(12) Patent Application Publication (10) Pub. No.: US 2013/0317087 A1 Maquat Et Al

US 20130317087A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2013/0317087 A1 Maquat et al. (43) Pub. Date: Nov. 28, 2013

(54) METHODS AND COMPOSITIONS RELATED Publication Classification TO STAUFEN 1 BINDING SITES FORMED BY DUPLEXING ALU ELEMENTS (51) Int. Cl. Inventors: Lynne E. Maquat, Rochester, NY (US); CI2O I/68 (2006.01) (75) (52) U.S. Cl. Chenguang Gong, Rochester, NY (US) CPC ...... CI2O I/6883 (2013.01) (73) Assignee: UNIVERSITY OF ROCHESTER, USPC ...... 514/44A: 436/501; 506/9: 435/6.12: Rochester, NY (US) 536/24.5 (21) Appl. No.: 13/984,709 (22) PCT Fled: Feb. 9, 2012 (57) ABSTRACT (86) PCT NO.: PCT/US12A24534 Disclosed are compositions and methods for identifying S371 (c)(1), binding sites of targets of Staul-mediated mRNA decay; (2), (4) Date: Aug. 9, 2013 methods and compositions for treating Subjects with condi tions resulting from Staul-mediated mRNA decay, and Related U.S. Application Data method of screening for therapeutic agents. Also disclosed is (60) Provisional application No. 61/440,967, filed on Feb. the new pathway as a means for cells to down-regulate the 9, 2011. expression of Staul-binding mRNAs. Patent Application Publication Nov. 28, 2013 Sheet 1 of 39 US 2013/0317087 A1

SSS:

: we & SRN &

sire Sv$3's S&S $. 3:Sys,

was SS on- &S sys’s

were {SS $$.

water SSS S. Ya. sees &C., SSX . A. se OASL mRN

F.G. 1-1 Patent Application Publication Nov. 28, 2013 Sheet 2 of 39 US 2013/0317087 A1

W. SyrSw six e S&NA ses a. Y G - s s S RNs,

CX S&N &

s 3. CXCL1 RN.

Sys Ny.

- yiSS rRNA

Svi Niš

Sv3S SNA TMSL8 mRNA

(SX S&NA

sy SUBSTITUTE SHEET (RULE 26) Y& N. FIG. 1-2 Patent Application Publication Nov. 28, 2013 Sheet 3 of 39 US 2013/0317087 A1

St. W st Y. Seas as “sto F isas . SS. Y -r is -

R. R. a a

Sy; KNA

^ - - - - SS SS S S &S ii e-ji, N airNA & so et x x 3. r is .3 er, N &

SERN RNA

tr & RNA

- Sys, RN &

R. Sy :- - -

------&NA. & N Y - Y go Patent Application Publication Nov. 28, 2013 Sheet 4 of 39 US 2013/0317087 A1

assass o

2O2

FG, 3 Patent Application Publication Nov. 28, 2013 Sheet 5 of 39 US 2013/0317087 A1

C SiRNA Contro 200 p. & SA U f

5 O

O O

5 O

is FLUC. FLJ21870 3'UTR RNA 3'UTR RNA

p%-sps AS or p-sisrMAS

p-sisrNAS-RS2bs

pFi, C-AS3ts

FIG. 3 Patent Application Publication Nov. 28, 2013 Sheet 6 of 39 US 2013/0317087 A1

|--

sts

SSS &

SS: S&S. SSSS: $g

FIG. 3 Patent Application Publication Nov. 28, 2013 Sheet 7 of 39 US 2013/0317087 A1

3 a S a siRNA { sy en re ex m en m r * r * is

2 s S Ag-S2-hRif * NB: ct-Fi. As SAt WB: a-STAU) (airexi * NB: acairexin

** is sis

SiRNA

s 150 Cot 88 iss is gg 100 si -- O

. g i. Rg O; 0 SERNE F28 RNA RNA

FIG 3 Patent Application Publication Nov. 28, 2013 Sheet 8 of 39 US 2013/0317087 A1

FIG. 4-1 Patent Application Publication Nov. 28, 2013 Sheet 9 of 39 US 2013/0317087 A1

**:******X. **,?????????

**:******xx:

*****

{{}} §§§ FG, 4-2 Patent Application Publication Nov. 28, 2013 Sheet 10 of 39 US 2013/0317087 A1

FG, 4-3 Patent Application Publication Nov. 28, 2013 Sheet 11 of 39 US 2013/0317087 A1

& N : S& && & y

k is M & v. s s & s - Y -

Patent Application Publication Nov. 28, 2013 Sheet 12 of 39 US 2013/0317087 A1

-¿?-.*****.:º.4.***

FG. 4-5 Patent Application Publication Nov. 28, 2013 Sheet 13 of 39 US 2013/0317087 A1

??<;,&ž*4.3%...3%),~~~~~~);

FG. 4-6 Patent Application Publication Nov. 28, 2013 Sheet 14 of 39 US 2013/0317087 A1

FG, 4-7 Patent Application Publication Nov. 28, 2013 Sheet 15 of 39 US 2013/0317087 A1

