bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 The evolutionary origin of bilaterian smooth and striated myocytes

2

3

4 Thibaut Brunet1, Antje H. L. Fischer1,2, Patrick R. H. Steinmetz1,3, Antonella Lauri1,4,

5 Paola Bertucci1, and Detlev Arendt1,*

6

7

8 1. Developmental Biology Unit, European Molecular Biology Laboratory,

9 Meyerhofstraße, 1, 69117 Heidelberg, Germany

10 2. Present address: Ludwig-Maximilians University Munich, Biochemistry, Feodor-

11 Lynen Straße 17, 81377 Munich

12 3. Present address: Sars International Centre for Marine Molecular Biology,

13 University of Bergen, Thormøhlensgate 55, 5008 Bergen, Norway.

14 4. Present address: Institute for Biological and Medical Imaging (IBMI), Helmholtz

15 Zentrum München, Neuherberg, Germany

16

17 * For correspondence: [email protected]

18

19

1 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 Abstract

2 The dichotomy between smooth and striated myocytes is fundamental for bilaterian

3 musculature, but its evolutionary origin remains unsolved. Given their absence in

4 Drosophila and Caenorhabditis, smooth muscles have so far been considered a

5 vertebrate innovation. Here, we characterize expression profile, ultrastructure,

6 contractility and innervation of the musculature in the marine annelid Platynereis

7 dumerilii and identify smooth muscles around the midgut, hindgut and heart that

8 resemble their vertebrate counterparts in molecular fingerprint, contraction speed,

9 and nervous control. Our data suggest that both visceral smooth and somatic

10 striated myocytes were present in the protostome-deuterostome ancestor, and that

11 smooth myocytes later co-opted the striated contractile module repeatedly – for

12 example in vertebrate heart evolution. During these smooth-to-striated myocyte

13 conversions the core regulatory complex of transcription factors conveying myocyte

14 identity remained unchanged, reflecting a general principle in cell type evolution.

15

16

2 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 Introduction

2 Musculature is composed of myocytes that are specialized in active contraction (Schmidt-

3 Rhaesa 2007). This function relies on actomyosin, a contractile module that dates back to

4 stem eukaryotes (Brunet & Arendt 2016) and incorporated accessory proteins of pre-

5 metazoan origin (Steinmetz et al. 2012). Two fundamentally distinct types of myocytes

6 are distinguished based on ultrastructural appearance. In striated myocytes, actomyosin

7 myofibrils are organized in aligned repeated units (sarcomeres) separated by transverse

8 ‘Z discs’, while in smooth myocytes adjacent myofibrils show no clear alignment and are

9 separated by scattered “dense bodies” (Figure 1A). In vertebrates, striated myocytes are

10 found in voluntary skeletal muscles, but also at the anterior and posterior extremities of

11 the digestive tract (anterior esophagus muscles and external anal sphincter), and in the

12 muscular layer of the heart; smooth myocytes are found in involuntary visceral

13 musculature that ensures slow, long-range deformation of internal organs. This includes

14 the posterior esophagus and the rest of the gut, but also blood vessels, and most of the

15 urogenital system. In stark contrast, in the fruit fly Drosophila virtually all muscles are

16 striated, including gut visceral muscles (Anderson & Ellis 1967; Goldstein & Burdette

17 1971; Paniagua et al. 1996); the only exception are poorly-characterized multinucleated

18 smooth muscles around the testes (Susic-Jung et al. 2012). Also, in the nematode

19 Caenorhabditis, somatic muscles are striated, while the short intestine and rectum

20 visceral myocytes are only one sarcomere-long and thus hard to classify (White 1988;

21 Corsi et al. 2000).

3 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 The evolutionary origin of smooth versus striated myocytes in bilaterians accordingly

2 remains unsolved. Ultrastructural studies have consistently documented the presence of

3 striated somatic myocytes in virtually every bilaterian group (Schmidt-Rhaesa 2007) and

4 in line with this, the comparison of Z-disc proteins supports homology of striated

5 myocytes across bilaterians (Steinmetz et al. 2012). The origin of smooth myocyte types

6 however is less clear. Given the absence of smooth muscles from fly and nematode, it has

7 been proposed that visceral smooth myocytes represent a vertebrate novelty, which

8 evolved independently from non-muscle cells in the vertebrate stem line (Goodson &

9 Spudich 1993; OOta & Saitou 1999). However, smooth muscles are present in many

10 other bilaterian groups, suggesting instead their possible presence in urbilaterians and

11 secondary loss in arthropods and nematodes. Complicating the matter further,

12 intermediate ultrastructures between smooth and striated myocytes have been reported,

13 suggesting interconversions (reviewed in (Schmidt-Rhaesa 2007))

14 Besides ultrastructure, the comparative molecular characterization of cell types can be

15 used to build cell type trees (Arendt 2003; Arendt 2008; Wagner 2014; Musser & Wagner

16 2015). Cell type identity is established via the activity of transcription factors acting as

17 terminal selectors (Hobert 2016) and forming “core regulatory complexes” (CRCs;

18 (Arendt et al. 2016; Wagner 2014)), which directly activate downstream effector genes.

19 This is exemplified for vertebrate myocytes in Figure 1B. In all vertebrate myocytes,

20 transcription factors of the Myocardin family (MASTR in skeletal muscles, Myocardin in

21 smooth and cardiac muscles) directly activate effector genes encoding contractility

22 proteins (Fig. 1B) (Creemers et al. 2006; Meadows et al. 2008; Wang & Olson 2004;

23 Wang et al. 2003)). They heterodimerize with MADS-domain factors of the Myocyte

4 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 Enhancer Factor-2 (Mef2) (Black & Olson 1998; Blais et al. 2005; Molkentin et al. 1995;

2 Wales et al. 2014) and Serum Response Factor (SRF) families (Carson et al. 1996;

3 Nishida et al. 2002). Other myogenic transcription factors are specific for different types

4 of striated and smooth myocytes. Myogenic Regulatory Factors (MRF) family members,

5 including MyoD and its paralogs Myf5, Myogenin, and Mrf4/Myf6 (Shi & Garry 2006),

6 directly control contractility effector genes in skeletal (and esophageal) striated

7 myocytes, cooperatively with Mef2 (Blais et al. 2005; Molkentin et al. 1995) – but are

8 absent from smooth and cardiac muscles. In smooth and cardiac myocytes, this function

9 is ensured by NK transcription factors (Nkx3.2/Bapx and Nkx2.5/Tinman, respectively),

10 GATA4/5/6, and Fox transcription factors (FoxF1 and FoxC1, respectively), which bind

11 to SRF and Mef2 to form CRCs directly activating contractility effector genes (Durocher

12 et al. 1997; Hoggatt et al. 2013; Lee et al. 1998; Morin et al. 2000; Nishida et al. 2002;

13 Phiel et al. 2001) (Figure 1B).

14 Regarding effector proteins (Figure 1B), (Kierszenbaum & Tres 2015), all myocytes

15 express distinct isoforms of the myosin heavy chain: the striated myosin heavy chain ST-

16 MHC (which duplicated into cardiac, fast skeletal, and slow skeletal isoforms in

17 vertebrates) and the smooth/non-muscle myosin heavy chain SM-MHC (which duplicated

18 in vertebrates into smooth myh10, myh11 and myh14, and non-muscle myh9) (Steinmetz

19 et al. 2012). The different contraction speeds of smooth and striated muscles are due to

20 the distinct kinetic properties of these molecular motors (Bárány 1967). In both myocyte

21 types, contraction occurs in response to calcium, but the responsive proteins differ

22 (Alberts et al. 2014): the Troponin complex (composed of Troponin C, Troponin T and

23 Troponin I) for striated muscles, Calponin and Caldesmon for smooth muscles. In both

5 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 myocyte types, calcium also activates the Calmodulin/Myosin Light Chain Kinase

2 pathway (Kamm & Stull 1985; Sweeney et al. 1993). Striation itself is implemented by

3 specific effectors, including the long elastic protein Titin (Labeit & Kolmerer 1995)

4 (which spans the entire sarcomere and confers it elasticity and resistance) and

5 ZASP/LBD3 (Z-band Alternatively Spliced PDZ Motif/LIM-Binding Domain 3), which

6 binds actin and stabilizes sarcomeres during contraction (Au et al. 2004; Zhou et al.

7 2001). The molecular study of Drosophila and Caenorhabditis striated myocytes

8 revealed important commonalities with their vertebrate counterparts, including the

9 Troponin complex (Beall & Fyrberg 1991; Fyrberg et al. 1994; Fyrberg et al. 1990;

10 Marín et al. 2004; Myers et al. 1996), and a conserved role for Titin (Zhang et al. 2000)

11 and ZASP/LBD3 (Katzemich et al. 2011; McKeown et al. 2006) in the striated

12 architecture.

13 Finally, smooth and striated myocytes also differ physiologically. All known striated

14 myocyte types (apart from the myocardium) strictly depend on nervous stimulations for

15 contraction, exerted by innervating motor neurons. In contrast, gut smooth myocytes are

16 able to generate and propagate automatic (or “myogenic”) contraction waves responsible

17 for digestive peristalsis in the absence of nervous inputs (Faussone‐Pellegrini &

18 Thuneberg 1999; Sanders et al. 2006). These autonomous contraction waves are

19 modulated by the autonomic nervous system (Silverthorn 2015). Regarding overall

20 contraction speed, striated myocytes have been measured to contract 10 to 100 times

21 faster than their smooth counterparts (Bárány 1967).

22

6 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 To elucidate the evolutionary origin and diversification of bilaterian smooth and striated

2 myocytes, we provide an in-depth ultrastructural, molecular and functional

3 characterization of the myocyte complement in the marine annelid Platynereis dumerilii,

4 which belongs to the Lophotrochozoa. Strikingly, as of now, no invertebrate smooth

5 visceral muscle has been investigated on a molecular level (Hooper & Thuma 2005;

6 Hooper et al. 2008). Platynereis has retained more ancestral features than flies or

7 nematodes and is thus especially suited for long-range comparisons (Raible et al. 2005;

8 Denes et al. 2007). Also, other annelids such as earthworms have been reported to

9 possess both striated somatic and midgut smooth visceral myocytes based on electron

10 microscopy (Anderson & Ellis 1967). Our study reveals the parallel presence of smooth

11 myocytes in the musculature of midgut, hindgut, and pulsatile dorsal vessel and of

12 striated myocytes in the somatic musculature and the foregut. Platynereis smooth and

13 striated myocytes closely parallel their vertebrate counterparts in ultrastructure, molecular

14 profile, contraction speed, and reliance on nervous inputs, thus supporting the ancient

15 existence of a smooth-striated duality in protostome/deuterostome ancestors.

16

17

18 Results

19 Platynereis midgut and hindgut muscles are smooth, while foregut and somatic muscles

20 are striated

21 Differentiation of the Platynereis somatic musculature has been documented in much

22 detail (Fischer et al. 2010) and, in five days old young worms, consists of ventral and

23 dorsal longitudinal muscles, oblique and parapodial muscles, head muscles and the

7 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 axochord (Lauri et al. 2014). At this stage, the first Platynereis visceral myocytes become

2 detectable around the developing tripartite gut, which is subdivided into foregut, midgut

3 and hindgut (based on the conserved regional expression of foxA, brachyury and hnf4 gut

4 specification factors (Martín-Durán & Hejnol 2015); Figure 2-supplement 1). At 7 days

5 post fertilization (dpf), visceral myocytes form circular myofibres around the foregut, and

6 scattered longitudinal and circular fibres around midgut and hindgut (Figure 2A), which

7 expand by continuous addition of circular and longitudinal fibres to completely cover the

8 dorsal midgut at 11dpf (Figure 2A) and finally form a continuous muscular orthogon

9 around the entire midgut and hindgut in the 1.5 months-old juvenile (Figure 2A).

10 We then proceeded to characterize the ultrastructure of Platynereis visceral and somatic

11 musculature by transmission electron microscopy (Figure 2C-M). All somatic muscles

12 and anterior foregut muscles display prominent oblique striation with discontinuous Z-

13 elements (Figure 2C-H; compare Figure 1A), as typical for protostomes (Burr & Gans

14 1998; Mill & Knapp 1970; Rosenbluth 1972). To the contrary, visceral muscles of the

15 posterior foregut, midgut and hindgut are smooth with scattered dense bodies (Figure 2I-

16 M). The visceral muscular orthogon is partitioned into an external longitudinal layer and

17 an internal circular layer (Figure 2J), as in vertebrates (Marieb & Hoehn 2015) and

18 arthropods (Lee et al. 2006). Thus, according to ultrastructural appearance, Platynereis

19 has both somatic (and anterior foregut) striated muscles and visceral smooth muscles.

20 The molecular profile of smooth and striated myocytes

21 We then set out to molecularly characterize annelid smooth and striated myocytes via a

22 candidate gene approach. As a starting point, we investigated, in the Platynereis genome,

23 the presence of regulatory and effector genes specific for smooth and/or striated

8 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 myocytes in the vertebrates. We found striated muscle-specific and smooth muscle/non-

2 muscle isoforms of both myosin heavy chain (consistently with published phylogenies

3 (Steinmetz et al. 2012)) and myosin regulatory light chain. We also identified homologs

4 of genes encoding calcium transducers (calponin for smooth muscles; troponin I and

5 troponin T for striated muscles), striation structural proteins (zasp/lbd3 and titin), and

6 terminal selectors for the smooth (nk3, foxF, and gata456) and striated phenotypes

7 (myoD).

8 We investigated expression of these markers by whole-mount in situ hybridization

9 (WMISH). Striated effectors are expressed in both somatic and foregut musculature

10 (Figure 3A,C; Figure 3—supplement 1). Expression of all striated effectors was observed

11 in every somatic myocyte group by confocal imaging with cellular resolution (Figure 3—

12 supplement 2). Interestingly, myoD is exclusively expressed in longitudinal striated

13 muscles, but not in other muscle groups (Figure 3—supplement 2).

