बℂकबॉन के माध्म से एक दसरेू से अपने शोध पत के प्रकाशन के लिए केआरसी ने शोधकर्तओ ंकी सहायता जडु ़ हुए हℂ । कℂपस नेटवर् पर बड़ संख्य मᴂ हाई एडं पर्नल कं प्टरय को की और साहित्यक चोरी की जांच और पर्ू आर् खोज मᴂ भी मदद की । जोडने के लिए अलग-अलग वीएलएएन बनाए गए हℂ और वायर् और कᴂ द स्वालित है और ई-गवरनेंस के मानदडⴂं की पष्टिु करता है। केआरसी वायरलेस नेटवर् के माध्म से कु ल इटरनेटं कनेक्न 1050+ हℂ । वै煍ञानकⴂ संस्थन की वेबसाइट, सोशल मीडिया पेज और संस्थगत भडारं का प्रबंधन, को निवास से एनआईआईएसटी मᴂ अपने कार्यलय कं प्टरय को जडु ने मᴂ रखरखाव और अदतन करता है। संस्थगत भडारं मᴂ वर्मान मᴂ 2613 अनमु ति देने के लिए आईटी लैब सरु क्त वीपीएन कनेक्टिवटी भी प्रदान पत्का लेख, 286 पीएचडी थीसिस और 200 न्जय आइटम् शामिल हℂ। करती है । आईटी प्रयोगशाला ने एक सरु क्त वायरलेस नेटवर् के साथ कᴂ द की तरफ से एक द्वार्षक न्焼लेटरय "एनआईआईएसटी समाचार" एनआईआईएसटी के सभी 啍ष配र को कवर करके वाई-फाई सविधु ा भी लाग ू का भी प्रकाशन किया गया । संदर् प्रबंधन सॉफ्वेयर, साहित् खोज, पर्ू की है । आर् खोज, खलीु पहुचं , अनसु ंधान मल्ू याकन, शोधकर्तओ ंके लिए सोशल मीडिया, साहित् चोरी की रोक ,प्रभावींच स ार इत्याद मᴂ केआरसी नियमित एनआईआईएसटी के उपयोगकर्तओ ं और प्रयोगशाला के आगंतकⴂु के 셂प से प्रशिकण प्रदान कर रहाहै । सचू नार् अनसु ंधान परिणामⴂ, नोटिस और परिपत, लॉरल् और अन् जानकारी प्रदर्शत करने के लिए प्रयोगशाला के अदरं सात अलग-अलग सचनू ा प्र셌饍योगकी सेवाएं ग अवधि के दौरानﴂस्थनⴂ मᴂ डिजिटल डिस㔪्ल सिस्म लाग ू की गयी । रिपोर् मौजदाू उच㔚 एडं सर्र, स्टरेज डिवाइस, यटीएमू डिवाइस और कोर स्वच् दरवाजे और 饍वरⴂ पर सरु क्त पहुचं लाग ू की गई । का रखऱखाव, जो सभी स्टफ सदस्ⴂ और शोधकर्तओ ं के लिए ईथरनेट और वायरलेस कनेक्टिवटी के साथ ओएफसी लिंक पर समर्पत प絍ट लाइनⴂ आईटी लैब आधार सकम बॉयोमीट्क उपस्थित प्रणाली केच सु ा셂
National Institute for Interdisciplinary Science & Technology 117 煍ञनAnnu ससं aाधl Repoन कᴂद्रrt 2017-18 Knowledge Resource Centre
संचालन और कर्मारीगण, शोध छात और पᴂशनभोगियⴂ को संस्थगत प्रशिकण टीम का समर्न करते हुये आईटी लैब संस्थन के कौशल विकास पहचान पत जारी करने का भी प्रबंधन करती है । संस्थगत उ饍शद ्ⴂ के कार्क्रममᴂ भी सक्रिय 셂प से शामिल है । लिए इकाई की तरफ से हेवी ड्यटीू कलर मल्ट-फ़ क्न लेजर प्रिंटर और आईटी लैब विभिन् अनप्रु योगⴂ का प्रबंधन भी करती है, जैसे भडारं व क्रय ए 3 / ए 4 स्क नर जैसे विभिन् प्रकार के प्रिंटर के माध्म से मदु ण और सॉफ्वेयर, संस्थगत रिपोजिटरी, लिब्इट,स केमड्रा, सिग्माप्ट, ओर्जन स्कैनंग सविधु ा भी प्रदान करतीहै । प्रयोगशाला के आईटी उत्पदⴂ और के लिए डी स्पस और कोहा इत्याद । हमने दरसू ् पहुचं के माध्म से उपकरणⴂ के अधिगहण मᴂ गणवु त्ता आ�वसन सनिशु 椿त करने मᴂ भी आईटी पत्काओ ंतक पहुचं ने के लिए ए焼प्रॉक्स भी स्थापत की है । अनप्रु योगⴂ लैब सहायता प्रदान करतीहै । प्रयोगशाला ने द्भाषी 셂प मᴂ संस्थन की के और मेल और वेबसाइट साम嵍र के आवधिक बैकअप के लिए एक वेबसाइट के संशोधन और सधु ार के लिए पहल की थी। तीन अतरं ्रा絍री बैकअप समाधान भी स्थापत है । सर्र 嵍रड एटीवां यरस सॉफ़वेयर के सम्मलनⴂ अर्थत,् सीएसएमएटी 2017, ईएएस 8 और आईसीएसएसपी प्रसारण केलि ए प्रयोगशाला ने लाइसᴂस प्राप्तकिय ा है जो एनआईआईएसटी 2018 के लिए वेबसाइटⴂ के विकास मᴂ भी आईटी प्रयोगशाला शामिल थी मᴂ वायरस मक्तु नेटवर् वातावरण प्रदान करताहै। । आईटी लैब 500 से अधिक डेस्टॉप, लैपटॉप, साथ ही प्रयोगशाला मᴂ आरटीआई उपलब् अन् कं प्टरय बाह्य उपकरणⴂ केलि ए एएमसी का प्रबंधन करती है । भारत मᴂ हर सार्जनिक प्राधिकरण के कामकाज मᴂ पारदर्शता और उपयोगकर्तओ ं को सॉफ़वेयर इसं ्टलेशन, पनु र्स्पना, मरम्त, सॉफ़वेयर जवाबदेही को बढ़वा देने के लिए वै煍ञानक और तकनीकी मामलⴂ के लिए अपडेट, नेटवर् और आईटी से संबंधित म饍ु द को हल करने मᴂ सहायता प्रदान संस्थन मᴂ सचू ना का अधिकार अधिनियम -2005 का कार्यन्वन। करने के लिए आईटी प्रयोगशाला एक सहायता डेस् रखती है । व्यपक प्रचार देते हुए और प्रशिकण कार्क्रम केच सु ा셂 संचालन के लिए कौशल
118 National Institute for Interdisciplinary Science & Technology Knowledge Resource Centre Annual Report 2017-18
KNOWLEDGE RESOURCE CENTRE
Information services The Knowledge Resource Centre supports scientists, high speed network through dedicated leased lines on technical personals and research scholars with Research OFC link with Ethernet and wireless connectivity to all information resources and Information Technology staff members and research scholars. A new high end services required in interdisciplinary research. During the UTM device from SOPHOS was included for secured and period 2017-18, KRC enhanced the collection to 13635 effective network management. Books, 10947 Standards and 11387 Bound Volumes of IT Lab enhances its existing internet bandwidth from time Periodicals. During 2017-18 112 new books including 43 to time to fulfill all the Internet requirements of the lab. Hindi books were added to the collection. Additionally, At present, the laboratory is linked with 100 mbps leased 47 books were received gratis. The Centre provide access line from NKN and also 26 mbps leased line from BSNL. to various e-journals, open resources and databases viz The links are regularly monitored using web based tool SciFinder, Web of Science, Derwent Innovation Index, that enables to gain a real-time, end-to-end view with Qpat and ASTM. The additional information requirement respect to system and network performance. of NIIST researchers fulfilled through resource sharing from other CSIR, DST institutes. Apart from traditional IT Lab provided network connectivity to the newly services, Literature search, Patent search, Citation constructed dispensary building and also provided analysis were carried out on requests from scientists and redundant fibre cabling to Guest House. By this facility, all students. KRC also assisted researchers to publish in high- the buildings in the campus are interconnected through quality journals and helped in plagiarism check and prior gigabit fiber optic backbone. Separate VLANs have art search. The centre is automated and confirms to the been created to connect a large no of High end personal norms of e-governance. computers to the campus network making the total internet connection to 1050+ through wired and wireless KRC also manages, maintain and update the institute network. IT lab also provides secured VPN connectivity to website, social media pages and institutional repository. allow scientists to connect to their NIIST office computers The IR presently consists of 2613 journal articles, 286 from home. IT lab has also implemented Wi-Fi facilities PhD Theses and 200 News items. The center published covering all areas of NIIST with a secured wireless network. a biannual newsletter ‘NIIST Samachar’. KRC is regularly providing training on reference management software, Digital Display System was implemented in seven literature search, prior art search, open access, research different locations inside the laboratory for exhibiting evaluation, social media for researchers, preventing research outcomes, notices and circulars, laurels and plagiarism, and effective communication etc. other information to NIIST users and visitors of the laboratory. Also, secured access to doors and gates were Information technology services implemented during the reporting period. The data center was upgraded and hosted three high end servers for the Chemical Sciences division apart IT Lab manages the smooth functioning of AADHAR from maintaining the existing high end servers, storage enabled Biometric Attendance System and also for the devices, UTM devices and core switches which provides issuing of Institutional identity cards for the staff members,
National Institute for Interdisciplinary Science & Technology 119 Annual Report 2017-18 Knowledge Resource Centre
research scholars and pensioners. The unit also provides Programme of the Institute by giving wide publicity and printing and scanning facility for institutional purposes also supporting the skill training team for the smooth through a wide variety of printers such as Heavy Duty functioning of the training program. Color Multi-Function Laser Printers and A3/A4 Scanners. The lab also manages various applications like Stores and The lab also provides assistance in ensuring Quality Purchase Software, D-Space and Koha for Institutional assurance in the acquisition of IT products and devices of Repository, Libsuite, Chemdraw, Sigmaplot, Origin. We the lab. had also installed Ezproxy for accessing the journals The lab had taken initiative for modification and through remote access. A backup solution is also installed revamping of the institute’s website in bilingual format. for generating periodic backup of the applications and IT lab was also involved in the development of websites also backup for mails and website contents. The lab has for three International Conferences namely, CSMAT 2017, procured licenses for deploying server grade antivirus EAS8 and ICSSP 2018. software which provides virus-free network environment at NIIST. The lab manages the AMC for more than 500 desktops, laptops as well as other computer peripherals in the lab. IT RTI lab also maintains a help desk that helps users in solving Implementation of Right to Information Act-2005 in the issues related to software installations, reinstallations, institute for Scientific & Technical matters to promote repairs, software updates, network and IT related issues. transparency and accountability in the working of every public authority in India. IT Lab also activity involved in the Skill Development
120 National Institute for Interdisciplinary Science & Technology List of Publications 2017 Annual Report 2017-18
List of Publications 2017
1. ABHILASH (P), NAIR (K S), SURENDRAN (K P) 8. ANGULAKSHMI (N), KAR (G P), BOSE (S), BHOJE GOWD Silver-Decorated Boron Nitride Nanosheets as an Effective (E), THOMAS (S), STEPHAN (A M) Hybrid Filler in PMMA for High-Thermal-Conductivity A High-Performance BaTiO3-Grafted-GO-Laden Poly(Ethylene Oxide)-Based Membrane as an Electrolyte Electronic Substrates for all-Solid Lithium-Batteries ACS Omega; 2(12):8825-8835; 2017 Materials Chemistry Frontiers; 1(2):269-277 ; 2017
2. ABHILASH (V), MANU (M V), SAVITHRI (S), PILLAI (U T 9. ANJALI (B A), SURESH (C H) S) Interpreting Oxidative Addition of Ph–X (X = CH3, F, Cl, Numerical Simulation and Experimental Validation of Free and Br) to Monoligated Pd(0) Catalysts Using Molecular Surface Flows During Low Pressure Casting Process Electrostatic Potential Journal of Materials Processing Technology; 244:320-330; ACS Omega; 2(8):4196-4206; 2017 2017 10. ANJU (A J), BINOD (P), PANDEY (A) Production and Characterization of Microbial Poly-?- 3. ADARSH (N), RAMYA (A N), MAITI (K K), RAMAIAH (D) Glutamic Acid from Renewable Resources Unveiling NIR Aza-Boron-Dipyrromethene (BODIPY) Dyes as Indian Journal of Experimental Biology; 55(7):405-410; Raman Probes: Surface-Enhanced Raman Scattering 2017 (SERS)-Guided Selective Detection and Imaging of Human 11. ANJU (K S), MAINAK DAS, ADINARAYANA (B), SURESH Cancer Cells (C H), SRINIVASAN (A) Chemistry - A European Journal; 23(57):14286-14291; 2017 Meso-Aryl [20]? Homoporphyrin: The Simplest Expanded 4. AJESH (V), JUMAILA (C U), BAIJU (T V), Porphyrin with the Smallest Möbius Topology Angewandte Chemie-International Edition; 56(49):15667– RADHAKRISHNAN (K V) 15671; 2017 Palladium-Catalyzed Cross-Coupling of Aryl Iodides with Heterobicyclic Olefins: Access to Hydroarylated and 12. ANUPAMA (C), SHIPRA (G), VASUNDHARA (M), JOSHI Heteroannulated Motifs (S R), MUTTA (G R), JAI SINGH ChemistrySelect; 2(21):5913–5916; 2017 Study of Structural, Optical and Magnetic Properties of Cobalt Doped ZnO Nanorods 5. AJU THARA (T R), PRABHAKAR RAO (P), DIVYA (S), RSC Advances; 7(80):50527-50536; 2017 ATHIRA (K V R), SREENA (T S) 13. ANUPAMA (V N), DIVYA (P S), RAVINDRAN (S C), Enhanced Near Infrared Reflectance with Brilliant Yellow ANIE (M), JASMIN (G R), PRADEEP (S), PEREIRA (B), Hues in Scheelite Type Solid Solutions, (LiLaZn)1/3MoO4– KRISHNAKUMAR (B) BiVO4 for Energy Saving Products Spatio-Temporal Distribution of Perchlorate and its ACS Sustainable Chemistry & Engineering; 5(6):5118-5126; Toxicity in Hydrilla Verticillata 2017 Ecotoxicology and Environmental Safety; 144:490-497; 2017 6. AKSHAY (V R), SUNEESH (M V), VASUNDHARA (M) 14. ANUSREE (V M), SUJITHA (B S), ANAND (J), ARUMUGAM (M) Tailoring Thermoelectric Properties through Structure and Dissolved Inorganic Carbonate Sustain the Growth, Lipid Morphology in Chemically Synthesized n-Type Bismuth and Biomass Yield of Scenedesmus Quadricauda Under Telluride Nanostructures Nitrogen Starved Condition Inorganic Chemistry; 56(11):6264–6274; 2017 Indian Journal of Experimental Biology; 55(10):702-710; 2017 7. ALWIN (S), SAHAYA SHAJAN (X), KARUPPASAMY (K), WARRIER (K G K) 15. APARNA (P S), VIJAYAN (A), RAVEENDRAN (S P), SURESH Microwave Assisted Synthesis of High Surface Area TiO2 (E), LUXMI VARMA (R), RADHAKRISHNAN (K V) Ruthenium/Iridium-Catalyzed C-2 Activation of Indoles Aerogels: A Competent Photoanode Material for Quasi- with Bicyclic Olefins: An Easy Access to Functionalized Solid Dye-Sensitized Solar Cells Heterocyclic Motifs Materials Chemistry and Physics; 196:37-44; 2017 Synlett; 28(05):572-576; 2017
National Institute for Interdisciplinary Science & Technology 121 Annual Report 2017-18 List of Publications 2017
16. ARUN (B), AKSHAY (V R), MUTTA (G R), VENKATESH 24. ASWATHI (K), JASNAMOL (P P), PAULOSE (A P), MANOJ (CH), VASUNDHARA (M) RAAMA VARMA Mixed Rare Earth Oxides Derived from Monazite Sand as Structural and Magnetic Properties of Multiferroic an Inexpensive Precursor Material for Room Temperature Y2NiMnO6 Double Perovskite Magnetic Refrigeration Applications Ferroelectrics ; 518(1):223-231 ; 2017 Materials Research Bulletin; 94:537-543; 2017 25. ASWATHY (U), ARUMUGAM (M) 17. ARUN (K B), JAYAMURTHY (P), ANUSHA (C V), MAHESH Selective Enrichment of Eicosapentaenoic Acid (20:5n-3) in (S K), NISHA (P) N. Oceanica CASA CC201 by Natural Auxin Supplementation Studies on Activity Guided Fractionation of Pomegranate Bioresource Technology; 242:329-333; 2017 Peel Extracts and Its Effect on Antidiabetic and Cardiovascular Protection Properties 26. ASWATHY (V S), SANKAR (C R), MANOJ RAAMA VARMA, Journal of Food Processing and Preservation; 41(1):e13108; ASSOUD (A), BIERINGER (M), KLEINKE (H) 2017 Thermoelectric Properties and Thermal Stability of Layered Chalcogenides, TlScQ2, Q = Se, Te 18. ARUN (K B), SITHARA (T), RESHMITHA (T R), AKHIL (G Dalton Transactions; 46(48):17053-17060 ; 2017 C), NISHA (P) Dietary Fibre and Phenolic-Rich Extracts from Musa 27. ATHIRA (K V R), PRABHAKAR RAO (P), DIVYA (S), Paradisiaca Inflorescence Ameliorates Type 2 Diabetes and AJUTHARA (T R) Associated Cardiovascular Risks Terbium Doped Sr2MO4 [M = Sn and Zr] Yellow Pigments Journal of Functional Foods; 31:198-207; 2017 With High Infrared Reflectance for Energy Saving Applications 19. ARUN (S), SEBASTIAN (M T), SURENDRAN (K P) Powder Technology; 311:52–58; 2017 Li2ZnTi3O8 based High ? LTCC Tapes for Improved Thermal Management in Hybrid Circuit Applications 28. ATHIRA (K V R), PRABHAKAR RAO (P), SREENA (T S), Ceramics International; 43(7):5509-5516; 2017 AJU THARA (T R) Influence of Local Structure on Photoluminescence 20. ARYA (A D), AJAYAKUMAR DARSANA (T), ELIZABETH Properties of Eu3+Doped CeO2 Red Phosphors through JACOB Induced Oxygen Vacancies by Contrasting Rare Earth Agent-Based Re-Engineering of ErbB Signaling: a Modeling Substitutions Pipeline for Integrative Systems Biology Physical Chemistry Chemical Physics; 19(30):20110-20120 ; Bioinformatics; 33(5):726-732; 2017 2017 21. ARYA NANDAN, NAMPOOTHIRI (K M) Molecular Advances in Microbial Aminopeptidases 29. ATHUL (K R), SRINIVASAN (A), PILLAI (U T S) Bioresource Technology; 245(Part B):1757-1765; 2017 Investigations on the Microstructure, Mechanical, Corrosion and Wear Properties of Mg-9Al-xGd (0, 0.5, 1, And 22. ASHISH (V), ANUP KUMAR (O), DASTAGER (S G), 2 wt%) Alloys RAMESHKUMAR (N), SHANMUGAM (M), SRINIVASAN Journal of Materials Research; 32(19):3732-3743; 2017 (K) Domibacillus Mangrovi Sp. Nov. and Domibacillus 30. BABITHA (K B), NISHANTH KUMAR (S), POOJA Epiphyticus Sp. Nov., Isolated from Marine Habitats of the (V), DILEEP KUMAR (B S), PEER MOHAMED (A), Central West Coast of India ANANTHAKUMAR (S) International Journal of Systematic and Evolutionary Design and Synthesis of ZPMx-Si@GO Hybrid Microbiology; 67(8):3063-3070; 2017 Nanocomposites with Various Aspect Ratios for Water Disinfection 23. ASHISH (V), ANUP KUMAR (O), PAL (Y), KUMARI (P), Chemical Engineering Journal; 324:154-167; 2017 SCHUMANN (P), GRUBER VODICKA (H), DASTAGER (S G), RAMESH KUMAR (N), MAYILRAJ (S), SRINIVASAN 31. BABU (J S S), SRINIVASAN (A), KANG (C G) (K) Nano and Macromechanical Properties of Aluminium An Investigation into the Taxonomy of “Bacillus (A356) Based Hybrid Composites Reinforced with Multiwall Aminovorans” and its Reclassification to the Genus Carbon Nanotubes/Alumina Fiber Domibacillus as Domibacillus Aminovorans Sp. Nov Journal of Composite Materials; 51(11):1631-1642; 2017 Systematic and Applied Microbiology; 40(7):458-467; 2017
122 National Institute for Interdisciplinary Science & Technology List of Publications 2017 Annual Report 2017-18
32. BALAJI (M), VIPIN (M D), VINODH (J S), JAMSHEENA 40. BISWAS (S), BEJOYMOHANDAS (K S), DAS (S), KALITA (V), RANJIT (R), SABU THOMAS, DASTAGER (S G), (P), REDDY (M L P), OYARZABAL (I), COLACIO (E), SANTHOSH KUMAR (K), RAVI SHANKAR (L), AJAY CHANDRASEKHAR (V) KUMAR (R) Mononuclear Lanthanide Complexes: Energy-Barrier Anti-microbial Activity of Chrysomycin A Produced by Enhancement by Ligand Substitution in Field-Induced Streptomyces Sp. Against Mycobacterium Tuberculosis DyIII SIMs RSC Advances; 7(58):36335-36339 ; 2017 Inorganic Chemistry; 56(14):7985-7997; 2017 33. BALAMURUGAN (K), UTHAYAKUMAR (M), SANKAR (S), 41. BOBBI (S), MELISSA (L), DHANYA (T J), YENJAI (S), HAREESH (U S), WARRIER (K G K) Mathematical Modelling on Multiple Variables in Machining RUMA (C), APINYA (B), RAMAIAH (D), KUMAR (C V) LaPO4/Y2O3 Composite by Abrasive Waterjet Chiral Photochemical Scissors: Toward Site Specific International Journal of Machining and Machinability of Cleavage of Proteins with Light Materials; 19(5):426-439; 2017 Journal of Photochemistry and Photobiology A - Chemistry; 340:181-200; 2017 34. BANERJEE (S), PATIL (Y), GIMELLO (O), AMEDURI (B) Well-defined Multiblock Poly(Vinylidene Fluoride) 42. BOGOMOLOVA (O YU), BIKTAGIROVA (I R), DANILAEV and Block Copolymers Thereof: a Missing Piece of the (M P), KLABUKOV (M A), POLSKY (YU E), SAJU PILLAI, Architecture Puzzle TSENTSEVITSKY (A A) Chemical Communications; 53(79):10910-10913 ; 2017 Effect of Adhesion Between Submicron Filler Particles 35. BELLO (M), RANGANATHAN (P), BRENNAN (F) and a Polymeric Matrix on the Structure and Mechanical Dynamic Modelling of Microalgae Cultivation Process in Properties of Epoxy-Resin-Based Compositions High Rate Algal Wastewater Pond Mechanics of Composite Materials; 53(1):117-122; 2017 Algal Research-Biomass Biofuels and Bioproducts; 24(Part B):457-466; 2017 43. CHACKO (A S), PRASAD (V S) Self-assembly of Anacardic Acid Derived Cation-Modified 36. BELLO (M), RANGANATHAN (P), BRENNAN (F) Montmorillonite into ’Arthropodal’ Branched Nanofibers Life Cycle Optimization for Sustainable Algal Biofuel CHEMISTRYSELECT; 2:2288 -2292; 2017 Production Using Integrated Nutrient Recycling Technology 44. CHALLA (C), SUNIL VARUGHESE, SURESH (C H), ACS Sustainable Chemistry & Engineering; 5(11):9869- LANKALAPALLI (R S) 9880; 2017 Metal-Free Multiple Carbon–Carbon and Carbon– 37. BHAGYA UTHAMAN, MANJU (P), SENOY THOMAS, Hydrogen Bond Activations via Charge-Switching DEEPSHIKHA (J N), SURESH (K G), MANOJ RAAMA Mechanism in Unstrained Diindolylmethanes VARMA Organic Letters; 19(16):4219–4222; 2017 Observation of Short Range Ferromagnetic Interactions 45. CHITHRA (P K), JAYALEKSHMY (A), HELEN (A) and Magnetocaloric Effect in Cobalt Substituted Gd5Si2Ge2 Petroleum Ether Extract of Njavara Rice (Oryza Sativa) Bran Physical Chemistry Chemical Physics; 19(19):12282-12295; Upregulates the JAK2–STAT3-Mediated Anti-inflammatory 2017 Profile in Macrophages and Aortic Endothelial Cells Promoting Regression of Atherosclerosis 38. BIJU FRANCIS, NEUHAUS (B), REDDY (M L P), EPPLE Biochemistry and Cell Biology; 95(6):652-662; 2017 (M), JANIAK (C) Amine-Functionalized Silica Nanoparticles Incorporating 46. CINCY (J), MILJA (T E), PRATHISH (K P) Covalently Linked Visible-Light-Excitable Eu3+ Complexes: Fabrication of a Flexible Carbon Cloth Based Solid Contact Synthesis, Characterization, and Cell-Uptake Studies Iodide Selective Electrode European Journal of Inorganic Chemistry; (25):3205-3213; Analytical Methods; 9(20):2947-2956; 2017 2017 47. DEBATA (M), ACHARYA (T S), SENGUPTA (P), ACHARYA 39. BINOD (P), SINDHU (R), MADHAVAN (A), ABRAHAM (P P), BAJPAI (S), JAYASANKAR (K) (A), MATHEW (A K), SABEELA BEEVI (U), RAJEEV K Effect of High Energy Ball Milling on Structure and SUKUMARAN, SINGH (S P), PANDEY (A) Recent Developments in L-Glutaminase Production and Properties of 95 W-3.5Ni-1.5Fe Heavy Alloys Applications €“ An Overview International Journal of Refractory Metals & Hard Materials; Bioresource Technology; 245(Part B):1766-1774; 2017 69:170-179; 2017
National Institute for Interdisciplinary Science & Technology 123 Annual Report 2017-18 List of Publications 2017
48. DEEPIKA (R), ENAMULLAH, SURESH (K G), YADAV (A 57. DIVYA (S P), GHOSH (S), SUDHEESH (K V), SURESH (C K), JHA (S N), BHATTACHARYYA (D), MANOJ RAAMA H), AJAYAGHOSH (A) VARMA, ALAM (A) An Unsymmetrical Squaraine-Dye-Based Chemical Structural, Electronic, Magnetic, and Transport Properties Platform for Multiple Analyte Recognition of the Equiatomic Quaternary Heusler Alloy CoRhMnGe: Chemistry - A European Journal; 23(71):17973–17980; 2017 Theory and Experiment 58. EBHOTA (W S), KARUN (A S), INAMBAO (F L) Physical Review B - Condensed Matter and Materials Improving the Surface Properties of a Pelton Turbine Physics; 96(18):184404; 2017 Bucket via Centrifugal Casting Technique 49. DELLA (T D), SURESH (C H) Advances in Mechanical Engineering; 9(10):1-14; 2017 Dihydrogen Binding Affinity of Polyatomic Anions: A DFT 59. ELLOL DOV (N), SREEJITH (S), COHEN (D), BENDIKOV Study (T), RECHAV (K), LINDA (J W S), LAHAV (M), VAN DER ACS Omega; 2(8):4505-4513; 2017 BOOM (M E) 50. DELLA (T D), SURESH (C H) Electrochromic Metallo-Organic Nanoscale Films: Massive Dihydrogen Uptake by Anionic Carbon Chains Fabrication, Color Range, and Devices PHYSICAL CHEMISTRY CHEMICAL PHYSICS; 19 (8):5830- Journal of the American Chemical Society; 139(33):11471- 5838; 2017 11481; 2017
51. DESHLAHRA (P), ASOK (A) 60. ERI (Q), ZHAO (X), RANGANATHAN (P), GU (S) Mixed Metal Oxides and Catalytic Redox Cycles Numerical Simulations on the Effect of Potassium on the Catalysis; 29:60-93; 2017 Biomass Fast Pyrolysis in Fluidized bed Reactor Fuel; 197:290-297; 2017 52. DEVENDRA (L P), PANDEY (A) Adsorptive Detoxification of Fermentation Inhibitors in 61. GANAPATHY (V), ZHANG (K), SURAJ SOMAN, NANSRA Acid Pretreated Liquor using Functionalized Polymer (H), PARK (J H) Designed by Molecular Simulation Stibnite Sensitized Hollow Cubic TiO2 Photoelectrodes for Bioprocess and Biosystems Engineering; 40(11):1657– Organic-Inorganic Heterojunction Solar Cells 1667; 2017 Solar Energy; 157:434-440; 2017
53. DHANYA (B P), GREESHMA (G), RESHMITHA (T R), 62. GAWALE (Y), ADARSH (N), SANDEEP KUMAR (K), SARANYA (J), SHARATHNA (P), SHIBI (I G), NISHA (P), JOSHY JOSEPH, PRAMANIK (M), RAMAIAH (D), SEKAR RADHAKRISHNAN (K V) (N) Synthesis and In Vitro Evaluation of Zerumbone Pendant Carbazole-Linked Near-Infrared Aza-BODIPY Dyes as Derivatives: Potent Candidates for Anti-Diabetic and Anti- Triplet Sensitizers and Photoacoustic Contrast Agents for Proliferative Activities Deep-Tissue Imaging New Journal of Chemistry; 41(15):6960-6964; 2017 Chemistry - A European Journal; 23(27):6570-6578; 2017
54. DHANYA (R), ARYA (A D), NISHA (P), JAYAMURTHY (P) 63. GAYATHRI PRABHU (T G), BISWAPRIYA DEB Quercetin, a Lead Compound against Type 2 Diabetes Designing an All-Solid-State Tungsten Oxide Based Ameliorates Glucose Uptake via AMPK Pathway in Skeletal Electrochromic Switch with a Superior Cycling Efficiency Muscle Cell Line Advanced Materials Interfaces; 4(14):1700124; 2017 Frontiers in Pharmacology; 8(2017):336; 2017 64. GHOSH (S), DIVYA (S P), SAEKI (A), AJAYAGHOSH (A) 55. DIJITH (K S), PILLAI (S), SURENDRAN (K P) Nanosheets of an Organic Molecular Assembly from Screen Printed Silver Patterns on La0.5Sr0.5CoO3 ? ? - Aqueous Medium Exhibit High Solid-State Emission and Epoxy Composite as a Strategy for Many-fold Increase in Anisotropic Charge-Carrier Mobility EMI Shielding Advanced Materials; 29(10):1605408; 2017 Surface and Coatings Technology; 330: 34-41; 2017 65. GHOSH (S), SANDEEP (C), SURESH (C H), AJAYAGHOSH (A) 56. DIJITH (K S), PILLAI (S), SURENDRAN (K P) A Supramolecular Nanocomposite as a Near-Infrared- Thermophysical and Microwave Shielding Properties of Transmitting Optical Filter for Security and Forensic La0.5Sr0.5CoO3-Delta and its Composite with Epoxy Applications Journal of Electronic Materials; 46(8):5158-5167; 2017 Advanced Materials; 29(46):1703783; 2017