& wNed (v) \ided

s 8 w

& * x: S.A. waxxx SS^ y a s & C s S is a -s-s-s-s- r SS poor a x x 3. s 3 S. SS:

ssy & &W S

Y *: we &: s & s s S s & se Fr's RSS & & S3 & SX S. SYY S is S&e S. S. as & & $3. s

Patent Application Publication Nov. 28, 2013 Sheet 17 of 39 US 2013/0317087 A1

------p'4-sbsRNA1(S) S 3 is S. ge g g ; ; ; ; ; ; SiRNA (5 : S. S. & S. S. G- ( ...... K c ------S:Ei , ; i; Ei; ; ; i; P. SA-1 has (WB: a-HA Calnexin (WB ca-Calnexin)

$: 8:::::$3i si is : 8888i siRNA* p:-st:sk-i Aisi

RNAi siRN&-- a-sisrNAisi S.

2 :

SSS8i SESR N is $ $$$. $$$$$$$$$.

FG, 6 Patent Application Publication Nov. 28, 2013 Sheet 18 of 39 US 2013/0317087 A1

Regiatei isy Sir ti-SER NE 3. . . ------Ssssssssss'XXXX-XXXXXXXX

C Off SA PF -SSRNA1 Sir A i if Gs it 3. f2 -is 5a gfi :i 52s ) . &K if2 pFLUC-SERPINE13'UTR SAu (WB: a-STAu1 - UPF (WB: a-UPF) - Calnexin (NB: ct-Cadingxi)

at a-sisr-A

-- SiG mRNA

F.G. 6 Patent Application Publication Nov. 28, 2013 Sheet 19 of 39 US 2013/0317087 A1

Sir A

WAAAAAAAAAAAAAAY KAAAAAAAAAAAAAA Gs. 2. X8. 888 & 8x s'i s i -- STAl-As (NB: a-HA -- Cainexit (S. c-Cainexin)

T. SERNE RNA SERPINE mRNA (9%) st SERPINE mRNA S is g|After IPBefore IP (%) -- 28, YRNA o St. F.J2870 mRNA (%) see, FS Sys Nis 3 After Pi Before P 6 s : S: Ss iss -...s. X--> w-XX. en- assir is (N --SSRNA s g After P. Before P (%) SG RNA

- E. coii ACY RNA

FG. 7 Patent Application Publication Nov. 28, 2013 Sheet 20 of 39 US 2013/0317087 A1

Siri

aa.sa sa ss was RAS Niš

see Sis RNA 3 3 Rastrip mRNA (6)

se s r

g Sir s i

re s ww. ww.S. s N as: vee S abara %

s a isyear is SERPINE1 mRNA (%)

· - Fifi RA Fi21870 in RNA is

s: - RASFP RNA RAB, FIP RNA (i.

8 × 8 is is six sess --Sfig7 rRNA

FG. 8 Patent Application Publication Nov. 28, 2013 Sheet 21 of 39 US 2013/0317087 A1

sts sixà,

issisi is Siria

SS SSSSŠ SS. f.i.28$ $ g siRNA&S

Rås is sisal S.

FG. 8 Patent Application Publication Nov. 28, 2013 Sheet 22 of 39 US 2013/0317087 A1

S RNA AG ei 393 sis

s S

$sS$Š ss S 3 WSW&

SS&S& S.S. S.ŠS&sSS S ...... $...... &s. S. WYY S. s' S S.Š S. S S.Š S. SS & S S S SSis SS$ Š$$$$. S&S SS -

AeaelSsss V Y Y YY Šssysa. SS Ss SS 432 SSSir &SSRNA

FIG. 9 Patent Application Publication Nov. 28, 2013 Sheet 23 of 39 US 2013/0317087 A1

--- S.

g ema e xeer O r m t 5(f) -- 3i. : s 5 - S is9 <2 - 25 S I C () tWNSqS-74 WN&SCS-24 ZWNSGS-24 WNASGS-7, do ss WIS OJuOO Patent Application Publication Nov. 28, 2013 Sheet 24 of 39 US 2013/0317087 A1 % wnaesqs„“*…!

-%),~ **vnºsas

s Patent Application Publication Nov. 28, 2013 Sheet 25 of 39 US 2013/0317087 A1

s -

&Y s

as:

era &W, . 8-v- 8 Y x -

Patent Application Publication Nov. 28, 2013 Sheet 26 of 39 US 2013/0317087 A1

, s

s -- 3.22 mg/ml

3 s r 2.12 mg/ml

0. 4. ww. s - 1.04 mg/ml. s \\ - 0.35 mg/ml

3 w8 , 2 8s s s3 8s

s' (Svedbergs)

FIG 10 Patent Application Publication Nov. 28, 2013 Sheet 27 of 39 US 2013/0317087 A1

RNase A

is sy s: & S. 3 : SR s S3 is s S sy s E. s. S s s pEGR-STA.SSS S is & YW is s a.