14 The expression of smooth markers is first detectable at 3 dpf in a small triangle-shaped

15 group of mesodermal cells posteriorly abutting the macromeres (which will form the

16 future gut) (Figure 3B, Figure 3—supplement 3A-D,H). Double WMISH shows that

17 these cells coexpress smooth markers and the muscle marker actin (Figure 3—

18 supplement 3I-K), supporting the idea that they are forming gut myocytes. At this stage,

19 smooth markers are also expressed in the foregut mesoderm (Figure 3B, Figure 3—

20 supplement 3A-D,H, yellow arrows). At 6 dpf, expression of all smooth markers (apart

21 from nk3) is maintained in the midgut and hindgut differentiating myocytes (Figure 3D,

22 Figure 3—supplement 3E-G, Figure 3—supplement 4A-E) but smooth effectors

23 disappear from the foregut, which turns on striated markers instead (Figure 3—

9 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 supplement 1R-W) – reminiscent of the replacement of smooth fibres by striated fibres

2 during development of the vertebrate anterior esophageal muscles (Gopalakrishnan et al.

3 2015). Finally, in 2 months-old juvenile worms, smooth markers are also detected in the

4 dorsal pulsatile vessel (Figure 3—supplement 3L-Q) – considered equivalent to the

5 vertebrate heart (Saudemont et al. 2008) but, importantly, of smooth ultrastructure in

6 polychaetes (Spies 1973; Jensen 1974). None of the striated markers is expressed around

7 the midgut or the hindgut (Figure 3—supplement 4F-K), or in the dorsal vessel (Figure

8 3—supplement 3P). Taken together, these results strongly support conservation of the

9 molecular fingerprint of both smooth and striated myocytes between annelids and

10 vertebrates.

11 We finally investigated general muscle markers that are shared between smooth and

12 striated muscles. These include actin, mef2 and myocardin – which duplicated into

13 muscle type-specific paralogs in vertebrates, but are still present as single-copy genes in

14 Platynereis. We found them to be expressed in the forming musculature throughout larval

15 development (Figure 3—supplement 5A-F), and confocal imaging at 6 dpf confirmed

16 expression of all 3 markers in both visceral (Figure 3—supplement 5G-L) and somatic

17 muscles (Figure 3—supplement 5M).

18 Smooth and striated muscles differ in contraction speed

19 We then characterized the contraction speed of the two myocyte types in Platynereis by

20 measuring myofibre length before and after contraction. Live confocal imaging of

21 contractions in Platynereis larvae with fluorescently labeled musculature (Movie 1,

22 Movie 2) gave a striated contraction rate of 0.55±0.27 s-1 (Figure 4A-E) and a smooth

23 myocyte contraction rate of 0.07±0.05 s-1 (Figure 4G). As in vertebrates, annelid striated

10 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 myocytes thus contract nearly one order of magnitude faster than smooth myocytes

2 (Figure 4F).

3 Striated, but not smooth, muscle contraction depends on nervous inputs

4 Finally, we investigated the nervous control of contraction of both types of muscle cells.

5 In vertebrates, somatic muscle contraction is strictly dependent on neuronal inputs. By

6 contrast, gut peristalsis is automatic (or myogenic – i.e., does not require nervous inputs)

7 in vertebrates, cockroaches (Nagai & Brown 1969), squids (Wood 1969), snails (Roach

8 1968), holothurians, and sea urchins (Prosser et al. 1965). The only exceptions appear to

9 be bivalves and malacostracans (crabs, lobster and crayfish), in which gut motility is

10 neurogenic (Prosser et al. 1965). Regardless of the existence of an automatic component,

11 the gut is usually innervated by nervous fibres modulating peristalsis movements (Wood

12 1969; Wu 1939).

13 Gut peristalsis takes place in Platynereis larvae and juveniles from 6 dpf onwards (Movie

14 3), and we set out to test whether nervous inputs were necessary for it to take place. We

15 treated 2 months-old juveniles with 180 µM Brefeldin A, an inhibitor of vesicular traffic

16 which prevents polarized secretion (Misumi et al. 1986) and neurotransmission (Malo et

17 al. 2000). Treatment stopped locomotion in all treated individuals, confirming that

18 neurotransmitter release by motor neurons is required for somatic muscles contraction,

19 while DMSO-treated controls were unaffected. On the other hand, vigorous gut

20 peristalsis movements were maintained in Brefeldin A-treated animals (Movie 4).

21 Quantification of the propagation speed of the peristalsis wave (Figure 5A-D; see

22 Material and Methods) indicated that contractions propagated significantly faster in

23 Brefeldin A-treated individuals than in controls. The frequency of wave initiation and

11 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 their recurrence (the number of repeated contraction waves occurring in one

2 uninterrupted sequence) did not differ significantly in Brefeldin A-treated animals

3 (Figure 5E,F). These results indicate that, as in vertebrates, visceral smooth muscle

4 contraction and gut peristalsis do not require nervous (or secretory) inputs in Platynereis.

5 An enteric nervous system is present in Platynereis

6 In vertebrates, peristaltic contraction waves are initiated by self-excitable myocytes

7 (Interstitial Cajal Cells) and propagate across other smooth muscles by gap junctions

8 ensuring direct electrical coupling (Faussone‐Pellegrini & Thuneberg 1999; Sanders et

9 al. 2006). We tested the role of gap junctions in Platynereis gut peristalsis by treating

10 animals with 2.5 mM 2-octanol, which inhibits gap junction function in both insects

11 (Bohrmann & Haas-Assenbaum 1993; Gho 1994) and vertebrates (Finkbeiner 1992). 2-

12 octanol abolishes gut peristalsis, both in the absence and in the presence of Brefeldin A

13 (Figure 5G), indicating that propagation of the peristalsis wave relies on direct coupling

14 between smooth myocytes via gap junctions.

15 The acceleration of peristalsis upon Brefeldin A treatment suggests that secretory (and

16 possibly neural) inputs modulate gut contractions (with a net inhibitory effect). We thus

17 investigated the innervation of the Platynereis gut. Immunostainings of juvenile worms

18 for acetylated tubulin revealed a dense, near-orthogonal nerve net around the entire gut

19 (Figure 6A), which is tightly apposed to the visceral muscle layer (Figure 6C) and

20 includes serotonergic neurites (Figure 6B,C) and cell bodies (Figure 6D). Interestingly,

21 some enteric serotonergic cell bodies are devoid of neurites, thus resembling the

22 vertebrate (non-neuronal) enterochromaffine cells – endocrine serotonergic cells residing

12 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 around the gut and activating gut peristalsis by direct serotonin secretion upon

2 mechanical stretch (Bulbring & Crema 1959).

3 Discussion

4 Smooth and striated myocyte coexisted in bilaterian ancestors

5 Our study represents the first molecular characterization of protostome visceral smooth

6 musculature (Hooper & Thuma 2005; Hooper et al. 2008). The conservation of molecular

7 signatures for both smooth and striated myocytes indicates that a dual musculature

8 already existed in bilaterian ancestors: a fast striated somatic musculature (possibly also

9 present around the foregut – as in Platynereis, vertebrates (Gopalakrishnan et al. 2015)

10 and sea urchins (Andrikou et al. 2013; Burke 1981)), under strict nervous control; and a

11 slow smooth visceral musculature around the midgut and hindgut, able to undergo

12 automatic peristalsis thanks to self-excitable myocytes directly coupled by gap junctions,

13 and undergoing modulation by nervous and paracrine inputs. In striated myocytes, a core

14 regulatory complex (CRC) involving Mef2 and Myocardin directly activated striated

15 contractile effector genes such as ST-MHC, ST-MRLC and the Troponin genes (Figure

16 7—supplement 1). Notably, myoD might have been part of the CRC in only part of the

17 striated myocytes, as it is only detected in longitudinal muscles in Platynereis. The

18 absence of myoD expression in other annelid muscle groups is in line with the “chordate

19 bottleneck” concept (Thor & Thomas 2002), according to which specialization for

20 undulatory swimming during early chordate evolution would have fostered exclusive

21 reliance on trunk longitudinal muscles, and loss of other muscle types. In smooth

22 myocytes, a CRC composed of NK3, FoxF and GATA4/5/6 together with Mef2 and

13 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 Myocardin activated the smooth contractile effectors SM-MHC, SM-MRLC and calponin

2 (Figure 7—supplement 1). In spite of their absence in flies and nematodes, gut myocytes

3 of smooth ultrastructure are widespread in other bilaterians, and an ancestral state

4 reconstruction retrieves them as present in the last common protostome/deuterostome

5 ancestor with high confidence (Figure 7—supplement 2), supporting our homology

6 hypothesis. Our results are consistent with previous reports of Calponin

7 immunoreactivity in intestinal muscles of earthworms (Royuela et al. 1997) and snails

8 (which also lack immunoreactivity for Troponin T) (Royuela et al. 2000).

9

10 Origin of smooth and striated myocytes by cell type individuation

11 How did smooth and striated myocytes diverge in evolution? Figure 7 presents a

12 comprehensive cell type tree for the evolution of myocytes, with a focus on Bilateria.

13 This tree illustrates the divergence of the two muscle cell types by progressive

14 partitioning of genetic information in evolution – a process called individuation (Wagner

15 2014; Arendt et al. 2016). The individuation of fast and slow contractile cells involved

16 two complementary processes: (1) changes in CRC (black circles, Figure 7) and (2)

17 emergence of novel genes encoding new cellular modules, or apomeres (Arendt et al.

18 2016) (grey squares, Figure 7).

19 Around a common core formed by the Myocardin:Mef2 complex (both representing

20 transcription factors of pre-metazoan ancestry (Steinmetz et al. 2012)), smooth and

21 striated CRCs incorporated different transcription factors implementing the expression of

22 distinct effectors (Figure 1B; Figure 7—supplement 1) – notably the bilaterian-specific

14 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 bHLH factor MyoD (Steinmetz et al. 2012) and GATA4/5/6, which arose by bilaterian-

2 specific duplication of a single ancient pan-endomesodermal GATA transcription factor

3 (Martindale et al. 2004; Leininger et al. 2014).

4 Regarding the evolution of myocyte-specific apomeres, one prominent mechanism of

5 divergence has been gene duplications. While the MHC duplication predated metazoans,

6 other smooth and striated-specific paralogs only diverged in bilaterians. Smooth and

7 striated MRLC most likely arose by gene duplication in the bilaterian stem-line

8 (Supplementary Figure 1). Myosin essential light chain, actin and myocardin paralogs

9 split even later, in the vertebrate stem-line (Figure 7). Similarly, smooth and non-muscle

10 mhc and mrlc paralogs only diverged in vertebrates. The calponin-encoding gene

11 underwent parallel duplication and subfunctionalization in both annelids and chordates,

12 giving rise to both specialized smooth muscle paralogs and more broadly expressed

13 copies with a different domain structure (Figure 7—supplement 3). This slow and

14 stepwise nature of the individuation process is consistent with studies showing that

15 recently evolved paralogs can acquire differential expression between tissues that

16 diverged long before in evolution (Force et al. 1999; Lan & Pritchard 2016).

17 Complementing gene duplication, the evolution and selective expression of entirely new

18 apomeres also supported individuation: for example, Titin and all components of the

19 Troponin complex are bilaterian novelties (Steinmetz et al. 2012). In vertebrates, the new

20 gene caldesmon was incorporated in the smooth contractile module (Steinmetz et al.

21 2012).

22

15 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 Smooth to striated myocyte conversion

2 Strikingly, visceral smooth myocytes were previously assumed to be a vertebrate

3 innovation, as they are absent in fruit flies and nematodes (two groups which are in fact

4 exceptions in this respect, at least from ultrastructural criteria (Figure 7—supplement

5 2A)). This view received apparent support from the fact that the vertebrate smooth and

6 non-muscle myosin heavy chains (MHC) arose by vertebrate-specific duplication of a

7 unique ancestral bilaterian gene, orthologous to Drosophila non-muscle MHC (Goodson

8 & Spudich 1993) – which our results suggest reflects instead gradual individuation of

9 pre-existing cell types (see above). Strikingly, the striated gut muscles of Drosophila

10 closely resemble vertebrate and annelid smooth gut muscles by transcription factors

11 (nk3/bagpipe (Azpiazu & Frasch 1993), foxF/biniou (Jakobsen et al. 2007a; Zaffran et al.

12 2001)), even though they express the fast/striated contractility module (Fyrberg et al.

13 1994; Fyrberg et al. 1990; Marín et al. 2004). If smooth gut muscles are ancestral for

14 protostomes, as our results indicate, this suggests that the smooth contractile module was

15 replaced by the fast/striated module in visceral myocytes during insect evolution.

16 Interestingly, chromatin immunoprecipitation assays (Jakobsen et al. 2007a) show that

17 the conserved visceral transcription factors foxF/biniou and nk3/bagpipe do not directly

18 control contractility genes in Drosophila gut muscles (which are downstream mef2

19 instead), but establish the morphogenesis and innervation of the visceral muscles, and

20 control non-contractile effectors such as gap junctions – which are the properties these

21 muscles seem to have conserved from their smooth ancestors. The striated gut myocytes

22 of insects would thus represent a case of co-option of an effector module from another

16 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 cell type, which happened at an unknown time during ecdysozoan evolution (Figure 7;

2 Figure 7—supplement 1).

3 Another likely example of co-option is the vertebrate heart: vertebrate cardiomyocytes

4 are striated and express fast myosin and troponin, but resemble smooth myocytes by

5 developmental origin (from the splanchnopleura), function (automatic contraction and

6 coupling by gap junctions) and terminal selector profile (Figure 1B). These similarities

7 suggest that cardiomyocytes might stem from smooth myocytes that likewise co-opted

8 the fast/striation module. Indicative of this possible ancestral state, the Platynereis dorsal

9 pulsatile vessel (considered homologous to the vertebrate heart based on comparative

10 anatomy and shared expression of NK4/tinman (Saudemont et al. 2008)) expresses the

11 smooth, but not the striated, myosin heavy chain (Figure 3—supplement 3O-Q). An

12 ancestral state reconstruction based on ultrastructural data further supports the notion that

13 heart myocytes were smooth in the last common protostome/deuterostome ancestor, and

14 independently acquired striation in at least 5 descendant lineages (Figure 7—supplement

15 2B) – usually in species with large body size and/or fast metabolism.