124 National Institute for Interdisciplinary Science & Technology List of Publications 2017 Annual Report 2017-18
66. GHOSH (T), PANICKER (J S), NAIR (V C) 75. JAMES (A R), UNNIKRISHNAN (B S), PRIYA (R), JOSEPH Self-Assembled Organic Materials for Photovoltaic (M M), MANOJKUMAR (T K), RAVEENDRAN PILLAI Application (K), SHIJI (R), PREETHI (G U), KUSUMAKUMARY (P), Polymers; 9(3):112; 2017 SREELEKHA (T T) Computational and Mechanistic Studies on the Effect of 67. GOTHANDAM (K M), INDU (S T), RAJEEV K SUKUMARAN, Galactoxyloglucan: Imatinib Nanoconjugate in Imatinib AGUILAR (C N), SUZANA (Y) International Conference on Current Trends in Resistant K562 Cells Biotechnology & Amp: Post ICCB-2016 Conference on Tumour biology ; 39(3); 2017 Strategies for Environmental Protection and Management 76. JAMSHEENA (V), MAHESHA (C K), NIBIN JOY (M), (ICSEPM-2016) LANKALAPALLI (R S) Bioresource Technology; 10.0840277777778; 2017 Metal-Free Diaryl Etherification of Tertiary Amines 68. GOVIND (C), KARUNAKARAN (V) by Ortho-C(sp2)-H Functionalization for Synthesis of Ultrafast Relaxation Dynamics of Photoexcited Heme Dibenzoxazepines and -ones Model Compounds: Observation of Multiple Electronic Organic Letters; 19(24):6614-6617; 2017 Spin States and Vibrational Cooling Journal of Physical Chemistry B; 121(14):3111-3120; 2017 77. JANU (C), NAYANA (N), ROSHINI (N), NISHA (P) Oxidative Stability, Thermal Stability and Acceptability of 69. GREESHMA (G), DHANYA (B P), SARANYA (J), Coconut Oil Flavored with Essential Oils from Black Pepper RESHMITHA (T R), BAIJU (T V), MEENU (M T), and Ginger MANGALAM S NAIR, NISHA (P), RADHAKRISHNAN (K V) Journal of Food Science and Technology - Mysore; Metal-Free Trans-Aziridination of Zerumbone: Synthesis 54(1):144-152; 2017 and Biological Evaluation of Aziridine Derivatives of Zerumbone 78. JAROSCHIK (F), PENKHUES (M), BAHLMANN European Journal of Organic Chemistry; (21):3072-3077; (B), NICOLAS (E), FISCHER (M), MASSICOT (F), 2017 MARTINEZ (A), HARAKAT (D), SCHMIDTMANN (M), 70. HEERA (M), AISWARYA (R), SURENDRAN (K P) RADHAKRISHNAN (K V), VASSE (J L), BECKHAUS (R) Screen Printable MWCNT Inks for Printed Electronics Synthesis, Characterization and Reactivity of Formal 20 RSC Advances; 7(70):44076-44081; 2017 Electron Zirconocene-Pentafulvene Complexes Organometallics; 36(10):2004-2013; 2017 71. INDUJA (I J), MANOJ RAAMA VARMA, SEBASTIAN (M T) Preparation, Characterization and Properties of Alumina- 79. JARZEMBSKA (K N), HOSER (A A), SUNIL VARUGHESE, Lithium Aluminium Borosilicate Glass Based LTCC Tapes KAMINSKI (R), MALINSKA (M), STACHOWICZ (M), Journal of Materials Science - Materials in Electronics; PEDIREDDI (V R), WOZNIAK (K) 28(19):14655–14663; 2017 Structural and Energetic Analysis of Molecular Assemblies in a Series of Nicotinamide and Pyrazinamide Cocrystals 72. INDUJA (I J), SEBASTIAN (M T) Microwave Dielectric Properties of Mineral Sillimanite with Dihydroxybenzoic Acids Obtained by Conventional and Cold Sintering Process Crystal Growth and Design; 17(9):4918-4931; 2017 Journal of the European Ceramic Society; 37(5):2143-2147; 80. JASNAMOL (P P), SANKAR (C R), MANOJ RAAMA 2017 VARMA 73. INDUJA (I J), SEBASTIAN (M T) Multiple Magnetic Transitions, Griffiths-Like Phase, and Microwave Dielectric Properties of SnO-SnF2-P2O5 Glass Magnetoresistance in La2CrMnO6 and its Composite with Alumina for ULTCC Applications Journal of Applied Physics; 122(7):073907; 2017 Journal of the American Ceramic Society; 100(6):2632– 2640; 2017 81. JAWAHARRAJ (K), KARPAGAM (R), ASHOKKUMAR (B), KATHIRESAN (S), MOORTHI (I M G), ARUMUGAM (M), 74. INDUJA (I J), SURENDRAN (K P), MANOJ RAAMA VARALAKSHMI (P) VARMA, SEBASTIAN (M T) Improved Biomass and Lipid Production in Synechocystis Low K, Low Loss Alumina-Glass Composite with Low CTE Sp NN Using Industrial Wastes and Nano-Catalyst Coupled for LTCC Microelectronic Applications Transesterification for Biodiesel Production Ceramics International; 43(1):736–740; 2017 Bioresource Technology; 242:128-132; 2017
National Institute for Interdisciplinary Science & Technology 125 Annual Report 2017-18 List of Publications 2017
82. JOSEPH (M M), NAIR (J B), ADUKKADAN (R N), NEETHU 90. LAKSHMI (N M), UMASHANKAR (K), CHANDRALEKHA (H), PILLAI (R K), NAIR (A J), MAITI (K K), SREELEKHA (T) (A), RAGHAVARAO (K S M S), JAYAN (N M), SALINI (C), Exploration of Biogenic Nano-chemobiotics Fabricated PANDEY (A), BINOD (P) by Silver Nanoparticle and Galactoxyloglucan with an Spray Drying as Effective Encapsulation Method for Phenol Efficient Biodistribution in Solid Tumor Investigated by Degrading Bacteria SERS Fingerprinting Indian Journal of Experimental Biology; 55(7):485-492; ACS Applied Materials & Interfaces; 9(23):19578-19590; 2017 2017 91. LAKSHMI (V), RAMYA (R), ANNU (R), RAJAN (T P D), 83. JOSEPH (M M), NAIR (J B), MAITI (K K), SREELEKHA (T T) PAVITHRAN (C) Plasmonically Enhanced Galactoxyloglucan Endowed Microstructural Aspects of Particle-Assisted Breath Figures Gold Nanoparticles Exposed Tumor Targeting in Polystyrene–Alumina Hybrid Free Standing Film Biodistribution Envisaged in a Surface-Enhanced Journal of Physical Chemistry C; 121(28):15154-15159; Raman Scattering Platform 2017 Biomacromolecules; 18(12):4041-4053; 2017 92. LEKSHMI (P N), BIJINI (B R), DIVYA (R), PRABITHA 84. JUBI JACOB, RESHMA (U R), SYAMA (H P), JAYAMURTHY (B N), EAPEN (S M), DILEEP KUMAR (B S), NISHANTH (P), DILEEP KUMAR (B S) Enhanced Antibacterial Metabolite Production Through KUMAR (S), NAIR (C M K), DEEPA (M), RAJENDRA BABU the Application of Statistical Methodologies by a (K) Streptomyces Nogalater NIIST A30 Isolated from Western A Novel Conformation of Gel Grown Biologically Active Ghats Forest Soil Cadmium Nicotinate PLoS ONE; 12(4):e0175919; 2017 Journal of Molecular Structure; 1147:397-405; 2017
85. KARUN (A S),HARI (S), EBHOTA (W S), RAJAN (T P D), 93. MADHAVAN (A), ANJU (A J), BINOD (P), SINDHU (R), PILLAI (U T S), PAI (B C) SUKUMARAN (R K), PANDEY (A), CASTRO (G E) Design and Processing of Bimetallic Aluminum Alloys by Synthetic Biology and Metabolic Engineering Approaches Sequential Casting Technique. and its Impact on Non-Conventional Yeast and Biofuel Metallurgical and Materials Transactions A - Physical Production Metallurgy and Materials Science; 48(1):279-293, DOI: Frontiers in Energy Research; 5(2017):8; 2017 10.1007/s11661-016-3824-9; 2017 94. MADHAVAN (A), PANDEY (A), RAJEEV K SUKUMARAN 86. KEERTHI (S), DEEPTI (K V), LEENA (D), MADHAVAN Expression System for Heterologous Protein Expression in NAMPOOTHIRI (K) the Filamentous Fungus Aspergillus Unguis An Exopolysaccharide (EPS) from a Lactobacillus Bioresource Technology; 245(Part B):1334-1342; 2017 Plantarum BR2 with Potential Benefits for Making Functional Foods 95. MADHAVAN (A), SINDHU (R), BINOD (P), RAJEEV K Bioresource Technology; 241:1152-1156; 2017 SUKUMARAN, PANDEY (A) Metagenome Analysis: a Powerful Tool for Enzyme 87. KERI (R S), CHAND (K), BUDAGUMPI (S), SASIDHAR (B Bioprospecting S), PATIL (S A), NAGARAJA (B M) Applied Biochemistry and Biotechnology; 183(2):636-651; An Overview of Benzo[b]Thiophene-Based Medicinal 2017 Chemistry European Journal of Medicinal Chemistry; 138:1002-1033; 96. MADHAVAN (A), SINDHU (R), BINOD (P), RAJEEV K 2017 SUKUMARAN, PANDEY (A) Strategies for Design of Improved Biocatalysts for Industrial 88. KRISHNAN (J), VEDHANARAYANAN (B), SASIDHAR (B Applications S), VARGHESE (S), NAIR (V) NHC-Mediated Synthesis of Pyrrolo[2,1-a]isoquinolines and Bioresource Technology; 245(Part B):1304-1313; 2017 Their Photophysical Investigations 97. MAKHLOUFI (G), BIJU FRANCIS, DECHNIK (J), Chemistry - An Asian Journal; 12 (6):623-627; 2017 STRZELCZYK (A), JANIAK (C) 89. KRISHNAN (S B), GOPIDAS (K R) Hydrophilic Microporous Lanthanide-Organic Frameworks Observation of Supramolecular Chirality in a Hierarchically Self- Based on 4,4?-Biphenyldiacetate: Synthesis, Crystal Assembled Mixed-Stack Charge-Transfer Complex Structures and Sorption Properties Chemistry - A European Journal; 23(40):9600–9606; 2017 Polyhedron; 127:59-67; 2017
126 National Institute for Interdisciplinary Science & Technology List of Publications 2017 Annual Report 2017-18
98. MAMATA (S), JAYANNAVAR (A M) 107. MIDHUN (M), PRAGATHEESWARAN (A), SANKAR (S), Stokes Efficiency and its Stochastic Properties SHIJINA (K), FIROZKHAN (M), PEER MOHAMED (A), Physica A: Statistical Mechanics and its Applications; ANANTHAPADMANABHAN (P V), WARRIER (K G K), 465:40-48; 2017 HAREESH (U S) Synthesis, Spray Granulation and Plasma Spray Coating of 99. MAMATA (S), JAYANNAVAR (A M) Lanthanum Phosphate Nanorods for Thermal Insulation The Nature of Stokes Efficiency in a Rocked Ratchet Coatings AIP Conference Proceedings; 1832(1):040004 ; 2017 Ceramics International; 43(6):4858-4865; 2017
100. MAYA (R J), ATHIRA (K), SIRAJUNNISA (P), SURESH (C 108. MIDHUN (M), SUZUKI (T), NAIR (A K), SAJU PILLAI, H), LUXMI VARMA (R) WARRIER (K G K), HAREESH (U S), NAIR (B N), GALE (J D) Lower Rim-Modified Calix[4]arene–Bentonite Hybrid Surface Modification Induced Enhanced CO2 Sorption in System as a Green, Reversible, and Selective Colorimetric Cucurbit[6]uril, an Organic Porous Material Sensor for Hg2+ Recognition Physical Chemistry Chemical Physics; 19(37):25564-25573 ; ACS Sustainable Chemistry & Engineering; 5(8):6969-6977; 2017 2017 109. MINJU (N), NAIR (B N), PEER MOHAMED (A), 101. MAYA (R J), LUXMI VARMA (R) ANANTHAKUMAR (S) An Efficient and Environmentally Benign Bentonite– Surface Engineered Silica Mesospheres – A Promising Gold Nanohybrid-Catalyzed Oxidative Cross-Coupling of Adsorbent for CO
102. MAYA (R J), SUSANNA (P), JUBI JOHN, LUXMI VARMA 110. MOHAMED (H), MISHRA (R K), VEDHANARAYANAN (B), (R) PRAVEEN (V K), AJAYAGHOSH (A) The Helix to Super-Helix Transition in the Self-Assembly Direct Reductive Amination of Aldehydes via of ?-Systems: Superseding of Molecular Chirality at Environmentally Benign Bentonite-Gold Nanohybrid Hierarchical Level Catalysis Angewandte Chemie-International Edition; 56(41):12634– Advanced Synthesis & Catalysis; 359(7):1177-1184; 2017 12638; 2017 103. MCINTOSH (S), PALMER (J), ZHANG (Z), DOHERTY (W O 111. MOLJI (C), AASHISH (A), NEETHU (K S), DEVAKI (S J) S), YAZDANI (S S), RAJEEV K SUKUMARAN, VANCOV (T) Self-Assembled Polyaniline Nanowires Stippled Graphene- Simultaneous Saccharification and Fermentation of 3-Pentadecylphenyl Phosphate Hybrid Nanocomposite Pretreated Eucalyptus Grandis Under High Solids Loading Based Green Sustainable Electrodes for Supercapacitors Industrial Biotechnology; 13(3):131-140; 2017 Journal of Materials Chemistry A; 5(32):16636-16645; 2017
104. MEERA (C), MATHEW (A K), KIRAN KUMAR (M), PANDEY 112. MOORTHY (R K), PREMALATHA (M), ARUMUGAM (M) (A), RAJEEV K SUKUMARAN Batch Sedimentation Studies for Freshwater Green A Biorefinery-Based Approach for the Production of Alga Scenedesmus Abundans Using Combination of Ethanol from Enzymatically Hydrolysed Cotton Stalks Flocculants Bioresource Technology; 242:178-183; 2017 Frontiers in Chemistry; 05(2017):37; 2017
105. MEGA (J), MOHAMED (A P), WARRIER (K G K), HAREESH 113. MUKHOPADHYAY (R D), VEDHANARAYANAN (B), (U S) AJAYAGHOSH (A) Visible-Light-Driven Photocatalytic Properties of Binary Creation of “Rose Petal” and “Lotus Leaf” Effects on MoS2/ZnS Heterostructured Nanojunctions Synthesized Alumina by Surface Functionalization and Metal-Ion via One-Step Hydrothermal Route Coordination New Journal of Chemistry; 41(9):3432-3442; 2017 Angewandte Chemie-International Edition; 56(50):16018– 16022; 2017 106. METZ (R), DIAZ (L), AZNAR (R), ALVAREZ (L), FLAUD (V), ANANTHAKUMAR (S), BANTIGNIES (J L) 114. MUTHU (C), ANUJA (V), NAIR (V C) Carbon Nanotube-Epoxy Composites: The Role of Acid CH3NH3PbBr3 Perovskite Nanocrystals as Efficient Light- Harvesting Antenna for Fluorescence Resonance Energy Treatment in Thermal and Electrical Conductivity Transfer Experimental Heat Transfer; 30(1):66-76; 2017 Chemistry - An Asian Journal; 12(9):988-995; 2017
National Institute for Interdisciplinary Science & Technology 127 Annual Report 2017-18 List of Publications 2017
115. NAGENDRA (B), SIJLA ROSELY (C V), LEUTERITZ (A), 123. NARAYANI (H), AUGUSTINE (R), SUMI (S), JOSE (M), REUTER (U), BHOJE GOWD (E) DEEPA NAIR (K), SAMSUDDIN (M), PRAKASH (H), Polypropylene/Layered Double Hydroxide SHUKLA (S) Nanocomposites: Influence of LDH Intralayer Metal Removal of Basic and Industrial azo Reactive Dyes From Constituents on the Properties of Polypropylene Aqueous Solutions via Fenton-Like Reactions Using ACS Omega; 2(1):20-31; 2017 Catalytic Non-Magnetic Pd-Flyash and Magnetic Pd- Fe3O4-Flyash Composite Particles 116. NAIR (R V), THOMAS (R T), VANDANA (S), HANIF (M), Separation and Purification Technology; 172:338-349; DONG (M), SAJU PILLAI 2017 Rapid, Acid-Free Synthesis of High-Quality Graphene Quantum Dots for Aggregation Induced Sensing of Metal 124. NINA JOSEPH, JOBIN VARGHESE, SEBASTIAN (M T) Graphite Reinforced Polyvinylidene Fluoride Composites Ions and Bioimaging an Efficient and Sustainable Solution for Electromagnetic ACS Omega; 2(11):8051-8061; 2017 Pollution 117. NAMITHA (L K), SEBASTIAN (M T) Composites Part B-Engineering; 123:271-278; 2017 High Permittivity Ceramics Loaded Silicone Elastomer 125. NINA JOSEPH, JOBIN VARGHESE, SEBASTIAN (M T) Composites for Flexible Electronics Applications In Situ Polymerized Polyaniline Nanofiber-Based Ceramics International; 43(3):2994–3003; 2017 Functional Cotton and Nylon Fabrics as Millimeter-Wave 118. NANDI (G C) Absorbers An Efficient Cu-Catalyzed Microwave-Assisted Synthesis of Polymers; 49(4):391-399; 2017 Diaryl Sulfones 126. OMER IDRIS (A S), PANDEY (A), RAO (S S), RAJEEV K Synthetic Communications; 47(4):319-323; 2017 SUKUMARAN 119. NANDI (G C) Cellulase Production Through Solid-State Tray Cu-Catalysed Mild Synthesis of N-Imidoyl and Fermentation, and its Use for Bioethanol from Sorghum N-Oxoimidoyl Sulfonimidamides through the Three- Stover Component Coupling of Sulfonimidamides, Azides, and Bioresource Technology; 242:265-271; 2017 Alkynes 127. PANDA (M K), MARTIN (E), DINNEBIER (R E), NAUMOV (P) European Journal of Organic Chemistry; 2017(45):6633- Acoustic Emission from Organic Martensites 6638; 2017 Angewandte Chemie-International Edition; 56(28):8104- 8109; 2017 120. NANDI (G C), RAJU (C) CuBr/TBHP-Mediated Synthesis of N-acyl 128. PANDA (M K), PAL (K B), GIJO (R), RAJESH (J), TARO Sulfonimidamides via the Oxidative Cross-Coupling of (M), GOUTAM DEV (M), BALARAM (M), NAUMOV (P) Sulfonimidamides and Aldehydes Flexibility in a Molecular Crystal Accomplished by Organic and Biomolecular Chemistry; 15(10):2234-2239; Structural Modulation of Carbohydrate Epimers 2017 Crystal Growth and Design; 17(4):1759-1765; 2017
121. NARASINHA (S), BINOD (P), MERLIN (R), SIPPULA (O), 129. PANDEY (A), JAYARAMAN (G), GNANSOUNOU (E), VIRKAJARVI (P), JUKKA (P), JORMA (J) LARROCHE (C), BINOD (P) Special Issue on Current Trends in Biotechnology (ICCB- INDO-NORDEN – a Consortium for Developing Holistic 2016): Preface Processes and Land Use Practices for Clean Energy Indian Journal of Biotechnology; 16(2):151; 2017 Energy Procedia; 125:363-371; 2017 130. PATEL (A K), SINGHANIA (R R), PANDEY (A) 122. NARAYANAN (R K), SADANANDHAN (N K), DEVAKI (S J) Production, Purification, and Application of Microbial Silver Patterned Supramolecular Liquid Crystalline Gels as Enzymes Electrochemical Sensor of Tyrosine Book:Biotechnology of Microbial Enzymes: Production, CHEMISTRYSELECT; 2 (1):320-328; 2017 Biocatalysis and Industrial Applications ; 13-41; 2017
128 National Institute for Interdisciplinary Science & Technology List of Publications 2017 Annual Report 2017-18
131. PIOUS (J K), LEKSHMI (M L), MUTHU (C), RAKHI (R B), 139. PREETHANUJ (P), JIJITHA (V), AJESH (V), JUBI JOHN, NAIR (V C) RADHAKRISHNAN (K V) Zero-Dimensional Methylammonium Bismuth Iodide- Sequential Tandem Transformations of Functionalized Based Lead-Free Perovskite Capacitor Diazanorbornenes: Facile Strategy towards Pentacyclic ACS Omega; 2(9):5798-5802; 2017 Frameworks with Multiple Stereocenters Synthesis - Stuttgart; 49(8):1816-1833; 2017 132. PODDER (A), ALEX (S M), MAITI (M), MAITI (K K), BHUNIYA (S) 140. PRIYA (S H), PRAKASAN (N), PURUSHOTHAMAN (J) Self-Calibrated Fluorescent Probe Resembled as an Antioxidant Activity, Phenolic-Flavonoid Content and Indicator of the Iysosomal Phosphatase Pertaining to the High-Performance Liquid Chromatography Profiling of Cancer Cells Three Different Variants of Syzygium Cumini Seeds: A Journal of Photochemistry and Photobiology B: Biology; Comparative Study 177:105-111; 2017 Journal of Intercultural Ethnopharmacology; 6(1):107-114; 2017 133. POOJA (R K), DHANYA (S), JOSEPH (M M), ABDUL SALAM (A A), SREELEKHA (T T) 141. PRIYANKA (A), SHYNI (G L), ANUPAMA (N), SALIN RAJ Indole-Coumarin-Thiadiazole Hybrids: An Appraisal of their (P), ANUSREE (S S), RAGHU (K G) MCF-7 Cell Growth Inhibition, Apoptotic, Antimetastatic Development of Insulin Resistance Through Sprouting and Computational Bcl-2 Binding Potential of Inflammatory Markers During Hypoxia in 3T3-L1 European Journal of Medicinal Chemistry; 136:442-451; Adipocytes and Amelioration with Curcumin 2017 European Journal of Pharmacology; 812:73-81; 2017
134. POOJA (R K), JOSEPH (M M), ABDUL SALAM (A A), 142. PRIYANKA (A), SINDHU (G), SHYNI (G L), PREETHA SREELEKHA (T T), DHANYA (S), BISWAS (S), PAI (K S R) RANI (M R), NISHA (V M), RAGHU (K G) Bisindole-Oxadiazole Hybrids, T3P®-Mediated Synthesis, Bilobalide Abates Inflammation, Insulin Resistance and and Appraisal of Their Apoptotic, Antimetastatic, and Secretion of Angiogenic Factors Induced by Hypoxia in 3T3- Computational Bcl-2 Binding Potential L1 Adipocytes by Controlling NF-?B and JNK Activation Journal of Biochemical and Molecular Toxicology; International Immunopharmacology; 42:209-217; 2017 31(11):e21962; 2017 143. RAGHAVAN (P), RAMASWAMY (S), CHANDRASEKHAR 135. PRATHAPAN (A), VARGHESE (M V), ABHILASH (S), (S), SUNDARARAJAN (M) SALIN RAJ (P), MATHEW (A K), NAIR (A), NAIR (R H), Evaluation for the Beneficiability of Silica Sands from RAGHU (K G) Cherthala Area of Alappuzha District, Kerala, India Polyphenol Rich Ethanolic Extract From Boerhavia Diffusa Indian Journal of Geo-Marine Sciences; 46(8):1596-1606; L. Mitigates Angiotensin II Induced Cardiac Hypertrophy 2017 and Fibrosis in Rats 144. RAHUL (S), DEVADAS (K M), SYJU THOMAS, NESON Biomedicine and Pharmacotherapy; 87 :427 - 436; 2017 VARGHESE, PAULOSE (A P), MANOJ RAAMA VARMA, 136. PRATHEESH (K), ALLESU (K), JOSEPH (M A), RAVI (M) SYAMAPRASAD (U) Study on the Effects of Squeeze Pressure on Mechanical A Comparative Study on the Effects of n C, n SiC and BRH Properties and Wear Characteristics of near-Eutectic on the Structural and Superconducting Properties of MgB2 Al€“Si€“Cu€“Mg€“Ni Piston Alloy with Variable Cu Content PIT Wires International Journal of Metalcasting; 11(4):831-842; 2017 Materials Chemistry and Physics; 200:395-401; 2017
137. PRAVEEN KUMAR (V), RENJITHA (J), FATHIMATH 145. RAHUL (S), THOMAS (S), DEVADAS (K M), NESON SALFEENA (C T), ASHITHA (K T), KERI (R S), SUNIL VARGHESE, PAULOSE (A P), MANOJ RAAMA VARMA, VARUGHESE, SASIDHAR (B S) SYAMAPRASAD (U) Antibacterial and Antitubercular Evaluation of Tackling the Agglomeration of Mg2Si Dopant in MgB2 Dihydronaphthalenone-indole Hybrid Analogs Superconductor Using Cast Mg-Si Alloy Chemical Biology & Drug Design; 90(5):703-708; 2017 Materials Research Bulletin; 93:296-302; 2017
138. PREETHALAYAM (P), KRISHNAN(K S), THULASI (S), 146. RAJESH KUMAR (R), JAYARAJ (J), SRINIVASAN (A), CHAND (S S), JOSEPH (J), NAIR (V), JAROSCHIK (F), PILLAI (U T S) RADHAKRISHNAN (K V) Investigation on the Microstructure, Mechanical Properties Recent Advances in the Chemistry of Pentafulvenes and Corrosion Behavior of Mg-Sb and Mg-Sb-Si Alloys Chemical Reviews; 117(5):3930-3989; 2017 Journal of Alloys and Compounds; 691:81-88; 2017
National Institute for Interdisciplinary Science & Technology 129 Annual Report 2017-18 List of Publications 2017
147. RAJESHKUMAR (R), UDHAYABANU (V), SRINIVASAN 155. RAMYA (A N), JOSEPH (M M), SANTHI (M), VARSHA (K), (A), RAVI (K R) SREELEKHA (T T), MAITI (K K) Microstructural evolution in ultrafine grained Al-Graphite Emergence of Gold-Mesoporous Silica Hybrid composite synthesized via combined use of ultrasonic Nanotheranostics: Dox-Encoded, Folate Targeted treatment and friction stir processing Chemotherapy with Modulation of SERS Fingerprinting for Journal of Alloys and Compounds; 726:358-366; 2017 Apoptosis Toward Tumor Eradication Small; 13(31):1700819; 2017 148. RAJI (G R), PAULOSE (A P), JOB (R B), THOMAS (S), SURESH (K G), VARMA (M R) 156. RAMYA (K), MENON (R R), LIKHITHA, BUSSE (H J), Phase Transformations,Iinverse Magnetocaloric Effect TANAKA (N), KRISHNAMURTHI (S), RAMESHKUMAR and Critical Behavior of Ni
130 National Institute for Interdisciplinary Science & Technology List of Publications 2017 Annual Report 2017-18
164. REMYA (R), DEB (B) 172. ROSHNI (S B), SEBASTIAN (M T), SURENDRAN (K P) Ultrathin Organic Spin-on Layers on Indium tin Oxide as a Can Zinc Aluminate-Titania Composite be an Alternative Prospective Tool for Enhanced Light Throughput for Alumina as Microelectronic Substrate? Materials Letters; 186:220-223; 2017 Scientific Reports; 7:40839; 2017
165. RENJU (U A), PRABHAKAR RAO (P), VAISAKHAN 173. SABEELA BEEVI (U), GNANSOUNOU (E), RAJEEV K THAMPI (D S) SUKUMARAN, SINDHU (R), PANDEY (A), SAHOO (D) Influence of Phase Transition from Order to Disorder and Bioflocculation: An Alternative Strategy for Harvesting of Philip’s Ionicity on the Thermal Expansion Coefficient Microalgae - An Overview of Pyrochlore Type Compositions with a Multivalent Bioresource Technology; 242:227-235; 2017 Environment 174. SADANANDHAN (N K), DEVAKI (S J) New Journal of Chemistry; 41(1):245-255; 2017 Gold Nanoparticle Patterned on PANI Nanowire Modified 166. RESHMA (M V), JUBI JACOB, SYAMNATH (V L), Transducer for the Simultaneous Determination of HABEEBA (V P), DILEEP KUMAR (B S), LANKALAPALLI Neurotransmitters in Presence of Ascorbic Acid and Uric (R S) Acid First Report on Isolation of 2,3,4-Trihydroxy-5- Journal of Applied Polymer Science; 134(1):44351-44351; 2017 Methylacetophenone from Palmyra Palm (Borassus Flabellifer Linn.) Syrup, its Antioxidant and Antimicrobial 175. SADANANDHAN (N K), MOLJI (C), DEVAKI (S J), MENON Properties (A R R) PEDOT-Reduced Graphene Oxide-Silver Hybrid Food Chemistry; 228:491-496; 2017 Nanocomposite Modified Transducer for the Detection of 167. RESHMA (R), ARUMUGAM (M) Serotonin Selective Degradation of the Recalcitrant Cell Wall of Journal of Electroanalytical Chemistry; 794:244-253; 2017 Scenedesmus Quadricauda CASA CC202 Planta; 246(4):779-790; 2017 176. SAHOO (D), SABEELA BEEVI (U), ASWIN KUMAR (O), RAJEEV K SUKUMARAN, EMRIN (G), PANDEY (A) 168. RESHMI (V R), PRABHAKAR RAO (P), ATHIRA (K V R), Potential of Brachiaria Mutica (Para Grass) for Bioethanol SREENA (T S) Production from Loktak Lake Novel Molybdenum Based Pyrochlore Type Red Bioresource Technology; 242:133-138; 2017 Phosphors, NaGd1?xSnMoO7: xEu3+ Under Near UV and Blue Excitation 177. SAHOO (J), SHANTHANA LAKSHMI (D), SUBRAMANIAN Journal of Luminescence; 190:6-9; 2017 (P S), GEORGE (T M), REDDY (M L P) Synthesis, Characterization and Photo-physical Properties 169. RESHMITHA (T R), THOMAS (S), GEETANJALI (S), of Eu(III) Complexes and its Luminescent Thin Films ARUN (K B), NISHA (P) Optical Materials; 70:83-91; 2017 DNA and Mitochondrial Protective Effect of Lycopene Rich Tomato (Solanum lycopersicum L.) Peel Extract Prepared 178. SAMEERA (S), PRABHAKAR RAO (P), DIVYA (S), ATHIRA by Enzyme Assisted Extraction Against H2O2 Induced (K V R), AJU THARA (T R) Oxidative Damage in L6 Myoblasts High IR Reflecting BiVO4-CaMoO4 Based Yellow Pigments Journal of functional foods; 28:147–156; 2017 for Cool Roof Applications Energy and Buildings; 154:491-498; 2017 170. ROBELLO (S), JOSE (L), SINDHU (R), ANEESH (E M) Molecular Advancements in the Development of 179. SANDEEP (C), GHOSH (S), PRAVEEN (V K), Thermostable Phytases AJAYAGHOSH (A) Applied Microbiology and Biotechnology; 101(7):2677- An Unprecedented Amplification of Near-Infrared Emission 2689; 2017 in a Bodipy Derived ?-System by Stress or Gelation Chemical Science; 8(8):5644-5649; 2017 171. ROSHNI (S B), JAYAKRISHNAN (M P), MOHANAN (P), SURENDRAN (K P) 180. SANDEEPA (K V), SAJENA (K S), JOSHY JOSEPH Design and Fabrication of an E-Shaped Wearable Textile Fullerene Cluster Assisted Self-Assembly of Short DNA Antenna on PVB-Coated Hydrophobic Polyester Fabric Strands into Semiconducting Nanowires Smart Materials and Structures; 26(10):105011; 2017 Chemistry - A European Journal; 23(62):15759-15765; 2017