16

17 Striated to smooth conversions

18 Smooth somatic muscles are occasionally found in bilaterians with slow or sessile

19 lifestyles – for example in the snail foot (Faccioni-Heuser et al. 1999; Rogers 1969), the

20 ascidian siphon (Meedel & Hastings 1993), and the sea cucumber body wall (Kawaguti &

21 Ikemoto 1965). As an extreme (and isolated) example, flatworms lost striated muscles

22 altogether, and their body wall musculature is entirely smooth (Rieger et al. 1991).

17 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 Interestingly, in all cases that have been molecularly characterized, smooth somatic

2 muscles express the same fast contractility module as their striated counterparts,

3 including ST-MHC and the Troponin complex – in ascidians (Endo & Obinata 1981;

4 Obinata et al. 1983), flatworms (Kobayashi et al. 1998; Witchley et al. 2013; Sulbarán et

5 al. 2015), and the smooth myofibres of the bivalve catch muscle (Nyitray et al. 1994;

6 Ojima & Nishita 1986). (It is unknown whether these also express zasp and titin in spite

7 of the lack of striation). This suggests that these are somatic muscles having secondarily

8 lost striation (in line with the sessile lifestyle of ascidians and bivalves, and with the

9 complete loss of striated muscles in flatworms). Alternatively, they might represent

10 remnants of ancestral smooth somatic fibres that would have coexisted alongside striated

11 somatic fibres in the last common protostome/deuterostome ancestor. Interestingly, the

12 fast contractile module is also expressed in acoel body wall smooth muscles (Chiodin et

13 al. 2011); since acoels belong to a clade that might have branched off before all other

14 bilaterians (Cannon et al. 2016) (but see (Telford & Copley 2016)), these could represent

15 fast-contracting myocytes that never evolved striation in the first place, similar to those

16 found in cnidarians. In all cases, the fast contractility module appears to represent a

17 consistent synexpression group (i.e. its components are reliably expressed together), and

18 a stable molecular profile of all bilaterian somatic muscles, regardless of the presence of

19 morphologically overt striation. This confirms the notion that, even in cases of

20 ambiguous morphology or ultrastructure, the molecular fingerprint of cell types holds

21 clue to their evolutionary affinities.

18 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 Implications for cell type evolution

2 In the above, genetically well-documented cases of cell type conversion (smooth to

3 striated conversion in insect visceral myocytes and vertebrate cardiomyocytes), cells kept

4 their ancestral CRC of terminal selector transcription factors, while changing the

5 downstream effector modules. This supports the recent notion that CRCs confer an

6 abstract identity to cell types, which remains stable in spite of turnover in downstream

7 effectors (Wagner 2014) – just as hox genes impart conserved abstract identity to

8 segments of vastly diverging morphologies (Deutsch 2005). Tracking cell type-specific

9 CRCs through animal phylogeny thus represents a powerful means to decipher the

10 evolution of cell types.

11 Pre-bilaterian origins

12 If the existence of fast-contracting striated and slow-contracting smooth myocytes

13 predated bilaterians – when and how did these cell types first split in evolution? The first

14 evolutionary event that paved the way for the diversification of the smooth and striated

15 contractility modules was the duplication of the striated myosin heavy chain-encoding

16 gene into the striated isoform ST-MHC and the smooth/non-muscle isoform SM-MHC.

17 This duplication occurred in single-celled ancestors of animals, before the divergence of

18 filastereans and choanoflagellates (Steinmetz et al. 2012). Consistently, both sm-mhc and

19 st-mhc are present in the genome of the filasterean Ministeria (though st-mhc was lost in

20 other single-celled holozoans) (Sebé-Pedrós et al. 2014). Interestingly, st-mhc and sm-

21 mhc expression appears to be segregated into distinct cell types in sponges, cnidarians

22 (Steinmetz et al. 2012), and ctenophores (Dayraud et al. 2012), suggesting that a cell type

19 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 split between slow and fast contractile cells is a common feature across early-branching

2 metazoans (Figure 7). Given the possibility of MHC isoform co-option (as outlined

3 above), it is yet unclear whether this split happened once or several times. The affinities

4 of bilaterians and non-bilaterians contractile cells remain to be tested from data on the

5 CRCs establishing contractile cell types in non-bilaterians.

6

7 Conclusions

8 Our results indicate that the split between visceral smooth myocytes and somatic striated

9 myocytes is the result of a long individuation process, initiated before the last common

10 protostome/deuterostome ancestor. Fast- and slow-contracting cells expressing distinct

11 variants of myosin II heavy chain (ST-MHC versus SM-MHC) acquired increasingly

12 contrasted molecular profiles in a gradual fashion – and this divergence process continues

13 to this day in individual bilaterian phyla. Blurring this picture of divergence, co-option

14 events have led to the replacement of the slow contractile module by the fast one, leading

15 to smooth-to-striated myocyte conversions. Our study showcases the power of molecular

16 fingerprint comparisons centering on effector and selector genes to reconstruct cell type

17 evolution (Arendt 2008). In the bifurcating phylogenetic tree of animal cell types (Liang

18 et al. 2015), it remains an open question how the two types of contractile cells relate to

19 other cell types, such as neurons (Mackie 1970) or cartilage (Lauri et al. 2014).

20

21

22

20 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 Material and Methods

2

3 Immunostainings and in situ hybridizations

4 Immunostaining, rhodamine-phalloidin staining, and simple and double WMISH were

5 performed according to previously published protocols (Lauri et al. 2014). For all

6 stainings not involving phalloidin, the following modifications: animals were mounted in

7 97% TDE/3% PTw for imaging following (Asadulina et al. 2012). Phalloidin-stained

8 larvae were mounted in 1% DABCO/glycerol instead, as TDE was found to quickly

9 disrupt phalloidin binding to F-actin. Confocal imaging of stained larvae was performed

10 using a Leica SPE and a Leica SP8 microscope. Stacks were visualized and processed

11 with ImageJ 1.49v. 3D renderings were performed with Imaris 8.1. Bright field Nomarski

12 microscopy was performed on a Zeiss M1 microscope. Z-projections of Nomarski stacks

13 were performed using Helicon Focus 6.7.1.

14

15 Transmission electron microscopy

16 TEM was performed as previously published (Lauri et al. 2014).

17

18 Pharmacological treatments

19 Brefeldin A was purchased from Sigma Aldrich (B7561) and dissolved in DMSO to a

20 final concentration of 5 mg/mL. Animals were treated with 50 µg/mL Brefeldin A in 6-

21 well plates filled with 5 mL filtered natural sea water (FNSW). Controls were treated

22 with 1% DMSO (which is compatible with Platynereis development and survival without

23 noticeable effect). Other neurotransmission inhibitors had no effect on Platynereis (as

21 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 they elicited no impairment of locomotion): tetanus toxic (Sigma Aldrich T3194; 100

2 µg/mL stock in distilled water) up to 5 µg/mL; TTX (Latoxan, L8503; 1 mM stock) up to

3 10 µM; Myobloc (rimabotulinum toxin B; Solstice Neurosciences) up to 1%; saxitoxin 2

4 HCl (Sigma Aldrich NRCCRMSTXF) up to 1%; and neosaxitoxin HCl (Sigma Aldrich

5 NRCCRMNEOC) up to 1%. (±)-2-Octanol was purchased from Sigma Aldrich and

6 diluted to a final concentration of 2.5 mM (2 µL in 5 mL FNSW). (±)-2-Octanol

7 treatment inhibited both locomotion and gut peristalsis, in line with the importance of gap

8 junctions in motor neural circuits (Kawano et al. 2011; Kiehn & Tresch 2002).

9

10

11 Live imaging of contractions

12

13 Animals were mounted in 3% low melting point agarose in FNSW (2-

14 Hydroxyethylagarose, Sigma Aldrich A9414) between a slide and a cover slip (using 5

15 layers of adhesive tape for spacing) and imaged with a Leica SP8 confocal microscope.

16 Fluorescent labeling of musculature was achieved either by microinjection of mRNAs

17 encoding GCaMP6s, LifeAct-EGFP or H2B-RFP, or by incubation in 3 µM 0.1% FM-

18 464FX (ThermoFisher Scientific, F34653). Contraction speed was calculated as (l2-

19 l1)/(l1*t), where l1 is the initial length, l2 the length after contraction, and t the duration

20 of the contraction. Kymographs and wave speed quantifications were performed with the

21 ImageJ Kymograph plugin: http://www.embl.de/eamnet/html/kymograph.html

22

23

22 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 Ancestral state reconstruction

2 Ancestral state reconstructions were performed with Mesquite 3.04 using the Maximum

3 Likelihood and Parsimony methods.

4

5 Cloning

6 The following primers were used for cloning Platynereis genes using a mixed stages

7 Platynereis cDNA library (obtained from 1, 2, 3, 5, 6, 10, and 14-days old larvae) and

8 either the HotStart Taq Polymerase from Qiagen or the Phusion polymerase from New

9 England BioLabs (for GC-rich primers):

10

Gene name Forward primer Reverse primer

foxF CCCAGTGTCTGCATCCTTGT CATGGGCATTGAAGGGGAGT

zasp CATACCAGCCATCCCGTCC AAATCAGCGAACTCCAGCGT

troponin T TTCTGCAGGGCGCAAAGTCA CGCTGCTGTTCCTTGAAGCG

SM-MRLC TGGTGTTTGCAGGGCGGTCA GGTCCATACCGTTACGGAAGCTTTT

calponin ACGTGCGGTTTACGATTGGA GCTGGCTCCTTGGTTTGTTC

transgelin1 GCTGCCAAGGGAGCTGACGC ACAAAGAGCTTGTACCACCTCACCC

myocardin GACACCAGTCCGAAGCTTGA CGTGGTAGTAGTCGTGGTCG

11

12

13 The following genes were retrieved from an EST plasmid stock: SM-MHC (as two

14 independent clones that gave identical expression patterns) and ST-MRLC.

23 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 Other genes were previously published: NK3 (Saudemont et al. 2008), actin and ST-MHC

2 (under the name mhc1-4) (Lauri et al. 2014) and GATA456 (Gillis et al. 2007).

3 Acknowledgements

4

5 We thank Kaia Achim for the hnf4 plasmid, Pedro Machado (Electron Microscopy Core

6 Facility, EMBL Heidelberg) for embedding and sectioning samples for TEM, and the

7 Arendt lab for feedback on the project. The work was supported by the European

8 Research Council “Brain Evo-Devo” grant (TB, PB and DA), European Union’s Seventh

9 Framework Programme project “Evolution of gene regulatory networks in animal

10 development (EVONET)” [215781-2] (AL), the Zoonet EU-Marie Curie early training

11 network [005624] (AF), the European Molecular Biology Laboratory (AL, AHLF, and

12 PRHS) and the EMBL International Ph.D. Programme (TB, AHLF, PRHS, AL).

13

14

15

24 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 References

2 Alberts, B. et al., 2014. Molecular Biology of the Cell 6 edition., New York, NY: Garland Science. 3 Anderson, W.A. & Ellis, R.A., 1967. A comparative electron microscope study of visceral muscle fibers in 4 Cambarus, Drosophila and Lumbricus. Zeitschrift für Zellforschung und Mikroskopische 5 Anatomie, 79(4), pp.581–591. 6 Andrikou, C. et al., 2013. Myogenesis in the sea urchin embryo: the molecular fingerprint of the myoblast 7 precursors. EvoDevo, 4(1), p.33. 8 Arendt, D., 2003. Evolution of eyes and photoreceptor cell types. International Journal of Developmental 9 Biology, 47(7/8), pp.563–572. 10 Arendt, D. et al., 2016. Evolution of sister cell types by individuation. Nature Reviews Genetics, submitted. 11 Arendt, D., 2008. The evolution of cell types in animals: emerging principles from molecular studies. 12 Nature Reviews. Genetics, 9(11), pp.868–882. 13 Asadulina, A. et al., 2012. Whole-body gene expression pattern registration in Platynereis larvae. EvoDevo, 14 3, p.27. 15 Au, Y. et al., 2004. Solution Structure of ZASP PDZ Domain: Implications for Sarcomere Ultrastructure 16 and Enigma Family Redundancy. Structure, 12(4), pp.611–622. 17 Ayme-Southgate, A. et al., 1989. Characterization of the gene for mp20: a Drosophila muscle protein that is 18 not found in asynchronous oscillatory flight muscle. The Journal of cell biology, 108(2), pp.521– 19 531. 20 Azpiazu, N. & Frasch, M., 1993. tinman and bagpipe: two homeo box genes that determine cell fates in the 21 dorsal mesoderm of Drosophila. Genes & Development, 7(7b), pp.1325–1340. 22 Bárány, M., 1967. ATPase activity of myosin correlated with speed of muscle shortening. The Journal of 23 general physiology, 50(6), pp.197–218. 24 Beall, C.J. & Fyrberg, E., 1991. Muscle abnormalities in Drosophila melanogaster heldup mutants are 25 caused by missing or aberrant troponin-I isoforms. The Journal of Cell Biology, 114(5), pp.941– 26 951. 27 Black, B.L. & Olson, E.N., 1998. Transcriptional control of muscle development by myocyte enhancer 28 factor-2 (MEF2) proteins. Annual Review of Cell and Developmental Biology, 14, pp.167–196. 29 Blais, A. et al., 2005. An initial blueprint for myogenic differentiation. Genes & Development, 19(5), 30 pp.553–569. 31 Bohrmann, J. & Haas-Assenbaum, A., 1993. Gap junctions in ovarian follicles of Drosophila melanogaster: 32 inhibition and promotion of dye-coupling between oocyte and follicle cells. Cell and Tissue 33 Research, 273(1), pp.163–173. 34 Brunet, T. & Arendt, D., 2016. From damage response to action potentials: early evolution of neural and 35 contractile modules in stem eukaryotes. Philosophical Transactions of the Royal Society of 36 London. Series B, Biological Sciences, 371(1685), p.20150043. 37 Bulbring, E. & Crema, A., 1959. The release of 5-hydroxytryptamine in relation to pressure exerted on the 38 intestinal mucosa. The Journal of Physiology, 146(1), pp.18–28. 39 Burke, R.D., 1981. Structure of the digestive tract of the pluteus larva of Dendraster excentricus 40 (Echinodermata: Echinoida). Zoomorphology, 98(3), pp.209–225. 41 Burr, A. & Gans, C., 1998. Mechanical Significance of Obliquely Striated Architecture in Nematode 42 Muscle. The Biological Bulletin, 194(1), pp.1–6. 43 Cannon, J.T. et al., 2016. Xenacoelomorpha is the sister group to Nephrozoa. Nature, 530(7588), pp.89–93. 44 Carnevali, M.D.C. & Ferraguti, M., 1979. Structure and ultrastructure of muscles in the priapulid 45 Halicryptus spinulosus: functional and phylogenetic remarks. Journal of the Marine Biological 46 Association of the United Kingdom, 59(3), pp.737–748. 47 Carson, J.A., Schwartz, R.J. & Booth, F.W., 1996. SRF and TEF-1 control of chicken skeletal alpha-actin 48 gene during slow-muscle hypertrophy. American Journal of Physiology - Cell Physiology, 270(6), 49 pp.C1624–C1633. 50 Chiodin, M. et al., 2011. Molecular architecture of muscles in an acoel and its evolutionary implications. 51 Journal of Experimental Zoology Part B: Molecular and Developmental Evolution, 316B(6), 52 pp.427–439. 53 Corsi, A.K. et al., 2000. Caenorhabditis elegans twist plays an essential role in non-striated muscle 54 development. Development, 127(10), pp.2041–2051.

25 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 Creemers, E.E. et al., 2006. Coactivation of MEF2 by the SAP Domain Proteins Myocardin and MASTR. 2 Molecular Cell, 23(1), pp.83–96. 3 Dayraud, C. et al., 2012. Independent specialisation of myosin II paralogues in muscle vs. non-muscle 4 functions during early animal evolution: a ctenophore perspective. BMC evolutionary biology, 5 12(1), p.107. 6 Denes, A.S. et al., 2007. Molecular architecture of annelid nerve cord supports common origin of nervous 7 system centralization in bilateria. Cell, 129(2), pp.277–288. 8 Deutsch, J., 2005. Hox and wings. BioEssays: News and Reviews in Molecular, Cellular and 9 Developmental Biology, 27(7), pp.673–675. 10 Durocher, D. et al., 1997. The cardiac transcription factors Nkx2-5 and GATA-4 are mutual cofactors. The 11 EMBO journal, 16(18), pp.5687–5696. 12 Duvert, M. & Salat, C., 1995. Ultrastructural Studies of the Visceral Muscles of Chaetognaths. Acta 13 Zoologica, 76(1), pp.75–87. 14 Endo, T. & Obinata, T., 1981. Troponin and Its Components from Ascidian Smooth Muscle. Journal of 15 Biochemistry, 89(5), pp.1599–1608. 16 Faccioni-Heuser, M.C. et al., 1999. The pedal muscle of the land snail Megalobulimus oblongus 17 (Gastropoda, Pulmonata): an ultrastructure approach. Acta Zoologica, 80(4), pp.325–337. 18 Faussone‐Pellegrini, M.-S. & Thuneberg, L., 1999. Guide to the identification of interstitial cells of Cajal. 19 Microscopy research and technique, 47(4), pp.248–266. 20 Feral, J.-P. & Massin, C., 1982. Digestive systems: Holothuroidea. Echinoderm nutrition, pp.191–212. 21 Finkbeiner, S., 1992. Calcium waves in astrocytes-filling in the gaps. Neuron, 8(6), pp.1101–1108. 22 Fischer, A.H., Henrich, T. & Arendt, D., 2010. The normal development of Platynereis dumerilii 23 (Nereididae, Annelida). Frontiers in zoology, 7(1), p.1. 24 Force, A. et al., 1999. Preservation of Duplicate Genes by Complementary, Degenerative Mutations. 25 Genetics, 151(4), pp.1531–1545. 26 Francés, R. et al., 2006. B-1 cells express transgelin 2: unexpected lymphocyte expression of a smooth 27 muscle protein identified by proteomic analysis of peritoneal B-1 cells. Molecular immunology, 28 43(13), pp.2124–2129. 29 Fyrberg, C. et al., 1994. Drosophila melanogaster genes encoding three troponin-C isoforms and a 30 calmodulin-related protein. Biochemical Genetics, 32(3–4), pp.119–135. 31 Fyrberg, E. et al., 1990. Drosophila melanogaster troponin-T mutations engender three distinct syndromes 32 of myofibrillar abnormalities. Journal of Molecular Biology, 216(3), pp.657–675. 33 Genikhovich, G. & Technau, U., 2011. Complex functions of Mef2 splice variants in the differentiation of 34 endoderm and of a neuronal cell type in a sea anemone. Development, 138(22), pp.4911–4919. 35 Gho, M., 1994. Voltage-clamp analysis of gap junctions between embryonic muscles in Drosophila. The 36 Journal of Physiology, 481(Pt 2), pp.371–383. 37 Gillis, W.J., Bowerman, B. & Schneider, S.Q., 2007. Ectoderm‐and endomesoderm‐specific GATA 38 transcription factors in the marine annelid Platynereis dumerilli. Evolution & development, 9(1), 39 pp.39–50. 40 Gimona, M. et al., 2003. Calponin repeats regulate actin filament stability and formation of podosomes in 41 smooth muscle cells. Molecular biology of the cell, 14(6), pp.2482–2491. 42 Goldstein, M.A. & Burdette, W.J., 1971. Striated visceral muscle of Drosophila melanogaster. Journal of 43 Morphology, 134(3), pp.315–334. 44 Goodson, H.V. & Spudich, J.A., 1993. Molecular evolution of the myosin family: relationships derived 45 from comparisons of amino acid sequences. Proceedings of the National Academy of Sciences of 46 the United States of America, 90(2), pp.659–663. 47 Gopalakrishnan, S. et al., 2015. A cranial mesoderm origin for esophagus striated muscles. Developmental 48 cell, 34(6), pp.694–704. 49 Han, Z. et al., 2004. A myocardin-related transcription factor regulates activity of serum response factor in 50 Drosophila. Proceedings of the National Academy of Sciences of the United States of America, 51 101(34), pp.12567–12572. 52 Hirakow, R., 1985. The vertebrate heart in relation to the protochordates. Fortschritt der Zoologie, 30, 53 pp.367–369. 54 Hobert, O., 2016. Chapter Twenty-Five - Terminal Selectors of Neuronal Identity. In P. M. Wassarman, ed. 55 Current Topics in Developmental Biology. Essays on Developmental Biology, Part A. Academic

26 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 Press, pp. 455–475. Available at: 2 http://www.sciencedirect.com/science/article/pii/S0070215315002148 [Accessed June 23, 2016]. 3 Hoggatt, A.M. et al., 2013. The Transcription Factor Foxf1 Binds to Serum Response Factor and 4 Myocardin to Regulate Gene Transcription in Visceral Smooth Muscle Cells. Journal of 5 Biological Chemistry, 288(40), pp.28477–28487. 6 Hooper, S.L., Hobbs, K.H. & Thuma, J.B., 2008. Invertebrate muscles: thin and thick filament structure; 7 molecular basis of contraction and its regulation, catch and asynchronous muscle. Progress in 8 neurobiology, 86(2), pp.72–127. 9 Hooper, S.L. & Thuma, J.B., 2005. Invertebrate muscles: muscle specific genes and proteins. Physiological 10 reviews, 85(3), pp.1001–1060. 11 Jakobsen, J.S. et al., 2007a. Temporal ChIP-on-chip reveals Biniou as a universal regulator of the visceral 12 muscle transcriptional network. Genes & Development, 21(19), pp.2448–2460. 13 Jakobsen, J.S. et al., 2007b. Temporal ChIP-on-chip reveals Biniou as a universal regulator of the visceral 14 muscle transcriptional network. Genes & Development, 21(19), pp.2448–2460. 15 Jensen, H., 1974. Ultrastructural studies of the hearts in Arenicola marina L. (Annelida: Polychaeta). Cell 16 and Tissue Research, 156(1), pp.127–144. 17 Jensen, H. & Myklebust, R., 1975. Ultrastructure of muscle cells in Siboglinum fiordicum (Pogonophora). 18 Cell and tissue research, 163(2), pp.185–197. 19 Kamm, K.E. & Stull, J.T., 1985. The function of myosin and myosin light chain kinase phosphorylation in 20 smooth muscle. Annual review of pharmacology and toxicology, 25(1), pp.593–620. 21 Katzemich, A. et al., 2011. Muscle type-specific expression of Zasp52 isoforms in Drosophila. Gene 22 Expression Patterns, 11(8), pp.484–490. 23 Kawaguti, S. & Ikemoto, N., 1965. Electron microscopy on the longitudinal muscle of the sea-cucumber 24 (Stichopus japonicus). S. Ebashi et al., Edits. Molecular biology of muscular contraction. Tokyo: 25 Igaku Shoin Ltd. XII, pp.124–131. 26 Kawano, T. et al., 2011. An imbalancing act: gap junctions reduce the backward motor circuit activity to 27 bias C. elegans for forward locomotion. Neuron, 72(4), pp.572–586. 28 Kiehn, O. & Tresch, M.C., 2002. Gap junctions and motor behavior. Trends in Neurosciences, 25(2), 29 pp.108–115. 30 Kierszenbaum, A.L. & Tres, L., 2015. Histology and Cell Biology: An Introduction to Pathology, 4e 4 31 edition., Philadelphia, PA: Saunders. 32 Kobayashi, C. et al., 1998. Identification of Two Distinct Muscles in the Planarian Dugesia japonica by 33 their Expression of Myosin Heavy Chain Genes. Zoological Science, 15(6), pp.861–869. 34 Labeit, S. & Kolmerer, B., 1995. Titins: Giant Proteins in Charge of Muscle Ultrastructure and Elasticity. 35 Science, 270(5234), pp.293–296. 36 Lan, X. & Pritchard, J.K., 2016. Coregulation of tandem duplicate genes slows evolution of 37 subfunctionalization in mammals. Science, 352(6288), pp.1009–1013. 38 Lauri, A. et al., 2014. Development of the annelid axochord: insights into notochord evolution. Science 39 (New York, N.Y.), 345(6202), pp.1365–1368. 40 Lee, H.-H., Zaffran, S. & Frasch, M., 2006. Development of the larval visceral musculature. In Muscle 41 Development in Drosophila. Springer, pp. 62–78. 42 Lee, Y. et al., 1998. The Cardiac Tissue-Restricted Homeobox Protein Csx/Nkx2.5 Physically Associates 43 with the Zinc Finger Protein GATA4 and Cooperatively Activates Atrial Natriuretic Factor Gene 44 Expression. Molecular and Cellular Biology, 18(6), pp.3120–3129. 45 Leininger, S. et al., 2014. Developmental gene expression provides clues to relationships between sponge 46 and eumetazoan body plans. Nature Communications, 5, p.3905. 47 Li, L. et al., 1996. SM22α, a Marker of Adult Smooth Muscle, Is Expressed in Multiple Myogenic Lineages 48 During Embryogenesis. Circulation Research, 78(2), pp.188–195. 49 Liang, C. et al., 2015. The statistical geometry of transcriptome divergence in cell-type evolution and 50 cancer. Nature Communications, 6, p.6066. 51 Mackie, G.O., 1970. Neuroid conduction and the evolution of conducting tissues. The Quarterly Review of 52 Biology, 45(4), pp.319–332. 53 Malo, M. et al., 2000. Effect of brefeldin A on acetylcholine release from glioma C6BU-1 cells. 54 Neuropharmacology, 39(11), pp.2214–2221. 55 Marieb, E.N. & Hoehn, K.N., 2015. Human Anatomy & Physiology 10 edition., Boston: Pearson.