National Institute for Interdisciplinary Science & Technology 131 Annual Report 2017-18 List of Publications 2017
181. SANDHYA (K S), SURESH (C H) 188. SARANYA (G), ANEES (P), JOSEPH (M M), MAITI (K K), Quantification of Thermodynamic Hydridicity of Hydride AJAYAGHOSH (A) Complexes of Mn, Re, Mo, and W Using the Molecular A Ratiometric Near-Infrared Fluorogen for the Real Time Electrostatic Potential Visualization of Intracellular Redox Status during Apoptosis Journal of Physical Chemistry A; 121(14):2814-2819; 2017 Chemistry - A European Journal; 23(30):7191-7195; 2017
182 SANEESH BABU (P S), MANU (P M), JAYARAM DHANYA 189. SARANYA (J), DHANYA (B P), GREESHMA (G), (T), PRADHAN (T), NAIR MEERA (R), ARUN (S), ANEESH RADHAKRISHNAN (K V), PRIYA (S) (K A), JISHA (V S), RAMAIAH (D), ASHA NAIR (S), Effects of a New Synthetic Zerumbone Pendant Derivative RADHAKRISHNA PILLAI (M) (ZPD) on Apoptosis Induction and Anti-migratory Effects in Bis(3,5-Diiodo-2,4,6- Trihydroxyphenyl)Squaraine Human Cervical Cancer Cells Photodynamic Therapy Disrupts Redox Homeostasis Chemico-Biological Interactions; 278:32-39; 2017 and Induce Mitochondria-mediated Apoptosis in Human 190. SARANYA (J), SHILPA (G), RAGHU (K G, PRIYA (S) Breast Cancer Cells Morus alba Leaf Lectin (MLL) Sensitizes MCF-7 Cells to Scientific Reports; 7:42126; 2017 Anoikis by Inhibiting Fibronectin Mediated Integrin-FAK 183. SANKARALINGAM (M), PRABHA (V), PALANIANDAVAR Signaling Through Ras and Activation of P38 MAPK (M) Frontiers in Pharmacology; 8(34):1-12; 2017 Novel Nickel(II) Complexes of Sterically Modified Linear 191. SARASWATHY(D), PRABHAKAR RAO (P), RAJ (A K V), N4 Ligands: Effect of Ligand Stereoelectronic Factors AJUTHARA (T R) and Solvent of Coordination on Nickel(II) Spin-State and Enhanced Pigmentary Properties of Rare Earth Germanates Catalytic Alkane Hydroxylation of the Type La
132 National Institute for Interdisciplinary Science & Technology List of Publications 2017 Annual Report 2017-18
196. SELVARAJ (N), BHOJE GOWD (E) 204. SHOBI (V), JACOB (N), MISHRA (B), MANJUNATH (S Star-Shaped Poly(l -lactide) with a Dipyridamole Core: Role H), BROOKS (M J), DONG (L), NAGASHIMA (K), QIAN of Polymer Chain Packing on Induced Circular Dichroism (H), GAO (C), SERGEEV (Y V), HUANG (X F), QU (J), LU and Photophysical Properties of Dipyridamole (F), CIDECIYAN (A V), LI (T), JIN (Z B), FARISS (R N), Macromolecules; 50(14):5261-5270; 2017 RATNAPRIYA (R), JACOBSON (S G), ANAND (S) REEP6 Mediates Trafficking of a Subset of Clathrin-coated 197. SENTHILKUMAR (S), GOWTHAM (B), VINODH (K), Vesicles and is Critical for Rod Photoreceptor Function and ARULPRAKASAM (V), SUNDARARAJAN (M) Survival Delineation of Subsurface Layers Using Resistivity Imaging Human Molecular Genetics; 26(12):2218-2230; 2017 Techniques in Coastal Blocks of Thiruvallur District, Tamil Nadu, India 205. SILJA (A), SREEJITH (M), DEEPIKA (S), JOSHY JOSEPH Indian Journal of Geo-Marine Sciences; 46(5):986-994; 2017 Transmissive-to-Black Electrochromic Devices 198. SHAMLA (L), NISHA (P) Based on Cross-Linkable Tetraphenylethene- Acrylamide Formation in Plantain (Musa Paradisiaca) Chips Diphenylamine Derivatives Influenced by Different Ripening Stages: A Correlation Chemistry of Materials; 29(23):9877-9881; 2017 Study With Respect to Reducing Sugars, Amino Acids and Phenolic Content 206. SINDHU (R), BINOD (P), MADHAVAN (A), SABEELA Food Chemistry; 222:53-60; 2017 BEEVI (U), MATHEW (A K), ABRAHAM (A), PANDEY (A), VINOD KUMAR 199. SHANTHIL (M), HEMNA (F), GEORGE THOMAS (K) Molecular Improvements in Microbial Alpha-Amylases for Cost-Effective Plasmonic Platforms: Glass Capillaries Enhanced Stability and Catalytic Efficiency Decorated with Ag@SiO2 Nanoparticles on Inner Walls as Bioresource Technology; 245(Part B):1740-1748; 2017 SERS Substrates ACS Applied Materials & Interfaces; 9(23):19470-19477; 2017 207. SINDHU (R), BINOD (P), MATHEW (A K), ABRAHAM (A), GNANSOUNOU (E), PANDEY (A) 200. SHI (Y), ASSOUD (A), SANKAR (C R), KLEINKE (H) Development of a Novel Ultrasound Assisted Hydrothermal Tl2Ag12Se7: A New pnp Conduction Switching Material Pretreatment Strategy for the Production of Bioethanol with Extraordinarily Low Thermal Conductivity from Chili Post-Harvest Residue Chemistry of Materials; 29(21):9565-9571; 2017 Annals of Agricultural & Crop Sciences; 2(1):1020; 2017 201. SHIJINA (K), RAJITH (I), SREEKUMAR (K), NAIR (B N), 208. SINDHU (R), BINOD (P), MATHEW (A K), ABRAHAM PEER MOHAMED (A), YAMAGUCHI (T), ANILKUMAR (G (A), GNANSOUNOU (E), SABEELA BEEVI (U), LEYA M), HAREESH (U S), SAILAJA (G S) THOMAS, PANDEY (A) Chitosan Intercalated Metal Organic Gel as a Green Development of a Novel Ultrasound- Assisted Alkali Precursor of Fe Entrenched and Fe Distributed N-Doped Pretreatment Strategy for the Production of Bioethanol Mesoporous Graphitic Carbon for Oxygen Reduction and Xylanases from Chili Post Harvest Residue Reaction Bioresource Technology; 242:146-151; 2017 ChemistrySelect; 2(28):8762-8770; 2017 209. SINDHU (R),BINOD (P),PANDEY (A), MADHAVAN 202. SHILPA (G), RENJITHA (J), SARANGA (R), SAJIN (F (A), ALPHONSA (J A), VIVEK (N), GNANSOUNOU (E), K), MANGALAM S NAIR, BEENA JOY, SASIDHAR (B S), PRIYA (S) CASTRO (E), VINCENZA FARACO Epoxyazadiradione Purified from the Azadirachta Indica Water Hyacinth a Potential Source for Value Addition: An Seed Induced Mitochondrial Apoptosis and Inhibition of Overview NF?B Nuclear Translocation in Human Cervical Cancer Cells Bioresource Technology; 230:152–162; 2017 Phytotherapy Research; 31(12):1892–1902; 2017 210. SINGH (L K), BHADAURIA (A), SRINIVASAN (A), PILLAI 203. SHIMI (M), VANDANA (S), ABDUL RAHIM (M K), NITHA (P (U T S), PAI (B C) R), SURESH DAS, RADHAKRISHNAN (K V), RAGHU (K G) Effects of Gadolinium Addition on the Microstructure and Novel Glycoconjugated Squaraine Dyes for Selective Mechanical Properties of Mg–9Al Alloy Optical Imaging of Cancer Cells International Journal of Minerals Metallurgy and Materials; Chemical Communications; 53(39):5433-5436; 2017 24(8):901-908; 2017
National Institute for Interdisciplinary Science & Technology 133 Annual Report 2017-18 List of Publications 2017
211. SIVADAS (A P), RAO (D S S), KUMAR (N S S), PRABHU (D 220. SUDAKSHINA (B), DEVI CHANDRASEKHAR (K), YANG D), VARGHESE (S), RAMACHANDRAN (M), ONGUNGAL (H D), VASUNDHARA (M) (R M), PRASAD (S K), DAS (S) Observation of Complex Magnetic Behaviour in Calcium Self-Assembling and Luminescent Properties of Chiral Doped Neodymium Manganites Bisoxadiazole Derivatives in Solution and Liquid- Journal of Physics D - Applied Physics; 50:065004; 2017 Crystalline Phases Journal of Physical Chemistry B; 121 (8):1922-1929; 2017 221. SUMINA (N B), KUMAR (S N), ACHU (R), KUMAR (B S D) RAY (A K), WARRIER (K G K), PILLAI (S) 212. SOMAN (S), CHACKO (A S), PRASAD (V S) Low Temperature Synthesis of High Energy Facets Exposed Semi-Interpenetrating Network Composites of Poly(lactic Sheet-like Anatase TiO2 Mesocrystals Show Reduced acid) With cis-9-Octadecenylamine Modified Cellulose- e(-) /h(+) Pair Recombination Rates and Enhanced Nanofibers From Areca Catechu Husk Photoactivity Composites Science and Technology; 141:65-73; 2017 CHEMISTRYSELECT; 1 (19):6221-6229; 2017 213. SOUMYA (M S), GAYATHRI DEVI (D), SHAFEEKH (K M), DAS (S), ANNIE ABRAHAM 222. SURAJ SOMAN, YOUNIS (H M), BROWNE (W R), VOS (J Photodynamic Therapeutic Efficacy of Symmetrical G), PRYCE (M T) Diiodinated Squaraine in In Vivo Skin Cancer Models Synthesis and Isotope Effects on the Excited State Properties Photodiagnosis and Photodynamic Therapy; 18:302-309; of N^N Bound [Ir(polypyridyl)2Cl2]PF6Complexes 2017 European Journal of Inorganic Chemistry; 2017(47):5598- 5603; 2017 214. SREE MANU (K M), ARUN KUMAR (S), RAJAN (T P D), RIYAS MOHAMMED (M), PAI (B C) 223. SURENDRA KUMAR, COONDOO (I), VASUNDHARA (M), Effect of Alumina Nanoparticle on Strengthening of Al-Si PATRA (A K), KHOLKIN(A L), PANWAR (N) Alloy through Dendrite Refinement, Interfacial Bonding Magnetization Reversal Behavior and Magnetocaloric and Dislocation Bowing Effect in SmCr0.85Mn0.15O3 Chromites Journal of Alloys and Compounds; 712:394-405; 2017 JOURNAL OF APPLIED PHYSICS; 121: 043907; 2017
215. SREEDEVI (K), GOPIDAS (K R) 224. SURENDRA KUMAR, COONDOO (I), VASUNDHARA (M), Covalent Functionalization of Organic Nanoparticles Using PULI (V S), PANWAR (N) Aryl Diazonium Chemistry and Their Solvent-Dependent Observation of Magnetization Reversal and Magnetocaloric Self-Assembly Effect in Manganese Modified EuCrO3 Orthochromites Langmuir; 3(5):1162-1170; 2017 Physica B: Condensed Matter; 519:69-75; 2017 216. SREEJITH (M), SILJA (A), JOSHY JOSEPH pH-Responsive Fluorescence Enhancement in Graphene 225. SURENDRA KUMAR, COONDOO (I), VASUNDHARA (M), Oxide-Naphthalimide Nanoconjugates: A Fluorescence SANDEEP KUMAR, KHOLKIN(A L), PANWAR (N) Turn-On Sensor for Acetylcholine Structural, Magnetic, Magnetocaloric and Specific Heat Chemistry - A European Journal; 23(47):11404–11409; 2017 Investigations on Mn Doped PrCrO3 Orthochromites Journal of Physics-Condensed Matter; 29:195802; 2017 217. SREELEKSHMI (R V), BRAHMAKUMAR (M),SUDHA (J D), MENON (A R R) 226. SUYANA (P), MINJU (T), PRIYANKA (G), NAIR (B N), Studies on Natural Rubber Containing Kaolin Modified MOHAMED (A P), WARRIER (K G K), HAREESH (U S) with Hexamethylenediamine Derivative of Phosphorylated C3N4 Anchored ZIF 8 Composites: Photo-Regenerable, Cashew Nut Shell Liquid Prepolymer High Capacity Sorbents as Adsorptive Photocatalysts for Applied Clay Science; 141:171-179; 2017 the Effective Removal of Tetracycline from Water 218. SREELEKSHMI (R V), SUDHA (J D), MENON (A R R) Catalysis Science & Technology; 7(10):2118-2128; 2017 Novel Organomodified Kaolin/silica Hybrid Fillers in 227. SUYANA (P), PRIYANKA (G), MIDHUN (M), NAIR (B N), Natural Rubber and its Blend with Polybutadiene Rubber PEER MOHAMED (A), WARRIER (K G K), HAREESH (U S) Polymer Bulletin; 1-19; 2017 Photoregenerable, Bifunctional Granules of Carbon- 219. SUCHITHRA (V G), PRABHAKAR RAO (P), ASWATHY (B A) Doped g-C3N4 as Adsorptive Photocatalyst for the Efficient Color - Tunable Phosphors in Weberite Type System, Removal of Tetracycline Antibiotic La3SbO7:Bi3+, Eu3+ for Near-UV LED Applications ACS Sustainable Chemistry & Engineering; 5(2):1610-1618; CHEMISTRYSELECT; 2(25):7602–7611; 2017 2017
134 National Institute for Interdisciplinary Science & Technology List of Publications 2017 Annual Report 2017-18
228. SUYANA (P), PRIYANKA (G), NAIR (B N), MOHAMED (A Cells by Inducing Apoptosis Mediated by Reactive Oxygen P), WARRIER (K G K), HAREESH (U S) Species Formation and Uncoupling of Warburg Effect Role of Precursors on the Photophysical Properties Frontiers in Pharmacology; 8(2017)-640; 2017 of Carbon Nitride and its Application for Antibiotic Degradation 235. THOMAS (S), JOSE (A), THANVEER (T), Environmental Science and Pollution Research; 24(9):8609- ANANTHARAMAN (M R) 8618; 2017 Exchange Biased Co3O4 Nanowires: A New Insight Into its Magnetic Core–Shell Nature 229. SUYANA (P), PRIYANKA (G), NAIR (B N), PEER Journal of Magnetism and Magnetic Materials; 432:336- MOHAMED (A), WARRIER (K G K), HAREESH (U S) 341; 2017 Co3O4€“C3N4 p€“n Nano-Heterojunctions for the Simultaneous Degradation of a Mixture of Pollutants 236. THOMAS (S), REETHU (K), THANVEER (T), MYINT (M T Under Solar Irradiation Z), AL-HARTHI (S H) Environmental Science: Nano; 4(1):212-221 ; 2017 Effect of Shell Thickness on the Exchange Bias Blocking Temperature and Coercivity in Co-CoO Core-Shell 230. SWETHA (S), SURAJ SOMAN, PRADHAN (S C), Nanoparticles NARAYANAN UNNI (K N), PEER MOHAMED (A), NAIR (B Journal of Applied Physics; 122(6):063902; 2017 N), HAREESH (U S) Fine Tuning of Compact ZnO Blocking Layers for Enhanced 237. THOMAS (T G), CHANDRASEKHAR (S), SWATHI (R S), Photovoltaic Performance in ZnO Based DSSCs: a Detailed GOPIDAS (K R) Insight Using Beta Recombination, EIS, OCVD and IMVS Triazatruxene Radical Cation: A Trigonal Class III Mixed Techniques Valence System New Journal of Chemistry; 41(3):1007-1016 ; 2017 RSC Advances; 7 (2):821-825; 2017
231. SYAMA (H P), ARYA (A D), DHANYA (R), NISHA (P), 238. UDAYAN (A), ARUMUGAM (M), PANDEY (A) Nutraceuticals From Algae and Cyanobacteria (Chapter - 4) SUNDARESAN (A), JACOB (E), JAYAMURTHY (P) Quantification of Phenolics in Syzygium Cumini Seed Algal Green Chemistry: Recent Progress in Biotechnology; and their Modulatory Role on Tertiary Butyl-Hydrogen 65-89; 2017 Peroxide-Induced Oxidative Stress in H9c2 Cell Lines and 239. ULAETO (S B), RAMYA (R), PANCRECIOUS (J K), RAJAN Key Enzymes in Cardioprotection (T P D), PAI (B C) Journal of Food Science and Technology - Mysore; Developments in Smart Anticorrosive Coatings with 54(7):2115-2125; 2017 Multifunctional Characteristics Progress in Organic Coatings; 111:294-314; 2017 232. TARUN KUMAR, MASSICOT (F), HARAKAT (D), CHEVREUX (S), MARTINEZ (A), BORDOLINSKA (K), 240. USHASREE (M V), KRISHNA (S), VIDYA (J), PANDEY (A) PREETHANUJ (P), RADHAKRISHNAN (K V), BEHR (J B), Microbial Phytase: Impact of Advances in Genetic VASSE (J L), JAROSCHIK (F) Engineering in Revolutionizing its Properties and Generation of ?,?-Difluorinated Metal-Pentadienyl Species Applications through Lanthanide-Mediated C?F Activation Bioresource Technology; 245(Part B):1790-1799; 2017 Chemistry - A European Journal; 23(65):16460–16465; 241. VAISAKHAN THAMPI (D S), PRABHAKAR RAO (P), 2017 RENJU (U A) 233. THAHA (K A), VARMA (R L), NAIR (M G), SAM JOSEPH (V Studies on Order – Disorder Transition, Lattice Expansion G), KRISHNAN (U) and Ionic Conductivity in Aliovalent Cation Substituted Interaction between Octenidine-based Solution and Sm2Zr2O7 System Sodium Hypochlorite: A Mass Spectroscopy, Proton Journal of Solid State Chemistry; 255:121-128; 2017 Nuclear Magnetic Resonance, and Scanning Electron 242. VARGHESE (M V), ABHILASH (M), MANJU (A), Microscopy–Based Observational Study SAUGANTH PAUL (M V), PRATHAPAN (A), RAGHU (K G), Journal of Endodontics; 43(1):135-140; 2017 NAIR (R H) 234. THOMAS (S), ARUN (K B), SYAMA (H P), RESHMITHA (T Attenuation of Arsenic Trioxide Induced Cardiotoxicity R), NISHA (P) through Flaxseed Oil in Experimental Rats Morin Inhibits Proliferation of SW480 Colorectal Cancer Redox Report; 22(6):346-352 ; 2017
National Institute for Interdisciplinary Science & Technology 135 Annual Report 2017-18 List of Publications 2017
243. VEDHANARAYANAN (B), BABU (B), SHAIJUMON (M M), 252. VISHAL (K), FAHLMAN (B D), SASIDHAR (B S), PATIL (S AJAYAGHOSH (A) A), PATIL (S A) Exfoliation of Reduced Graphene Oxide with Self- A Convenient, Efficient and Reusable N-Heterocyclic Assembled ?-Gelators for Improved Electrochemical Carbene-Palladium(II) Based Catalyst Supported on Performance Magnetite for Suzuki–Miyaura and Mizoroki–Heck Cross- ACS Applied Materials & Interfaces; 9(23):19417-19426; 2017 Coupling Reactions 244. VERMA (R), SRINIVASAN (A), JAYAGANTHAN (R), NATH New Journal of Chemistry; 41(17):9531-9545; 2017 (S K), GOEL (S) Studies on Tensile Behaviour and Microstructural Evolution 253. VISHAL (K), FAHLMAN (B D), SASIDHAR (B S), PATIL (S of UFG Mg-4Zn-4Gd Alloy Processed Through Hot Rolling A), PATIL (S A) Materials Science and Engineering A - Structural Materials Magnetic Nanoparticle-Supported N-Heterocyclic Properties Microstructure and Processing; 704:412-426; Carbene-Palladium(II): A Convenient, Efficient and 2017 Recyclable Catalyst for Suzuki–Miyaura Cross-Coupling Reactions 245. VIDYA (J), SAJITHA (S), USHASREE (M V), SINDHU (R), Catalysis Letters; 147(4):900-918; 2017 BINOD (P), MADHAVAN (A), PANDEY (A) Genetic and Metabolic Engineering Approaches for the 254. VIVEK (N), ASTRAY (G), GULLON (B), CASTRO (E), Production and Delivery of L-Asparaginases: An Overview BINOD (P), PANDEY (A) Bioresource Technology; 245(Part B):1775-1781; 2017 Improved 1,3-Propanediol Production with Maintained 246. VIJAYALAKSHMI (K P), SURESH (C H) Physical Conditions and Optimized Media Composition: Ammonia Borane Clusters: Energetics of Dihydrogen Validation with Statistical and Neural Approach Bonding, Cooperativity, and the Role of Electrostatics Biochemical Engineering Journal; 126:109-117; 2017 Journal of Physical Chemistry A; 121(13):2704–2714; 2017 255. VIVEK (N), ASWATHI (T V), SVEN (P R), PANDEY (A), 247. VIJAYAN (A), JUMAILA (C U), RADHAKRISHNAN (K V) BINOD (P) Rhodium(III)-Catalyzed C?H Activation of O-Acetyl Self-Cycling Fermentation for 1,3-Propanediol Production: Ketoximes/N-Methoxybenzamides toward the Synthesis of Comparative Evaluation of Metabolite Flux in Cell Isoquinoline/Isoquinolone-Fused Bicycles Recycling, Simple Batch and Continuous Processes Using Asian Journal of Organic Chemistry; 6(11):1561–1565; 2017 Lactobacillus Brevis N1E9.3.3 Strain 248. VIJI (M), NIDHI (T), NEERAJ (N), RAMAIAH (D) Journal of Biotechnology; 259:110-119; 2017 Aryl Appended Neutral and Cationic Half-Sandwich Ruthenium(II)-NHC Complexes: Synthesis, Characterisation 256. VIVEK (N), SINDHU (R), MADHAVAN (A), ANJU (A J), and Catalytic Applications CASTRO (E), FARACO (V), PANDEY (A), BINOD (P) New Journal of Chemistry; 41(21):12736-12745; 2017 Recent Advances in the Production of Value Added Chemicals and Lipids Utilizing Biodiesel Industry 249. VIJI (M), NIDHI (T), RAMAIAH (D) Design of Air and Moisture Stable Ruthenophane Generated Crude Glycerol as a Substrate - Metabolic and Ruthenium(II)-Pai Complexes and Study of Their Aspects, Challenges and Possibilities: An Overview Applications in Catalysis Bioresource Technology; 239:507-517; 2017 ChemistrySelect; 2(34):11195-11199; 2017 257. YOGITA (B), RICHA (T), ABHILASH (P), DEEPA (R L), 250. VINOTH BABU (K), WINOWLIN JAPPES (J T), THIRUMAL (M) UTHAYAKUMAR (M), RAJAN (T P D) Microwave Dielectrics: Solid Solution, Ordering and Optimization of Drilling Process on Al-SiC Composite Using Microwave Dielectric Properties of (1?x)Ba(Mg1/3Nb2/3) Grey Relation Analysis O3?xBa(Mg1/8Nb3/4)O3 Ceramics Book: Materials Science and Engineering: Concepts, Bulletin of Materials Science; 40(6):1165-1170; 2017 Methodologies, Tools, and Applications; 392-406; 2017 258. ZHANG (Y), VANMEERT (M), SIEKIERSKA (A), ANNELII 251 VIRENDRA KUMAR, DIWAN (U), ISHA (S), MISHRA (R (N), JUBI JOHN, CALLEWAERT (G), EVELINE (L), K), UPADHYAY (K K) A Categorical Naked-Eye Detection of Cu2+ and DEHAEN (W), DE WITTE (P A M), KAMINSKI (R M) Zn2+through a Donor-Acceptor-Donor (D-A-D)-Type Inhibition of Glutamate Decarboxylase (GAD) by Ethyl Salicylaldimine: An Experimental and Theoretical Ketopentenoate (EKP) Induces Treatment-resistant Approach Epileptic Seizures in Zebrafish ChemistrySelect; 2(34):11358-11363; 2017 Scientific Reports; 7195 (2017); 2017
136 National Institute for Interdisciplinary Science & Technology Foreign Visits एनआईआईएसटी वै煍社नAnnuिकⴂa lद Repo्वराr tवि 2017-18देश दौर ा
एनआईआईएसटी वै煍社निकⴂ द्वरा विदेश दौरा
नाम दौरा किया देश अवधि या配र का उद्दश्
08.04.2017 डॉ. बिनोद पी फिनलℂड -14.04.2017 आईएनएनओ-इंडिगो बायोएने셍煀 सम्मलन मᴂ भाग लेने के लिए
21.05.2017 औद्योगि बायोꥍरसेसेस पर 7 वां अंतर्섾�絍셀य फोरम मᴂ भाग लेने डॉ. बिनोद पी चीन -24.05.2017 के लिए और आमंत्त वयाख् यान् देने के लिए
डॉ. के माधवन 21.05.2017- औद्योगि बायोꥍरसेसेस पर 7 वां अंतर्섾�絍셀य फोरम मᴂ भाग लेने चीन 24.05.2017 नमप् ूतिरि के लिए और आमंत्त वयाख् यान् देने के लिए
07.08.2017 डॉ. रमेश कु मार मैक् प्कℂ इंडियन मोबिलिटी अनुदान के भाग के 셂प मᴂ मैक् जर्नी एन -30.09.2017 प्कℂ संस्थन मᴂ शोध करने के लिए
19.08.2017 – डीएसटी की ओर से इंडो स्लवेनियाई परियोजना के संबंध मᴂ डॉ. मनोज रामवर्म स्लवेनिया 29.08.2017 दौरा
बायोमास उपयोग ꥍरद्योगकियⴂ पर (आईएसबीयूटी 2017) पहली 17.11.2017 डॉ. बिनोद पी चीन अंतर्섾�絍셀य संगोष्腀 मᴂ भाग लेने तथा व्यख्यन देने के लिए -19.11.2017
2017 ( 13) , 13 डॉ. विशव् प्या देब 18.11.2017 – ईकॉ मैटेरियल् आईसीईएम बकℂ ॉक थाईलℂड मᴂ वᴂ थाईलℂड 23.11.2017 अंतर्섾�絍셀य सम्मलन मᴂ भाग लेने तथा आमंत्त व्यख्यन देने के लिए
2017 ( 13) , 13 18.11.2017 – ईकॉ मैटेरियल् आईसीईएम बकℂ ॉक थाईलℂड मᴂ वᴂ डॉ. विजयकु मार थाईलℂड 23.11.2017 अंतर्섾�絍셀य सम्मलन मᴂ भाग लेने तथा आमंत्त व्यख्यन देने के लिए
22.03.2018 नेशनल त्सिग हुआ विश्विद्यलय, हिनचु, ताइवान मᴂ रमन डॉ. ई भौजे गौड ताइवान -21.06.2018 रिसर् फै लोशिप का लाभ उठाने के लिए
30.03.2018 नोरिटेक कं पनी लिमिटेड मᴂ परियोजना समी啍ष बैठक, और टोक्य डॉ. यू एस हरीश जापान -07.04.2018 इंस्टट्यट ऑफ टेक्नलॉजी, जापान की या配र
National Institute for Interdisciplinary Science & Technology 137 विदेशीAnnu वै煍社नal Repoिकⴂrt 2017-18/ प्रतिष्脿 त व㔯क्तिⴂ के एनआईआईएसटी का दौरा Foreign Visits
विदेशी वै煍社निकⴂ / प्रतिष्脿त व㔯क्तिⴂ के एनआईआईएसटी का दौरा
नाम देश से अवधि यात्रा का उद्देश्य
कार्यात्मक एलिफाटिक पॉली कार्बोनेट्स पर: संश्लेषण, डॉ. श्रीनिवास सिंगापुर 03.04.2017 जलीय सेल्फ-असेंबली और बायोमेडिकल अनुप्रयोग पर वेंकटरमन व्याख्यान देने के लिए
नोवा गोरिका विश्वविद्यालय और एनआईआईएसटी सहा. प्रो. डॉ आर्टम 08.05.2017 – के बीच"होल डोप्ड डबल पेरोव्स्काइट्स फोर सेंसर और स्लोवेनिया बदास्यान 12.05.2017 स्पिंट्रोनिक्स अनुप्रयोगों " नामक भारतीय-स्लोवेनियाई द्विपक्षीय अनुसंधान परियोजना के भाग के रूप में
प्रो एम एम शर्मा मुंबई 11.05.2017 राष्ट्रीय प्रौद्योगिकी दिवस व्याख्यान
अन्स एफईएम सोलूशन्स का उपयोग कर' ठोसकरण, डॉ मंजुनाथ एस बैंगलोर 29.05.2017 सीएफडी, मैकेनिकल विश्लेषण' पर व्याख्यान देने के लिए
डॉ. के आर रवि मिश्र धातु डिजाइन में कैल्फाड दृष्टिकोण में चुनौतियों और कोयम्बटुर 20.06.2017 अवसरों पर ए व्याख्यान देने के लिए
बेहतर हाइड्रोकार्बन उपयोग के लिए उत्प्रेरक सामग्री के प्रो पी देशलहरा यूएस 05.07.2017 तर्कसंगत डिजाइन पर व्याख्यान देने के लिए
ऑटोमोटिव और एयरोस्पेस उद्योगों में इस्तेमाल की प्रो आर नारायनसामी तिरुचिरापल्लि 06.09.2017 ल्यूमीनियम मिश्र धातु के क्रायोरोलिंग और फॉर्मिंग सीमा आरेख पर व्याख्यान देने के लिए
स्कैटरिंग और माइक्रोस्कोपी तकनीक के माध्यम से एच- डॉ. देबर्षी दासगुप्ता बैंगलोर 13.09.2017 बॉन्डेड आण्विक असेंबली के क्रिस्टलाइजेशन की समझ पर व्याख्यान
कम्प्यूटेशनल कैमिस्ट्री एंड इंफॉर्मेटिक्स का उपयोग कर प्रो हिरोमित्सु तकाबा जापान 04.10.2017 'कार्यात्मक सामग्री के डिजाइन' पर व्याख्यान देने के लिए
ट्रांज़िशन धातु ऑक्साइड के इलेक्ट्रॉनिक और डॉ. विद्या चक्रपाणी न्यू यार्क 07.11.2017 इलेक्ट्रोकेमिकल गुणों को मॉड्यूल करने के लिए डिफेक्ट इंजीनियरिंग पर व्याख्यान देने के लिए
21.12.2017 – डीएसटी, नई दिल्ली द्वारा अफ्रीकी शोधकर्ताओं के लिए सी डॉ. फेरिट अबिडि ट्यूनीशिया 16.01.2018 वी रमन इंटरनेशनल
138 National Institute for Interdisciplinary Science & Technology Foreign Visits Annual Report 2017-18
FOREIGN VISITS BY NIIST SCIENTISTS
Name Country Visited Duration Purpose of visit
Dr Binod P Finland 08.04.2017 - 14.04.2017 To attend INNO-INDIGO Bioenergy Conference
To attend Conference and deliver invited talk in the 7th Dr Binod P China 21.05.2017 - 24.05.2017 International Forum on Industrial Bioprocesses
Dr K Madhavan To attend Conference and deliver invited talk in the 7th China 21.05.2017 - 24.05.2017 Nampoothiri International Forum on Industrial Bioprocesses
Dr Ramesh To conduct research at Max Planck Institute as part of Germany 07.08.2017 - 30.09.2017 Kumar N Max Planck Indian Mobility grant
Dr Manoj Rama Visit in connection to Indo Slovenian Project on behalf Slovenia 19.08.2017 – 29.08.2017 Varma of DST
To attend and deliver a talk in the 1st International Symposium on Biomass Utilization Dr Binod P China 17.11.2017 - 19.11.2017 Technologies (ISBUT 2017)
To attend and deliver an invited talk at the 13th Dr Bishwapriya Thailand 18.11.2017 – 23.11.2017 International Conference on Ecomaterials 2017 (ICEM Deb 13) Bangkok, Thailand
To attend and deliver an invited talk at the 13th Dr Vijayakumar Thailand 18.11.2017 – 23.11.2017 International Conference on Ecomaterials 2017 (ICEM 13) Bangkok, Thailand
Dr E Bhoje For availing Raman Research Fellowship at National Taiwan 22.03.2018 - 21.06.2018 Gowd Tsing Hua University, Hsinchu, Taiwan