27 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 Marín, M.-C., Rodríguez, J.-R. & Ferrús, A., 2004. Transcription of Drosophila Troponin I Gene Is 2 Regulated by Two Conserved, Functionally Identical, Synergistic Elements. Molecular Biology of 3 the Cell, 15(3), pp.1185–1196. 4 Martindale, M.Q., Pang, K. & Finnerty, J.R., 2004. Investigating the origins of 5 triploblasty:mesodermal’gene expression in a diploblastic animal, the sea anemone Nematostella 6 vectensis (phylum, Cnidaria; class, Anthozoa). Development, 131(10), pp.2463–2474. 7 Martín-Durán, J.M. & Hejnol, A., 2015. The study of Priapulus caudatus reveals conserved molecular 8 patterning underlying different gut morphogenesis in the Ecdysozoa. BMC biology, 13, p.29. 9 Martynova, M.G., 1995. Possible Cellular Mechanisms of Heart Muscle Growth in Invertebratea. Annals of 10 the New York Academy of Sciences, 752(1), pp.149–157. 11 Martynova, M.G., 2004. Proliferation and Differentiation Processes in the Heart Muscle Elements in 12 Different Phylogenetic Groups. In B.-I. R. of Cytology, ed. Academic Press, pp. 215–250. 13 Available at: http://www.sciencedirect.com/science/article/pii/S0074769604350059 [Accessed 14 June 17, 2016]. 15 McKeown, C.R., Han, H.-F. & Beckerle, M.C., 2006. Molecular characterization of the Caenorhabditis 16 elegans ALP/Enigma gene alp-1. Developmental Dynamics, 235(2), pp.530–538. 17 Meadows, S.M. et al., 2008. The myocardin-related transcription factor, MASTR, cooperates with MyoD to 18 activate skeletal muscle gene expression. Proceedings of the National Academy of Sciences, 19 105(5), pp.1545–1550. 20 Meedel, T.H. & Hastings, K.E., 1993. Striated muscle-type tropomyosin in a chordate smooth muscle, 21 ascidian body-wall muscle. Journal of Biological Chemistry, 268(9), pp.6755–6764. 22 Mill, P.J. & Knapp, M.F., 1970. The Fine Structure of Obliquely Striated Body Wall Muscles in the 23 Earthworm, Lumbricus Terrestris LINN. Journal of Cell Science, 7(1), pp.233–261. 24 Misumi, Y. et al., 1986. Novel blockade by brefeldin A of intracellular transport of secretory proteins in 25 cultured rat hepatocytes. Journal of Biological Chemistry, 261(24), pp.11398–11403. 26 Molkentin, J.D. et al., 1995. Cooperative activation of muscle gene expression by MEF2 and myogenic 27 bHLH proteins. Cell, 83(7), pp.1125–1136. 28 Morin, S. et al., 2000. GATA-dependent recruitment of MEF2 proteins to target promoters. The EMBO 29 journal, 19(9), pp.2046–2055. 30 Musser, J.M. & Wagner, G.P., 2015. Character trees from transcriptome data: Origin and individuation of 31 morphological characters and the so-called “species signal.” Journal of Experimental Zoology. 32 Part B, Molecular and Developmental Evolution, 324(7), pp.588–604. 33 Myers, C.D. et al., 1996. Developmental genetic analysis of troponin T mutations in striated and 34 nonstriated muscle cells of Caenorhabditis elegans. The Journal of Cell Biology, 132(6), pp.1061– 35 1077. 36 Nagai, T. & Brown, B.E., 1969. Insect visceral muscle. Electrical potentials and contraction in fibres of the 37 cockroach proctodeum. Journal of Insect Physiology, 15(11), pp.2151–2167. 38 Nishida, W. et al., 2002. A Triad of Serum Response Factor and the GATA and NK Families Governs the 39 Transcription of Smooth and Cardiac Muscle Genes. Journal of Biological Chemistry, 277(9), 40 pp.7308–7317. 41 Nyitray, L. et al., 1994. Scallop striated and smooth muscle myosin heavy-chain isoforms are produced by 42 alternative RNA splicing from a single gene. Proceedings of the National Academy of Sciences, 43 91(26), pp.12686–12690. 44 Nylund, A. et al., 1988. Heart ultrastructure in four species of Onychophora (Peripatopsidae and 45 Peripatidae) and phylogenetic implications. Zool Beitr, 32, pp.17–30. 46 Obinata, T., Ooi, A. & Takano-Ohmuro, H., 1983. Myosin and actin from ascidian smooth muscle and their 47 interaction. Comparative Biochemistry and Physiology Part B: Comparative Biochemistry, 76(3), 48 pp.437–442. 49 Ojima, T. & Nishita, K., 1986. Isolation of Troponins from Striated and Smooth Adductor Muscles of 50 Akazara Scallop. Journal of Biochemistry, 100(3), pp.821–824. 51 Økland, S., 1980. The heart ultrastructure of Lepidopleurus asellus (Spengler) and Tonicella marmorea 52 (Fabricius)(Mollusca: Polyplacophora). Zoomorphology, 96(1–2), pp.1–19. 53 OOta, S. & Saitou, N., 1999. Phylogenetic relationship of muscle tissues deduced from superimposition of 54 gene trees. Molecular Biology and Evolution, 16(6), pp.856–867. 55 Paniagua, R. et al., 1996. Ultrastructure of invertebrate muscle cell types. Histology and Histopathology, 56 11(1), pp.181–201.

28 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 Phiel, C.J. et al., 2001. Differential Binding of an SRF/NK-2/MEF2 Transcription Factor Complex in 2 Normal Versus Neoplastic Smooth Muscle Tissues. Journal of Biological Chemistry, 276(37), 3 pp.34637–34650. 4 Prosser, C.L., Nystrom, R.A. & Nagai, T., 1965. Electrical and mechanical activity in intestinal muscles of 5 several invertebrate animals. Comparative biochemistry and physiology, 14(1), pp.53–70. 6 Raible, F. et al., 2005. Vertebrate-type intron-rich genes in the marine annelid Platynereis dumerilii. 7 Science, 310(5752), pp.1325–1326. 8 Reynolds, P.D., Morse, M.P. & Norenburg, J., 1993. Ultrastructure of the Heart and Pericardium of an 9 Aplacophoran Mollusc (Neomeniomorpha): Evidence for Ultrafiltration of Blood. Proceedings of 10 the Royal Society of London B: Biological Sciences, 254(1340), pp.147–152. 11 Rieger, R. et al., 1991. Organization and differentiation of the body-wall musculature in Macrostomum 12 (Turbellaria, Macrostomidae). Hydrobiologia, 227(1), pp.119–129. 13 Roach, D.K., 1968. Rhythmic muscular activity in the alimentary tract of Arion ater (L.)(Gastropoda: 14 Pulmonata). Comparative biochemistry and physiology, 24(3), pp.865–878. 15 Rogers, D.C., 1969. Fine structure of smooth muscle and neuromuscular junctions in the foot of Helix 16 aspersa. Zeitschrift für Zellforschung und Mikroskopische Anatomie, 99(3), pp.315–335. 17 Rosenbluth, J., 1972. Obliquely striated muscle. In The structure and function of muscle. New York and 18 London: Academic Press, pp. 389–420. 19 Royuela, M. et al., 2000. Characterization of several invertebrate muscle cell types: a comparison with 20 vertebrate muscles. Microscopy Research and Technique, 48(2), pp.107–115. 21 Royuela, M. et al., 1997. Immunocytochemical electron microscopic study and Western blot analysis of 22 caldesmon and calponin in striated muscle of the fruit fly Drosophila melanogaster and in several 23 muscle cell types of the earthworm Eisenia foetida. European journal of cell biology, 72(1), 24 pp.90–94. 25 Sanders, K.M., Koh, S.D. & Ward, S.M., 2006. Interstitial cells of Cajal as pacemakers in the 26 gastrointestinal tract. Annu. Rev. Physiol., 68, pp.307–343. 27 Saudemont, A. et al., 2008. Complementary striped expression patterns of NK homeobox genes during 28 segment formation in the annelid Platynereis. Developmental biology, 317(2), pp.430–443. 29 Schlesinger, J. et al., 2011. The Cardiac Transcription Network Modulated by Gata4, Mef2a, Nkx2.5, Srf, 30 Histone Modifications, and MicroRNAs. PLOS Genet, 7(2), p.e1001313. 31 Schmidt-Rhaesa, A., 2007. The Evolution of Organ Systems 1 edition., Oxford ; New York: Oxford 32 University Press. 33 Sebé-Pedrós, A. et al., 2014. Evolution and classification of myosins, a paneukaryotic whole-genome 34 approach. Genome biology and evolution, 6(2), pp.290–305. 35 Shaw, K., 1974. The fine structure of muscle cells and their attachments in the tardigrade Macrobiotus 36 hufelandi. Tissue and Cell, 6(3), pp.431–445. 37 Shi, X. & Garry, D.J., 2006. Muscle stem cells in development, regeneration, and disease. Genes & 38 Development, 20(13), pp.1692–1708. 39 Shimeld, S.M. et al., 2010. Clustered Fox genes in lophotrochozoans and the evolution of the bilaterian Fox 40 gene cluster. Developmental biology, 340(2), pp.234–248. 41 Silverthorn, D.U., 2015. Human Physiology: An Integrated Approach 7 edition., San Francisco: Pearson. 42 Spies, R.B., 1973. The blood system of the flabelligerid polychaete Flabelliderma commensalis (Moore). 43 Journal of morphology, 139(4), pp.465–490. 44 Steinmetz, P.R.H. et al., 2012. Independent evolution of striated muscles in cnidarians and bilaterians. 45 Nature, 487(7406), pp.231–234. 46 Sulbarán, G. et al., 2015. An invertebrate smooth muscle with striated muscle myosin filaments. 47 Proceedings of the National Academy of Sciences, 112(42), pp.E5660–E5668. 48 Susic-Jung, L. et al., 2012. Multinucleated smooth muscles and mononucleated as well as multinucleated 49 striated muscles develop during establishment of the male reproductive organs of Drosophila 50 melanogaster. Developmental Biology, 370(1), pp.86–97. 51 Sweeney, H.L., Bowman, B.F. & Stull, J.T., 1993. Myosin light chain phosphorylation in vertebrate 52 striated muscle: regulation and function. American Journal of Physiology-Cell Physiology, 264(5), 53 pp.C1085–C1095. 54 Telford, M.J. & Copley, R.R., 2016. Zoology: War of the Worms. Current Biology, 26(8), pp.R335–R337. 55 Thor, S. & Thomas, J.B., 2002. Motor neuron specification in worms, flies and mice: conserved and “lost” 56 mechanisms. Current Opinion in Genetics & Development, 12(5), pp.558–564.

29 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 Tjønneland, A., Økland, S. & Nylund, A., 1987. Evolutionary aspects of the arthropod heart. Zoologica 2 Scripta, 16(2), pp.167–175. 3 Wagner, G.P., 2014. Homology, Genes, and Evolutionary Innovation, Princeton ; Oxford: Princeton 4 University Press. 5 Wales, S. et al., 2014. Global MEF2 target gene analysis in cardiac and skeletal muscle reveals novel 6 regulation of DUSP6 by p38MAPK-MEF2 signaling. Nucleic Acids Research, p.gku813. 7 Wang, D.-Z. & Olson, E.N., 2004. Control of smooth muscle development by the myocardin family of 8 transcriptional coactivators. Current Opinion in Genetics & Development, 14(5), pp.558–566. 9 Wang, Z. et al., 2003. Myocardin is a master regulator of smooth muscle gene expression. Proceedings of 10 the National Academy of Sciences, 100(12), pp.7129–7134. 11 White, J., 1988. 4 The Anatomy. The nematode Caenorhabditis elegans - Cold Spring Harbor Monograph 12 Archive, 17, pp.81–122. 13 Witchley, J.N. et al., 2013. Muscle Cells Provide Instructions for Planarian Regeneration. Cell Reports, 14 4(4), pp.633–641. 15 Wood, J.D., 1969. Electrophysiological and pharmacological properties of the stomach of the squid Loligo 16 pealii (Lesueur). Comparative biochemistry and physiology, 30(5), pp.813–824. 17 Wu, K.S., 1939. On the physiology and pharmacology of the earthworm gut. J. exp. Biol., 16, pp.184–197. 18 Zaffran, S. et al., 2001. biniou (FoxF), a central component in a regulatory network controlling visceral 19 mesoderm development and midgut morphogenesis in Drosophila. Genes & Development, 15(21), 20 pp.2900–2915. 21 Zhang, Y. et al., 2000. Drosophila D-titin is required for myoblast fusion and skeletal muscle striation. 22 Journal of cell science, 113(17), pp.3103–3115. 23 Zhou, Q. et al., 2001. Ablation of Cypher, a PDZ-LIM domain Z-line protein, causes a severe form of 24 congenital myopathy. The Journal of Cell Biology, 155(4), pp.605–612. 25 26

30 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Skeletal myocyte A Cross-striation, solid Z-discs B core regulatory complex Transcription factor families MyoD E12 Striated effectors skeletal actin bHLH MASTR skeletal troponin C SRF/MEF2 skeletal troponin I ZASP/LDB3 SRF or MEF2 Cross-striation, discontinuous Z-elements (MADS domain) C Smooth myocyte Myocardin core regulatory complex (SAP domain)

Fox FoxF1 Smooth effectors Oblique striation, discontinuous Z-elements GATA Nkx3.2 Myocardin smooth actin SRF/MEF2 smooth MLCK NK GATA6 SM22alpha telokin direct caldesmon enhancer binding Smooth ultrastructure demonstrated regulation, D Cardiac myocyte direct binding core regulatory complex untested

demonstrated FoxC1 ? ? Cardiac effectors co-regulation, ? direct binding Thin myofilament: actin Nkx2.5 Myocardin cardiac actin cardiac MHC untested Thick myofilament: myosin GATA4 SRF/MEF2 cardiac troponin T Dense bodies ?

Brunet et al. Figure 1 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1

2 Figure 1. Ultrastructure and core regulatory complexes of myocyte types.

3 (A) Schematic smooth and striated ultrastructures. Electron-dense granules called “dense

4 bodies” separate adjacent myofibrils. Dense bodies are scattered in smooth muscles, but

5 aligned in striated muscles to form Z lines. (B-D) Core regulatory complexes (CRC) of

6 transcription factors for the differentiation of different types of myocytes in vertebrates.

7 Complexes composition from (Creemers et al. 2006; Meadows et al. 2008; Molkentin et

8 al. 1995) for skeletal myocytes, (Hoggatt et al. 2013; Nishida et al. 2002; Phiel et al.

9 2001) for smooth myocytes, and (Durocher et al. 1997; Lee et al. 1998) for

10 cardiomyocytes. Target genes from (Blais et al. 2005) for skeletal myocytes, (Nishida et

11 al. 2002) from smooth myocytes, and (Schlesinger et al. 2011) for cardiomyocytes.

12

31 bioRxiv preprint 7doi: dpf https://doi.org/10.1101/06488111 dpf; this version posted1.5 Julymonths 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprintSomatic in perpetuity. It is made availableVisceral under A aCC-BY-NC-ND 4.0 International license. B muscles muscles striated smooth/striated foregut

ventral longitudinal foregut musculature muscles C A midgut G H posterior

Ventral half Ventral foregut hindgut I 3 muscles ventral oblique E midgut D V muscles musculature 4 J K L

P axochord D

M hindgut musculature parapodial F muscles Dorsal half

Somatic muscles Visceral muscles

C E mitochondrion G

foregut Z-lines lumen F

Z- Z- lines lines DH I foregut Z-lines dense muscles bodies

Z- lines

circular muscles J coelom K M

longitudinal muscles dense bodies dense bodies longitudinal muscles circular L muscles gut epithelium dense bodies

Brunet et al. Figure 2 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 Figure 2. Development and ultrastrcture of visceral and somatic musculature in

2 Platynereis larvae and juveniles. (A) Development of visceral musculature. All panels

3 are 3D renderings of rhodamine-phalloidin staining imaged by confocal microscopy.

4 Visceral muscles have been manually colored green and somatic muscle red. Scale bar:

5 50 µm. (B) Schematic of the musculature of a late nectochaete (6 dpf) larva. Body outline

6 modified from (Fischer et al. 2010). Ventral view, anterior is up. (C-M) Electron

7 micrographs of the main muscle groups depicted in B. Each muscle group is shown

8 sectioned parallel to its long axis, so in the plane of its myofilaments. Scale bar: 2 µm.

9 (H) is a close-up of the region in the yellow box in G. (J) shows the dorsal midgut in

10 cross-section, dorsal side up.

11

32 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Striated molecular profile Smooth molecular profile ST-MHC SM-MHC A * B SM-MHC SM-MRLC Calponin* NK3 FoxF GATA456 KLF5 Actin Mef2 Troponin I Troponin T Troponin Titin ST-MHC ST-MRLC Zasp/LBD3 MyoD Myocardin Annelid longitudinal * striated muscles Annelid striated foregut muscles

72 hpf Annelid oblique/parapodial striated muscles Annelid gut smooth muscles

C D Vertebrate striated * * trunk muscles Vertebrate striated esophageal muscles Vertebrate gut

6 dpf smooth muscles Acto- Calcium Striation Transc. Acto- Transcription Acto- Transcription myosin response factors myosin factors myosin factors Expressed Not expressed Expressed in a subset

Brunet et al. Figure 3 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 Figure 3. Expression of smooth and striated muscle markers in Platynereis larvae.

2 Animals have been stained by WMISH and observed in bright field Nomarski

3 microscopy. Ventral views, anterior side up. Scale bar: 25 µm. (A-D) Expression patterns

4 of the striated marker ST-MHC and the smooth marker SM-MHC. These expression

5 patterns are representative of the entire striated and smooth effector module (see Figure

6 3-supplements 1 and 3). (E) Table summarizing the expression patterns of smooth and

7 striated markers in Platynereis and vertebrate muscles. (*) indicates that Platynereis and

8 vertebrate Calponin are mutually most resembling by domain structure, but not one-to-

9 one orthologs, as independent duplications in both lineages have given rise to more

10 broadly expressed paralogs with a different domain structure (Figure 7—supplement 3).

11

12

33 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

A Lifeact-EGFP B Lifeact-EGFP C GCaMP6s D G FM-464FX H2B-RFP H2B-RFP c. b. c. b. 60 μm longitudinal muscle ventral c. b. t0 longitudinal muscles E foregut

telotroch 51 μm telotroch 20 μm 50 μm 6 dpf t0 t0+280ms 3 dpf t0+436 ms myocytes A’ H2B-RFP B’ H2B-RFP F ) -1 midgut t 0 t0+1.3s 52 μm 61 μm

1 -8 1 p = 8.5*10 hindgut Contraction speed (s 31 27 μm μm 50 μm 0.0 0.4 0.8 1.2 2 2 t t +280ms Somatic striated Visceral smooth 0 0 muscles muscles 6 dpf

Brunet et al. Figure 4 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 Figure 4. Contraction speed quantifications of smooth and striated muscles. (A-

2 B) Snapshots of a time lapse live confocal imaging of a late nectochaete larva expressing

3 fluorescent markers. Ventral view of the 2 posterior-most segments, anterior is up.

4 (C) Snapshots of a time lapse live confocal imaging of a 3 dpf larva expressing

5 GCaMP6s. Dorsal view, anterior is up. (D-E) Two consecutive snapshots on the left

6 dorsal longitudinal muscle of the larva shown in C, showing muscle contraction.

7 (F) Quantification of smooth and striated muscle contraction speeds (see Experimental

8 procedures). (G) Snapshot of a time lapse live confocal imaging of a late nectochaete

9 larva. Ventral view, anterior is up. Optical longitudinal section at the midgut level.

10

11

34 certified bypeerreview)istheauthor/funder,whohasgrantedbioRxivalicensetodisplaypreprintinperpetuity.Itmadeavailableunder bioRxiv preprint doi: 400 μm G D A https://doi.org/10.1101/064881

Wave propagation speed ( m/s) gut Control 0 100 200 300 Control Brunet etal. Figure 5 pharynx head p =5*10 parapodia 2 months Brefeldin A- treated -3 a CC-BY-NC-ND 4.0Internationallicense ;

+2-octanol this versionpostedJuly20,2016. outline of E B the gut Number of contractions 100 μm per minute 1 2 3 4 5 6 longitudinal fibres circular fibres Control

+Brefeldin-A n. s. Brefeldin A- FM464-FX interest line of treated The copyrightholderforthispreprint(whichwasnot . C time (t) F Kymograph

+Brefeldin-A +2-octanol contraction waves Recurrence of contraction events wave propagation

1 2 3 4 5 6 7 speed Control n. s. Brefeldin A- treated Δx = space (x) Δx Δt Δt bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 Figure 5. Platynereis gut peristalsis is independent of nervous inputs and dependent

2 on gap junctions. (A) 2 months-old juvenile mounted in 3% low-melting point (LMP)

3 agarose for live imaging. (B) Snapshots of a confocal live time lapse imaging of the

4 animal shown in A. Gut is observed by detecting fluorescence of the vital membrane dye

5 FM-464FX. (C) Kymograph of gut peristalsis along the line of interest in (B).

6 Contraction waves appear as dark stripes. A series of consecutive contraction waves is

7 called a contraction event: here, two contraction waves are visible, which make up one

8 contraction event with a recurrence of 2. (D) Quantification of the propagation speed of

9 peristaltic contraction waves in mock (DMSO)-treated individuals and Brefeldin A-

10 treated individuals (inhibiting neurotransmission). Speed is calculated from kymographs

11 (see Material and Methods). (E,F) Same as in E, but showing respectively the frequency

12 of initiation and the recurrence of contraction events. (G) Representative kymographs of

13 controls, animals treated with Brefeldin A (inhibiting neurotransmission), animals treated

14 with 2-octanol (inhibiting gap junctions), and animals treated with both (N=10 for each

15 condition). 2-octanol entirely abolishes peristaltic waves with or without Brefeldin A.

16

17

35 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

A outline of the gut BC D

ac-tub serotonin 10 μm phalloidin

neurites ac-tubulin

ac-tubulin 50 μm ac-tubulin serotonin serotonin combined

Brunet et al. Figure 6 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 Figure 6. The enteric nerve net of Platynereis. (A) Immunostaining for acetylated

2 tubulin, visualizing neurites of the enteric nerve plexus. Z-projection of a confocal stack

3 at the level of the midgut. Anterior side up. (B) Same individual as in A, immunostaining

4 for serotonin (5-HT). Note serotonergic neurites (double arrow), serotonergic neuronal

5 cell bodies (arrow, see D), and serotonergic cell bodies without neurites (arrowhead).

6 (C) Same individual as in A showing both acetylated tubulin and 5-HT immunostainings.

7 Snapshot in the top right corner: same individual, showing both neurites (acetylated

8 tubulin, yellow) and visceral myofibres (rhodamine-phalloidin, red). The acetylated

9 tubulin appears yellow due to fluorescence leaking in the rhodamine channel. (D) 3D

10 rendering of the serotonergic neuron shown by arrow in B.

11

12

36 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Slow-contracting group NM/SM-MHC+ Fast-contracting group ST-MHC+ Somatic striated Cardiomyocytes Gut myocytes myocytes Porifera Cnidaria Deuterostomia Protostomia Protostomia Deuterostomia Deuterostomia Protostomia Cnidaria Porifera

Sponge Nematostella Vertebrate Annelid Drosophila Drosophila gut Annelid gut Vertebrate gut Vertebrate Annelid Planarian Nematostella Jellyfish Sponge exopinacocyte slow myocytes cardiomyocyte cardiomyocyte cardiomyocyte striated smooth smooth striated striated somatic fast striated reticuloapopylocyte myocytes myocytes myocytes myocytes myocytes smooth myocytes myocytes myocytes

sm-actin st-actin SM-MHC SM-MHC SM-MHC striation striation: sm-MELC st-MELC loss loss loss actin loss convergent striation, MELC evolution striation, fast module striation, myocardin MASTR fast fast module myocardin module connexin gap junctions

SM-MRLC ST-MRLC MRLC GATA456 striation: MyoD titin, troponin complex innexin gap junctions SM-MHC ST-MHC ? ? ? ? change in core regulatory complex

apomere SM-MHC ST-MHC module co-option MHC

module loss paralog 1 paralog 2 paralog 2 paralog 1 ancestral species split reciprocal loss of expression gene (division of labor) cell type split gene duplication

Brunet et al. Figure 7 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 Figure 7. The evolutionary tree of animal contractile cell types. Bilaterian smooth and

2 striated muscles split before the last common protostome/deuterostome ancestor.

3 Bilaterian myocytes are split into two monophyletic cell type clades: an ancestrally SM-

4 MHC+ slow-contracting clade (green) and an ancestrally ST-MHC+ fast-contracting

5 clade (orange). Hypothetical relationships of the bilaterian myocytes to the SM-MHC+

6 and ST-MHC+ contractile cells of non-bilaterians are indicated by dotted lines (Steinmetz

7 et al. 2012). Apomere: derived set of effector genes common to a monophyletic group of

8 cell types (Arendt et al. 2016). Note that ultrastructure only partially reflects evolutionary

9 relationships, as striation can evolve convergently (as in medusozoans), be co-opted (as

10 in insect gut myocytes or in vertebrate and insect cardiomyocytes), be blurred, or be lost

11 (as in planarians). Conversion of smooth to striated myocytes took place by co-option of

12 striation proteins (Titin, Zasp/LDB3) and of the fast contractile module (ST-MHC, ST-

13 MRLC, Troponin complex) in insect cardiomyocytes and gut myocytes, as well as in

14 vertebrate cardiomyocytes.

15

16

37 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

ABCDEfoxA foxA bra hnf4 * * * *

foregut bra foxA bra+foxA

midgut hnf4

6 dpf 6 dpf 6 dpf 6 dpf hindgut

Brunet et al. Figure 2 - supplement 1 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 Figure 2—figure supplement 1. Gut patterning in Platynereis 6 dpf larvae. (A-D)

2 WMISH for gut markers. (A) Ventral view, anterior is up. (B-D) Left lateral views,

3 anterior is up, ventral is right. (E) Schematic of gut patterning in Platynereis late

4 nectochaete larvae. Scale bar: 50 µm.

5

6

38 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

ST-MRLC zasp titin troponin I troponin T A B C D E 48 hpf

EF G H I J 72 hpf

K L M N O

ST-MHC ST-MRLC titin 6 dpf P Q RS T

l Q UVWtroponin I troponin T zasp

Brunet et al. Figure 3 - supplement 1 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 Figure 3—supplement 1. Expression of striated muscle markers in Platynereis

2 larvae. (A-O) Larvae stained by WMISH and observed in bright field Nomarski

3 microscopy. Ventral views, anterior side up. Scale bar is 20 µm for 48 hpf and 25 µm for

4 the two other stages. (P) Foregut musculature visualized by rhodamine-phalloidin

5 fluorescent staining. Z-projection of confocal planes. Ventral view, anterior side up.

6 Scale bar: 20 µm. (Q) TEM micrograph of a cross-section of the foregut. Foregut muscles

7 are colored green, axochord orange, ventral oblique muscles pink, ventral nerve cord

8 yellow. Inset: zoom on the area in the red dashed box with enhanced contrast to visualize

9 oblique striation. Scale bar: 10 µm. (R-W) WMISH for striated muscle markers

10 expression in the foregut observed in Nomarski bright field microscopy, ventral views,

11 anterior side up. Scale bar: 20 µm.

12

13

39 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Axochord Oblique muscles Longitudinal muscles Antennal muscles Parapodial muscles DAPI DAPI NBT/BCIP DAPI DAPI NBT/BCIP DAPI DAPI NBT/BCIP DAPI DAPI NBT/BCIP DAPI DAPI NBT/BCIP * * * * ** ** * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * ST-MRLC * * * * * * * *

*** *** ** * * * * * * * * * * * * * * * ** * * ** * * * * * * * * * * * * * * * * * ST-MHC * * * * * * * * *

* * * * * ** * ** * * * * * * * * * * * * * * * * * * * * * *

zasp * * * * * * * * * * * * * * * *

* * * * ** ** * * * * * * * * * * * * * titin * ** ** * * * * * * * * * * * * * * * * * * * * * * * * * * * ** * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * troponin I

* * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * *** *** * *

troponin T *

* * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * myoD * * * * * * * * * * * * * * * * * *

Brunet et al. Figure 3 - supplement 2 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 Figure 3—supplement 2. Expression of striated muscle markers in the 6 dpf

2 Platynereis larva. Animals have been stained by WMISH and observed by confocal

3 microscopy (DAPI fluorescence and NBT/BCIP 633 nm reflection). All striated effector

4 genes are expressed in all somatic muscles examined. The transcription factor myoD is

5 detectable in the axochord and in ventral longitudinal muscles, but not in other muscles.

6

7

40 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

SM-MRLC calponin GATA456 A B C D foxF I J actin SM-MHC coloc. * * * t.f. * l. d. l. d. 72 hpf * l.f. 72 hpf 72 hpf forming E F G H NK3 gut muscles K foxF GATA456 calponin NK3 * * t.f. * * 6 dpf

l.f. 72 hpf 72 hpf actin coloc.