Project review meeting at Noritake Co. Ltd., and visit to Dr U S Hareesh Japan 30.03.2018 - 07.04.2018 Tokyo Institute of Technology, Japan
National Institute for Interdisciplinary Science & Technology 139 Annual Report 2017-18 Foreign Visits
VISITS OF FOREIGN SCIENTISTS / EMINENT PERSONALITIES TO NIIST
Name Country From Duration Purpose of visit
To deliver a lecture on “Functional aliphatic polycarbonates: Dr Shrinivas Venkataraman Singapore 03.04.2017 Synthesis, aqueous self-assembly and biomedical applications”
As the part of Indian-Slovenian bilateral research project be- Asst Prof 08.05.2017 – Slovenia tween University of Nova Gorica and NIIST entitled “Hole doped Dr Artem Badasyan 12.05.2017 double perovskites for sensor and spintronics applications”
To Deliver a lecture on “Solidification, CFD, Mechanical Analysis Dr Manjunath S Bangalore 29.05.2017 using Ansys FEM Solutions”
To Deliver a lecture on “Challenges and Opportunities in CAL- Dr K R Ravi Coimbatore 20.06.2017 PHAD Approach in Alloy Design”
To Deliver a lecture on “Rational Design of Catalytic Materials for Prof P Deshlahra US 05.07.2017 Improved Hydrocarbon Utilization”
To Deliver a lecture on “Cryorolling and Forming Limit Diagram of Prof R Narayanasamy Tiruchirappalli 06.09.2017 Aluminium alloys used in Automotive and Aerospace industries”
Delivered a lecture on “Understanding Crystallization of H-Bond- Dr Debarshi Dasgupta Bangalore 13.09.2017 ed Molecular Assemblies through Scattering & Microscopy Techniques”
Delivered a lecture on “Design of Functional Materials using Com- Prof Hiromitsu Takaba Japan 04.10.2017 putational Chemistry and Informatics”
Delivered a lecture on “Defect Engineering for Modulating Elec- Dr Vidya Chakrapani New York 07.11.2017 tronic and Electrochemical Properties of Transition Metal Oxide”
21.12.2017 – C V Raman International Fellowship for African Researchers by Dr Ferid Abidi Tunisia 16.01.2018 DST, New Delhi
140 National Institute for Interdisciplinary Science & Technology Ph.D Awarded (April 2017 – March 2018) Annuपीएचडीal Repor सेt 2017-18सम्मानि
पीएचडी से सम्मानि (अप्रैल 2017 – मार् 2018) क्रम नाम थीसिस का शीर्क पर्वेकक विश्ववि饍यलय अवार् किया सं मेटल नैनोपार्टकल् / कार्न क्वटम डॉट्स बेस् इलेक絍र डॉ टी प्रसाद राव और 1 शेरीमा आर एम ा एसीएसआईआर अप्रैल के मिकल सᴂसर् फॉर सिलेक्टड बायोलॉजिकल कपाउड्स डॉ के वी राधाकृ ष्न ं ं 2017 मेटाबोलिक इजीं नियरिंग ऑफ़ सी- ग्टाल मिकम फॉर सैलिटोल डॉ के माधवन अप्रैल 2 किरण एस धर कु साट प्रोडक्न 굍रम पᴂटोसेस नंपतिू री 2017 डिज़ाइन ऑफ़ नोवेल ट्जीशन मेटल कॉप्लक्सस : स्डी ऑफ़ 3 विजी एम र डॉ डी रामय्य एसीएसआईआर मई कैटेलिटिक , आयन रिकग्नशन एड बायोलॉजिकल प्रॉपर्ज ं 2017 डिज़ाइन , सिंथेसिस एडं सेल् -असᴂबली ऑफ़ β-सैक्लडेक्सटन 4 नागराज नायक बेस् मैटेरियल् फॉर ड्रग डिलिवरी एडं फोटो इन्ड्सय ् इलेक絍रन डॉ के आर गोपिदास एसीएसआईआर मई ट्रसफर अप्लकेशन् 2017 ए स्डी ओण सिगल एड मल्टफोटोन एक्टव स्रैन मई 5 दिव्य ससन फिलिप् ं ं क डॉ ए अजयघोष एसीएसआईआर ू डेरिवेटिव् 2017
वेदनारायणन बी सेल् -असᴂबल् फक्नल हाइब섿ड मैटेरियल् ऑफ़ कार्न 6 ं डॉ ए अजयघोष एसीएसआईआर मई अलो絍रोप एड एक्टᴂडेड π-सिस्म् फॉर वेरियस अप्लकेशन् ं 2017 डेवलपमᴂट ऑफ़ नोवेल मेथोडोलोजिज़ टुवर्ड् फ़ं क्नलिज़् मई 7 शरन्य एस डॉ के वी राधाकृ ष्न केरल विश्व饍यलय सैक्लपᴂटानोइड्स 2017 राहुल देव के मिस絍र एड अप्पलकेशन ऑफ़ ए फ् टेलर -मेड मेटल -आर्गेक जन 8 ं य डॉ ए अजयघोष एसीएसआईआर ू मखोपाध्ु या मैटेरियल् 2017
फै ब섿केशन एडं कैरेक्राइजेशन ऑफ़ एलमिनियु म कं पोजिट्स बाइ जलाईु 9 श्री मन ु के एम डॉ टी पी डी राजन एसीएसआईआर स्क्व इफिलं 絍रशन एडं कोम्पकास्टिग टेक्नक् 2017 टाइटानिया, टाइटानेट एडं फ्लई ऐश बेस् नैनो स्क㔚र् एडं नैनो जलाईु 10 मन ु जोस डॉ सत्जीत शकु ्ल एसीएसआईआर कं पोजिट्स फॉर आर्गेक डाई रिमवलू 굍रम एक्स सोलशनू ् 2017 एक्सप्इटेशन ऑफ़ डयाजोनियम के मिस絍र : सिथेसिस , ं अगस् 11 प्रकाश एस पी कैरेक्राइजेशन एड अप्लकेशन् ऑफ मेटल नैनो पार्टकल -लिक् डॉ के आर गोपिदास एसीएसआईआर ं ं 2017 आर्गेक 祍र मवर्क एडं नैनो 嵍राफिटक मैटेरियल् π π अगस् 12 ए स्डी ऑफ़ डोनर-अक्सेपर इटरेकं ्न् इन -जेल् एडं डॉ ए अजयघोष एसीएसआईआर विष् ण एस कं जगेटेडु पॉलीमर् 2017 के मिकल एडं बायोलॉजिकल इवेसं ्टगेशसं ओण फाइटो केमीकल् अगस् 13 इदं ु शशिधरन डॉ ए सनु ्रेशन केरल विश्व饍यलय ऑफ़ टर्मनलिया चेबलाु 2017 ग ऑफ़ पॉलीमर अलम्न नैनो अगस्ﴂल啍ष् वी पार्टकल असिस्टड माइक्रो पैटेर् 14 ु डॉ टी पी डी राजन कसाट कम्पोजट फिल् ु 2017 सॉल - जेल नैनो असᴂबली ऑफ़ अलमिनो - सिलोक्सन हाइब섿ड लिजा व�यल ु अगस् 15 ं जेल् एड हैरार्क कली पोरस एरोजेल आर्क टेक्चेर फॉर डॉ एस अनतकमार केरल विश्व饍यलय ं ं ु 2017 बायोफक्नल अप्लकेशन् डीएफटी स्डीज ओण दि नेचर , स絍रग् एड कोऑपरेटिविटि रम्य के ं 16 ऑफ़ इटरं मॉलिक्लरय इटरेकं ्न् इन डाइपोलर आर्गेक डॉ सरेशु सी एच केरल विश्व饍यलय अगस् मोलेक्लय ्, पोलियन् एडं कार्न रिंग् 2017
National Institute for Interdisciplinary Science & Technology 141 पीएचडीAnnu aसेl Reसमpo्मानिrt 2017-18 Ph.D Awarded (April 2017 – March 2018)
आर्गेक नैनो पार्टकल् कं पोज् ऑफ़ 굍र के मिस絍र डेनड्रिटिस : अगस् 17 श्रीदेवी के डॉ के आर गोपिदास कु साट सिंथेसिस , कैरेक्राइजेशन एडं अप्लकेशन् 2017 डिज़ाइन , सिथेसिस , फोटो फिजिकल स्डीज एड अप्लकेशन् इन अगस् 18 विनायक एम वी ं ं डॉ के आर गोपिदास केरल विश्व饍यलय डाई सᴂसिटीज़ेड सोलर सेल् ऑफ़ ए फ् य 絍रइफेनीलामिन 2017 मेसो -π-एक्टᴂडेड बॉडीपी डेरिवेटिव् : सेल् -असᴂबली , 19 संदीप सी डॉ ए अजयघोष एसीएसआईआर सितंबर 2017 ऑप्टकल प्रॉपर्ज एडं अप्लकेशन् स्क㔚रल चᴂजस प्रोब् इन पॉलीमर -साल्ᴂट सिस्म् अट् षैज ू पी 20 मॉलिक्लरय , क्रिस्लाइन एडं लमेल्र लᴂथ -स्क ल् ड्यरू िंग डॉ ई भोजे गौड एसीएसआईआर सितंबर 2017 क्रिस्लाइसेशन एडं फेज ट्रांशन् जयकु मार ई प्रोसेसिंग एडं कैरेक्राइजेशन ऑफ़ फ़ं क्नैली 嵍रडेड मेटल एडं 21 डॉ टी पी डी राजन कु साट सितंबर 2017 पॉलीमर कं पोजिट्स इवेसं ्टगेशसं ओण 嵍राफिटक कार्न नाइ絍रइड बेस् सेमिकं डक्र अक्तू बर 22 सयु ाना पी डॉ. य ू एस हरीश एसीएसआईआर हेटेरो जंक्सश फॉर फोटोकैटेलिटिक अप्लकेशन् 2017
फोटो के मिकल इन्वस्टगेशन ऑफ़ सीजीजियम कु मिन सीड्स एडं अक्तू बर 23 श्यमा एच पी डॉ. पी. जयमरू ्त कु साट इट्स इम्पक् इन एमेलिओरेट डिसीसेस लाइफस्टइल असोवा 2017
मैक् फेज टेरनरी कार्बइड्स : सिथेसिस , नैनो कपोजिट्स ं ं अक्तबर 24 महेश के वी एड एक्फोलिएटेड 2डी मैक्सन /मैक्सन नैनो स्क्चेर फॉर डॉ एस अनतकमार केरल विश्व饍यलय ू ं ं ु 2017 मल्टफं क्नल अप्लकेशन् डॉ. जे.डी. सधा एव नैनो स्क㔚र् कडक्टग पॉलीमर बेस् 絍रन्डसर् 镍 लिक्वड ु ं अक्तबर 25 नीत के एस ं ि ू र डॉ. ए आर आर केरल विश्व饍यलय ू ू क्रिस्लाइन टेम्लेट पोलीमेराइसेजन 2017 मेनोन स्क㔚रल , मैग्नेटक एड मैग्नटो कैलोरिक स्डीज इन NiMn-बेस् अक्तबर 26 राजी जी आर ं डॉ. मनोज रामवर्म केरल विश्व饍यलय ू हैसलेर अलॉय् 2017 सिथेसिस एड कैरेक्राइजेशन ऑफ़ पोरस सिरेमिक् फॉर मैटेलिक डॉ टी पी डी राजन & October 27 रेश्म वी जी ं ं केरल विश्व饍यलय कं पोजिट्स डॉ. सी. पवितन 2017
फ्ओरेसᴂटली लेबल् कार्हाइड्रेट्स आस टार्टेड ट्यमर डॉ. सरेश दास एव नवबर 28 शिमी एम ल ू ु ं एसीएसआईआर ं इमेजिंग प्रोब् एडं आस पी एच रेस्पॉन्व जेलटर् डॉ. के वी राधाकृ ष्न 2017
हाइली डिस्पेरड पाली प्रोपाइलिन /लयेर् डबल हाइड्रोक्सइड नैनो 29 बकू नागᴂद डॉ ई भोजे गौड एसीएसआईआर नवंबर कपोजिट्स : प्रिपरेशन , स्क㔚र एड दयर प्रॉपर्ज ं ं 2017 मैग्नेटक , ट्सपोर् एड मैग्नटो ट्सपोर् प्रॉपर्ज ऑफ़ परोव्स्ट्स 30 जसनामोल पी पी र ं र डॉ मनोज राम वर्म एसीएसआईआर दिसबर La2BMnO6 (B=Fe, Cu, and Cr) ं 2017 बᴂटोनाइट बेस् आर्गेक -इनऑर्गेक हाइब섿ड मैटेरियल् : 31 माया आर जे डॉ ल啍ष् वर्म एसीएसआईआर दिसंबर अप्लकेशन् टवर्ड् 嵍रन कटैलिसीस एड आस मरक्री सᴂसर ु ं य 2017 डिज़ाइन , सिंथेसिस , स्डी ऑफ़ दि सेल् -असेम्बलंग एडं 32 राहुल एम ओगगल लमिनेसेन् प्रॉपर्ज ऑफ़ सम 1,3,4-ऑक्सडयाजोल एड डॉ सरेश दास एसीएसआईआर ं ु ु ं ु दिसबर 2,1,3-बᴂज़ो ऑक्सडयाजोल डेरिवेटिव् ं 2017 डिज़ाइन , सिथेसिस एड फोटो फिजिकल स्डीज ऑफ़ डाइकीटो ल啍ष्कात टी एम ं ं 33 ं प्यरलोप्यरल -बेस् स्मल मोलेक्ल् एड दयर अप्लकेशन् इन डॉ के आर गोपिदास एसीएसआईआर य ं दिसबर बल् हेटेरो जक्न सोलर सेल ं ं 2017
142 National Institute for Interdisciplinary Science & Technology Ph.D Awarded (April 2017 – March 2018) Annuपीएचडीal Repor सेt 2017-18सम्मानि
स्डीज ओण डेवलपमᴂट ऑफ़ ओर्नो – मॉडिफाइड नैनो – 34 राजी वी वी डॉ ए आर आर मेनन केरल विश्व饍यलय दिसबर ं ग फिल्लर फॉर रबर इडस絍रﴂकयोलिन् आस री-इन्फर् ं 2017 इवेसं ्टगेशसं ओण दि वेट के मिकल सिंथेसिस ऑफ़ सिरेमिक 35 शभाु पी वी डॉ य ू एस हरीश कु साट दिसंबर अडसोर्ट्स फॉर कार्न डाइऑक्सइड कै प㔚र 2017 निशात गोपाल बायो रिफाइनिग ऑफ़ वीट ब्न फॉर दि प्रोडक्न ऑफ़ डॉ के माधवन 36 ं ं एसीएसआईआर जनवरी 2018 फे셁लोयल एस्टेर ,फे셁लिक एसिड एडं देयर अप्लकेशन् नम्ुतप री
निशा एन डिज़ाइन एड फे ब섿केशन ऑफ़ एसईआरएस गाइडेड टार्टेड नैनो डॉ कौस्भ कमार 37 ं 酁 ु एसीएसआईआर जनवरी 2018 प्रोब् टुवर्ड् कℂसर मैनेजमᴂट मैती फाइटो कⴂस्टटूएटं स्डीज ऑफ़ पालमिरा पाम रेष्म एम वी डॉ के पी पद्मकु मारी 38 (बोरासेसफ्लबेलीफेर लĂन ) सैप , इट्स वैल् एडेड सिरप एड कसाट जनवरी 2018 य ं अम्म ु प्रोसेस ऑप्टमाइजेशन डॉ मनोज राम इडजा आई जे डेवलपमᴂट ऑफ़ लो -लॉस एलमिना बेस् कोफयरबिल सिरेमिक 39 ं ु ु वर्म एव डॉ एम टी केरल विश्व饍यलय जनवरी 2018 सब्絍रटस एड डाई इलेक्टक इग्क फॉर माइक्रोवेव अप्लकेशन् ं ं ं सेबास्टिन सेल् -असᴂबली एड प्रॉपर्ज ऑफ़ लो बℂड गैप डाइकीटो 40 स륍रट घोष ं डॉ ए अजयघोष एसीएसआईआर फऱवरी 2018 प्यरलोप्यरल डेरिवेटिव्
β-साइक्लडेक्सटन फसिलिटटेड डोनर -अक्सेपर सप्राु मॉलिक्लरय 41 समेशु बाबू सेल् -असᴂबल् सिस्म् फॉर चार् ट्रसफर एडं इलेक絍रन ट्रसफर डॉ के आर गोपिदास एसीएसआईआर फऱवरी 2018 अप्लकेशन्
एक्सप्इटिंग नॉनकोवलᴂट इटरेकं ्न् फॉर दि प्रिपरेशन ऑफ़ 42 अ셁ण गोपी डॉ यसफू क셁वाथ एसीएसआईआर फऱवरी 2018 क्वाटम डॉट -आर्गेक क्रोमोफोर हाइब섿ड नैनोस्क㔚र्
डेवलपमᴂट ऑफ़ नोवेल मेटल -굍र मल्ट कॉम्पनेन् एडं सी एच चदं शेखर 43 ऑक्सडेटिव रिएक्न मेथोडोलोजिज़ फॉर दि कं स्क्न ऑफ़ डॉ एल रवि शकरं एसीएसआईआर फऱवरी 2018 बायोलॉजिकली रिलेवᴂट मोलेक्लय ् गाय配र टी एच रेयर अर् बेस् मिक्स मेटल ऑक्सइड्स फॉर एनर् मार् 44 डॉ एस अनतकमार एसीएसआईआर अप्लकेशन् ं ु 2018 फे ब섿केशन एड कैरेक्राइजेशन ऑफ़ फ़क्नैली 嵍रडेड मेटल अखिल एस करण ं ं 45 एडं पॉलीमर कम्पोजट बाइ स्वकᴂ टिअल सेन絍रफ्गलय कास्टिग डॉ टी पी डी राजन कु साट मार् टेक्नक् 2018 इवेस्टगेशस ओण जिग ऑक्सइड एम्बडेड पॉलीमर मैट्क् नैनो ं ं ं मार् 46 सौम्य एस कम्पोजट कोटिग् एड फिल्म फॉर यवी/आईआर शील्डग सोलर डॉ एस अनतकमार केरल विश्व饍यलय ं ं ू ि ं ु 2018 थर्ल कण絍रल सर् सस
National Institute for Interdisciplinary Science & Technology 143 Annual Report 2017-18 Ph.D Awarded (April 2017 – March 2018)
Ph.D Awarded (April 2017 – March 2018)
Sl. Name Thesis Title Supervisor University Awarded No. Metal nanoparticles / carbon quantum dots Dr. T Prasad Rao & April 1 Shereema R M based electrochemical sensors for selected AcSIR Dr. K V Radhakrishnan 2017 biological Compounds Metabolic engineering of cglutamicum for Dr. K Madhavan April 2 Kiran S Dhar CUSAT xylitol production from pentoses. Nampoothiri 2017 Design of Novel Transition Metal Complexes: 3 Viji M Study of Catalytic, Ion Recognition and Dr. D Ramaiah AcSIR May Biological Properties 2017 Design, Synthesis and Self-assembly of β-Cyclodextrin Based Materials for Drug 4 Nagaraj Nayak Dr. K R Gopidas AcSIR May Delivery and Photoinduced Electron Transfer 2017 Applications
A Study on Single and Multiphoton Active May 5 Divya Susan Philips Dr. A Ajayaghosh AcSIR Squaraine Derivatives 2017
Self-assembled Functional Hybrid Materials of Vedhanarayanan B 6 Carbon Allotropes and Extended π-Systems for Dr. A Ajayaghosh AcSIR May Various Applications 2017
Development of Novel Methodologies towards University of May 7 Saranya S Dr. K V Radhakrishnan Functionalized Cyclopentanoids Kerala 2017
Rahul Dev Chemistry and Applications of a Few Tailor- June 8 Dr. A Ajayaghosh AcSIR Mukhopadhyay made Metal-Organic Materials 2017
Fabrication and Characterization ofAluminum Dr. T P D July 9 Sree Manu K M Composites by Squeeze Infiltration and AcSIR Rajan 2017 Compocasting Techniques Titania, Titanate, and Flyash Based July 10 Manu Jose Nanostructures and Nanocomposites for Dr. Satyajit Shukla AcSIR 2017 Organic Dye Removal from Aqueous Solutions
Exploitation of Diazonium Chemistry: Synthesis, Characterization and Applications August 11 Prakash S P Dr. K R Gopidas AcSIR of Metal Nanoparticle-Linked Organic 2017 Frameworks and Nanographitic Materials
A Study of Donor-Acceptor Interactions in August 12 Vishnu S Dr. A Ajayaghosh AcSIR π-Gels and π Conjugated Polymers 2017 Chemical and Biological Investigations on University of August 13 Indu Sasidharan Dr. A Sundaresan Phytochemicals of Terminalia Chebula Kerala 2017 Particle assisted micropatterning of polymer Dr. T P D August 14 Lakshmi V CUSAT alumnae Nanocomposite film Rajan 2017
Sol- Gel Nanoassembly of Alumino- Siloxane University of August 15 Linsha Vazhayal Hybrid Gels and Hierarchically Porous Aerogel Dr. S Ananthakumar Kerala 2017 Architectures for Biofunctional Applications
144 National Institute for Interdisciplinary Science & Technology Ph.D Awarded (April 2017 – March 2018) Annual Report 2017-18
DFT Studies on the Nature, Strength and Cooperativity of Inter Molecular Interactions University of 16 Remya K Dr. Suresh C H in Dipolar Organic Molecules, Polyynes and Kerala August Carbon Rings. 2017
Organic Nanoparticles composed of 17 Sreedevi K fri chemistry dendrites: Synthesis, Dr. K R Gopidas CUSAT August characterisation and application 2017
Design, synthesis, Photophysical studies and University of August 18 Vinayak M V applications in dye sensitized solar cells of a Dr. K R Gopidas Kerala 2017 few triphenylamine
Sandeep C Meso-π-Extended Bodipy Derivatives: Self- September 19 Dr. A Ajayaghosh AcSIR Assembly, Optical Properties and Applications 2017 Structural Changes Probed in Polymer-Solvent Shaiju P Systems at Molecular, Crystalline and Lamellar September 20 Dr. E Bhoje Gowd AcSIR Length-Scales during Crystallization and Phase 2017 Transitions Processing and characterization of functionally September 21 Jayakumar E Dr. T P D Rajan CUSAT Graded metal and polymer composites 2017
Investigations on Graphitic Carbon Nitride Suyana P October 22 based Semiconductor Heterojunctions for Dr. U S Hareesh AcSIR 2017 Photocatalytic Applications
Photochemical investigation of October 23 Syama H P syzygiumcuminiseeds and its impact in Dr. P Jayamurthy CUSAT 2017 ameliorate diseases lifestyle assowa
MAX phase ternary carbides: Synthesis, nanocomposites and exfoliated 2D MAXene/ October 24 University of MXene nanostructures for multifunctional Dr. S. Ananthakumar 2017 Mahesh K. V. Kerala applications
Nanostructured Conducting Polymer Based Dr. J.D. Sudha University of October 25 Transducers Through Liquid Crystalline Neethu K. S. & Dr. A.R.R. Menon Kerala 2017 Template Polymerization Structural, magnetic and magnetocaloric Dr. Manoj Raama University of October 26 Raji G. R. studies in NiMn-based Heusler alloys Varma Kerala 2017
Synthesis and Characterization of Porous Dr. T P D Rajan & University of October 27 Resmi V.G. Ceramics for Metallic Composites Dr.C.Pavithran Kerala 2017
Fluorescently Labeled Carbohydrates as Dr. Suresh Das November 28 Shimi M Targeted Tumor Imaging Probes and as pH & Dr. K V AcSIR 2017 Responsive Gelators Radhakrishnan Highly Dispersed Polypropylene/Layered November 29 Baku Nagendra Double Hydroxide Nanocomposites: AcSIR Dr. E Bhoje Gowd 2017 Preparation, Structure and their Properties Magnetic, transport and magnetotransport Dr. Manoj Raama 30 Jasnamol P P properties of perovskites AcSIR December Varma La2BMnO6 (B=Fe, Cu, and Cr) 2017
Bentonite Based Organic-Inorganic Hybrid 31 Maya R J Materials: Application Towards Green Catalysis Dr. Luxmi Varma AcSIR December and as Mercury Sensor 2017
National Institute for Interdisciplinary Science & Technology 145 Annual Report 2017-18 Ph.D Awarded (April 2017 – March 2018)
Design, Synthesis, Study of the Self-Assembling and Luminescent Properties of Some 32 Rahul M Ongungal Dr. Suresh Das AcSIR 1,3,4-Oxadiazole and 2,1,3-Benzooxadiazole December Derivatives 2017
Design, Synthesis and Photophysical Studies Lakshmykanth T M of Diketopyrrolopyrrole-Based Small Molecules 33 Dr. K R Gopidas AcSIR and their Application in Bulk Heterojunction December Solar Cell 2017 Studies on Development of Organo – modified University of December 34 Raji V V Nano – kaolins as Reinforcing fillers for Rubber Dr. A R R Menon Kerala 2017 Industry.
Investigations on the wet chemical Synthesis of December 35 Subha P V Dr. U S Hareesh CUSAT ceramic adsorbents for carbon dioxide capture 2017
Biorefining of wheat bran for the production NishantGopalan Dr. K Madhavan January 36 of feruloyl esterase,ferulic acid and their AcSIR Nampoothiri 2018 applications Design and Fabrication of SERS Guided Nisha N Dr. Kaustabh Kumar January 37 Targeted NanoprobesTowards Cancer AcSIR Maiti 2018 Management Phytoconstituent Studies of Palmyra Palm Dr. K P Padmakumari January 38 Reshma M V (Borassusflabellifer Linn) Sap, its value added CUSAT Amma 2018 syrup and process optimization
Development of low-loss alumina based Dr. Manoj Raama University of January 39 Induja I J cofirable ceramic substrates and dielectric inks Varma Kerala 2018 for microwave applications & Dr. Sebastian M T
Self-Assembly and Properties of Low Band Gap February 40 Samrat Ghosh Dr. A Ajayaghosh AcSIR Diketopyrrolopyrrole Derivatives 2018
β-Cyclodextrin Facilitated Donor-Acceptor Supramolecular February 41 Sumesh Babu Dr. K R Gopidas AcSIR Self-Assembled Systems For Charge Transfer 2018 And Electron Transfer Applications
Exploiting Noncovalent Interactions for 42 Arun Gopi the Preparation of Quantum Dot-Organic Dr. Yoosaf Karuvath AcSIR February Chromophore Hybrid Nanostructures 2018 Development of Novel Metal-Free Multicomponent and Oxidative Reaction 43 C H Chandrasekhar Dr. L Ravi Shankar AcSIR Methodologies for the Construction of February Biologically Relevant Molecules 2018
Gayathri T H Rare earth based mixed metal oxides for energy March 44 Dr. S Ananthakumar AcSIR applications 2018
Fabrication & Characterization of Functionally 45 Akhil S. Karan graded metal & polymer composite by Dr. T P D Rajan CUSAT March Sequential Centrifugal casting Techniques 2018
Investigations on ZnO Embedded Polymer University of March 46 Soumya S. Matrix Nanocomposite Coatings and Films for Dr. S Ananthakumar Kerala 2018 UV/IR Shielding Solar Thermal Control Surfaces
146 National Institute for Interdisciplinary Science & Technology Research Council Annual Repoअनुसrtधां 2017-18न परिषद
अनुसधां न परिषद
अध्य प्रो. डी नरसिहं राव प्रो. के ए पद्मनाभन जैव रसायन विभाग, भारतीय वि煍ञन संस्थन प्रतिष्त प्रोफेसर बᴂगल셁ु - 560012 मैके निकल इजीं नियरिंग विभाग और सलाहकार, प्रौ饍योगकी विकास तथा हस्तातरण कᴂ द प्रो. अनिल के त섿पाठी इजीं नियरिंग कॉलेज, गिंडी निदेशक, सीएसआईआर-कᴂ द्र औषधीय एवं सगंध पौधा संस्थन पीओ- अन्न विश्व饍यलय, चेन्ई - 600 025 सीआईएमएपी, कु कराइल पिकनिक स्पट के पास, लखनऊ - 226 015 सदस् डॉ. के सी गुꥍ鄾 पर्ू निदेशक, आईआईटीआर,233, धर्कंु ज अपार्मᴂट प्रो. अश्विनी कु मार नांगिया निदेशक,सीएसआईआर-राष絍री रासायनिक प्रयोगशाला, सेक्र 9, रोबिनी, दिल्ल 110085 डॉ होमी भाभा रोड, पणे-ु 411 008 डॉ. जी एन काजी निदेशक महानिदेशक डॉ. ए अजयघोष हमदार् इसं ्टट्यटू ऑफ मेडिकल साइसेजं एडं रिसर् निदेशक, राष絍री अतरं ्विषी वि煍ञन तथा प्रौ饍योगकी संस्थन (एचआईएमएसआर),जामिया हमदार् विश्व饍यलय इडं स्ट्ल एस्टट पीओ, ति셁वनंतपरमु -69501 9 मेहरौली - बदरपरु रोड, ब配र अस्ताल के पास हमदार् नगर, नई दिल्ल-110 062 स्थयी आमंत섿त डी. जी, सीएसआईआर या उनके नामांकित प्रो. ए रमणन सीएसआईआर मख्ु यलय, अनसु ंधान भवन, 2 रसायन वि煍ञन विभाग, भारतीय प्रौ饍योगकी संस्थन दिल्ल रफी मार्, नई दिल्ल - 110001 हौज खास, नई दिल्ल - 110016 सचिव (फरवरी 2018 तक) प्रो. यू राममूर酀 डॉ. ए सदरेंु शन साम嵍र इजीं नियरिंग विभाग मखु ् वै煍ञानक, सीएसआईआर-एनआईआईएसटी भारतीय वि煍ञन संस्थन, बᴂगल셁ु - 560012 सचिव (मार् 2018 से) डॉ. पी जी राव डॉ. के हरिकृ ष् भट्ट कु लपति, मखु ् वै煍ञानक, सीएसआईआर-एनआईआईएसटी वि煍ञन तथा प्रौ饍योगकी विश्व饍यलय, मेघालय -793101
प्रबंधन परिषद् (01/01/2016 से 31/12/2017 की अवधि के लिए)
अध्य डॉ. अनंतकु मार एस निदेशक, एनआईआईएसटी व. प्रधान वै煍ञानक सदस् डॉ. राजीव के सकु ु मारन डॉ. विजयमोहनन के. पिल्쥈 व. वै煍ञानक रनदेशक, सीएसआईआर-सीईसीआरआई, कारैकु डी डॉ. पी निशा डॉ. राम ए विश्वकर् वै煍ञानक रनदेशक, सीएसआईआर-आईआईएम, जम् म ( विशेष आमत्ं त) �र आर राजीव डॉ. सनु ्रेशन व. अधीकण अभियंता मखु ् वै煍ञानक तथा प्रमख,ु आरपीबीडी सीओएफए/एफएओ, एनआईआईएसटी डॉ. एलिजाबेथ जेकब सदस् सचिव मखु ् वै煍ञानक तथा प्रधान, ईटीडी सीओए/एओ, एनआईआईएसटी
National Institute for Interdisciplinary Science & Technology 147 Annual Report 2017-18 Research Council
RESEARCH COUNCIL
CHAIRMAN Prof. K A Padmanabhan Prof. D Narasimha Rao Professor of Eminence Department of Biochemistrty Department of Mechanical Engineering Indian Institute of Science and Advisor, Centre for Technology Bangalore – 560012 Development and Transfer College of Engineering Guindy, Anna University Prof. Anil K Tripathi Chennai - 600 025 Director CSIR-Central Institute of Medicinal & MEMBERS Aromatic Plants Dr. K C Gupta P.O-CIMAP, Near Kukrail Picnic Spot Formerly Director, IITR Lucknow – 226 015 233, Dharamkunj Apartment, Sector-9, Robini, Delhi 110085 Prof. Ashwini Kumar Nangia Director Dr. G N Qazi CSIR-National Chemical Laboratory, Director General Dr. HomiBhabha Road,Pune- 411 008 Hamdart Institute of Medical Sciences and Research (HIMSR) DIRECTOR JamiaHamdart University Dr. A Ajayaghosh Mehrauli - Badarpur Road, Near Batra Hospital, Director, National Institute for Interdisciplinary Hamdard Nagar, New Delhi, Delhi 110062 Science & Technology, Industrial Estate P O Thiruvananthapuram-695 019 Prof. A Ramanan Department of Chemistry PERMANENT INVITEE Indian Institute of Technology DG, CSIR or His Nominee HauzKhas, New Delhi – 110016 CSIR-HQ, Anusandhan Bhawan, 2, Rafi Marg, New Delhi-110 001 Prof . U Ramamurty Department of Materials Engineering SECRETARY (up to February 2018) Indian Institute of Science Dr. A Sundaresan Bangalore – 560012 Chief Scientist, CSIR-NIIST
Dr. P G Rao SECRETARY (From March 2018) Vice Chancellor, University of Science & Technology
Meghalaya – 793 101 Dr. K Harikrishna Bhat Chief Scientist, CSIR-NIIST
MANAGEMENT COUNCIL Period 01/01/2016 to 31/12/2017
CHAIRMAN Dr S Ananthakumar Director, CSIR-NIIST Sr. Principal Scientist
MEMBERS Dr Rajeev K Sukumaran Dr Vijayamohanan K Pillai Senior Scientist Director, CSIR-CECRI, Karaikudi Dr P Nisha Dr Ram A Vishwakarma Scientist Director, CSIR-IIM, Jammu Kashmir (Special Invitee) Sri R Rajeev Sr. Superintending Engineer Dr Sundaresan Chief Scientist & Head, RPBD CoFA/FAO, NIIST
Dr Elizabeth Jacob Chief Scientist & Head, ETD MEMBER SECRETARY CoA / AO, NIIST
148 National Institute for Interdisciplinary Science & Technology Staff News Annual Report 2017-18
सखी और समद्ध सेवानिवत्त जीवन के लिए शभकामनाए Bestु Wishes forृ Happy andृ Prosperous Retiredु Lifeं
�र एम एम �रकु मार डॉ. य ू टी सबु मण्म पिल्쥈 �र सी पी नारायणन �र एम सी शाजी मखु ् वै煍ञानक मखु ् वै煍ञानक प्रयोगशाला सहायक व. प्रधान वै煍ञानक सेवानिवत्त:ृ 31.05.2017 सेवानिवत्त:ृ 31.05.2017 सेवानिवत्त:ृ 31.07.2017 सेवानिवत्त:ृ 31.08.2017 Shri M M Sreekumar Dr. U T Subramonian Pillai Shri C P Narayanan Shri M C Shaji Chief Scientist Chief Scientist Lab Assistant Sr. Principal Scientist Retired: 31.05.2017 Retired: 31.05.2017 Retired: 31.07.2017 Retired: 31.08.2017
�र पी बी विजयकु मार डॉ. के आर गोपिदास �र एन सधिु लाल �र वी आटनीं प्रयोगशाला सहायक मखु ् वै煍ञानक वरिष तकनीशियन (3) वरिष तकनीशियन (2) सेवानिवत्त:ृ 30.09.2017 सेवानिवत्त:ृ 30.11.2017 सेवानिवत्त:ृ 30.11.2017 सेवानिवत्त:ृ 30.11.2017 Shri P B Vijayakumar Dr. K R Gopidas Shri N Sudhilal Shri V Antony Lab Assistant Chief Scientist Senior Technician (3) Senior Technician (2) Retired: 30.09.2017 Retired: 30.11.2017 Retired: 30.11.2017 Retired: 30.11.2017
पदोन्नत /PROMOTIONS
�र शाजिकु मार वी के �र ए पीर मोहम्द �र प्रवीण कन्नल �र एम जयदीप �र हरीश राज वी वरिष तकनीकी अधिकारी (2) वरिष तकनीकी अधिकारी (2) वरिष तकनीशियन(1) वरिष तकनीशियन (1) तकनीकी अधिकारी Shri Shajikumar V K Shri A Peer Mohammed Shri Praveen Kannal Shri M Jayadeep Shri Harish Raj V Senior Technical Officer (2) Senior Technical Officer (2) Senior Technician(1) Senior Technician(1) Technical Officer
National Institute for Interdisciplinary Science & Technology 149 Annual Report 2017-18 Staff News
सीएसआईआर-एनआईआईएसटी मᴂ स्वगत नई नियकु 鄿या ं / New APPOINTMENTS WELCOME TO CSIR-NIIST (स्थनातं रण पर) (On Transfer)
डॉ. के जयशकरं डॉ. �रजाकु मारी एस एस डॉ. सब्रु दास डॉ. लकमी राके श कु मार यासरला वरिष वै煍ञानक वरिष वै煍ञानक वै煍ञानक वै煍ञानक Dr. Subrata Das Dr. Lakshmi Rakesh Kumar Yasarla Dr. K. Jayasankar Dr.Sreejakumari S. S Senior Scientist Scientist Senior Scientist Scientist
परसु ्कर एव ं सम्मन/AWARDS AND HONOURS डॉ बी एस शशिधर / Dr B S SASIDHAR केरल राज् यवाु वै煍ञानक परसु ्कर (केएसवाईएसए) - 2017 Kerala State Young Scientist Award (KSYSA) - 2017
डॉ प्रिया एस / Dr. Priya S डीएसटी-एसईआरबी परियोजना (मोरस अल्ब एल से शद्धीु कृ त एक लेक्टन से प्रेरित मानव स्न कℂसर कोशिकाओ ं मᴂ अनोईकिस के मैके निज् पर अध्यन) वर㔷 2010-15 के दौरान लाइफ साइसं श्रेणी मᴂ एसईआरबी की शोध हाइलाइट्स मᴂ चयनित । The DST-SERB project (Study on the mechanism of anoikis in human mammary cancer cells induced by a purified lectin from Morus alba L.) selected in the research highlights of SERB during 2010-15 in Life Science category.
निधन-सचनू ा /OBITUARY
�र पी. सोमन / Shri. P. Soman �र के. एम. प्रकाश / Shri. K. M. Prakash (1957-2017) (1964-2017) श्री पी. सोमन का निधन दिनाकं 17-04-2017 को हआु । ति셁वनतपं रमु के मलू श्री के. एम. प्रकाश का निधन 17-11-2017 को हआ।ु पालक्क के मलू विवासी श्री पी. सोमन वर㔷 1982 मᴂ एनआईआईएसटी मᴂ शामिल हएु । मत्ृ य के निवासी, श्री प्रकाश वर㔷 1989मᴂ एनआईआईएसटीमᴂ शामिल हएु । मत्ृ य के समय, आप प्रयोगशाला सहायक 嵍डर I(4) के 셂प मᴂ काम कर रहे थे । समय, आप वरिष तकनीशियन (2) के 셂प मᴂ काम कर रहे थे । Shri. P. Soman passed away on 17-04-2017. Hailing from Shri. K. M. Prakash passed away on 17-11-2017. Hailing from Thiruvananthapuram, he joined NIIST in 1982. At the time of Palakkad, he joined NIIST in 1989. At the time of demise, he demise, he was working as Lab Assistant Gr. I (4) was working as Senior Technician (2)
150 National Institute for Interdisciplinary Science & Technology Staff List Annuकalर् Repoचारी समrt हू 2017-18 की सचीू
31/03/2018 को कर्चारी समहू की सचीू रसायन वि煍ञन तथा डॉ टी पी डी राजन डॉ ए अजयघोष प्रिसिं पल वै煍ञानक निदेशक प्र셌饍योगकी प्रभाग डॉ (�रमती) आर ल啍ष् वर्मा डॉ एस वी शक्लु वरिष वै煍ञानक निदेशक का कार्यलय वरिष प्रिसिं पल वै煍ञानक तथा प्रधान डॉ के वी राधाकृ ष्न डॉ य ु एस हरीश �र किरन जे.एस वरिष वै煍ञानक तकनीकी सहायक प्रिसिं पल वै煍ञानक डॉ सी एच सरेश डॉ ई भोजे गौड �र विष् ण गर्ु र ु वरिष वै煍ञानक कनिष आशलिपिु क प्रिसिं पल वै煍ञानक डॉ ए �रीनवासन डॉ के एन नारायणन उण्ण वरिष वै煍ञानक कृ षि प्रससं ्रण तथा प्रिसिं पल वै煍ञानक प्र셌饍योगकी प्रभाग डॉ एम सनु ्राराजन डॉ कौस्鄾भ कु मार मैती वरिष वै煍ञानक डॉ बी एस दिलीप कु मार वरिष वै煍ञानक व.प्रिसिं पल वै煍ञानक एव ं प्रधान डॉ. के. जयशकरं डॉ बिश्वप्रिया देब व. वै煍ञानक डॉ. ए. सनु ्रेशन वरिष वै煍ञानक मखु ् वै煍ञानक तथा निदेशक के सलाहकार डॉ. सब्रु दास डॉ क셁णाकरन वेणगोपु ाल व. वै煍ञानक डॉ के जी रघ ु वरिष वै煍ञानक प्रिसिं पल वै煍ञानक डॉ के पी सरेु नद्रन डॉ. सनिु ल वर्स वै煍ञानक �र वी वी वेणगोपाल वरिष वै煍ञानक ु डॉ सज ु पिल्쥈 प्रिसिं पल वै煍ञानक डॉ यसू फ क셁वात वै煍ञानक वै煍ञानक डॉ (�रमती) एम वी रेश्मा डॉ (�रमती) एम वसधंु रा वरिष वै煍ञानक डॉ एल. रविशकरं वै煍ञानक वै煍ञानक डॉ (�रमती) पी निशा डॉ के.जी.निशातं वै煍ञानक डॉ जोशी जोसफ वै煍ञानक वै煍ञानक डॉ पी जयमरू 酀 डॉ. एस.एस. �रजाकु मारी वै煍ञानक डॉ बी एस शशिधर वै煍ञानक वै煍ञानक डॉ(�रमती) प्रिया एस डॉ वी एस प्रसाद वै煍ञानक डॉ सी विजयकु मार प्रिसिं पल तकनीकी अधिकारी वै煍ञानक डॉ (�रमती) बीना जोय �र एम बह्मकु मार प्रिसिं पल तकनीकी अधिकारी डॉ (�रमती) जे डी सधाु प्रिसिं पल तकनीकी अधिकारी प्रिसिं पल तकनीकी अधिकारी �र डी आर शोभन कमार �र ए पीर मोहम्द ु वरिष तकनीकी अधिकारी (2) वरिष तकनीकी अधिकारी(1) �रमती सौमिनी मैथ्य वरिष तकनीकी अधिकारी (1) डॉ. एस. रामस्वमी माइक्रोबियल प्रोसेस तथा �र रोबर् फिलिप वरिष तकनीकी अधिकारी (1) प्र셌饍योगकी प्रभाग वरिष तकनीकी अधिकारी (1) �र वी. हरीश राज तकनीकी अधिकारी डॉ के माधवन नपं तिू रर �रमती एस विजी प्रिसिं पल वै煍ञानक एव ं प्रधान वरिष तकनीकी अधिकारी (1) �र एम.पी.वर् प्रयोगशाला सहायक डॉ राजीवकु मार सकु ु मारन �र किरन मोहन वरिष वै煍ञानक तकनीकी अधिकारी पर्यवरण प्र셌饍योगकी प्रभाग डॉ पी बिनोद पदार् वि煍ञन तथा डॉ (�रमती) एलि焼बेथ जेकब वै煍ञानक प्र셌饍योगकी प्रभाग मखु ् वै煍ञानक तथा प्रधान डॉ एन रमेश कु मार डॉ पी प्रभाकर राव डॉ अजित हरिदास वै煍ञानक मखु ् वै煍ञानक तथा प्रधान मखु ् वै煍ञानक डॉ म配ु त अ셁मगमु डॉ के हरिकृ ष् भट्ट डॉ (�रमती) एस सावित섿 वै煍ञानक मखु ् वै煍ञानक वरिष प्रिसिं पल वै煍ञानक डॉ. जे असारी �र एम किरन कु मार डॉ मनोज रामावर्म ं वरिष प्रिसिं पल वै煍ञानक वरिष प्रिसिं पल वै煍ञानक वै煍ञानक डॉ एम रवि डॉ बी कृ ष्कु मार डॉ. ल啍ष् राके श कु मार यासरला वरिष प्रिसिं पल वै煍ञानक वरिष वै煍ञानक वै煍ञानक डॉ एस अनन्कु मार �र बी अब्दल हलीम वरिष प्रिसिं पल वै煍ञानक वै煍ञानक
National Institute for Interdisciplinary Science & Technology 151 कर्Annuचारी समal हूRepo की सrtचीू 2017-18 Staff List
डॉ के पी प्रतीश �र जी नाग�रीनवासु �रमती शाना एस. नायर वै煍ञानक वरिष तकनीशियन (2) स्टफ नर् �रमती विजयाप्रसाद �र पषु ्पकु मार के आर नायर वरिष तकनीकी अधिकारी (3) �रमती एम गीता 嵍पर सी गैर तक. (एमएसीपी) प्रयोगशाला सहायक �र वी के षाजिकु मार वरिष तकनीकी अधिकारी (1) �र के उण्णकृ ष्न अनसु धां न योजना तथा 嵍पर सी गैर तकनीकी (एमएसीपी) �र जोशी जोर् व्वसाय विकास वरिष तकनीकी अधिकारी (1) डॉ सी चनद्रशेखरा भट्ट �र के मध ु बेयरर (एमएसीपी) �रमती पी एम सह셂बा वरिष प्रिसिं पल वै煍ञानक तथा प्रधान तकनीकी अधिकारी �र सी के चनद्रकान् �र ए �रकु मारन �र टी पी पौलोस प्रिसिं पल वै煍ञानक वाशबॉय (एमएसीपी) वरिष तकनीशियन (3) �र आर एस प्रवीण राज वरिष वै煍ञानक वित एव ं लेखा एस एडं टी सेवा प्रभाग डॉ दीपा बालन �र डी पी मारेट इजीं नियरिंग एव ं सेवा प्रभाग वै煍ञानक वित्त एवं लेखा अधिकारी
डॉ जे अंसारी �र बी वेणगोपु ाल �रमती पी वी विजि वरिष प्रिसिं पल वै煍ञानक तथा प्रधान वरिष तकनीशियन (2) अनभागु अधिकारी (वित्त एवं लेखा) �र आर राजीव �रमती रमणी देवराज वरिष अधीकण अभियतां प्रशासन अनभागु अधिकारी (वित्त एवं लेखा) �र जी चनद्रबाबु �रमती एस शोभना �रमती जी.गीता अधीकण अभियतां प्रशासनध अ िकारी सहायक अनभागु अधिकारी �र के एफ जोसफ �र चनद्रशेखर नीलम सहायक कार्पालक अभियतां अनभागु अधिकारी(सा) �र सजीवं सदानन्न सहायक अनभागु अधिकारी �र बी कार्तक �र एम के शिवदासन सहायक अभियतां (सिविल) अनभागु अधिकारी(सा) �रमती कोमला सोमन सहायक अनभागु अधिकारी �र पी अ셁मगमु �र टी जे बाबु सहायक अभियतां (सिविल) वरिष सर啍ु ष अधिकारी �र विष् ण वी एल कनिष आशलिपिु क �र एस. हरिदासन पिल्쥈 �रमती के एस लतीदेवी व. तकनीशियन (1) हिन्द अधिकारी �र पी रजित मल्ट टास्कग स्टफ �र एम जयदीप डॉ. सादत सलीम ि तकनीशियन (2) चिकित्स अधिकारी भण्डर एव क्रय �र के एस प्रमोद �र के पी कृ ष्न ं तकनीशियन (2) सहायक अनभागु अधिकारी �र दुलीप कु मार भण्डर एव ं क्रय नियतं क �र के सरेु श कण्न �रमती मेर् जोसफ तकनीशियन (2) सहायक अनभागु अधिकारी �र सी एम कृ ष्दास सहायक अनभागु अधिकारी �र य ु धरणीपति स�ु र टी एस लता तकनीशियन (2) सहायक अनभागु अधिकारी �र एम अनिलकु मार सहायक अनभाग अधिकारी �र बी.राधाकृ ष्न स�ु र नीत ू इदं ुचडनू ु तकनीशियन (2) सहायक अनभागु अधिकारी �र एस राज ु �र टी वी सतीश �रमती पी.एस. पद्मिनी वरिष आशलिपिु क (एमएसीपी) वरिष आशलिपिु क (एमएसीपी) 嵍पर सी गैर तक. (एमएसीपी) स�ु र शीबा सैतू �र ओ.वी.शशिकु मार क. सचिवालय सहायक वरिष आशलिपिु क (एमएसीपी) नॉलिज रिसोर् सᴂटर �रमती एल लता डॉ.(�रमती) पी निशी �र आर के रमेशकु मार वरिष तकनीशियन (2) वरिष प्रिसिपल वै煍ञानक तथा प्रधान व. सचिवालय सहायक ं �र बी सतीशकमार �र बी अजयकु मार �र वी मणी ु वरिष तकनीशियन (2) वै煍ञानक क. सचिवालय सहायक स�ु र सजिता ए.एल �र टी आर सरेु श कु मार �र एस बी रिबिन जोन् वरिष तकनीशियन (2) वै煍ञानक क. सचिवालय सहायक �र टी के घोष स�ु र टी.एम. अश्वती �र एम रामसामि पिल्쥈 嵍पर सी गैर तकनीकी (एमएसीपी) प्रिसिं पल तकनीकी अधिकारी क. सचिवालय सहायक
�र एस पष्कु न �र प्रवीण कन्नल �र जी भकवल्लम तकनीकी अधिकारी व. तकनीशियन (1) 嵍पर सी गैर तकनीकी �र पी एन शिवनकु ट्टि नायर �र टी एच बशीर वरिष तकनीशियन (2) वरिष तकनीशियन (2)
152 National Institute for Interdisciplinary Science & Technology Staff List Annual Report 2017-18
STAFF LIST AS ON 31/03/2018
Dr A Ajayaghosh Director Dr K V Radhakrishnan Dr U S Hareesh Principal Scientist Senior Scientist Dr C H Suresh Dr E Bhoje Gowd Director’s Office Principal Scientist Senior Scientist Mr Kiran J S Dr K N Narayanan Unni Technical Assistant Dr A Srinivasan Principal Scientist Senior Scientist Mr Vishnu Gurjar Junior Stenographer Dr Kaustabh Kumar Maiti Dr M Sundararajan Senior Scientist Senior Scientist Agroprocessing & Dr Biswapriya Deb Dr K Jayasankar Technology Division Senior Scientist Senior Scientist Dr B S Dileep Kumar Dr Karunakaran Venugopal Dr Subrata Das Senior Principal Scientist & Head Senior Scientist Senior Scientist Dr A Sundaresan Dr Sunil Varughese Dr K P Surendran Chief Scientist & Advisor to Director Senior Scientist Scientist Dr K G Raghu Dr Yoosaf Karuvath Dr Saju Pillai Principal Scientist Scientist Scientist Mr V V Venugopalan Dr L Ravi Shankar Dr (Mrs) M Vasundhara Principal Scientist Scientist Scientist Dr (Mrs) M V Reshma Dr Joshy Joseph Dr K G Nishanth Senior Scientist Scientist Scientist Dr (Mrs) P Nisha Dr B S Sasidhar Dr (Mrs) S S Sreejakumari Scientist Scientist Scientist Dr P Jayamurthy Dr C Vijayakumar Dr V S Prasad Scientist Scientist Principal Technical Officer Dr (Mrs)S Priya Dr (Mrs) J D Sudha Mr M Brahmakumar Scientist Principal Technical Officer Principal Technical Officer Dr (Mrs) Beena Joy Mrs Saumini Mathew Mr A Peer Mohammed Principal Technical Officer Senior Technical Officer (I) Senior Technical Officer (2) Mr D R Soban Kumar Mr Robert Philip Dr S Ramaswamy Senior Technical Officer (1) Senior Technical Officer (I) Senior Technical Officer(1) Mr V Harish Raj Microbial Processes & Mrs S Viji Technical Officer Senior Technical Officer (I) Technology Division Mr M P Varkey Mr Kiran Mohan Dr K Madhavan Nampoothiri Lab Assistant Technical Officer Principal Scientist & Head
Dr Rajeevkumar Sukumaran Environmental Materials Science & Technology Division Senior Scientist Technology Division Dr P Binod Dr (Mrs )Elizabeth Jacob Dr P Prabhakar Rao Chief Scientist & Head Scientist Chief Scientist & Head Dr N Ramesh Kumar Dr Ajit Haridas Dr K Harikrishna Bhat Chief Scientist Scientist Chief Scientist Dr Muthu Arumugam Dr (Mrs) S Savithri Dr Manoj Raama Varma Senior Principal Scientist Scientist Senior Principal Scientist Mr M Kiran Kumar Dr J Ansari Dr M Ravi Senior Principal Scientist Scientist Senior Principal Scientist Dr Lakshmi Rakesh Kumar Yasarla Dr B Krishnakumar Dr S Ananthakumar Senior Scientist Scientist Senior Principal Scientist Mr B Abdul Haleem Chemical Sciences & Dr T P D Rajan Scientist Principal Scientist Technology Division Dr K P Prathish Dr S V Shukla Dr (Mrs) R Luxmi Varma Scientist Senior Scientist Senior Principal Scientist & Head
National Institute for Interdisciplinary Science & Technology 153 Annual Report 2017-18 Staff List
Mrs Vijaya Prasad Mr G Nagasrinivasu Mr T H Basheer Senior Technical Officer(3) Senior Technician (2) Senior Technician(2) Mr V K Shajikumar Mr Pushpakumar K R Nair Mrs Shana S Nair Senior Technical Officer(2) Group C (Nt) (Macp) Staff Nurse Mr Joshy George Mrs M Geetha Senior Technical Officer(1) Research Planning & Lab Assistant Business Development Mrs P M Saharuba Mr K Unnikrishnan Technical Officer Dr C Chandrasekara Bhat Gr C (Nt) (Macp) Senior Principal Scientist & Head Mr T P Paulose Mr K Madhu Senior Technician(3) Mr C K Chandrakanth Bearer(Macp) Principal Scientist S & T Services Mr R S Praveen Raj Mr A Sreekumaran Washboy (Macp) Engineering Senior Scientist & Services Division Dr Deepa Balan Finance & Accounts Dr J Ansari Scientist Senior Principal Scientist & Head Mr D P Maret Mr B Venugopal Finance And Accounts Officer (Macp) Mr R Rajeev Senior Technician(2) Senior Superintending Engineer Mrs P V Viji Mr G Chandra Babu Administration Section Officer (F&A) Superintending Engineer Mrs S Sobhana Mrs Remani Devaraj Mr Chandra Shekar Neelam Administrative Officer Section Officer (F&A) Assistant Executive Engineer Mr K F Joseph Mrs G Geetha Mr B Karthik Section Officer (G) Assistant Section Officer Assistant Engineer (Civil) Mr M K Sivadasan Mr Sanjeev Sadanandan Mr P Arumugam Section Officer (G) Assistant Section Officer Assistant Engineer (Civil) Mr T J Babu Mrs Komala Soman Mr S Haridasan Pillai Senior Security Officer Assistant Section Officer Senior Technician (1) Mrs K S Lathidevi Mr Vishnu V L Mr M Jayadeep Hindi Officer Junior Stenographer Senior Technician(1) Dr Sadath Salim Mr P Rejith Mr K S Pramod Medical Officer Multi Tasking Staff Technician (2) Mr K P Krishnan Mr K Suresh Kannan Assistant Section Officer Stores & Purchase Technician (2) Mrs Mercy Joseph Mr Dulip Kumar Mr U Dharanipathy Assistant Section Officer Controller of Stores & Purchase Technician(2) Mrs T S Latha Mr C M Krishnadas Mr B Radhakrishnan Assistant Section Officer Assistant Section Officer (S&P) Technician(2) Mr M Anilkumar Mr T V Satheesh Mrs Neethu Induchoodan Assistant Section Officer Assistant Section Officer (S&P) Group C (Nt) (Macp) Ms P S Padmini Mr S Raju Knowledge Senior Stenographer (Macp) Senior Stenographer (Macp) Resource Centre Mr O V Sasikumar Mrs Sheeba Saithu Dr (Mrs) P Nishy Senior Stenographer (Macp) Junior Secretariat Assistant (S&P) Senior Principal Scientist & Head Mr R K Ramesh Kumar Mrs L Latha Mr V Moni Senior Secretariat Assistant Senior Technician(2) Scientist Mr B Satheesh Kumar Mr B Ajayakumar Mr S B Ribin Jones Junior Secretariat Assistant Senior Technician (2) Scientist Mrs A L Sajitha Mr T R Suresh Kumar Mr M Ramasamy Pillai Junior Secretariat Assistant Senior Technician (2) Principal Technical Officer Mrs T M Aswathy Mr T K Ghosh Mr S Pushkin Junior Secretariat Assistant Group C (Nt) (Macp) Technical Officer Mr Praveen Kannal Mr G Bhakthavalsalam Mr P N Sivankutty Nair Senior Technician(1) Group C (Nt) Senior Technician (2)
154 National Institute for Interdisciplinary Science & Technology General Information Annual सRepoामrानt् 2017-18 सचनू ा
घटनाए ं और समारोह राष絍रय प्र셌饍योगकी दिवस समारोह -2017
भारत के तकनीकी नवाचारⴂ और उत्क ष्टता के इतिहास को मनाने के लिए हर लिए पर्यप्त समय की आवश्कता होती है और कई नवाचारⴂ ने इस प्रक्रिया साल 11 मई को राष絍री प्रौ饍योगकी दिवस मनाया जाता है । यह दिन इसलिए के लिए कई वरषों का समय लिया है । उन्ⴂने यह भी बताया कि इनोवेशन महत् ऱखता है कि वर㔷 1998 को इसी दिन भारत ने पोखरण मᴂ परमाण ु बमⴂ प्रबंधन के लिए मश्कु ल है और दबाना आसान है और इनोवेटर को अक्र का सफलतापर्ू क परीकण किया था । सीएसआईआर-एनआईआईएसटी मᴂ परेशान किया जाता है क्ⴂकि रचनात्कता इस्ं टिक्, अनिश椿तता, 굍रडम 11 मई, 2017 को राष絍री प्रौ饍योगकी दिवस मनाया गया। सीएसआईआर- और आईकोनोकला焼म पर पनपती है, जबकि प्रबंधन आम सहमति, एनआईआईएसटी के निदेशक, डॉ. ए. अजयघोष ने स्वगत भाषण दिया नियंतण, निश्, और यथास्थित की मांग करता है । दनियु ा मᴂ महान और मखु ् अतिथि प्रो. एम.एम. शर्म, पर्ू निदेशक, रसायन प्रौ饍योगकी नवाचारⴂ का आधा महान अतं र्दृष् से आया है, दसराू आधा संयोगवश हुआ संस्थन, मबईंु का परिचय दिया । प्रो एम. एम. शर्म ने “तेजी से आर्थक है और उनमᴂ से कोई भी एक शेड्यलू पर नहĂ है और सफल नवाचार के विकास को गति प्रदान करने के लिए नवाचार की महत्पर्ू भमिू का” पर लिए पर्वू नमानु पथ नहĂ है । नवाचार को विकसित करने के लिए धर्ै एक प्रौ饍योगकी दिवस व्यख्यन दिया । इनोवेशन के महत् पर जोर देते हुए अनिवार् शर् है । एनआईआईएसटी की उपलब्धिⴂ की सराहना करते हुए उन्ⴂने कहा कि अच्छ वि煍ञन से नवीन विचार पैदा किये जा सकते है, जिन् ᴂ प्रो. शर्म ने जोर दिया कि नवाचार के लिए वि煍ञन और इजीं नियरिंग के बीच मानव जाति के लाभ के लिए नवाचारⴂ, प्रौ饍योगिकिⴂ मᴂ बदला सकता है, एक सशक्त रिश्त आवश्क है । गलतियां आम हℂ, न कि लोग या फर् और यह सीध े आर्थक विकास को प्रभावित करता है । बॉल पेन, हेलीकाप्र, अकम हℂ क्ⴂकि वे लगातार 煍ञन के किनारे पर नाच रहे हℂ । विफलता से ट्रांस्र, सीडी, डीएनए, टीके, एटीबां योटिक्, मोबाइल फोन, एनेस्थेटक सीखने की कमता महत्पर्ू है और भारत मᴂ प्रगति करने के लिए नवाचारⴂ एजᴂट जैसी कु छ प्रौ饍योगिकिॉ, जिन्ⴂने व्यपार की बनियु ादी बातⴂ को बदल को प्रभावित करने वाला एक महत्पर्ू कारक विफलताओ ंके स्वामत् की दिया है, का हवाला देते हुए रसायन इजीं नियरिंग के दिग्ज ने व्क्त किया कु ल कमी है। डॉ ए सनु ्रेशन, प्रमख,ु आरपीबीडी ने धन्वाद प्रस्तव दिया। कि नवाचारⴂ को निर्धरित नहĂ किया जा सकता है, जिसका परिपक् होने के
प्रौ饍योगकी दिवस समारोह का 饃श् प्रो एम एम शर्म, पर्ू निदेशक, रासायनिक प्रौ饍योगकी संस्थन, मबईंु प्रौ饍योगकी दिवस व्यख्यन देते हुए
National Institute for Interdisciplinary Science & Technology 155 सामAnnuान् aसl Repoचनू ाrt 2017-18 General Information
'कृ षि प्रससं ्रण मᴂ सभं ावनाओ ं' पर कार्यशला ऐसी प्रौ饍योगिकिⴂ के विकास और लोकप्रियकरण मᴂ सीएसआईआर एनआईआईएसटी के प्रयासⴂ की सराहना की । उन्ⴂने संस्थन 饍वरा विकसित प्रशीतन अवशोषण निरार्कृ त ड्रायर (आरएडीडी) और उसकी अपार कमता पर प्रकाश डाला औरचि सू त किया कि किसानⴂ के लाभ के लिए राज् सरकार ऐसी 14 इकाइयⴂ को स्थापत करने जा रही है । डॉ. ए. अजयघोष, निदेशक सीएसआईआर- एनआईआईएसटी ने उ饍यगⴂ को आ�वसन दिया कि औ饍योगक समस्यओ ं को सलझानेु मᴂ संस्थन अपने प्रयासⴂ पर पन:ु फोकस कर रहा है और संस्थन के साथ उपलब् विशाल विशेषजता और बनियु ादी ढांच े का उपयोग करने के लिए उन्ⴂने कृ षि विकास एवं किसान कल्यण विभाग के निदेशक श्री बिज ू प्रभाकर कार्शाला उ饍यगⴂ से आगह किया । ए.के. फ्लवर् एडं एरोमैटिक्, कोचीन,मेसेर् का उ饍घटन करते हुए ब्ह्मण् खाद उत्पद, मेसेर् पीसीपीसीएल पालक्का, स्पइसेस बोर्,
सीएसआईआर एनआईआईएसटी ति셁वनंतपरमु मᴂ 23 मई 2017 "कृ षि एफएसएसएआई और किन्रा से उ饍यग प्रतिनिधियⴂ 饍वरा प्रस्तिय酁 ां दी गई । प्रसंस्रण मᴂ संभावनाओ"ं पर एक दिवसीय आर एडं डी संगो�ठ का संस्थन मᴂ बडे पैमाने पर प्रौ饍योगिकिⴂ का विकास और फिर उसे प्रारंभिक आयोजन किया, जिसका उ饍घटन कृ षि विकास एवं किसान कल्यण विभाग संयंत और वाणिज्यक स्र पर कैसे विस्तर किया जाता है, पर एक प्रस्ति酁 के निदेशक श्री बिज ू प्रभाकर ने किया । श्री बिज ू प्रभाकर ने इस 啍षे के भी दी गई । संस्थन 饍वरा टर्की आधार पर स्थापत किए गए कु छ उदमⴂ को उत्पदन के प्राथमिक प्रसंस्रण के नए उदमⴂ के दायरे पर जोर दिया और भी प्रस्ति酁 के दौरान हाइलाइट किया गया ।
विश्व पर्यवरण दिवस 5 जन,ू 2017 को सीएसआईआर-एनआईआईएसटी के परिसर मᴂ पौध े लगाकर संस्थन मᴂ विश पर्यवरण दिवस मनाया गया। जेएनटीबीजीआरआई ने औषधीय पौधⴂ और विभिन् अन् वकृ पौधⴂ को प्रदान किया । विश पर्यवरण दिवस मᴂ कर्मारियⴂ और छा配र को संबोधित करते हुए निदेशक, सीएसआईआर-एनआईआईएसटी ने परिसर मᴂ हरियाली के रोपण और रखरखाव के महत् पर जोर दिया। उन्ⴂने पौधⴂ को प्रदान करने के लिए जवाहरलाल नेह셂 उष्कटिबंधीय वनस्पत उ饍यन अनसु ंधान संस्थन (जेएनटीबीजीआरआई) को धन्वाद दिया। सीएसआईआर- एनआईआईएसटी के कर्मारियⴂ और छा配र 饍वरा संस्थन परिसर मᴂ पौध े लगाये गए । पौधⴂ को सीएसआईआर-एनआईआईएसटी के कर्मारियⴂ और छा配र के बीच भी वितरित किया गया । विश पर्यवरण दिवस का 饃श्
जि煍ञसा 2017 - वै煍ञानक-छात कनेक् कार्क्रम वै煍ञानक तथा औ饍योगक अनसु ंधान परिषद (सीएसआईआर) ने के न्द् प्रयोगशालाओ ं मᴂ आयोजित "जि煍ञसा" कार्क्रम , 350 के न्द् वि饍यलय वि饍यलय संगठन (केवीएस) के सहयोग से राष絍री अतरं ्विषी वि煍ञन तथा स्क लⴂ के लगभग 75,000 छा配र और 1,000 शिककⴂ को जोडने की प्रौ饍योगकी संस्थन मᴂ एक व्यपक वै煍ञानक-छात कनेक् कार्क्रम लॉन㔚 उम्मद है । सीएसआईआर-एनआईआईएसटी मᴂ 12 - 16 जनू 2017 किया है । के न्द् वि饍यलय की पर्ू धारा के साथ परेू देश की सीएसआईआर तक एक सप्ताह के लिए " जि煍ञसा " कार्क्रम आयोजित किया गया,
156 National Institute for Interdisciplinary Science & Technology General Information Annual सRepoामrानt् 2017-18 सचनू ा