DAPI FM-464FX SM-MHC DAPI FM-464FX L M N dlm Q phalloidin DAPI heart phalloidin dorsal longitudinal heart coelom intrisic muscles muscles coelom gut muscles dlm gut dlm heart gut tube muscles O SM-MHC intrinsic heart DAPI muscles gut muscles gut gut heart tube

2 months - heart tube ST-MHC P heart DAPI dlm striated musculature ST-MHC+ gut intrisic muscles smooth musculature SM-MHC+ blood gut coelomic lining epidermis

Brunet et al. Figure 3 - supplement 3 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 Figure 3—supplement 3. Expression of smooth muscle markers in Platynereis

2 larvae. (A-H) Animals are stained by WMISH and observed by Nomarski bright field

3 microscopy. Ventral views, anterior side up. Yellow arrows: expression in the foregut

4 mesoderm. White dashed lines: outline of the midgut and hindgut (or their anlage at 3

5 dpf). Asterisk: stomodeum. (I) Schematic drawing of a 3 dpf larva (ventral view, anterior

6 is up) showing the forming midgut and hindgut (dotted line) and the forming visceral

7 myofibres in green (compared to double WMISH panels J and K). (J,K) Animals are

8 stained by double WMISH and observed by confocal microscopy (cyanine 3 precipitate

9 fluorescence for actin, NBT/BCIP precipitate reflection for other genes). Ventral views,

10 anterior side up. Abbreviations: t.f.: transverse fibres; l.f.: longitudinal fibres. (L-Q)

11 Molecular profile of the pulsatile dorsal vessel. All panels show 2 months-old juvenile

12 worms. (L,M) Maximal Z-projections of confocal stacks. Dorsal view, anterior is up. (L)

13 Dorsal musculature of a juvenile Platynereis dumerilii individual visualized by

14 phalloidin-rhodamine (green) together with nuclear (DAPI, blue) and membrane (FM-

15 464FX, red) stainings. The heart tube lies on the dorsal side, bordered by the somatic

16 dorsal longitudinal muscles (dlm). (M) Expression of SM-MHC in the heart tube

17 visualized by WMISH. (N) Virtual cross-section of the individual shown in A. Dorsal

18 side up. Note the continuity of the muscular heart tube with gut musculature. (O) Virtual

19 cross-section of the individual shown in B, showing continuous expression of SM-MHC

20 in the heart and the midgut smooth musculature. Note the similarity to the NK4/tinman

21 expression pattern documented in (Saudemont et al. 2008). (P) Virtual cross-section on

22 an individual stained by WMISH for ST-MHC expression. Note the lack of expression in

23 the heart, while expression is detected in intrinsic muscles that cross the internal cavity to

41 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 suspend internal organs, and in dorsal longitudinal muscles (dlm). (Q) Schematic cross-

2 section of a juvenile worm (dorsal side up) showing the shape, connections and molecular

3 profile of the main muscle groups. Scale bar: 30 µm in all panels.

4

5

42 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

A SM-MRLC B SM-MHC C calponin

foregut

D GATA456 E foxF *

Smooth muscle markers midgut

6 dpf F ST-MRLC G ST-MHC H zasp

I titin J troponin I K troponin T Striated muscle markers

Brunet et al. Figure 3 - supplement 4 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 Figure 3—supplement 4. Molecular profile of midgut muscles in the 6 dpf larva. All

2 panels are Z-projections of confocal planes, ventral views, anterior side up. Blue: DAPI,

3 red: NBT/BCIP precipitate. White dashed line: midgut/hindgut, yellow dashed ellipse:

4 stomodeum. (A-E) Smooth markers expression. White arrows indicate somatic

5 expression of GATA456 in the ventral oblique muscles. (F-K) Striated markers

6 expression; none of them is detected in any gut cell. White arrows: somatic expression.

7 Scale bar: 20 µm in all panels.

8

9

43 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

* * actin a A 24 hpf B 24 hpf C 48 hpf D dlm 48 hpf E 72 hpf F 72 hpf dlm dlm vlm vlm am dlm a vom vom lom

lom vc vc pm lom

* * myocardin mef2 actin G 6 dpf H I 6 dpf J K 6 dpf L

f.m. f.m. f.m. f.m. f.m.

midgut midgut

midgut midgut midgut midgut r.a.

M Oblique muscles Longitudinal muscles Oblique muscles Longitudinal muscles Oblique muscles Longitudinal muscles DAPI DAPI NBT/BCIP DAPI DAPI NBT/BCIP DAPI DAPI NBT/BCIP DAPI DAPI NBT/BCIP DAPI DAPI NBT/BCIP DAPI DAPI NBT/BCIP

ach ach * * * * vlm vlm * * * * * * * * * * * * * * * * * * ** ** * * * * * * * * * * * * * * * * * * * * * * * * * *

Brunet et al. Figure 3 - supplement 5 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 Figure 3—supplement 5. General muscle markers are expressed in both smooth and

2 striated muscles. All panels show gene expression visualized by WMISH. (A-F) actin

3 expression. (A-B) bright field micrographs in Nomarski optics. (A) is an apical view, (B)

4 is a ventral view. Abbreviations: dlm, dorsal longitudinal muscles; vc, ventral

5 mesodermal cells, likely representing future ventral musculature. (C-F) 3D rendering of

6 confocal imaging of NBT/BCIP precipitate. (C,E) ventral views, anterior side up. (D,F)

7 ventrolateral views, anterior side up. Abbreviations are as in Figure 1. (G-M) Z-

8 projections of confocal stacks. Blue is DAPI, red is reflection signal of NBT/BCIP

9 precipitate. (G-L) Ventral views, anterior side up. White dashed line: midgut, yellow

10 ellipse: foregut. White arrows: somatic muscle expression. Abbreviations: f.m.: foregut

11 muscles; r.a.: reflection artifact. (M) Expression in individual somatic muscles. Scale bar:

12 20 µm in all panels.

13

14

44 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Evolution of somatic striated CRC Vertebrate trunk Platynereis trunk striated Drosophila trunk Caenorhabditis trunk striated myocytes longitudinal myocytes striated myocytes striated myocytes

MyoD E12 MyoD E12 Nau Da hlh-1 hnd-1

MASTR Myocardin SRF/MEF2 MEF2 Striated MEF2 UNC-120 Striated effectors effectors Striated Striated effectors effectors

MyoD E12 Ancestral somatic Myocardin striated CRC SRF/MEF2

Striated effectors

Evolution of visceral smooth CRC Gut myocytes branch Cardiomyocytes branch

Vertebrate gut Platynereis gut Drosophila gut Vertebrate Platynereis Drosophila smooth myocyte smooth myocyte striated myocyte cardiomyocyte cardiomyocyte cardiomyocyte

FoxF1 FoxF biniou FoxC1 Nkx3.2 Myocardin NK3 Myocardin bagpipe NK4 SRF/MEF2 Nkx2.5 Myocardin Myocardin tinman SRF/MEF2 GATA6 MEF2 GATA456 MEF2 GATA4 SRF/MEF2 SRF/MEF2 MEF2 ?GATA4/5/6 Pannier Smooth contractile and Smooth contractile and Gut myocyte Striated contractile Striated differentiation effectors differentiation effectors differentiation Striated Smooth effectors effectors effectors effectors effectors

striation striation striation FoxF

NK3 FoxC Myocardin Ancestral gut SRF/MEF2 NK4 Myocardin GATA4/5/6 smooth CRC Ancestral SRF/MEF2 cardiac CRC Smooth contractile effectors GATA4/5/6 Differentiation effectors Smooth (morphogenesis, innervation, adhesion) effectors

Fox

NK Myocardin SRF/MEF2 Ancestral visceral GATA4/5/6 smooth CRC Smooth contractile effectors Differentiation effectors

Brunet et al. Figure 7 - supplement 1 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 Figure 7—supplement 1. Evolution of myogenic Core Regulatory Complexes (CRC)

2 in Bilateria. Transcription factor families are depicted as in Figure 1. Direct contact

3 indicates proven binding. Co-option of the fast/striated module happened on three

4 occasions: in Drosophila gut myocytes, and in cardiomyocytes of both vertebrates and

5 Drosophila. Note that in both cases, composition of the CRC was maintained in spite of

6 change in the effector module. In insect gut myocytes, replacement of the smooth by the

7 striated module entailed a split of the CRC, with the ancient smooth CRC still controlling

8 conserved differentiation genes (involved in adhesion, morphogenesis, axonal guidance,

9 or formation of innexin gap junctions), while the striated contractile cassette is

10 downstream Mef2 alone (Jakobsen et al. 2007b). It is less clear whether a similar split of

11 CRC took place in striated cardiomyocytes.

12

13

45 certified bypeerreview)istheauthor/funder,whohasgrantedbioRxivalicensetodisplaypreprintinperpetuity.Itmadeavailableunder bioRxiv preprint Brunet et al. Figure 7-supplement 2 A doi: Chordata B 0.82 Vertebrata Deuterostomia https://doi.org/10.1101/064881

0.82 Chordata Urochordata Deuterostomia Cephalochordata 1.00 0.53

chordata Echinodermata 0.83 Saccoglossus Hemi- 0.98 0.54 Rhabdopleura

Cephalodiscus Chaetognatha a

Hemithris Spiralia CC-BY-NC-ND 4.0Internationallicense ; 0.56 Meiomenia this versionpostedJuly20,2016. 0.79 0.88 Mollusca

Lepidopleurus Mollusca 1.00 0.69 Rossia 1.00

0.61 Helix Annelida 0.62 0.73 Mytilus Ecdysozoa Eisenia 0.97 Ultrastructure ofmidgutmuscles Priapulida 0.80 Annelida 0.77 Helobdella Striated One-sarcomere Smooth 0.66 The copyrightholderforthispreprint(whichwasnot Siboglinum Ecdysozoa Spiralia . 0.97 0.63 Nematoda Flabelliderma 0.89 Arenicola Panarthropoda 0.73 Peripatopsis Arthropoda myocytes Smooth heart myocytes Striated heart Protostomia 0.62

0.90 Chelicerata 0.74 0.77 Crustacea Tardigrada Insecta bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 Figure 7—supplement 2. Ancestral state reconstructions of the ultrastructure of

2 midgut/hindgut and heart myocytes. (A) Distribution, and ancestral state

3 reconstruction, of midgut smooth muscles in Bilateria. Ancestral states were inferred

4 using Parsimony and Maximum Likelihood (ML) (posterior probabilities indicated on

5 nodes). Character states from: Chordata (Marieb & Hoehn 2015), Echinodermata (Feral

6 & Massin 1982), Chaetognatha (Duvert & Salat 1995), Mollusca (Royuela et al. 2000),

7 Annelida (Anderson & Ellis 1967), Priapulida (Carnevali & Ferraguti 1979), Nematoda

8 (White 1988), Arthropoda (Goldstein & Burdette 1971), and Tardigrada (Shaw 1974).

9 (B) Distribution, and ancestral state reconstruction, of cardiomyocyte ultrastructure in

10 Bilateria. Ancestral states were inferred using Parsimony and ML (posterior probabilities

11 indicated on nodes). Note that, due to the widespread presence of striated cardiomyocytes

12 in bilaterians, the support value for an ancestral smooth ultrastructure in the ML method

13 remain modest (0.56). This hypothesis receives independent support from the comparison

14 of CRCs (Figure 1B, Figure 7—supplement 1) and developmental data (see Discussion).

15 Character states follow the review by Martynova (Martynova 2004; Martynova 1995) and

16 additional references for Siboglinum (Jensen & Myklebust 1975), chordates (Hirakow

17 1985), Peripatopsis (Nylund et al. 1988), arthropods (Tjønneland et al. 1987), Meiomenia

18 (Reynolds et al. 1993), and Lepidopleurus (Økland 1980). In Peripatopsis and

19 Lepidopleurus, some degree of alignment of dense bodies was detected (without being

20 considered regular enough to constitute striation), suggesting these might represent

21 intermediate configurations.

22

46 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

A C Homo sapiens Platynereis dumerilii auhm am Hsa-calponin1 Pdu-calponin

Hsa-calponin2 Pdu-transgelin1

Hsa-calponin3 Pdu-transgelin2

Hsa-transgelin1 Drosophila melanogaster mp20 Hsa-transgelin2 ach vlm Hsa-transgelin3 chd64 vom Caenorhabditis elegans Domains unc-87 Calponin homology Calponin repeats

Branchiostoma-floridae-calponin 0,9907 Danio-transgelin Deuterostomia B 0,8256 Danio-transgelin2 Transgelin transgelin1 1Homo-transgelin2 1 Rattus-transgelin2 clade 1 Rattus-transgelin DAPI Homo-transgelin Homo-transgelin3 1 1Mus-calponin2 1 Homo-calponin2 Xla-calponin2B Latimeria-calponin3-isoformX1 Calponin D 1 0,5786 Latimeria-calponin3-isoformX2 clade 1 Homo-calponin3 Oryzias-calponin3-like 0,99730,978Danio-calponin37 b 0,9973Danio-calponin3a Astyanax-calponin3-like 0,5846Danio-calponin2 1 Xiphophorus-calponin1-like Takifugu-calponin1-like Meleagris-calponin1 0,5959 1 0,52 Gallus-calponin1 Chrysemys-calponin1 0,595Mu9 s-calponin1 1 Sus-calponin2 0,Sus-calponin9794 3 Homo-calponin1 0,99Ceratitis-capitata-myophilin-likeX8 1 1 Drosophila-chd64 Musca-domestica-myophilinX1 1 midgut 0,9734 Riptortus-pedestris-calponin-transgelin 0,8702 Daphnia-pulex-DAPPUDRAFT_308120 0,98 Nasonia-vitripennis-myophilin 0,9927 Bombyx-mori-transgelin 1 Pdu-transgelin1 0,5473 Pdu-transgelin2 0,9953 Echinococcus-myophilin 1 Drosophila-mp20 0,7643 Metaseiulus-occidentalis-mp20-like 0,5839 Solen-grandis-calponin-like-protein Mytilus-galloprovincialis-calponin-like 0,7603 1 Helobdella-robusta-HELRODRAFT_186180 1 1 Capitella-teleta-CAPTEDRAFT_17776 Helobdella-robusta-HELRODRAFT_185231 Cerebratulus-lacteus-calponin 1 0,715 Capitella-myophilin 1 Helobdella-robusta-HELRODRAFT_184984 Pdu-calponin transgelin1 Lottia-gigantea-LOTGIDRAFT_149649 Protostomia 0,7716 Aplysia-californica-myophilin-like Crassostrea-gigas-Mp20 DAPI

0.2

Brunet et al. - Figure 7 supplement 3 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 Figure 7—supplement 3. Domain structure, phylogeny and expression patterns of

2 members of the calponin gene family. (A) Domain structure of calponin-related

3 proteins in bilaterians. Calponin is characterized by a Calponin Homology (CH) domain

4 with several calponin repeats, while Transgelin is characterized by a CH domain and a

5 single calponin repeat. In vertebrates, Calponin proteins are specific smooth muscle

6 markers, and the presence of multiple CH repeats allows them to stabilize actomyosin

7 (Gimona et al. 2003). Transgelins, with a single calponin repeat, destabilize actomyosin

8 (Gimona et al. 2003), and are expressed in other cell types such as podocytes (Gimona et

9 al. 2003), lymphocytes (Francés et al. 2006), and striated muscles (transiently in mice (Li

10 et al. 1996) and permanently in fruit flies (Ayme-Southgate et al. 1989)). (B) Maximum

11 Likelihood phylogeny of the calponin/transgelin family based on alignment of the CH

12 domain. Paralogs with calponin and transgelin structures evolved independently in

13 vertebrates and Platynereis (Pdu, in red squares). (C) Expression patterns of Pdu-

14 transgelin1. Scale bar: 25 µm. As in vertebrates and insects, transgelin1 is not smooth

15 myocyte-specific, but also detected in striated myocytes.