जिसका उ饍घटन सीएसआईआर-एनआईआईएसटी के निदेशक डॉ. ए. अजयघोष ने किया। ति셁वनंतपरमु शहर के छह कᴂ द्र वि饍यलयⴂ से लगभग 85 कᴂ द्र वि饍यलय छा配र और शिककⴂ ने इस कार्क्रममᴂ भाग लिया। सीएसआईआर-एनआईआईएसटी मᴂ जि煍ञसा का समन्व डॉ सी एच सरेश,ु प्रधान वै煍ञानक और डॉ आर ल啍ष् वर्म, वरिष प्रधान वै煍ञानक व प्रमख,ु रसायन वि煍ञन तथा प्रौ饍योगकी प्रभाग 饍वरा किया गया । इस कार्क्रममᴂ ल मू प्रयोगशाला प्रयोग, लोकप्रिय वि煍ञन व्यख्यन, वि煍ञन प्र�नत्तरी, वि煍ञन फिल्, प्रयोगशाला दौरा और वै煍ञानकⴂ और शोध छा配र के साथ संपर् 16 जनू 2017 को सीएसआईआर-एनआईआईएसटी ऑडिटोरियम मᴂ 'टीम शामिल थᴂ। डॉ मनोज रामावर्म, डॉ य.ू एस. हरीश, डॉ के. के. मैती, डॉ. बी जि煍ञसा-2017' का समापन समारोह कृ ष्कु मार, डॉ. टी.पी.डी. राजन, डॉ. वी. क셁णाकरण, डॉ एल. रविशकर,ं मᴂ वि煍ञन शि啍ष के 啍षे के लिए बहुत ही प्रेरणादायक है । निश椿त 셂प डॉ. के यसफ,ू डॉ. पी. निशा, और डॉ. पी. बिनोद सहित वै煍ञानकⴂ ने इस से, कार्क्रम का सफल और दीर्कालिक संचालन हमारी शि啍ष प्रणाली कार्क्रममᴂ भाग लिया। मᴂ बड़ पैमाने पर सधु ार के लिए नेततृ ् करᴂगे और यह वै煍ञानक कैरियर वि煍ञन के छा配र और शिककⴂ के एक बड़ समहू के साथ सीएसआईआर मᴂ महत्वकां啍ष ल啍ष् को प्राप्त करने के लिए पथ का नेततृ ् करने के लिए संस्थनⴂ के वै煍ञानकⴂ और अनसु ंधान छा配र को जोडने की अवधारणा देश छा配र, शिककⴂ और यहां तक कि माता-पिता को सशक्त बनाएगा । दुर्भ पथृ ्व और समुद्र तट रेत खनिजⴂ के उपयोग" पर एक दिवसीय उ饍यग - ससं ्थन कार्यशला उन्त अनप्रु योगⴂ के लिए अपने महत् के आधार पर दर्ु भ पथृ ्व और समदु तट रेत खनिज भारतीय खनन उ饍यगⴂ मᴂ एक प्रमखु भमिू का निभा रही है । भारतीय दर्ु भ पथृ ्व संघ (आरईएआई) के संयक्तु तत्ववधान मᴂ सीएसआईआर-एनआईआईएसटी ने 27 जन,ू 2017 को "दर्ु भ पथृ ्व और समदु तट रेत खनिज का उपयोग" विषयक एक दिवसीय उ饍यग-संस्थन कार्शाला का आयोजन किया । प्रदषू ण की कमी से जडु ़ समस्य सहित खनिज खनन / प्रसंस्रण मᴂ नवीनतम घटनाओ ं पर चर्च डॉ. ए .डी. दामोदरन, पर्ू निदेशक, सीएसआईआर-एनआईआईएसटी करने के लिए संस्थन के शोधकर्तओ ं और खनिज उ饍यग के लिए एक आम विशेष व्यख्यन देते हएु प्लटफॉर् प्रदान करना कार्शाला का उ饍शद ् था । इडियं न रेअर अर्थ लिमिटेड के स्थनांतरण पर विशेष व्यख्यन दिया । डॉ एम एल पी रेड्डी, सचिव, आरईएआई अध्य व प्रबंध निदेशक (आईआरईएल) तथा आरईएआई के अध्य श्री डी. तथा मखु ् वै煍ञानक (सेवानिवत्त)ृ सीएसआईआर-एनआईआईएसटी ने सभा का सिंह ने कार्शाला का उ饍घटन किया । उन्ⴂने शोधकर्तओ ंऔर खनिज उ饍यगⴂ से स्वगत किया। कार्शाला का संयोजक डॉ. के. हरिकृ ष्ण भट ने धन्वाद प्रस्तव स्थनांतरणीय अनसु ंधान के लिए आम हित के 啍ष配र की पहचान के लिए अनरोु ध दिया । श्री आटनीं फ्रांस, केरल मिनरल् एडं मेटल् लिमिटेड, (केएमएमएल), किया। सीएसआईआर-एनआईआईएसटी के निदेशक डॉ. ए. अजयघोष ने अपने श्री सी. स्वमीदास, वी वी मिनरल् और डॉ. के.जॉन्न, 配रवणकोर टाइटेनियम अध्啍षी संबोधन मᴂ वै煍ञानक तथा तकनीकी हस्啍षप आवश्क उ饍यगⴂ के म饍ु द के प्रोडक्ट् लिमिटेड (टीटीपीएल) ने आमत्ं त व्यख्यन दिया । डॉ. के. हरिकृ ष्ण लिए अनसु ंधान संस्थनⴂ के साथ सहयोग करने के लिए खनिज उ饍यगⴂ को आमत्ं त भट, सीएसआईआर-एनआईआईएसटी ने समदु तट रेत खनन, टाइटेनियम पिगमᴂट किया । सीएसआईआर-एनआईआईएसटी के पर्ू निदेशक डॉ ए. डी.दामोदरन ने का उत्पदन और सिंथेटिक 셂टाइल की तैयारी से जडु ़ म饍ु द पर व्यख्यन दिया । सीएसआईआर-एनआईआईएसटी मᴂ खनिज गतिविधियⴂ के विकास की गाथा और कार्शाला मᴂ सीएसआईआर-एनआईआईएसटी, वीएसएससी और आईआरईएल कई प्रारंभिक संयंत परीकणⴂ के माध्मⴂ से प्रयोगशाला से उ饍यगⴂ तक उनके के वै煍ञानकⴂ ने भाग लिया । हिंदी सꥍ鄾ह - 2017 का आयोजन संस्थन मᴂ 11-14 सितंबर 2017 के दौरान हिदीं सप्ताह मनाया गया । दिनांक आयोजन समिति के अध्य डॉ. पी.प्रभाकर राव ने समारोहमᴂ उपस्थत सभी 11 सितंबर को सबहु 10.00 बजे हिदीं सप्ताह का औपचारिक उ饍घटन का स्वगत किया । उन्ⴂने अपने स्वगत भाषण मᴂ कᴂ द सरकार कार्यलयⴂ समारोह आयोजित किया गया । मᴂ हिदीं दिवस और हिदीं सप्ताह के आयोजन की प्रासंगिकता पर संक्प्त
National Institute for Interdisciplinary Science & Technology 157 सामAnnuान् aसl Repoचनू ाrt 2017-18 General Information
डॉ. पी. प्रभाकर राव, अध्य, आयोजन समिति, प्रतिभागियⴂ का स्वगत करते हुये संस्थन निदेशक डॉ. ए. अजयघोष उ饍घटन सत मᴂ अध्啍षी भाषण देते हुये
जानकारी प्रस्त酁 की और प्रतिभागियⴂ से यह आगह किया कि वे अपने उ饍घटन के तरु ंत बाद संस्थन के भडारं व क्रय नियंतक श्री दलीपु कु मार कार्यलयीन कार्यो मᴂ राजभाषा हिदीं का अधिकाधिक प्रयोग करते हुये ने “तनाव प्रबंधन” पर प्रस्ति酁 दी । अपनी प्रस्ति酁 मᴂ उन्ⴂने तनाव क्य सरकार की राजभाषा नीति के कार्यन्वन मᴂ सर핋त्तम योगदान करᴂ ।डॉ. है, तनाव के विभिन् चरण, तनाव को कैसे प्रबंधित किया जा सकता है ए. अजयघोष, निदेशक, सीएसआईआर-एनआईआईएसटी ने उ饍घटन सत और तनाव रहित होने के लिये सरलतम, सबसे सस्त उपलब् तकनीकⴂ पर की अध्यता की । उन्ⴂने अपने अध्啍षी भाषण मᴂ बताया कि हिदीं एक प्रतिभागियⴂ को जानकारी दी । उन्ⴂने जीवन और इसकी समस्यओ ंको एक समद्धृ भाषा है और यह भारत की राष絍री तथा सांस्क ृतक एकता की कड़ मौके के 셂प मᴂ मान लेने के लिए प्रतिभागियⴂ से आगह किया । है । जहॉ तक सरकारी कामकाज मᴂ इसके प्रयोग का संबंध है, हमᴂ अपने दसराू पावर पॉइटं प्रस्तीकरण酁 का विषय था- “दैनिक जीवन मᴂ उपयोगी मन मᴂ ऐसा निश् करना होगा और अपना कर्व् मानना होगा कि सरकारी पॉलिमरⴂ” । संस्थन मᴂ रामनजनु फैलो डॉ. संजीब बनर् ने अपनी प्रस्ति酁 कामकाज मᴂ इसके प्रयोग के लिए किसी संकल् की आवश्कता न पड़ । मᴂ दैनिक जीवन मᴂ महत्पर्ू कु छ पॉलिमर, उनकी रासायनिक संरचना और आज भारत एक विश शक्ति के 셂प मᴂ उभरा है । हमᴂ राजभाषा हिदीं को मानव स्वस्थ पर उनके प्रभाव परवि स्तर से बताया । प्रस्तीकरण酁 के दोनⴂ 煍ञन-वि煍ञन, सचू ना प्रौ饍योगकी जैसे 啍ष配र से जोडकर इन 啍ष配र के लाभ को विषय वर्मान परिप्रे啍ष मᴂ अत्यत महत्पर्ू होने के कारण सभी प्रतिभागियⴂ जन-जन तक पहूचँ ाना चाहिए । उन्ⴂने प्रतिभागियⴂ से यह आगह किया कि ने इसका पराू फायदा उठाया और वक्ताओ ंकी खबू प्रशसां की । श्रीमती एस. शोभना, प्रशासनध अ िकारी ने धन्वाद 煍ञापत किया । छोटा- मोटा सरकारी कामकाज मलू 셂प मᴂ हिदीं मᴂ करने के लिए प्रयास करᴂ इसके पश्त परेू सप्ताह के दौरान परियोजना स्टफ, अनसु धान छात और राजभाषा नीति संबंधी अपे啍षओ ं को पराू करते हुए अपना सरकारी ं आदि सहित संस्थन के संपर्ू स्टफ सदस्ⴂ निम्नलिखत प्रतियोगिताए ं कामकाज अधिक से अधिक हिदीं मᴂ करने का 饃褼 संकल् लᴂ । उन्ⴂने हिदीं आयोजित की गयी । दिवस/हिदीं सप्ताह के आयोजन से जडु ़ सभी अधिकारी व कर्मारी गण को 1) हिदीं ऑनलाइन प्र�नत्तरी (11सि तंबर से 13 सितंबर तक ) बधाई दी और राजभाषा हिदीं के प्रचार-प्रसार केलि ए सभी के योगदान और 2) हिदीं प्र�नत्तरी (12 सितंबर 2017) प्रयासⴂ की प्रशसां की और बाद मᴂ वर㔷 2017 के हिदीं सप्ताह समारोह के 3) हिदीं अतां करी (13 सितंबर 2017) औपचारिक उ饍घटन की घोषणा की । 4) हिदीं वाद-विवाद (14 सितंबर 2017) 14 सितंबर 2017 को हिदीं दिवस के 셂प मᴂ मनाया गया और समापन समारोह व परसु ्कर वितरण उसी दिन शाम 4.00 बजे आयोजित किया गया । डॉ. पी. प्रभाकर राव, अध्य, हिदीं सप्ताह आयोजन समिति ने समारोह की अध्यता की । डॉ. एस.आर. जयश्री, सहायक प्रोफेसर, हिदीं विभाग, एम जी कॉलेज, ति셁वनंतपरमु समारोह मᴂ मखु ् अतिथि थी । डॉ.पी. निशी, प्रमख,ु केआरसी तथा सदस्, आयोजन समिति ने स्वगत भाषण दिया और समारोह मᴂ उपस्थत सभी को मखु ् अतिथि का परिचय दिया । मखु ् अतिथि ने अपने भाषण मᴂ हिदीं को राजभाषा एवं राष्भाषा बनाने का औचित् और राजभाषा की उत्तरोत्तर प्रगति मᴂ सरकारी कर्मारियⴂ की भमिू का पर श्री दलीपु कु मार, भडारं व क्रय नियंतक डॉ. संजीब बनर् “दैनिक जीवन “तनाव प्रबंधन” पर अपनी प्रस्तुत मᴂ उपयोगी पॉलिमरⴂ” पर अपनी अत्यत रोचक व्यख्यन दिया । निदेशक –प्रभारी डॉ. ए.न सु ्रेशन ने विभिन् देते हुये प्रस्तुत देते हुये प्रतियोगिताओ ंके सफल भागीदारⴂ को परसु ्कर वितरित किये ।
158 National Institute for Interdisciplinary Science & Technology General Information Annual सRepoामrानt् 2017-18 सचनू ा
सीएसआईआर-एनआईआईएसटी साइसं आउटरीच प्रो嵍रम सीएसआईआर- राष絍री अतरं ्विषी वि煍ञन तथा प्रौ饍योगकी ससं ्थन, और समझने मᴂ आसान होना चाहिए । अध्啍षी सबों धन मᴂ, सीएसआईआर- ति셁वनतपं रमु ने विभा (वि煍ञन भारती) के साथ मिलकर वि煍ञन तथा एनआईआईएसटी के निदेशक, डॉ. ए. अजयघोष ने मानव जीवन मᴂ वि煍ञन के प्रौ饍योगकी म配ं रलय और पथृ ्व वि煍ञन म配ं रलय 饍वरा सयं क्तु 셂पसे आयोजित महत् के बारे मᴂ जनता को जाग셂क बनाने की ज셂रत पर बल दिया। हालाकिं तीसरे भारत अतरं ्रा絍री वि煍ञन महोत्व (आईआईएसएफ-2017) की एक कई बार वि煍ञन एक बैकसीट लेता है, मानव जाति के विकास के लिए यह अगदतू घटना के 셂प मᴂ छा配र और जनता के लिए 18 सितबरं , 2017 को एक अभिन् और अनिवार् है । दिवसीय साइसं आउटरीच कार्क्रम काय आ ोजन किया । आउटरीच प्रो嵍रम लोकप्रिय वि煍ञन व्यख्यन, वै煍ञानकⴂ के साथ छा配र का इटरैकं ्न, का ल啍ष सीएसआईआर- एनआईआईएसटी की आर एडं डी गतिविधियⴂ के प्रयोगशाला दौरा, प्रौ饍योगिकिⴂ की प्रदर्नी आदि शामिल कार्क्रम मᴂ बारे मᴂ जनता के बीच जाग셂कता पैदा करना और यवाु दिमाग मᴂ एक वै煍ञानक स्क ल और कॉलेजⴂ से लगभग 150 छा配र और शिककⴂ ने भाग लिया । मनोदशा जगाना है, क्ⴂकि किसी भी चरण मᴂ, हमारे राष् का विकास, वि煍ञन डॉ. य.एस.ू हरीश, वरिष वै煍ञानक, सीएसआईआर-एनआईआईएसटी ने और नवाचार की उन्नत के साथ जडु ़ हआु है । "साम嵍र वि煍ञन मᴂ लोकप्रिय प्रगति: कु छ प्रकरण ्यअध न " पर बात की साइसं आउटरीच कार्क्रम का उ饍घटन प्रो. के. गिरीश कु मार, प्रोफेसर, और डॉ. बी. कृ ष्कु मार, वरिष वै煍ञानक, सीएसआईआर-एनआईआईएसटी कोचीन वि煍ञन तथा प्रौ饍योगकी विश्व饍यलय, कोच्च 饍वरा किया गया । ने "अपशिष्ट ससां धन कारखानⴂ" पर बात की । कार्क्रममᴂ सीएसआईआर- अपने उ饍घटन भाषण मᴂ उन्ⴂने प्रभावीच सं ार और वि煍ञन की लोकप्रियता एनआईआईएसटी की विभिन् गतिविधियⴂ पर एक वीडियो शो भी शामिल के महत् को हाइलाइट किया। वि煍ञन प्रकाशन आम आदमी के लिए सरल था ।
कार्यत्क रंजकⴂ और उन्न सामग्यⴂ पर (ईएएस 8) 8 वĂ पूर् एशिया सगो�ं ठ
सीएसआईआर-एनआईआईएसटी, ति셁वनंतपरमु मᴂ 20-22 सितंबर 2017 के दौरान कार्यत्क रंजकⴂ और उन्त सामग्रⴂ" पर (ईएएस 8) 8 वĂ पर्ू एशिया संगो�ठ आयोजित की गई । ईएएस 8 द्वार्षक सम्मलन की श्रखलांृ के अतं र्त आती है, जो पर्ू मᴂ जापान (2003, 2009, 2015), ताइपेई (2005), कोरिया (2007), और चीन (2011, 2013) मᴂ आयोजित की गयी थी और सीएसआईआर के प्लैटनम जयंती समारोह के भाग के 셂प मᴂ पहली बार यह भारत मᴂ आयोजित की गयी । नतनू रंजकⴂ और स्यही के विकास पर सीएसआईआर-एनआईआईएसटी लगातार लगे हुए है और ईएएस 8 ने यवाु शोधकर्तओ,ं छा配र और उद्यमⴂ के बीच सफल बातचीत के लिए एक उत्क ष्ट मचं प्रदान किया । ईएएस 8 मᴂ सर핋च㔚 वै煍ञानक कमता के तीन दिन के रोमांचक और प्रेरक कार्क्रम शामिल थे । भारत, जापान, कोरिया, सिंगापर,ु ऑस絍रेलिा, ताइवान और स्वट्जरलℂड, पर्ू -संगो�ठ कार्शाला (ईएएस 8- 2017 ) सितंबर 19, 2017 से लगभग 300 प्रतिभागियⴂ के साथ पर्ू एशियाई देशⴂ के बाहर पहली बार मेजबानी की यह संगो�ठ अपनी श्रखलांृ मᴂ सबसे बडे आयोजनⴂ मᴂ से एक थी । 19 सीएसआईआर-एनआईआईएसटी के निदेशक डॉ. ए. अजयघोष ने इस कार्शाला सितंबर, 2017 को, “ अपने अनसु ंधान को प्रभावीं ढग से कैसे संप्रेषण कर सकता का उ饍घटन किया। डॉ. वर्म ने अपने स्वगत भाषण के दौरान बताया कि किसी भी है- मैनस्क्रिपु लेखन से श셂ु होकर स्वकृ ति एवं प्रमोशन” विषय पर छा配र वै煍ञानक संप्रेषण का उ饍शद ् नए वै煍ञानक 煍ञन को सही और स्ष्ट 셂प से फैलाना और संप्रेषण करना है । उ饍घटन संबोधन मᴂ, डॉ. अजयघोष ने "प्रभावी वै煍ञानक के लिए एक पर्ू -संगो�ठ कार्शाला के माध्म से संगो�ठ का शभारु ंभ हुआ । अमेरिकी के मिकल सोसाइटी ने इस कार्शाला का संचालन किया और 80 संप्रेषण की कला" का महत् बताया, जिसे दो घटें के इटरैं क्टव सत के दौरान डॉ से अधिक छा配र ने कार्शाला मᴂ सक्रिय 셂प से भाग लिया । डॉ. आर ल啍ष् दी啍ष गप्ताु (प्रबंध संपादक, एसीएस ओमेगा) और उनकी टीम ने विस्तर से बताया। वर्म, प्रमख,ु सीएसटीडी और अध्啍ष, एपीसी ने सभा का स्वगत किया और सभी उपस्थत छा配र को भागीदारी प्रमाणपत दिया गया ।
National Institute for Interdisciplinary Science & Technology 159 सामAnnuान् aसl Repoचनू ाrt 2017-18 General Information
20 सितंबर 2017 को एक रंगीन उ饍घटन समारोह के साथ संगो�ठ श셂ु पोस्र परसु ्कर (3 परसु ्कर) और ईएएस 8 सर्वश्रे पोस्र परसु ्कर (4 हुई । डॉ अजयघोष के स्वगत संबोधन के साथ संगो�ठ श셂ु हुई और परसु ्कर) के लिए चयन किया गया । तीन सर핋त्तम फ्लश टॉक प्रस्तक酁 र्त डॉ सरेशु दास (कार्कारी उपाध्य, केएससीएसटीई, केरल सरकार) ने को आरएससी बेस् टॉक अवार् दिया गया । संगो�ठ के समापन सत के दौरान समारोह की अध्यता की। प्रो. हिरोयकीु नाकाजमीु (ओसाका प्रीफेक㔚र परसु ्कर विजेताओ ं को परसु ्कर प्रदान किए गए । डॉ डेर-गन चो ने घोषणा यनिू वर्सटी, जापान) ने संगो�ठ के संदर् और परिसंचरण के आयामⴂ पर की कि ईएएस श्रखलांृ मᴂ 9वᴂ संगो�ठ वर㔷 2019 मᴂ ताइवान मᴂ आयोजित विस्तर से बताया। तीन सहोदर संस्थनⴂ के निदेशक – डॉ. एस.चदं शेखर की जाएगी । संगो�ठ के अध्啍ष की (डॉ अजयघोष और प्रो नाकाजमी)ु (निदेशक, सीएसआईआर-आईआईसीटी, हैदराबाद), डॉ. विजयमोहनन के. समापन टिप्पणिⴂ के बाद सम्मलन का समापन हुआ । डॉ विजयकु मार पिल्ल (निदेशक, सीएसआईआर-सीईसीआरआई, कारैकु डी) और डॉ. बी. सी नायर (सह-संयोजक, ईएएस 8, सीएसआईआर-एनआईआईएसटी, चदं शेकरन (निदेशक, सीएसआईआर-सीएलआरआई, चेन्ई ) सम्मननीय ति셁वनंतपरम)ु ने धन्वाद 煍ञपन दिया । अतिथि थᴂ । डॉ एस चदं शेखर ने उ饍घटन भाषण दिया और डॉ पिल्ल और डॉ सीएसआईआर स्थपना दिवस चदं शेखरन ने सार पसु ्क का लोकार्ण किया । डॉ. के. एन. नारायणन उण्ण सीएसआईआर-एनआईआईएसटी मᴂ 26 सितंबर, 2017 को सीएसआईआर (सीएसआईआर-एनआईआईएसटी, ति셁वनंतपरमु और संयोजक, ईएएस 8) स्थपना दिवस मनाया गया । डॉ ए सनु ्रेशन, मखु ् वै煍ञानक तथा प्रमखु , के धन्वाद 煍ञपन के साथ उ饍घटन समारोह संपन् हुआ। प्रो. जी डी यादव आरपीबीडी, सीएसआईआर-एनआईआईएसटी ने स्वगत भाषण दिया और (उप-कु लपति और आर टी मोदी प्रतिष्त प्रोफेसर, आईसीटी, मबई)ंु 饍वरा सभा को मखु ् अतिथि का परिचय दिया । मखु ् अतिथि डॉ एन पर्णू दं प्रारंभिक पर्ू व्यख्यन दिया गया और डॉ सरेशु दास ने सत की अध्यता राव, निदेशक, नेशनल सᴂटर फॉर अर् साइसं स्डीज, ति셁वनंतपरमु ने की । प्रो यादव ने अपने व्यख्यन मᴂ ठोस एसिड / बेस उत्प्ररक का उपयोग "भारतीय उपमहा饍वप मᴂ भकू ं प और सनामीु - हम कैसे तैयार हℂ?" विषय पर करके बायोमास से व्तय ्न् कार्यत्क साम嵍र के 啍षे मᴂ हुई प्रगति के बारे सीएसआईआर स्थपना दिवस व्यख्यन दिया । मᴂ विस्तर से चर्च की । व्यख्यन मᴂ सस्त और अक् पर्यवरण अनकु ू ल उन्ⴂने अपने भाषण मᴂ भकू ं प और सनामीु कैसे होती है और उसका प्रमखु रतⴂ से मलू ् वर्धत उत्पदⴂ की प्राप्ति के लिए हरे और टिकाऊ रसायन कारण क्य है आदि के बारे मᴂ बताया । उन्ⴂने भारत मᴂ भकू ं प प्रवण 啍ष配र शास्त्र के महत् पर बल दिया । संगो�ठ मᴂ विभिन् प्रायोजकⴂ और विक्रे ताओ ं को चित्त किया और भकू ं प और सनामीु होने पर हमᴂ क्य-क्य सामान् 饍वरा विशेष 셁प से प्रदर्शत प्रदर्नी स्टल थे और डॉ बी चदं शेकरन ने चेतावनी संकेत मिलते हℂ, के बारे मᴂ बताया तथा सनामीु घटनाओ ं की इसका उ饍घटन किया । तकनीकी कार्क्रममᴂ छा配र के लिए दो पोस्र सत भविष्वाणी के तरीकⴂ के बारे मᴂ और प्रमखु कारणⴂ को किस प्रकार कम और फ्लश टॉक सत के साथ 6 पर्ू व्यख्यन, 16 आमत्ं त व्यख्यन, 6 किया जा सकता है, का वर्न किया । उन्ⴂने कहा कि दिसंबर 2004 के यवाु वै煍ञानक व्यख्यन और उ饍यगⴂ से 4 आमत्ं त व्यख्यन शामिल सनामीु के बाद, भारत ने सनामीु चेतावनी प्रणाली की स्थपना और उनकी थे । संगो�ठ के पहले दो दिनⴂ मᴂ छात प्रतिभागियⴂ 饍वरा कु ल मिलाकर 130 निगरानी मᴂ प्रमखु कदम उठाए हℂ । डॉ ल啍ष् वर्म, अध्啍ष, अकादमिक पोस्र प्रस्त酁 किए गए । सात सर्वश्रे पोस्र को एसीएस ओमेगा सर्वश्रे कार्क्रम समिति ने धन्वाद प्रस्तव दिया। खलेु दिन के भाग के 셂प मᴂ विभिन् शैक्क संस्थनⴂ से लगभग तीन सौ छात ने सीएसआईआर- एनआईआईएसटी का दौरा किया ।
160 National Institute for Interdisciplinary Science & Technology General Information Annual सRepoामrानt् 2017-18 सचनू ा
एनआईआईएसटी स्थपना दिवस- 2017
6 अक्टबर, 2017 को सीएसआईआर-एनआईआईएसटी मᴂ की आवश्कता पर बल दिया । मखु ् अतिथि 饍वरा सीएसआईआर- एनआईआईएसटी स्थपना दिवस मनाया गया । संस्थन निदेशक डॉ ए एनआईआईएसटी की वर㔷 2016-17 की वार्षक रिपोर् जारी की और डॉ अजयघोष ने स्वगत भाषण दिया और मखु ् अतिथि का परिचय दिया। ए सनु ्रेशन, मखु ् वै煍ञानक और प्रमख,ु आरपीबीडी, सीएसआईआर- मखु ् अतिथि डॉ कु चेरिया पी इसहाक, उप कु लपति, एपीजे अब्लद कलाम एनआईआईएसटी ने उसकी पहली प्रति प्राप्त की । डॉ ल啍ष् वर्म, अध्啍ष, तकनीकी विश्व饍यलय, ति셁वनंतपरमु ने स्थपना दिवस व्यख्यन दिया । अकादमिक कार्क्रम समिति ने धन्वाद प्रस्तव दिया । उन्ⴂने अपने भाषण मᴂ राज् मᴂ उच㔚 शि啍ष की गणवु त्ता को बढ़ने सतर्कत सꥍ鄾ह- 2017
संस्थन मᴂ सतर् ता जाग셂कता सप्ताह-2017 का आयोजन 30 अक्टबर, 2. भ्रष्टाचार के कारणⴂ मᴂ से एक है- पर्ू अधिकार । इसलिए नागरिकⴂ 2017 को सतर् ता शपथ गहण के साथ श셂ु हुआ । उ饍घटन समारोह मᴂ की भागीदारी सनिशु 椿त करने के लिए उच㔚तम स्र से स्थनीय परिषद स्टफ सदस्ⴂ को संबोधित करते हुए निदेशक ने इस साल का विषय "मेरा स्र तक विभिन् पदानक्रु मित स्र पर अधिक अधिकार का वितरण ल啍ष-भ्रष्टाचार मक्तु भारत" केंब स ंध मᴂ और सप्ताह लंबे आयोजन के दौरान भ्रष्टाचार को कम करने मᴂ मदद करेगा । होने वाली गतिविधियⴂ के बारे मᴂ जानकारी दी। उन्ⴂने स्टफ सदस्ⴂ को 3. राजनीतिक दलⴂ के निधिकरण मᴂ पारदर्शता होनी चाहिए । हिदीं और अ嵍ं रजी दोनⴂ भाषा मᴂ शपथ दिलायी और सभी से सीवीसी की साइट पर जाकर ई- प्रति煍ञ लेने की भी सलाह दी । कर्मारियⴂ और शोध 4. राजनीतिज शामिल मामलⴂ को निपटाने के लिए विशेष अदालतⴂ की छा配र के बीच सतर् ता के बारे मᴂ जाग셂कता पैदा करने के लिए 31 अक्टबर स्थपना, प्रणालीमᴂ भ्रष्टाचार को कम करने के लिए प्रेरित करेगा । को टीए / डीए / एलटीसी, आचरण नियमावली, क्य करᴂ और क्य न करᴂ 5. भ्रष्टाचार अब समाज मᴂ एक संस्क ृत की तरह बन गया है। इसलिए इससे आदि पर कार्शाला आयोजित की गयी और इसके बाद उक्त विषयⴂ पर छुटकारा पाने के लिए गणवु त्तापर्ू शि啍ष आवश्क है । एक प्र�नत्तरी भी आयोजित की गयी। दिनांक 1 नवंबर को "विकासात्क गतिविधियⴂ के साथ भ्र�टचार सह- मौजूदा है ? " विषय पर स्टफ सदस्ⴂ और छा配र के लिए अलग से वाग्मता प्रतियोगिता आयोजित की गयी । दिनांक 3 नवंबर को इस वर㔷 का विषय- “ मेरा ल啍ष- भ्र�टचार मुक भारत पर” पैनल चर्च आयोजित की गयी। भारत को भ्रष्टाचार से मक्तु करने के लिए पैनल 饍वरा प्रस्त酁 सझावⴂु का सं啍षप निम्ननसारु है: - 1. रडरजटली सकम शासन से प्रणाली की पारदर्शता मᴂ सधु ार लाने मᴂ मदद मिली है, जिसकी वजह से सरकार के सार्जनिक विभागⴂ मᴂ भ्रष्टाचार को कम करने मᴂ मदद मिली है ।
National Institute for Interdisciplinary Science & Technology 161 सामAnnuान् aसl Repoचनू ाrt 2017-18 General Information
6. आरटीआई, लोकपाल और लोकायक्तु के कार्यन्वन का स饃ु ढ़करण 饍वरा सराहना की गई । दर्कⴂ को भी विषय पर अपने विचार व्क्त करने देश को भ्रष्टाचार मक्तु बननेमᴂ सहायक होगा । का अवसर दिया गया । कर्मारियⴂ के बीच तथा इस सप्ताह के दौरान प्रयोगशाला का दौरे किये लोगⴂ के बीच सतर् ता और भ्रष्टाचार विरोध 7. आम लोगⴂ की बनियु ादी ज셂रत जैसे भोजन, अस्ताल, शि啍ष आदि के बारे मᴂ जाग셂कता पैदा करने के लिए विभिन् स्थनⴂ पर रखी प्रदर्न सरकारी प्रणाली के माध्म से करनी चाहिए ताकि ऐसी मलभत सविधा ू ू ु प्रणाली के माध्म से सतर् ता और भ्रष्टाचार विरोध पर नारे और प्रसिद्ध मᴂ भ्रष्टाचार को कम किया जा सकता है, जिससे सामान् जनता को उद्धरण प्रदर्शत किए गए । सभी के लाभ के लिए संस्थन के इ絍ं रनेट पोर्ल अपनी बनियु ादी ज셂रतⴂ को पराू करने के लिए कोई कठिनाई नही होगी । पर "भारत को भ्रष्टाचार से कैसे मक्तु करᴂ" पर एकहℂडब कु प्रदर्शत किया 8. महिलाओ ं का सशक्तीकरण और दहेज जैसी कई बरीु प्रथाओ ं को गया है । समापन समारोह और विभिन् प्रतियोगिताओ ं के विजेताओ ं को रोकने से भ्रष्टाचार को कम करने मᴂ मदद मिलेगी । परसु ्कर वितरण 6 नवंबर 2017 को आयोजित किया गया । 9. कानन का क्रियान्वन और दोषी को सजा सनिश椿त करना भ्रष्टाचार को ू ु डॉ शेक दरवेश साहिब, आईपीएस, अपर पलिु स महानिदेशक, (सतर् ता कम करने के लिए आवश्क है। एवं भ्रष्टाचार-विरोध ब्रो)य समारोह मᴂ मखु ् अतिथि थे । समापन भाषण मᴂ, 10. जाग셂क और सतर् पलिु स प्रणाली (जैसा कि सिंगापरु के मामले मᴂ) मखु ् अतिथि ने अपने कैरियर मᴂ सामना की विभिन् घटनाओ ं का हवाला निश椿त 셂प से भ्रष्टाचार को कम करने मᴂ मदद करेगी । देते हुए, प्रतिभागियⴂ से आगह किया कि अपने सभी सरकारी और निजी 6 नवंबर सबहु को "क्य डिजिटलीकरण के कार्यन्यन से भ्र�टचार लेनदेन मᴂ ईमानदार रहᴂ और अपनी अगली पीढ़ के लिए ये आदतᴂ विकसित कम हो गया है" विषय पर डिबेट का आयोजन किया गया । विषय पर करᴂ, ताकि हमारे देश को भ्रष्टाचार मक्तु बनाने मᴂ हम सफल हो सकᴂ । गहरा 煍ञन रखनेवाले पक और विपक ने खबू बहस किया, जिसकी दर्कⴂ स्च्छत पखवाड़
भारत सरकार / सीएसआईआर से प्राप्त देशⴂअनु के अनसारु संस्थन ने पर प्र�नत्तरीतिय प्र ोगिता आयोजित की गयी। स्टफ सदस्ⴂ ने सक्रिय प्रयोगशाला के अदरं और संस्थन के बाहरी परिसर मᴂ व्यपक सफाई 셂प से प्रतियोगिता मᴂ भाग लिया। सभी प्रशासनिक अनभागⴂु मᴂ परानीु गतिविधियⴂ का आयोजन किया । सभी आर एडं डी और गैर-आर एडं फाइलⴂ की निराई की और 3 बेकार वाहनⴂ का निपटारा किया गया । डी प्रभागⴂ से साफ-सफाई की गतिविधियⴂ को पराू करने और अप्रयक्त/ु प्रयोगशाला और इसके परिसर की गहन सफाई की गई और स्च्ता अप्रचलित आइटम / फाइलⴂ को स्च्ता पखवाड़ के दौरान बाहर पखवाड़ को सच्च भावना से मनाया गया ।
निकालने का अनरोु ध किया गया । 1 नवंबर, 2017 को कर्मारी समहू को स्च्ता शपथ दिलायी गयी । सर啍ु ष समिति ने 14 नवंबर 2017 को सफाई दिन के 셂प मᴂ मनाने के लिए सभी वै煍ञानक विभागⴂ से अनरोु ध किया । इसके अनसारु हर प्रभाग ने अपनी अपनी सफाई प्रक्रिया का आयोजन किया । धमनू और कीट नियंतण उपायⴂ को भी किया गया । स्च्ता पखवाड़ के भाग के 셂प मᴂ 14 नवंबर, 2017 को “ साफ-सफाई और स्च्ता” कℂपस मᴂ सफाई गतिविधियॉ
162 National Institute for Interdisciplinary Science & Technology General Information Annual सRepoामrानt् 2017-18 सचनू ा
उ配तेजि स्थित मᴂ रसायन वि煍ञन तथा भौतिकी रसायन वि煍ञन तथा प्रौ饍योगकी प्रभाग की आउटरीच गतिविधियⴂ के डॉ ए अजयघोष, निदेशक - सीएसआईआर-एनआईआईएसटी ने सेमिनार भाग के 셂प मᴂ, 24 नवंबर, 2017 को "उत्तेजित स्थित मᴂ रसायन वि煍ञन का उ饍घटन किया था, जिन्ⴂने अपनी प्रारंभिक टिप्णी मᴂ उत्तेजित स्थित मᴂ तथा भौतिकी" पर एक दिवसीय राष絍री सेमिनार आयोजित किया गया सामग्रⴂ के गणⴂु और प्रतिक्रियाओ ंपर निरंतर जांच के महत् पर विस्तर से था । सेमिनार मᴂ उच㔚तम वै煍ञानक कमता को रोमांचक और प्रेरणादायक बताया । डॉ. ए .अजयघोष ने प्रतिष्त मेहमानⴂ, वक्ताओ ंऔर कार्क्रम के कार्क्रम शामिल थे । छा配र, वै煍ञानकⴂ और उ饍यग प्रतिनिधियⴂ समेत भारत सभी प्रतिभागियⴂ का स्वगत किया। के विभिन् भागⴂ से लगभग 200 प्रतिभागियⴂ ने सगो�ठ मᴂ भाग लिया और ं तकनीकी कार्क्रममᴂ ु कछ पोस्र के साथ 8 आमत्ं त व्यख्यन शामिल थᴂ। संगो�ठ का समापन सत, डॉ ए अजयघोष (निदेशक, सीएसआईआर- एनआईआईएसटी) की अध्यता मᴂ हुआ और यह सत डॉ के.आर. गोपिदास (मखु ् वै煍ञानक, सीएसआईआर-एनआईआईएसटी, ति셁वनंतपरम)ु के सम्मन मᴂ समर्पत था, जो नवंबर 2017 मᴂ परिषद की सेवा से सेवानिवत्तृ होने वाले थे । डॉ अजयघोष और अन् प्रतिभागियⴂ ने एक महान वै煍ञानक, एक अ饍भत संरकक, एक व्यवहारिक शि啍षावद ् और एक समर्पत प्रशासक के 셂प मᴂ डॉ गोपिदास की उत्क ष्टता और कमता को रेखांकित किया, जिन्ⴂने वि煍ञन को न केवल एक करियर के 셂प मᴂ, लेकिन जीवन के एक हिस्स के डॉ. गोपिदास, मखु ् वै煍ञानक, सीएसटीडी भाषण देते हुए । 셂प मᴂ भी लेने के लिए एक पीढ़ को प्रेरित किया था । संगो�ठ ने न केवल वै煍ञानक प्रगति का प्रदर्न किया बल्क शोध के इस डॉ नारायणन उण्ण के एन (सीएसआईआर-एनआईआईएसटी, 啍षे मᴂ मौजदू अवसरⴂ और चनौु तियⴂ को भी प्रस्त酁 किया। लेजर स्पे絍र ति셁वनंतपरम)ु 饍वरा प्रस्तावत धन्वाद और राष्गान के साथ सत का सर्वसेज प्राइवेट लिमिटेड, बᴂगल셁ु 饍वरा कार्क्रम प्रायोजित किया गया था। औपचारिक समापन किया गया । "डाइऑक्सन वि�लषण मᴂ उन्न वि�लषणात्क समाधान" पर राष絍रय कार्यशला सीएसआईआर- एनआईआईएसटी ने 5 जनवरी 2018 को एजिलᴂट कार्शाला के दौरान नगर निगम 饍वरा ठोस कचरे के खलेु जलने से उत्न् टेक्नलॉजीज के सहयोग से "डाइऑक्सन वि�लेण मᴂ उन्त वि�लेणात्क डाइऑक्सन उत्सरन पर सीएसआईआर-एनआईआईएसटी 饍वरा किए गए समाधान" पर एक दिवसीय कार्शाला आयोजित की। एनआईआईएसटी अध्यनⴂ के नवीनतम निष्कषों पर प्रकाश डाला गया । सीएसआईआर- ने भारत मᴂ पहली डाइऑक्सन शोध प्रयोगशाला की स्थपना की और एनआईआईएसटी के निदेशक डॉ ए अजयघोष ने कार्शाला का उ饍घटन सतत ् कार्बनक प्रदषू कⴂ पर देश के स्टकहोम सम्मलन के दायित्ⴂ के भाग किया और डॉ एस के भार्व, सदस्, विशेषज मल्ू याकन समिति, पर्यवरण के 셂प मᴂ राष絍री कार्यन्वन योजना (एनआईपी) तैयार करने मᴂ योगदान तथा वन म配ं रलय कार्क्रममᴂ विशेष आमत्ं त थे। दिया । इसके बाद एनआईआईपी मल्ू याकन मᴂ उल्लिखत कमियⴂ के लिए डॉ. के पी प्रतीश, वै煍ञानक - प्रभारी, डाइऑक्सन प्रयोगशाला, श्री डाइऑक्सन उत्सरन की सची विकसित करने के लिए एनआईआईएसटी ू चदं शेखर कं दस्वमी, एजिलᴂट टेक्नलॉजीज और डॉ वान एसेन मार् , की सविधाओ को मजबत किया गया है। पर्यवरण और वन म配रलय ु ं ू ं एलसीटेक. जर्नी ने जीसी-एमएस / एमएस का उपयोग करके खलाु जलन (एमओईएफ) ने विभिन् 啍ष配र मᴂ पर्यवरण मजरी के लिए डाइऑक्सन ं ू अध्यन, नमनाू तैयारी के तरीकⴂ और प्रमा配रकरण के लिए अत्याुनध क वि�लेण करने के लिए एक रेफरल प्रयोगशाला के 셂प मᴂ सीएसआईआर- वि�लेणात्क पद्धतियⴂ के बारे मᴂ प्रस्ति酁 दी । कᴂ द्र और राज् प्रदषू ण एनआईआईएसटी की सिफारिश की है। नियंतण बोर्, सीएसआईआर-नीरी, आईआईटीआर, एनजीआरआई, परीकण प्रयोगशालाओ,ं उ饍यगⴂ, नियामक निकायⴂ, अनसु ंधान संस्थनⴂ निर्यत निरीकण परिषद (ईआईसी), स्पइसेस बोर्, एफएसएसएआई, और पर्यवरणविदⴂ को डाइऑक्सन वि�लेण के नवीनतम 셁झानⴂ के बारे सीआईएफटी, केएसआरईसी, कृ षि विश्व饍यलय, केईआईएल (फैक्), मᴂ 煍ञन प्रसार और जाग셂कता पैदा करने के लिए कार्शाला का आयोजन केएमएमएल, विम्त लैब् (हैदराबाद), सी लैब (कोच्च), इटरफीलं ् लैब किया गया था । नमनाकरण,ू नमनेू की तैयारी और डाइऑक्सन वि�लेण (कोच्च), कु साट आदि संगठनⴂ से करीब 30 प्रतिभागियⴂ ने कार्शाला मᴂ व्यवहारिक प्रशिकण का आयोजन भारत मᴂ पहली बार किया गया था। मᴂ भाग लिया ।
National Institute for Interdisciplinary Science & Technology 163 सामAnnuान् aसl Repoचनू ाrt 2017-18 General Information
लुमिनेसेन् और इसके अनुप्रयोग (एनसीएलए-2018) पर राष絍रय सम्मलन सीएसआईआर- राष絍री अतरं ्विषी वि煍ञन तथा प्रौ饍योगकी संस्थन पर बड़ संख्य मᴂ डिवाइस मौजदू हℂ, डिवाइस निर्मण तकनीक दनियु ा (एनआईआईएसटी) तथा लमिु नेसेन् सोसाइटी ऑफ इडियं ा के संयक्तु भर मᴂ बहुराष絍री कं पनियⴂ 饍वरा आईपीआरएस पर एकाधिक जोडⴂ 饍वरा तत्ववधान मᴂ 14-16 फरवरी, 2018 के दौरान लमिु नेसेन् और इसके ध्यनपर्ू क संरक्त है । मौलिक 煍ञन का वास्तवक उपकरणⴂ मᴂ 셂पांतर अनप्रु योग (एनसीएलए-2018) पर सीएसआईआर-एनआईआईएसटी, एक बड़ चनौतीु है, इसलिए उन्ⴂने उपकरणⴂ के विकास के लिए विकास के ति셁वनंतपरमु मᴂ राष絍री सम्मलन आयोजित किया गया । श셁आतीु चरणⴂ मᴂ रसायन वि煍ञन, जीववि煍ञन, इजीं नियरिंग और भौतिकी जैसे विभिन् शाखाओ से विशेष煍ञ को शामिल करके एक अतर्विषी फोस्फरस के 啍षे मᴂ हो रही विभिन् घटनाओ ं व विकास पर चर्च करने ं ं 饃ष्टिकोण को अपनाने की सिफारिश की । के लिए अकादमिक, शोधकर्तओ ं और उ饍यग के लिए एक इटरैं क्टव मचं प्रदान करना एनसीएलए-2018 का शउ饍द ् था। सम्मलन का उ饍शद ् यवाु तकनीकी स配र मᴂ विषय से संबंधित विभिन् 啍ष配र से प्रतिष्त विशेष煍ञ शोधकर्तओ ंको इस 啍षे मᴂ सहयोगियⴂ से मिलने के लिए और फोस्फरस के और सहयोगियⴂ के आमत्ं त व्यख्यन शामिल थᴂ । प्रत्यक सत मᴂ मखु ् विकास, निर्मण, इजीं नियरिंग और अनप्रु योगⴂ मᴂ आनेवाली चनौु तियⴂ और व्यख्यन के बाद चयनित योगदान प配र की मौखिक प्रस्तिय酁 ॉ भी थĂ । म饍ु द पर चर्च के लिए अवसर प्रदान करना था। सम्मलन का उ饍घटन 14 लगभग 12 तकनीकी सत मᴂ पर्ू , आमत्ं त और योगदान श्रेणियⴂ मᴂ, 40 से फरवरी, 2018 को सीएसआईआर-एनआईआईएसटी, ति셁वनंतपरमु मᴂ डॉ अधिक आमत्ं त शोध पत प्रस्त酁 किए गए थᴂ । अन् योगदान पत पोस्र आर पी राव, स्पशलिटी फॉस्र, यएसएू 饍वरा किया गया । प्रस्तिय酁 ⴂ मᴂ थे । पोस्र स配र मᴂ प्रस्त酁 तीन योगदान पत को सर्वश्रे पोस्र प्रेजᴂटेशन परसु ्करⴂ के लिए चनेु गए थे और उन् ᴂ प्रमाण पत के साथ नकद डॉ ए अजयघोष, निदेशक, सीएसआईआर-एनआईआईएसटी ने समारोह परसु ्कर से सम्मानत किया गया था। सम्मलन मᴂ लगभग 200 पंजीकृ त की अध्यता की । अपने उ饍घटन भाषण मᴂ डॉ राव ने डायग्नोस्क्, प्रतिनिधियⴂ ने भाग लिया । इमेजिंग जैसे चिकित्स अनप्रु योगⴂ के 啍ष配र मᴂ फोस्फरस के महत् पर प्रकाश डाला । उन्ⴂने आगे बताया कि हालांकि मौलिक सिद्धांतⴂ और सम्मलन बोर् ऑफ रिसर् इन न्ूक्लय र साइसेजं (बीआरएनएस), डीएई, केरल स्टट काउसिल फॉर साइस, टेक्नलॉजी एड एनवायरनमᴂट नयी और कु शल फॉस्र साम嵍र के विकास पर दनियु ा भर मᴂ बहुत ध्यन ं ं ं (केएससीएसटीई), वै煍ञानक तथा औ饍योगक अनसु धान परिषद कᴂ द섿त अनसु ंधान किया गया है, तो भी, वास्तवक 啍षे के अनप्रु योगⴂ के ं लिए उपकरणⴂ के अहसास के प्रयासⴂ पर अभी भी कमी है । जैसा कि राजस् (सीएसआईआर) 饍वरा प्रायोजित था और कई अन् निजी उ饍यगⴂ / संगठनⴂ 饍वरा समर्थत था। उत्पदन के मामले मᴂ यह 啍षे अत्यिक चनौतीपरकु है, इन सामग्रⴂ के आधार पर कई घटक निर्मण का कार्, आईपीआर के साथ बहुराष絍री कं पनियⴂ 饍वरा ध्यनपर्ू क संरक्त हℂ । डॉ. ए. अजयघोष, निदेशक, सीएसआईआर-एनआईआईएसटी,ति셁वनंतपरमु ने अपने उ饍घटन संबोधन मᴂ रसायन वि煍ञन, भौतिकी, इजीं नियरिंग, उ饍घटन सत जीववि煍ञन जैसी शाखाओ ं से इनपटु के साथ लमेनसᴂटु साम嵍र के विकास के लिए अतरं ्विषी 饃ष्टिकोण अपनाने की आवश्कता पर प्रकाश डाला । उन्ⴂने अपने भाषण मᴂ बताया कि लमेनसᴂटु साम嵍र का 啍षे अत्यिक चनौतीपु र्ू है और ठोस अवस्थ प्रकाश जैसे 啍ष配र मᴂ त्रित गति पर विकास हो रहा है । उन्ⴂने इस 啍षे मᴂ कार् कर रहे शोधकर्तओ ं से मौलिक समझ पर ध्यन देकर डिवाइस निर्मण के इजीं नियरिंग सिद्धांतⴂ को एकीकृ त करने डॉ ए अजयघोष, निदेशक सीएसआईआर-एनआईआईएसटी अध्啍षी भाषण देते हुए का आवन किया । उन्ⴂने प्रतिनिधियⴂ से इजीं नियरिंग सहित वि煍ञन की , विभिन् शाखाओ ंके विशेष煍ञ को शामिल करके एक अतरं ्विषी 饃ष्टिकोण को अपनाने के लिए आवन किया । डॉ आर पी राव, स्पशलिटी फॉस्र, यएसएू ने मलू व्यख्यन दिया । अपने व्यख्यन के दौरान, डॉ राव ने चिकित्स अनप्रु योगⴂ मᴂ लमेनसᴂटु साम嵍र 饍वरा निभाई गई भमिू का पर प्रकाश डाला । यद्य लमेनसᴂटु साम嵍र के आधार मखु ् व्यख्यन देते हुए डॉ आर पी राव, स्पशलिटी फॉस्र, यएसएू
164 National Institute for Interdisciplinary Science & Technology General Information Annual सRepoामrानt् 2017-18 सचनू ा
आर एडं डी उ饍यग बैठक उ饍यगⴂ के साथ साझेदारी को बढ़ने और मजबतू करने के लिए 23 फरवरी डॉ राम चद,ं मखु ् कार्कारी अधिकारी, सैक्सन लाइफ साइसेसं प्रा. 2018 को सीएसआईआर-एनआईआईएसटी, ति셁वनंतपरमु मᴂ दसरीू आर लिमिटेड ने भविष् अनसु ंधान के कु छ 啍ष配र, विशेष 셂प से स्वस्थ और दवा एडं डी उ饍यग बैठक आयोजित की गई । श्री टी के जोस, आईएएस, अपर खोज के 啍ष配र मᴂ प्रकाश डाला । उन्ⴂने अपने भाषण मᴂ विशिष्ट समस्यओ ं मखु ् सचिव (स्थनीय स्शासन विभाग), केरल सरकार ने आर एडं डी को हल करने के लिए पश椿मी देशⴂ से उ饍यग और अकादमिक सहयोग की उ饍यग बैठक का उ饍घटन किया । डॉ एम बीना, आईएएस, प्रबंध निदेशक, आवश्कता पर बल दिया । उन्ⴂने यह भी कामना की कि वै煍ञानक संगठनⴂ केएसआईडीसी, पद्मश्री हरीदन नायर, संस्थपक एवं प्रबंध निदेशक, को देश मᴂ महत्पर्ू और कु शल जनशक्ति की कमी को संबोधित करना पंकजकस्रीत और डॉ राम चद,ं मखु ् कार्कारी अधिकारी, सैक्सन लाइफ चाहिए । साइसेजं प्रा. लिमिटेड उक्त अवसर पर उपस्थत थे । डॉ ए अजयघोष, निदेशक, सीएसआईआर-एनआईआईएसटी ने अपने श्री टी.के. जोस, आईएएस, अपर मखु ् सचिव (स्थनीय स्शासन विभाग), अध्啍षी भाषण मᴂ सीएसआईआर की गतिविधियⴂ के बारे मᴂ बताया और केरल सरकार ने अपने उ饍घटन संबोधन मᴂ सामाजिक समस्यओ ं को हल समाज की सेवा के लिए सीएसआईआर के साथ उपलब् प्रौ饍योगिकिⴂ करने के लिए अकादमिक संस्थनⴂ, अनसु ंधान संस्थनⴂ, उ饍यगⴂ और को सचिू त किया । उन्ⴂने आ�वसन दिया कि उ饍यगⴂ के साथ जडु ़ रहने सरकारी संगठनⴂ को एक साथ जोड कर काम करने की आवश्कता पर के लिए आर एडं डी-उ饍यग बैठक हर साल आयोजित की जाएगी, जो बताया । उन्ⴂने अपने संबोधन मᴂ देश के आर्थक विकास के लिए उ饍यगⴂ एनआईआईएसटी मᴂ उपलब् 煍ञन का उ饍यग के उत्पदⴂ और सेवाओ ं मᴂ वै煍ञानक हस्啍षप की आवश्कता पर बल दिया । उन्ⴂने केरल राज् के मᴂ 셂पांतरण के लिए महत्पर्ू है। उन्ⴂने यह भी उल्लख किया कि लिए विशिष्ट कई 啍ष配र का उल्लख किया जैसे कृ षि उत्पदⴂ, आयरु 핇द, दवा, एनआईआईएसटी सामाजिक ज셂रतⴂ के प्रति काम करेगा और उ饍यगⴂ की पर्यवरण, जैव प्रौ饍योगकी, जिनमᴂ मलू ्वर्न, उत्पदकता मᴂ वद्धिृ , विदेशी समस्यओ ं के समाधान के लिए प्रयास करेगा । डॉ सी एस भट, वरिष प्रधान आयात को कम करने और निर्यत और लागत प्रभावशीलता को बढ़ने के वै煍ञानक और प्रमख,ु आरपीबीडी ने धन्वाद प्रस्तव दिया। लिए वै煍ञानकⴂ की भागीदारी की आवश्कता है। उन्ⴂने एनआईआईएसटी उ饍घटन सत के बाद प्रत्यक प्रभाग यानि, कृ षि प्रसंस्रण तथा प्रौ饍योगकी जैसे वै煍ञानक संगठनⴂ से सस्त दवा, सभी के लिए आवास, स्च् और प्रभाग, माइक्रोबियल प्रक्रिया तथा प्रौ饍योगकी प्रभाग, रसायन वि煍ञन तथा हरे समाज जैसे सरकार की सामाजिक 셂प से प्रासंगिक परियोजनाओ ं मᴂ प्रौ饍योगकी प्रभाग, साम嵍र वि煍ञन तथा प्रौ饍योगकी प्रभाग और पर्यवरण भाग लेने के लिए कहा । केरल सरकार के साथ भागीदारी मᴂ हर साल प्रौ饍योगकी प्रभाग केतिनिध प्र ियⴂ 饍वरा अपने संबंधित प्रभाग कीवि शेषजता, कोचीन और कोष़कोड जैसे केरल के अन् स्थनⴂ मᴂ समान कार्शालाओ ं सविधु ाओ ं और अनसु ंधान उन्नत पर प्रकाश डालतेुय ह े तकनीकी को व्वस्थत करने के लिए उन्ⴂने सीएसआईआर-एनआईआईएसटी से प्रस्तिय酁 ां दी गयी । श्री प्रवीण राज, वरिष वै煍ञानक, रिसर् प्लानंग एडं आगह किया । बिजनेस डेवलपमᴂट प्रभाग ने एनआईआईएसटी के साथ व्वसाय करने डॉ एम बीना, आईएएस, प्रबंध निदेशक, केएसआईडीसी ने अपने संबोधन की आसानी पर प्रकाश डाला। एनआईआईएसटी के विभिन् प्रभागⴂ का मᴂ कहा कि आर एडं डी उ饍यग बैठक ऐसा एक मचं है, जहां उ饍यग की दौरा और वहॉ उपलब् सविधु ाओ ं का अवलोकन करने के लिए उ饍यग समस्यओ ं और सामाजिक ज셂रतⴂ की पहचान की जा सकती है और प्रतिभागियⴂ को प्रोत्साहत किया गया । ट्रस्लशनल अनसु ंधान पर ध्यन नवाचार के लिए अवसरⴂ के 셂प मᴂ चर्च की जा सकती है । उन्ⴂने प्रस्त酁 कᴂ द섿त करने के लिए और उ饍यग आवश्कताओ ं के लिए आर एडं डी किया कि अनसु ंधान संस्थनⴂ 饍वरा विकसित प्रौ饍योगिकिⴂ का उपयोगी कार्क्रमⴂ को्य ट नू करने के लिए वै煍ञानकⴂ, प्रौ饍योगकीविदⴂ और उ饍यग उत्पदⴂ मᴂ 셂पांतरण के लिए केएसआईडीसी अनसु ंधान प्रयोगशाला और प्रतिनिधियⴂ के साथ एक से एक इटरैकं ्न थे । बैठक के भाग के 셂प मᴂ उ饍यगⴂ के बीच एक सेत ु का कार् करेगा । उ饍यग 啍षे की उत्पदकता मᴂ सीएसआईआर-एनआईआईएसटी मᴂ विकसित उत्पदⴂ / प्रौ饍योगिकिⴂ / सधु ार के लिए और शिक्त यवाओु ं के लिए नौकरियां पैदा करने के लिए प्रक्रियाओ ं की एक प्रदर्नी भी व्वस्थत की गई थी । पारस्रिक हित के अनसु ंधान संगठनⴂ के साथ काम करने के अवसर का लाभ उठाने के लिए म饍ु द की पहचान करने और गठबंधन बनाने के लिए स啍ू ष, लघ ु और मध्म उन्ⴂने राज् के यवाु उद्यमⴂ को आमत्ं त किया । उदमⴂ सहित विभिन् 啍ष配र के साठ से अधिक उ饍यगⴂ ने आर एडं डी उ饍यग की बैठक मᴂ भाग लिया । दौरा किये उ饍यगⴂ मᴂ से कछ हमारे मौजदा 嵍रहक पद्मश्री हरीन्न नायर, संस्थपक एवं प्रबंध निदेशक, पंकजकस्रीत व्वसाय ु ू थे और अधिकाश नए प्रतिभागी थᴂ। समहू ने अपने मलू व्यख्यन मᴂ देश भर मᴂ आयरु 핇द और आयरु 핇दिक उत्पदⴂ ं के प्रचार और लोकप्रियता की आवश्कता पर बल दिया और वांछना की कार्क्रममᴂ एक पैनलचर्च भी थी। समापन समारोह के साथ कार्क्रम समाप्त कि आयरु 핇दिक दवा और हर्ल उत्पदⴂ के सत्यपन मᴂ वै煍ञानक अनसु ंधान हुआ जिसमᴂ एनआईआईएसटी और केएमएमएल, चवरा के बीच तथा संगठनⴂ को एक महत्पर्ू भमिू का निभानी चाहिए । एथमिक बायोटेक प्राइवेट लिमिटेड के साथ कु छ समझौते निष्पादत किए गए थे और कु छ व्यपार सौदे भी उभर गए।
National Institute for Interdisciplinary Science & Technology 165 सामAnnuान् aसl Repoचनू ाrt 2017-18 General Information
आर एडं डी-उ饍यग बैठक के विभिन् 饃श् सतर्कत और निविदा प्रक्रिया पर कार्यशला
सीएसआईआर - मानव संसाधन विकास कᴂ द, गाजियाबाद (सीएसआईआर- एचआरडीसी) के सहयोग से संस्थन के 煍ञन संसाधन कᴂ द ने वै煍ञानक और तकनीकी स्टफ को सतर् ता और निविदा प्रक्रिया पर जानकारी प्रदान करने के लिए 26 फरवरी 2018 को 'सतर्कत और निविदा प्रक्रिया' पर एक दिवसीय कार्शाला का आयोजन किया । श्री साजन पीटर, आईएएस (सेवानिवत्त),ृ र् पू मखु ् सचिव, सतर् ता और दिया । श्री एम दलिु प कु मार, भडारं व क्रय नियंतक, एनआईआईएसटी ने सांस्क ृतक कार्, ने कार्शाला का उ饍घटन किया, जबकि सीएसआईआर- निविदा प्रक्रिया के सतर् ता परिप्रे啍ष पर व्यख्यन दिया, इस्पत म配ं रलय एचआरडीसी के प्रमखु डॉ मन ु मनसेनाु ने सत की अध्यता की। श्री राकेश के पर्ू निदेशक श्री समᴂदनाथ ने सार्जनिक खरीद और वर्क और सेवाओ ं कु मार शर्म, वरिष उप सचिव (सेवानिवत्त),ृ सीएसआईआर ने सतर् ता, पर सीवीसी के दिशानिर्शⴂ पर व्यख्य दी । प्रतिभागियⴂ को कार्शाला से आचरण नियमावली, दायित् और अनपालन;ु सामान् अनियमितताओ ं बहुत फायदा हुआ और संकाय और सीएसआईआर-एचआरडीसी के प्रति और “क्य करᴂ और क्य न करᴂ” के पहलओु ंके बारे मᴂ एक सिंहावलोकन धन्वाद के साथ कार्शाला समाप्तु हई । तकनीकी कार्मक के लिए योग्यत विकास कार्क्रम सीएसआईआर-एनआईआईएसटी के समहू II और समहू III तकनीकी कार्मकⴂ के लिए 26 -27 फरवरी 2018 के दौरान सीएसआईआर - मानव संसाधन विकास कᴂ द, गाजियाबाद (सीएसआईआर-एचआरडीसी) 饍वरा प्रशिकण कार्क्रमय आ ोजित किया गया था। सीएसआईआर विजन, मिशन और ल啍ष्, एस एडं टी कार्मक के लिए सतर् ता 饃ष्टिकोण, दैनिक कार्यो मᴂ आईटी टूल्, योजना और आयोजन कौशल, प्रभावी पारस्रिक कौशल, समᴂदनाथ, पर्ू निदेशक, इस्पत म配ं रलय, भारत सरकार, श्री राकेश कु मार टीम बिल्डिग और 嵍पर डायनेमिक्, सेवा संबंधी मामले, कार्स्ल शर्म, वरिष उप सचिव (सेवानिवत्त),ृ सीएसआईआर और डॉ आलोक पर आत् प्रभावशीलता जैसे विभिन् विषयⴂ पर प्रशिकण दिया गया था गोयल, वरिष तकनीकी अधिकारी, सीएसआईआर-एचआरडीसी योग्ता । डॉ मन ु सक्सना, प्रमख,ु सीएसआईआर-एचआरडीसी गाजियाबाद, श्री विकास कार्क्रम केंका स य थे । राष絍रय वि煍ञन दिवस -2018 28 फरवरी, 2018 को सीएसआईआर-एनआईआईएसटी मᴂ राष絍री वि煍ञन दिवस मनाया गया । सीएसआईआर-एनआईआईएसटी के निदेशक डॉ ए अजयघोष ने स्वगत भाषण दिया और दिन के मखु ् अतिथि का परिचय दिया । मखु ् अतिथि प्रो.वी नागराज, अध्य, जवाहरलाल नेह셂 सᴂटर फॉर एडवांस् साइटिफिं क रिसर्, बℂगल셁ु ने "पन셁तु ्थनशील दवा प्रतिरोधी क्रोग का मकाबलाु कैसे करᴂ" विषय पर राष絍री वि煍ञन दिवस व्यख्यन प्रभावी दवाओ ंका विकास करना मश्कु ल हो जाता है। हालांकि, दनियु ा भर दिया । उन्ⴂने जोर दिया कि क्रोग के इलाज के लिए नई दवाओ ंपर खोज मᴂ ट्यबरकू ्लोसस का मकाबलाु करने का एकमात तरीका टीका और नई दवा वै煍ञानकⴂ के लिए एक गंभीर चनौतीु है। इसका मखु ् कारण यह है कि रणनीति के माध्म से होगा । डॉ ल啍ष् वर्म आर, अध्啍ष, अकादमिक ट्यबरकू ्लोसस बैक्टरिया एक प्रबल रोगजनकहै, जिससे शोधकर्तओ ंको कार्क्रम समिति ने धन्वाद प्रस्तव दिया।
166 National Institute for Interdisciplinary Science & Technology General Information Annual Report 2017-18
EVENTS AND CELEBRATIONS National Technology Day – 2017
National Technology Day is celebrated every year on May fundamentals of business such as Ball Pen, Helicopter, 11 to commemorate the history of India’s technological Transistor, CD’s, DNA, Vaccines, Antibiotics, Mobile innovations and excellence. The day holds significance phones, Anaesthetic agent etc., the veteran of chemical as India successfully tested nuclear bombs in Pokhran on engineering manifested that the innovations cannot May 11, 1998. be scheduled, which requires enough time to mature and many of the innovations had taken years for this CSIR-NIIST celebrated the National Technology Day on process. He also pointed out that Innovation is tough to May 11, 2017. Dr. A. Ajayaghosh, Director, CSIR-NIIST manage and easy to stifle and innovator is often harassed delivered the welcome address and introduced the Chief because Creativity thrives on Instinct, Uncertainty, Guest of the dayProf. M.M. Sharma, Former Director, Freedom and Iconoclasm while management demands Institute of Chemical Technology, Mumbai. Prof. Sharma Consensus, Control, Certainty, and the Status quo. Half delivered the Technology day lecture on "The Critical of the great innovations in the world came from great Role of Innovation to Trigger Rapid Economic Growth". insights, the other half happened by accident and none He emphasized the need for strong fundamental research of them on a schedule and no one predictable path to linking to the industrial applications. While emphasizing successful innovation. Patience is a mandatory condition the importance of Innovation, he said that innovative if innovation is to thrive. While congratulating the ideas can be born from good science, which can turn achievements of NIIST, Prof. Sharma emphasized that a to Innovations, technologies for the benefit of mankind fertile relationship between Science and Engineering is which influence the economic growth directly. While required for Innovation. The mistakes are common, not citing some technologies which have changed the because people or firms are incompetent but because they are continuously dancing on the edge of knowledge.
Prof. M.M. Sharma, Former Director, Institute of Chemical Technology, A scene from Technology day celebrations Mumbai delivering the Technology day lecture
National Institute for Interdisciplinary Science & Technology 167 Annual Report 2017-18 General Information
World Environment day The ability to learn from failure is critical to making progress and in India a very important factor affecting Innovations is total lack of ownership of failures.Dr. A. Sundaresan, Head, RPBD proposed the vote of thanks. Workshop on ' Prospects in Agroprocessing'
World Environment Day The world Environment day was celebrated on 5 June, 2017 at CSIR-NIIST, Thiruvananthapuram by planting of saplings within the campus of CSIR-NIIST. Jawaharlal Nehru Tropical Botanic Garden and Research Institute has provided medicinal plants and various other tree saplings. Director, CSIR-NIIST in his address to the staff Shri Biju Prabhakar, Director of Agriculture Development & Farmer’s and students on the World Environment day stressed Welfare inaugurating the workshop the importance of planting and maintenance of greenery A one day R & D symposium on “Prospects in within the campus. He also thanked JNTBGRI for providing Agroprocessing “was inaugurated by Shri Biju Prabhakar, the saplings. The saplings were planted by the staff and Director of Agriculture Development & Farmer’s Welfare students of CSIR-NIIST. Saplings were also distributed on 23rd May, 2017 at CSIR-NIIST. He stressed the scope among staff and students of CSIR-NIIST. of new ventures in the primary processing of produce of the region and complimented the efforts of CSIR NIIST Jigyasa 2017 - Scientist-Students Connect in developing and popularizing such technologies. He Programme singled out the Refrigeration Adsorption Dehumidified The Council of Scientific and Industrial Research (CSIR) Drier (RADD) developed by the institute and its great in collaboration with KendriyaVidyalayaSangathan (KVS) potential and informed that the state government has launched a wide ranging Scientist-Students Connect is going to install 14 of such units for the benefit of the programme at National Institute for Interdisciplinary farmers. Science and Technology (NIIST). The programme Dr. A. Ajayaghosh, Director CSIR NIIST assured the industry named “Jigyasa” in full stream with KVS is expected that, the institute is refocusing its efforts in solving to connect about 350 KVS schools targeting 75,000 industrial problems and urged the industry to make use students and nearly 1,000 teachers with CSIR labs across of the vast expertise and infrastructure available with the institute. Presentations were made by the industry representatives from A.K. Flavours & Aromatics Cochin, M/ Brahmins Food Products, M/s. PCPCL Palakkad, Spices Board, FSSAI and KINFRA. A presentation was also done by the institute on how technologies are developed at bench scale and then taken it to pilot plant and commercial level. Some of the ventures set up by the institute on turnkey basis were ‘Team Jigyasa-2017’ at the valedictory function, at CSIR-NIIST auditorium on 16th June 2017 highlighted during the presentation from the institute.