16

17

47 A CapsaCalmo bioRxivBos preprintCalmo doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified0.41 by9 peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under DmeCalmo aCC-BY-NC-ND 4.0 International license. ThtrCalmo 0.763 Fungi MRLC Fungi

0.997 Fungi MRLC FalbaMRLC 0.704 0.747 Sponge MRLC Porifera 0.99 0.291 Sponge MRLC

1 OscMRLC 0.87 0.97 Cnidarian MRLC Cnidaria 0 BflMRLCb Striated MRLC 0.718 CteMRLCa 0.99 0.77 Platynereis-ST-MRLC 0.628 0.99 RypaRLC

0.48 0.923 Mollusc striated MRLC 0.74 0.99 1 Arthropod muscle MRLC 0.88 1 Arthropod/nematode muscle MRLC 0.006 1 0.86 Vertebrate striated MRLC 0.8 SpuMRLCa 0.678 SkoMRLCb SpuMRLCb 0.715 SpuMRLCc 0.83 Bilateria 1 Nematode non-muscle MRLC Smooth MRLC 0.77SkoMRLCa 0.86 0.96 Insect non-muscle MRLC Amphioxus MRLCa 0.71 0.87 0.98 Vertebrate-smooth/non-muscle MRLC Platynereis-SM-MRLC 0.833 HelobdMRLC

0.9 Mollusc smooth MRLC BatdenMRLC 0.606 Fungi MonveMRLC

0.4 Dme-biniou Cgi-LBD3

1 B Pdu-FoxF C

0.9956 Aca-LBD3 Cte-FoxF 0.9878 1 1 1 Patvu-FoxF Hro-LBD3

1 Brafl-FoxF Cte-LBD3 1 1 Mus-FoxF2

1 1 Hsa-FoxF2 Pdu-ZASP/LBD3

1 Mus-FoxF1 GgaLBD3X12

1 Xenla-FoxF1B

1 1 Xenla-FoxF1A HSALBD3X14 0.9612

1 Hsa-FoxF1 DreCyphX3a Mus-FoxQ1

1

Cte-FoxQ1 Nve-LBD3

0.2 0.2

Brunet et al. Supplementary Figure 1 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not HSA-MYH7 Cel-MEF2 Cte-Titin

certified by peer review) is the author/funder,0 who has granted bioRxiv a license to display the preprint in perpetuity. It1 is made available under DANRE-AMHC 0 aCC-BY-NC-ND 4.0 InternationalTt-Mef2 license. Hro-Titin D E F 1 1 DANRE-MYH1 1 0.99 Pdu-titin HSA-MYH8 Pdu-mef2 1 1 HSA-MYH1 Lgi-Titin 1 Dme-MEF2 1 0.6208 Platynereis-ST-MHC Aca-titin 0.6086 0.994 Hsa-MEF2B DME-M-MHC 1 1 0.85 1 1 Cgig-Titin DME-ST-MHC DanreMEF2B

HSA-MYH10 Octo-Titin 1 Hsa-MEF2A 1 1 MUS-MYH10 0.91 PrcauTitin XenlaMEF2A 1 HSA-MYH9 1 Limu-Titin MUS-MYH9 1 1 DanreMEF2A 0 DANREMYH11 PolisTitin Hsa-MEF2C 0 GGA-MYH11 0.79 Cel-Titin 0.999 0.94 HSA-MYH11 Xenla-MEF2C 1 1 Mus-Titin 1 0.5876 MUS-MYH11 1 Danre-MEF2C Hsa-Titin DME-NM-MHC 0.94 0.999 1 DanreMEF2D LPO-NMMHC 1 Dre-TitinA 0.989 1 Platynereis-SM-MHC 1 Hsa-MEF2D Dre-TitinB 0.992 1 ACANMMHCX1 1 0.984 1 Xenla-MEF2D SkoTitin BGANMMHCX3

SKOMYH10X2 NemvMef2X1 SpurTwitch

0.2 0.2 0.2 Bfl-TropT Onchocerca-calponin-like 1 0.9996 Calponin/transgelin clade G Cint-TropT-X5 H 0.986 Hsa-TropI2 0.9997 Oryctolagus-TropI2 Dre-TropT-cardiac 0.9982 0.9 0.34 0.8288 Gga-TropI2 Hsa-TropT-skeletal 0.738 Hsa-TropI1 0.962 Xla-TropI3 Mus-TropT-cardiac 0.6167 0.886 Mus-TropI3 0.9999 Hsa-TropT-cardiac Rattus-TropI3 0.9999 0.7829 Hsa-TropI3 Drome-TropT Gga-TropI3 0.9998 Cte-TropT Coturnix-TropI3

0.986 0.849 Dm-TropI Helro-TropT 1 1 Astacus-TropI 0.227

Pdu-TropT 1 Ce-TropI3 0.872 1 Ce-TropI2 Cgi-TropT-X8 0.9678 1 Ce-TropI1 0.9998 0.79 Sma-TropT Ce-TropI4

0.845 Chlamys-TropI 0.9991 Linan-TropT Pdu-TropI

0.4 0.4 Bbe-MyoD2 Hsa-MYLK2

0.3803 1 I Bbe-MyoD1 J Mus-MYKL2 0.8647 DanreMyoD Hsa-MKL1

0.6341 0.222Xenla-Myo4 D Mus-MYKL1 1 0.5046 Hsa-MYOD1 1 Xenla-MRTFA 0.2914 Hsa-Myf5 Gga-MYCD 0.3348 Xenla-Myf5

1 Hsa-MYCD 1 0.5938 0.4319 Dre-Myf5 Mus-MYCD 0.6741 Mus-Myog 0.2719 Xenla-MYCD HSA-Myf6 Pdu-MYCD Spur-MyoD1 0.6148 0.5143 0.9302 Lottia-gigantea-LOTGIDRAFT_111577 Sacko-MyoD 0.7073 Crassostrea-gigas-MKL-myocardin-like-protein-2 Tt-MyoD 1 0.5314 Pdu-MyoD Daphnia-pulex-DAPPUDRAFT_309984 0.5938 0.9989 Drosophila-melanogaster-Myocardin-related-transcription-factor-isoform-H Spur-MyoD2 0.8282 0.5326 Dme-nau Stegodyphus-mimosarum-MKL-myocardin-like-protein-2

0.07 0.2

Brunet et al. Supplementary Figure 1 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

K

CapsaCalmo BosCalmo DmeCalmo ThtrCalmo 0,606 BatdenMRLC MonveMRLC AllomaMRLC 0,763 SalpunMRLC MucorMRLC 0,997 LichcoMRLC 1 FalbaMRLC LeucMRLC6 SyconMRLCa 0,704 0,747 LeucMRLC19 LeucMRLC21 1 SyconMRLCb 0,291 LeucMRLC23 EphmuMRLC 0,988AmquMRLC OscMRLC 0,87 MontaMRLC3 1 0,971 NveMRLCb 0,971 MetseMRLCb BflMRLCb 0,991 CteMRLCa Pdu-ST-MRLC 0,628 RypaRLC 0,987 LgiMRLCd 0,768 LgiMRLCa 0,718 0,923 PfuMRLC 0,951 PlmaMRLC 1 AirMRLCm ScolopMRLC 0,482 TriboMRLC 0,997 0,797 ArtfraMRLC 0,422 DaphMRLC 1 1DaphMRLCb BmorMRLCb 0,596 DmeMRLCm 0,878 0,98 AnopMRLCb TrichiMRLC 0,988 1 LoaMRLC1 0,738 Necator-am 0,922 CelMLC1 0,006 CelMLC2 MusMRLCat 0,989 GgaMRLCsk 0,864 HsaMRLCsk 0,791 RbMRLCsk 0,904 RatMRLCsk GgaMRLChe 0,595 HsaMRLCve RatMRLCve SpuMRLCa 0,678 SkoMRLCb SpuMRLCb 0,715 SpuMRLCc AscMRLC WuchMRLC 1 CelMLC4 0,77 AncyMRLC SkoMRLCa 0,83 0,87 HarpeMRLCn AnopMRLCnm BombyxMRLC DanaMRLCsm DmeMRLCnm CeraMRLCnm BflMRLC 1 BflMRLCa Callorhinc CalMRLC12B LepiMRLC 1 GgaMRLCsm 0,868 RatMRLCsm HsaMRLCsm PterMRLCsm BosMRLCsm XentrMRLCs TtdnMRLC FuguMRLC9 AstyMRLC9 IctaMRLCsm OryzMRLCsm 0,833 OreoMRLCsm Pdu-SM-MRLC HelobdMRLC 0,343 CrassosMRL LgiMRLCb 0,901 ApcalMRLC 0,965

0.4

Brunet et al. Supplementary Figure 1 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 Supplementary Figure 1. Phylogenetic trees of the markers investigated.

2 (A) Simplified Maximum Likelihood (ML) tree for Myosin Regulatory Light Chain (full

3 tree in panel M), rooted with Calmodulin, which shares an EF-hand calcium-binding

4 domain with MRLC. (B) ML tree for FoxF, rooted with FoxQ1, the probable closest

5 relative of the FoxF family (Shimeld et al. 2010). (C) MrBayes tree for bilaterian

6 ZASP/LBD3, rooted with the cnidarian ortholog (Steinmetz et al. 2012). (D) ML tree for

7 bilaterian Myosin Heavy Chain, rooted at the (pre-bilaterian) duplication between smooth

8 and striated MHC (Steinmetz et al. 2012). (E) MrBayes tree for Mef2, rooted by the first

9 splice isoform of the cnidarian ortholog (Genikhovich & Technau 2011). (F) MrBayes

10 tree for Titin, rooted at the protostome/deuterostome bifurcation (Titin is a bilaterian

11 novelty). (G) MrBayes tree for Troponin T, rooted at the protostome/deuterostome

12 bifurcation (Troponin T is a bilaterian novelty). (H) MrBayes tree for Troponin I, rooted

13 by the Calponin/Transgelin family, which shares an EF-hand calcium-binding domain

14 with Troponin I. (I) MrBayes tree for MyoD, rooted at the protostome/deuterostome

15 bifurcation (MyoD is a bilaterian novelty). (J) MrBayes tree for Myocardin, rooted at the

16 protostome/deuterostome bifurcation (the Drosophila myocardin ortholog is established

17 (Han et al. 2004)). (K) Complete MRLC tree.

18 Species names abbreviations: Pdu: Platynereis dumerilii; Xenla: Xenopus laevis; Mus:

19 Mus musculus; Hsa: Homo sapiens; Dre: Danio rerio; Gga: Gallus gallus; Dme:

20 Drosophila melanogaster; Cte: Capitella teleta; Patvu: Patella vulgata; Brafl:

21 Branchiostoma floridae; Nve or Nemv: Nematostella vectensis; Acdi: Acropora

22 digitifera; Expal: Exaiptasia pallida; Rat: Rattus norvegicus; Sko: Saccoglossus

23 kowalevskii; Limu or Lpo: Limulus polyphemus; Trib or Trca: Tribolium castaneum;

48 bioRxiv preprint doi: https://doi.org/10.1101/064881; this version posted July 20, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1 Daph: Daphnia pulex; Prcau: Priapulus caudatus; Cgi or Cgig: Crassostrea gigas; Ling

2 or Linan: Lingula anatina; Hdiv: Haliotis diversicolor; Apcal or Aca: Aplysia

3 californica; Spu: Strongylocentrotus purpuratus; Poli or Polis: Polistes dominula; Cin or

4 Cint: Ciona intestinalis; Hro: Helobdella robusta; Bos: Bos taurus; Capsa: Capsaspora

5 owczarzaki; Thtr: Thecamonas trahens; Lpo: ; Bga: Biomphalaria glabrata; Cel:

6 Caenorhabditis elegans; Tt: Terebratalia transversa; Octo: Octopus vulgaris; Sma:

7 Schmidtea mediterranea; Bbe: Branchiostoma belcheri, Batden: Batrachochytrium

8 dendrobaditis; Monve: Mortierella verticillata; Alloma: Allomyces macrogynus; Salpun:

9 Spizellomyces punctatus; Mucor: Mucor racemosus; Lichco: Lichtheimia corymbifera;

10 Ephmu: Ephydatia muelleri; Sycon: Sycon ciliatum; Amqu: Amphimedon queenslandica;

11 Osc: Oscarella lobularis; Metse: Metridium senile; Pfu: Pinctada fucata; Rypa: Riftia

12 pachyptila; Plma: Placopecten magellanicus; Air: Argopecten irradians; Scolop:

13 Scolopendra gigantea; Artfra: Artemia franciscana; Bmor: Bombyx mori; Loa: Loa loa;

14 Necator-am: Necator americanus; Trichi: Trichinella spiralis; Asc: Ascaris lumbricoides;

15 Wuch: Wucheria bancrofti; Ancy: Ancylostoma duodenale; Callorinc: Callorhinchus

16 milii; Dana: Danaus plexippus; Anop: Anopheles gambiae; Asty: Astyanax mexicanus;

17 Oreo: Oreochromis niloticus; Icta: Ictalurus punctatus.

18

19

49