168 National Institute for Interdisciplinary Science & Technology General Information Annual Report 2017-18 the country. A one week “Jigyasa” programme has to collaborate with research institutions for the issues been conducted at CSIR-NIIST from 12th to 16th June of the industries for which scientific and technological 2017 was inaugurated by the Director CSIR-NIIST Dr. A. interventions are required. Dr. A. D.Damodaran, Former Ajayaghosh. Around 85 KVS students and teachers from Director, CSIR-NIIST delivered a special lecture on the six KV schools in Thiruvananthapuram city attended saga of development of mineral activity at CSIR-NIIST this programme. Jigyasa at CSIR-NIIST was coordinated and its translation from laboratory to industries through by Dr. C. H. Suresh, Principal Scientist, and Dr. R. Luxmi many of the pilot plant trials. Dr. M. L. P. Reddy, Secretary, Varma, Sr. Principal Scientist & Head, Chemical Sciences REAI and Chief Scientist (Retd.) CSIR-NIIST welcomed and Technology Division. This programme consisted of the gathering. Dr. K. Harikrishna Bhat, convener of the basic lab experiments, popular science lectures, science workshop proposed the vote of thanks. Invited lectures quiz, science film, laboratory visit, and interaction with were delivered by Shri. Antony Francis, Kerala Minerals scientists and research scholars. Scientists including Dr. and Metals Ltd.,(KMML), Shri. C. Swamydas, VV Minerals, Manoj Raama Varma, Dr. U. S. Hareesh, Dr. K. K. Maiti, Dr.K.Johnson, Travancore Titanium Products Ltd.(TTPL) Dr B Krishnakumar, Dr. T.P.D. Rajan, Dr. V. Karunakaran, and Dr. K. Harikrishna Bhat, CSIR-NIIST on issues related Dr. L. Ravishankar, Dr. K. Yoosaf, Dr. P. Nisha, and Dr. to beach sand mining, titanium pigment production P. Binod took part. The idea of connecting scientists and and preparation of synthetic rutile. The workshop was research scholars of CSIR institutes with a large pool of attended by scientists from CSIR-NIIST, VSSC and IREL. science students and teachers in the country is a highly inspirational one for the science education sector in the country. Definitely, a successful and long term conduct of the programme will lead to massive improvement in our education system and it will empower the students, teachers and even parents to lead a path for achieving ambitious goals in a scientific career. Dr. A D Damodaran, Former Director, CSIR-NIIST delivering One Day Industry -Institute Workshop on " special lecture Utilization of Rare Earths and Beach Sand OBSERVANCE OF HINDI WEEK Minerals" Hindi Week was celebrated in the Institute during 11- Rare Earths and beach sand minerals continue to play 14th September 2017. The formal inaugural function a dominant role in the Indian mining industry by virtue of the Hindi week was held on 11th September 2017 at of their importance to advanced applications. CSIR- 10.00 AM. Dr. P. Prabhakar Rao Chairman, Organizing NIIST organised a one day Industry-Institute Workshop Committee welcomed everyone present in the function. on "Utilisation of Rare Earths and Beach Sand Minerals" In his welcome speech, he presented a brief information on June 27, 2017 jointly with Rare Earths Association of on the relevance of organizing Hindi Day and Hindi Week India (REAI). The workshop was aimed at providing a in Central Government Offices and urged the participants common platform for the researchers in the Institute and to use the official language Hindi in their official work and the mineral Industries to discuss the latest developments contribute their best in implementing the official language in the mineral mining/ processing including the issue policy of the Government. Dr. A. Ajayaghosh, Director, CSIR-NIIST presided over the inaugural session. In his related to pollution abatement. presidential address, he said that Hindi is a rich language The workshop was inaugurated by Shri. D. Singh, Chairman and it is a link between India's national and cultural unity. and Managing Director of Indian Rare Earths Limited (IREL) As far as its use in official work is concerned, we have to and President of REAI. He called on the researchers and make such a decision in our mind and have to accept it mineral industries to identify areas of common interest as our duty and that no resolution will be required for its for translational research. In presidential address, Dr. A. use in government functioning. Today India has emerged Ajayaghosh, Director, CSIR-NIIST invited mineral industries as a world power. We should connect the Hindi language
National Institute for Interdisciplinary Science & Technology 169 Annual Report 2017-18 General Information
Dr. P.Prabhakar Rao, Chairman, Hindi Week Celebration Committee Dr. A. Ajayaghosh, Director delivering the welcoming the participants Presidential address
with Science & Technology and Information Technology, most affordable available techniques for a stress-free life. so that benefits of these areas will reach the common . He urged the participants to accept life and its problems man. He urged the participants to do their official work as an opportunity. originally in Hindi and also to take a firm determination The second presentation was given by Dr.Sanjib Banerjee, to do official work in Hindi as much as possible in Ramanujan Fellow on "useful polymers in daily life". in his order to fulfill the official language requirements. He presentation, he explained in detail about the importance congratulated all officers and employees for their efforts in of certain polymers, their chemical composition and their promoting Official Language Hindi and appreciated their impact on human health. The topics of both presentations contributions and later declared the formal inauguration being extremely important in the present perspective, of the Hindi Week -2017. the participants took full advantage and appreciated the speakers . The inaugural session ended with vote of thanks by Smt. S. Sobhana, AO. The following competitions were organized throughout the whole week for staff of the Institute, including project staff, research students etc. 1) Hindi Online Quiz (September 11 to September 13) 2) Hindi Quiz (12 September 2017) 3) Hindi Antakshari (September 13, 2017) Mr. Dulip Kumar, Controller of Stores & Purchase, giving 4) Hindi debate (September 14, 2017) presentation on Stress Management 14 September 2017 was celebrated as Hindi Day and the closing ceremony and prize distribution was organized on the same day at 4.00 pm. Dr. P. Prabhakar Rao, Chairman, Hindi Week Organizing Committee presided over the function. Dr. S.R. Jayashree, Assistant Professor, Department of Hindi, MG College, Thiruvananthapuram was the chief guest .Dr.P. Nishy, Head, KRC and Member, Organizing Committee delivered welcome address
Dr. Sanjib Banerjee giving presentation on and introduced the Chief guest to the participants. "Useful polymers in daily life". The Chief Guest, gave a very interesting lecture on the Immediately after the inauguration, Mr. Dulip Kumar, rationale of making Hindi as the official language and Controller of Stores & Purchase gave a presentation on the role of government employees in the progress of the "Stress Management" in Hindi. In his presentation, he official language. Director – In Charge Dr. A. Sundaresan elucidated different forms and different stages of stress, distributed prizes to successful participants of various its management, and gave information on the simplest, competitions.
170 National Institute for Interdisciplinary Science & Technology General Information Annual Report 2017-18
Csir-Niist Science Outreach Programme
CSIR-National Institute for Interdisciplinary Science Communication and popularisation of science. Science and Technology (NIIST), Trivandrum organised one day publication should be simple and easy to understand Science Outreach Programme for students and public for the common man. In the presidential address, Dr. A. on September 18, 2017 as a precursor event of the Ajayaghosh, Director, CSIR-NIIST, Trivandrum emphasised India International Science Festival (IISF–2017), the third the need make the public aware about the importance of of its kind, jointly organised by the Ministry of Science science in human life. Though science takes a backseat and Technology and the Ministry of Earth Sciences in many times, it is integral and essential for the growth of association with VIBHA (VijnanaBharati). The outreach mankind. program aims to create awareness of the R&D activities About 150 school and college students and teachers of CSIR-NIIST to the public and to inculcate a scientific attended the programme comprising popular science lectures,interaction of students with scientists, open temper among the young minds as the development of house laboratory visits, exhibition of technologies. Dr. U.S. our Nation at any phase is linked with advance in science Hareesh, Senior Scientist, CSIR-NIIST delivered the talk and innovation. on “Popular Advancements in Materials Science: A few The Science outreach programme was inaugurated Case Studies” and Dr. B. Krishnakumar, Senior Scientist, by Prof. K. Girish Kumar, Professor, Cochin University CSIR-NIIST talked on “Waste Resource Factories”. The of Science and Technology, Kochi. In his inaugural programme had also a video show on various activities address he highlighted the importance of Effective of CSIR-NIIST.
8th East Asia Symposium on Functional Dyes and Advanced Materials (EAS8)
The “8th East Asia Symposium onFunctional Dyes and was offered by American Chemical Society and more Advanced Materials” (EAS8) was held at CSIR-NIIST, than 80 students actively participated in the workshop. Thiruvananthapuram, India during 20-22 September Dr. R. Luxmi Varma, Head CSTD and Chairperson APC 2017. EAS8 belongs to the series of biennial symposia welcomed the gathering and Dr. A. Ajayaghosh, Director previously organized in Japan (2003, 2009, 2015), Taipei - CSIR-NIIST, inaugurated the workshop. Dr. Varma, (2005), Korea (2007), and China (2011, 2013) and for the first time it is being organized in India, as part ofthe Platinum Jubilee celebrations of CSIR. CSIR-NIIST has been continuously engaged in developing such novel dyes and inks and EAS8 offered an excellent platform for productive interactions among young researchers, students and entrepreneurs. EAS8 witnessed three days of exciting and inspiring program of the highest scientific caliber. With Pre-symposium workshop (EAS8-2017) approximately 300 participants from India, Japan, September 19, 2017 Korea, Singapore, Australia, Taiwan and Switzerland, the during her welcome address, spoke about the objectives symposium showcased one of the largest in the series and of any scientific communication to accurately and the first one hosted outside the East Asian countries. The clearly disseminate and communicate new scientific event was flagged off on th19 September 2017, via a pre- knowledge. In the inaugural address, Dr. Ajayaghosh symposium workshop for students on “How to Effectively pointed out the significance of “the art of effective Communicate your Research – Starting from Manuscript scientific communication”, that was further elaborated by Writing to Acceptance and Promotion”. The workshop Dr. Deeksha Gupta (Managing Editor, ACS Omega) and
National Institute for Interdisciplinary Science & Technology 171 Annual Report 2017-18 General Information
her team during the two-hour interactive session. All the attendees were given participation certificates. The symposium started on 20th September 2017 with a colorful opening ceremony. Dr. A. Ajayaghosh opened the symposium with a welcome address and Dr. Suresh Das (Executive Vice President, KSCSTE, Govt. of Kerala) presided over the function. Prof. Hiroyuki Nakazumi (Osaka Prefecture University, Japan) elaborated on the context and dimensions of the symposium. Directors of exhibition stalls from different sponsors and vendors and three sister institutes - Dr. S. Chandrasekhar (Director, CSIR- was inaugurated by Dr. B. Chandrasekaran. IICT, Hyderabad), Dr. Vijayamohanan K. Pillai (Director, CSIR-CECRI, Karaikudi) and Dr. B. Chandrasekaran The technical program included 6 plenary lectures, 16 (Director, CSIR-CLRI, Chennai) were the guests of honor. invited lectures, 6 young scientist lectures and 4 invited Dr. S. Chandrasekhar delivered the inaugural address, lectures from industries, along with two poster sessions and a flash talk session for students. In total, 130 posters and Dr. Pillai and Dr. Chandrasekaran unveiled the book were presented by the student participants over the first of abstracts. The opening ceremony came to a close with two days of the symposium. Seven best posters were vote of thanks proposed by Dr. K. N. Narayanan Unni (CSIR- selected for ACS Omega best poster awards (3 prizes) NIIST, Thiruvananthapuranm and Convener, EAS8). The and EAS8 best poster awards (4 prizes). Three best inaugural plenary lecture was given by Prof. G. D. Yadav flash talk presenters were bestowed with RSC best talk (Vice Chancellor and R. T. Modi Distinguished Professor, awards. The awardees were conferred the prizes during ICT, Mumbai) and was chaired by Dr. Suresh Das. The the concluding session of the symposium. Dr. Der-Gun advancement made in the field of functional materials Chou announced the 9th symposium in the EAS series derived from biomass using solid acid / base catalysts was to be held in Taiwan in 2019. The symposium came to a discussed in detail by Prof. Yadav. The lecture stressed on close after the concluding remarks by the Chairs of the the significance of green and sustainable chemistry for symposium (Dr. Ajayaghosh and Prof. Nakazumi) and a the realization of value added products from cheap and vote of thanks proposed by Dr. Vijayakumar C. Nair (Co- renewable ecofriendly sources. The symposium featured convener, EAS8, CSIR-NIIST, Thiruvananthapuram). CSIR Foundation Day - 2017
The CSIR Foundation Day was celebrated in CSIR-NIIST on September 26, 2017. Dr. A. Sundaresan, Chief Scientist and Head, RPBD, CSIR-NIIST delivered the welcome address and introduced the Chief Guest of the day. The CSIR Foundation Day Lecture was delivered by the chief guest, Dr. N. Purnachandra Rao, Director, National Centre for Earth Science Studies, Thiruvananthapuramon the topic "Earthquakes and Tsunamis in the Indian subcontinent - How prepared are we?". He described be mitigated. He told after the tsunami in December, how the earthquakes and Tsunami occurs and what are 2004, India had taken major steps in installing tsunami major causalities happened.He depicted the earthquake warning systems and monitoring them. Dr.Luxmi prone areas in India and what are the normal warning Varma, Chairperson, Academic Programme Committee signals we get when the earthquake and tsunami proposed the vote of thanks. Around three hundred occurs. He described the methods for prediction of students from various educational institutions had visited tsunami occurrences and how the large causalities can CSIR-NIIST as part of open day.
172 National Institute for Interdisciplinary Science & Technology General Information Annual Report 2017-18
NIIST Foundation Day - 2017
CSIR-NIIST celebrated the NIIST Foundation Day on enhancing the quality of higher education in the state. October 6, 2017. Dr. A. Ajayaghosh, Director, CSIR-NIIST The Annual Report of CSIR-NIIST for the year 2016-17 delivered the welcome address and introduced the Chief was released by the Chief Guest and received by Dr. A. Guest of the day. The NIIST Foundation Day Lecture was Sundaresan, Chief Scientist and Head, RPBD, CSIR-NIIST. delivered by the chief guest Dr.Kuncheria P. Isaac, Vice Dr. R. Luxmi Varma, Chairperson, Academic Programme Chancellor, APJ Abdul Kalam Technological University, committee proposed the vote of thanks. Thiruvananthapuram. He emphasised the need for Observance of Vigilance Week-2017
On 1st November, elocution competition was held separately for staff members and students on the topic “ Is corruption co-existing with developmental activities” ? On 3rd November Panel Discussion on this year’s theme- My vision- corruption free India was held. The Panels views on “ How to make India corruption free” are summarized as follows :- 1. Digitally enabled governance has helped in improving the transparency in the system, which in turn has helped in reducing the corruption in the public dealing departments of Government. 2. One of the reasons for corruption is absolute Power, Hence distribution of more power at various In CSIR- NIIST, Thiruvananthapuram, Vigilance Awareness hierarchical level from highest author to the level week-2017 started on 30th October 2017 with Vigilance of local council level to ensure the participation of Pledge. In the Inaugural function of the Vigilance Citizen will help in reducing the corruption. Awareness Week, Director briefed this year’s theme” 3. Funding to political parties should be transparent. My vision- Corruption free India” and also the activities 4. Establishment of Special courts for dealing with proposed to be conducted during the week long cases involved by politicians will lead to reducing the celebration. He read out the pledge in both Hindi and corruption in the system. English and advised the staff members to take e-pledge 5. Corruption has almost become like a culture in the also by visiting CVC’s site. On 31stOctober, aWorkshop on society now. Hence quality education is a must to get TA/DA/ LTC, Conduct Rules and do’s and Don’ts was held rid of this. in order to create awareness on Vigilance among staff Strengthening the implementation of RTI, Lokpal and and Research students. Followed by this a quiz was held 6. Lokayukta, will enable a corruption free country. on the above topics.
National Institute for Interdisciplinary Science & Technology 173 Annual Report 2017-18 General Information
7. The common men should get his basic needs like were also given opportunity to express their views on the food, hospital, and education from the government topic. system so that corruption in such basic amenity can To create awareness on vigilance and anti- corruption be reduced and the general public will not be suffered among staff and public who visited the Instt. during the to meet his basic needs. week, slogans and famous quotes on vigilance anti- 8. Empowering women and stoppage of many bad corruption were displayed through the display system practices like dowry etc. will also help to reduce kept at various places of the Institute. A hand book on corruption . “How to make India Corruption free” has been displayed in the Institute’s intranet portal for the benefit of all. 9. Implementation of law and ensuring punishment to the guilty is also necessary to reduce the corruption. The valedictory function and distribution of prizes to the winners of various competitions were held on 6th 10. A vigilant and watchful police system ( as in the case of November afternoon with Dr. ShaikDarvesh Sahib, IPS Singapore) surely help to reduce the corruption and ADGP, Vigilance & Anti- Corruption Bureau as the Debate on the topic “Whether Implementation of Chief Guest . In his valedictory address, quoting various digitalization has reduced corruption” was held on 6th incidents that came across his career, he urged the November morning. Both the teams, for and against participants to be honest in all their official and personal having an in-depth knowledge on the theme debated dealings and also inculcate these habits to their next generation so that our Country will emerge corruption well, which was appreciated by the audience. Audience free. Swachhta Pakhwada As per instructions received from Govt. of India/ CSIR, the As part of Swachhtapakhwada Quiz competition on “ Institute conducted extensive cleaning activities within Cleanliness & hygeine “ was held on 14th September 2017. the Laboratory and outside premises of the Institute. All Staff members actively participated in the Competition. R&D and Non- R&D divisions were requested to carry All Administrative Sections carried out weeding out of out cleaning activities and weeding out of unused/ old files and 3 condemed vehicles have been disposed. obsolete items / files during Swachhta pakhwada. On Intensive cleaning was carried out to keep the laboratory 1st November 2017, the staff members took Swachhta and its surroundings clean and Swachhta Pakhwada was Pledge. observed in its true spirit.
The safety committee requested all the scientific divisions of the institute to observe 14th November 2017 as cleaning day. In accordance with this, every division conducted their own cleaning process. Fumigation and pest control measures were also undertaken. Cleaning activities in the Campus
174 National Institute for Interdisciplinary Science & Technology General Information Annual Report 2017-18
Chemistry and Physics at The Excited States
The seminar was inaugurated by Dr. A. Ajayaghosh, Director - CSIR-NIIST, who, in his introductory remarks, elaborated on the significance of continued investigations on the excited state properties and reactions of materials. Dr. Ajayaghosh also welcomed the distinguished guests, speakers and all the participants to the program. The technical program included 8 invited lectures along with a few posters.
Dr. K. R. Gopidas, Chief Scientist, CSTD delivering the lecture The seminar came to a close with a concluding session, chaired by Dr. A. Ajayaghosh (Director, CSIR-NIIST) As part of the outreach activities of the Chemical Sciences and was devoted in honour of Dr. K. R. Gopidas (Chief and Technology Division, we organized a one-day national Scientist, CSIR-NIIST, Thiruvananthapuram), who was seminar on “Chemistry and Physics at the Excited States” superannuating from Council service in November 2017. on 24 November, 2017. The seminar witnessed a day of Dr.Ajayaghosh and others underlined the excellence and exciting and inspiring program of the highest scientific caliber of Dr. Gopidas as a great scientist, a wonderful caliber. With approximately 200 participants from different mentor, an insightful academician and a dedicated parts of India, including students, scientists and industry administrator, who inspired and motivated a generation delegates, the seminar showcased not only the scientific to take science not only as a career, but as a part of life advancements but also presented the opportunities and also. The session was formally closed with the vote of challenges existing in this field of research. The event was thanks proposed by Dr. Narayanan Unni K. N. (CSIR-NIIST, sponsored by Laser Spectra Services Pvt. Ltd., Bengaluru. Thiruvananthapuram) followed by the national anthem.
National Workshop on Advanced Analytical Solutions in Dioxin Analysis
CSIR- National Institute for Interdisciplinary Science and analysis of dioxins was conducted for the first time & Technology conducted an one day workshop on in India. The latest findings of the studies conducted "Advanced Analytical Solutions in Dioxin Analysis" in by CSIR-NIIST on the emission of dioxins from open collaboration with Agilent Technologies on 5th January burning of municipal solid wastes were presented during 2018. NIIST established the first dioxin research laboratory the workshop. Dr. A. Ajayaghosh, Director, CSIR-NIIST in India and contributed in preparing the National inaugurated the workshop and Dr. S.K. Bhargava, Expert Implementation Plan (NIP) as a part of country's Stockholm Appraisal Committee Member, Ministry of Environment & convention obligations on POPs. Subsequently the Forests was the special invitee to the programme. facilities at NIIST have been strengthened for developing Dr. K. P. Prathish, Scientist – in charge, Dioxin Laboratory, inventories of dioxin emission for gaps pointed out in Mr. Chandrasekar Kandaswamy, Agilent Technologies NIP evaluation. Ministry of Environment & Forests (MoEF) and Dr. Van Essen Marc, LCTech, Germany presented the has recommended CSIR- NIIST as a referral laboratory for state of the art analytical methodologies for open burning carrying out dioxin analysis for environmental clearance studies, sample preparation methods and quantification in various sectors. using GC-MS/MS. About 30 participants from organisations The workshop was organized for knowledge dissemination such as Central and State Pollution Control Boards, CSIR- and creating awareness to testing laboratories, NEERI, IITR, NGRI, Export Inspection Council (EIC), Spices industries, regulatory bodies, research institutes and Board, FSSAI, CIFT, KSREC, Agricultural University, KEIL environmentalists in the latest trends in dioxin analysis. (FACT), KMML, Vimta Labs(Hyderabad), Sea Lab(Kochi), The hands-on training in sampling, sample preparation Interfield Lab (Kochi), CUSAT etc attended the workshop.
National Institute for Interdisciplinary Science & Technology 175 Annual Report 2017-18 General Information
National Conference on Luminescence and its Applications ( NCLA-2018)
National Conference on “Luminescence and its The key Note Lecture was delivered by Dr. R. P. Rao, Applications “ ( NCLA-2018) organized jointly by CSIR- Speciality Phosphors, USA. During his lecture, Dr. Rao National Institute for Interdisciplinary Science and highlighted the role played by luminescent materials Technology (NIIST) and Luminescence Society of India in the medical applications. Though there exist a large (LSI) was held during February 14-16, 2018 at CSIR-NIIST number of devices based o luminescent materials, Thiruvananthapuram. NCLA-2018 was aimed at providing the device fabrication technology is closely guarded an interactive platform to the academia, researchers and by multiple add on IPRS by MNCs worldwide. As the the industry to discuss the various developments taking translation of fundamental knowledge to actual devices place in the area of phosphors. The conference was is a major challenge and hence he recommended also intended to provide an opportunity for the young adopting an interdisciplinary approach for the device researchers to meet the peers in the field and discuss the development and engaging experts from different challenges and issues in the development, fabrication, branches such as chemistry, biology, engineering and engineering and applications of phosphors. physics in the early stages of development. The conference was inaugurated by Dr. R. P. Rao, The technical sessions included invited lectures from Speciality Phosphors, USA, at CSIR-NIIST, Trivandrum on the distinguished experts and peers in various theme February 14, 2018. The function was presided over by areas of the subject. The lead lectures in each session Dr. A. Ajayaghosh, Director, CSIR-NIIST, Trivandrum. were followed by selected contributed papers in the oral presentations. There were about 12 technical sessions In his inaugural address Dr.Raohighlighted the in which over 40 invited papers were presented in importance of phosphors in medical applications in areas plenary, invited and contributed categories. The other such as diagnostics and imaging. He further informed contributed papers were in poster presentations. Three that though there has been very focussed research on the contributed papers presented in the poster sessions fundamentals and the development of new and efficient phosphor materials worldwide, the efforts on realisation of devices for actual field applications still lacking. As the area is highly competitive in terms of revenue generation, many of the component fabrication based on these materials are closely guarded by multinational companies with IPRs. Inaugural Session Dr.A. Ajayaghosh, Director, CSIR-NIIST, Trivandrum in his presidential address highlighted the need of interdisciplinary approach for the development of luminescent materials with inputs from branches such as chemistry, physics, engineering and biology. He also emphasized that the area of luminescent materials is highly challenging and the developments are Dr. A. Ajayaghosh, Director, CSIR-NIIST delivering the Presidential Address taking place at rapid rates in areas such as solid state lighting. He called upon the researchers in the area to devout attention on fundamental understanding and integrateengineering principles of device fabrication. He called upon the delegates to adopt an interdisciplinary approach comprising experts from different branches of science including engineering. Dr. R.P. Rao, Speciality Phosphors, USA, delivering the Keynote Lecture
176 National Institute for Interdisciplinary Science & Technology General Information Annual Report 2017-18 were selected for the best poster presentation awards Nuclear Sciences (BRNS), DAE, Kerala State Council for and were awarded cash prize with a certificate. About 200 Science, Technology and Environment ( KSCSTE), Council registered delegates attended the conference. of Scientific & Industrial Research (CSIR), and supported by many other private industries/organisations. The conference was sponsored by Board of Research In
R & D Industry meet The second R&D Industry meet was held at CSIR-NIIST improving the productivity of industry sector and creating for enhancing and deepening partnership with Industry jobs for educated youths. on 23rd February 2018. The R & D Industry meet was Padmashree Hareendran Nair, Founder & MD, inaugurated by Shri T.K. Jose, IAS Additional Chief Pankajakasthuri business group in his keynote address Secretary (Local Self Government Department), Govt. stressed the need for promoting and popularizing of Kerala in the esteemed presence of Dr. M. Beena, IAS Ayurveda and ayurvedic products across the country and Managing Director, KSIDC, Padmashree Hareendran Nair, desired that scientific research organizations should play Founder & MD, Pankajakasthuri, Dr. Ram Chand Chief a pivotal role in the validation of Ayurvedic medicine and Executive Officer, Saksin Lifesciences Pvt. Ltd. herbal products. Shri. T.K. Jose, IAS, Additional Chief Secretary (Local Self Dr. Ram Chand Chief Executive Officer, Saksin Lifesciences Government Department), Govt. of Kerala in his Inaugural Pvt. Ltd. highlighted some of the areas of futuristic address highlighted the need for linking academic research specifically in the health and drug discovery institutions, research institutions, industries and sector. He emphasized the need for Industry and government organizations to resolve societal problems. academia collaboration for solving specific problems as He emphasized the need for the scientific intervention in in the western countries. He also wished that scientific industries to achieve economic growth for the country. organizations should address the shortage of critical and He mentioned many sectors specific to the state of Kerala skilled manpower in the country. The Director, CSIR-NIIST, such as Agri-products, Ayurveda, medicine, environment, Dr. A. Ajayaghosh in his presidential address briefed the bioTechnology which required scientist’s involvement activities of CSIR and cited the technologies available with for value addition, productivity increase, reduce foreign CSIR to serve the society. He assured that R&D Industry import and enhance export and cost effectiveness etc. meet would be organized every year to stay connected He asked scientific organizations like NIIST to take part in with Industries which is important for the translation of the government’s socially-relevant projects in affordable the knowledge available at NIIST to industry products and medicine, housing-for-all, clean and green society etc. He services. He also mentioned that NIIST would be working wished CSIR-NIIST to organize similar workshops in other towards the societal needs and finding solutions to the parts of Kerala like Cochin and Kozhikode every year in problems of the industries. Dr. C. S. Bhat Sr. Pr. Scientist partnership with Kerala Government. and Head, RPBD proposed the vote of thanks. Dr. M. Beena, IAS Managing Director, KSIDC in her address The inaugural session was followed by technical cited that R&D and Industry meets are forums where the presentations by the representatives of each division Industry problems and social needs can be identified and viz., Agro-processing and Technology division, Microbial discussed as opportunities for innovation. She offered that process and Technology division, Chemical Sciences & the KSIDC can build a bridge between research laboratory Technology Division, Materials Science & Technology and industry to translate technologies developed by the Division and Environmental Technology division research institutes to useful products. She invited the highlighting the expertise, facilities and research young entrepreneurs of the state to take advantage of advancement of their respective division. Mr. Praveen the opportunity to work with research organizations for Raj, Sr. Scientist of Research Planning and Business
National Institute for Interdisciplinary Science & Technology 177 Annual Report 2017-18 General Information
development division highlighted the ease of doing Enterprises took part in the R&D Industry meet to identify business with NIIST. The industry participants were the issues of mutual interest and to forge alliances. encouraged to visit the divisions and facilities available at Among the industries that visited few were our existing NIIST. There were one to one interactions with scientists, clients and majority were new participants. technologists and Industry representatives to focus on The programme also had a panel discussion. The translational research and tune the R&D programmes programme ended with a valedictory function in which to industry requirements. An exhibition of Products/ a couple of agreements were executed between NIIST Technologies/ Processes developed in CSIR-NIIST also and KMML, Chavara and also with Athmic Biotech Private arranged as part of the meet. More than Sixty Industries limited and a few business deals budded. from various sectors including Micro, Small & Medium
Various scenes from R.& D Industry meet Workshop on Vigilance and Tendering Process
A one-day workshop was organised by the Knowledge Resource Centre, CSIR-NIIST in association with CSIR - Human Resource Development Centre, Ghaziabad (CSIR- HRDC) on 26th February 2018 on ‘Vigilance and Tendering Process’ for imparting the knowledge of vigilance and tendering process to Scientific and Technical Staff. Shri Sajen Peter IAS (Retd.), former Chief Secretary Vigilance and Cultural Affairs inaugurated the workshop while Dr Manu Saxena, Head, CSIR-HRDC chaired the session. the Vigilance Perspective of Tendering Process, Shri. Shri. Rakesh Kum ar Sharma, Sr. Deputy Secretary(Retd.), SamrendraNath, Former Director, Ministry of Steel CSIR gave an overview about a Facets of Vigilance, explained on the CVC Guidelines on Public Procurement Conduct Rules, The Obligation and Compliance; and Works & Services. The participants were greatly Common Irregularities and Do’s & Don’ts. Shri M. Dulip benefited by the workshop which ended with vote of Kumar, Controller of Stores & Purchase, NIIST talked on thanks to Faculty and CSIR-HRDC.
Competency Development Programme for Technical Personnel
The training programme was organized by CSIR - Human Resource Development Centre, Ghaziabad (CSIR-HRDC) during 26th -27th February 2018 for the group II & Group III Technical Personals of CSIR-NIIST. Training was given on various topics such as CSIR Vision, Mission and Goals, Vigilance Perspectives for S&T Personnel, IT Tools in the day to day work, planning & organizing skills, effective
178 National Institute for Interdisciplinary Science & Technology General Information Annual Report 2017-18 interpersonal skills, team building and group Dynamics, Govt. of India; Shri. Rakesh Kumar Sharma, Sr. Deputy Service Matters and Self-Effectiveness at the workplace. Secretary(Retd.), CSIR and Dr AlokGoel, Sr. Technical Dr Manu Saxena, Head, CSIR-HRDC Ghaziabad; Shri Officer, CSIR-HRDC were the faculties for imparting the SamrendraNath, Former Director, Ministry of Steel, Competency Development Programme. National Science Day Celebrations - 2018 The National Science Day was celebrated in CSIR-NIIST on February 28, 2018. Dr. A. Ajayaghosh, Director, CSIR-NIIST delivered the welcome address and introduced the Chief Guest of the day. The National Science Day Lecture was delivered by the chief guest, Prof. V. Nagaraja, President, Jawaharlal Nehru Centre for Advanced Scientific Research, Bangalore, on the topic “How to counter the resurgent drug-resistant tuberculosis". He emphasized that the research on newer drugs to treat tuberculosis is posing a serious challenge to scientists. This is primarily because the TB bacteria is a formidable pathogen making it tough for researchers to develop effective drugs. However, the only way to counter TB worldwide would be through a vaccine and new drug strategy. Dr.Luxmi Prof. V. Nagaraja, President, Jawaharlal Nehru Centre for Advanced Varma R, Chairperson, Academic Programme Committee Scientific Research, Bangalore, delivering Science day Lecture proposed the vote of thanks.
National Institute for Interdisciplinary Science & Technology 179 Annual Report 2017-18 General Information
नयी सविधाु / New Facility X-ray Photoelectron Spectroscopy
नया एनआईआईएसटी डिस्ᴂसरी भवन / New NIIST dispensary building
180 National Institute for Interdisciplinary Science & Technology