* : * r * r * is SSS S.: S:C. , S: , E.S: pnik we iswres Ali & Sr Sai - Ss - a

^ p 8 xxx wax. XXXX 888 S. & X is s &is S & Saxx. & ej-, op. 'RB'sE. "E. " city - ini-SS-R'sS * RER.'RB's (8 a-RFP) rippMiss 'RED's RBD's ice,- exposure hSIAU1 (WB: OSIA1) SIAU rt Dorkerexposure

--Carexit 8 x-Conexis

F.G. 10 Patent Application Publication Nov. 28, 2013 Sheet 28 of 39 US 2013/0317087 A1 ****************************************************************************************** ~~~~€Œ-~~~~€Œ---- IIº‘DILI

SeDice ea SepiceJehu Patent Application Publication Nov. 28, 2013 Sheet 29 of 39 US 2013/0317087 A1

--s - SS wsa 8x s & S-3 stXFs is ww.

************ II“OICH 9,088,

s E3.

& & S. Patent Application Publication Nov. 28, 2013 Sheet 30 of 39 US 2013/0317087 A1

s S. S. & S S

*s y

& s

Patent Application Publication Nov. 28, 2013 Sheet 31 of 39 US 2013/0317087 A1

Structure

css-complexotion signifigance score

FIG. 13 Patent Application Publication Nov. 28, 2013 Sheet 32 of 39 US 2013/0317087 A1

A-2 PSA Rest structure 1 structure 2 Selection range Class Symmetry operation X. Š x^ Number of atons interface surface tot Number of residues interface surface total Solvent-accessible area.A. interface

Selection range i Cess Protein Symmetry operation ------, -g- if Symmetry ID 8885 Number ofinterface atoms surface total Number of residues interface surface it total Solvent-accessible area.A. interface total Patent Application Publication Nov. 28, 2013 Sheet 33 of 39 US 2013/0317087 A1

S S S S

FG, 13 Patent Application Publication Nov. 28, 2013 Sheet 34 of 39 US 2013/0317087 A1

Š S. S Sw

Š y

F.G. 14 Patent Application Publication Nov. 28, 2013 Sheet 35 of 39 US 2013/0317087 A1

ax fra ~. ZITTMINTMACHOSENGÅIOHSI?ddOSSONITS ~#~{….?*****..^,…****&}JIENAÐHVORVATIONNADÓIR:IOMETISIETOI #7I“OICH r x

|uobox. Patent Application Publication Nov. 28, 2013 Sheet 36 of 39 US 2013/0317087 A1

Patent Application Publication Nov. 28, 2013 Sheet 37 of 39 US 2013/0317087 A1

s s 3. S.

. s & w w S.; C:

8: { 3.

N i. & Me \ Patent Application Publication Nov. 28, 2013 Sheet 38 of 39 US 2013/0317087 A1

SI“OICH

V Patent Application Publication Nov. 28, 2013 Sheet 39 of 39 US 2013/0317087 A1

s Drosophila STAUa RBD3

Human STAU1 RBD'5

FG, 15 US 2013/0317087 A1 Nov. 28, 2013

METHODS AND COMPOSITIONS RELATED mRNA, which is insensitive to Staul siRNA and served to TO STAUFEN 1 BINDING SITES FORMED BY control for variations in RNA recovery. Numbers below each DUPLEXING ALU ELEMENTS lane specify the fold change in the level of each test transcript 0001. This application claims the benefit of U.S. Provi in cells treated with Staul siRNA relative to Control siRNA, sional Application No. 61/440,967, filed on Feb. 9, 2011, the latter of which was defined as 1. which is incorporated by reference herein in its entirety. 0008 FIG. 2 shows that c-JUN, SERPINE1 and IL7R 0002 This invention was made with government support mRNAs are increased in abundance in human cells depleted of either Upf1 or Staul but not Upf2. HeLa cells were tran under National Instutes of Health Grant GMO74593, RO1 siently transfected with Staul, Staul (A), Upf1, Upf1(A) or GM074593, NCI T32 CA09363, 1S10 RR026501, 1S10 Upf2 siRNA or, to control for nonspecific depletion, Control RR027241, NIH NIAID P30 AI078498, NIH/NCRR siRNA. Three days later, protein and RNA were purified. FIG. RR-01646, and NSF award DMR-0225180. The government 2A shows Western blot analysis, where the level of Vimentin has certain rights in the invention. serves to control for variations in protein loading, and the I. BACKGROUND OF THE INVENTION normal level of Stau1, Upfl or Upf2 is determined in the presence of Control siRNA. FIG. 2B shows RT-PCR analysis 0003 Expression of truncated or nonsense proteins play a of the levelofendogenous c-JUN mRNA (upper), SERPINE1 role or are the causative agent in many inherited disorders and mRNA or IL7R mRNA (lower), each of which is normalized cancers. These truncated or nonsense proteins result from to the level of endogenous SMG7 mRNA. The normalized mutations or aberrant mRNA splicing that result in early level of each mRNA in the presence of Control siRNA is termination signals in the mRNA. Mammalian Staufen 1 defined as 1. RT-PCR results are representative of three inde (Staul) is an RNA binding protein that binds to extensive pendently performed experiments that did not differ by the RNA secondary structures, primarily through one or more amount specified. double-stranded RNA-binding domains. In mammals, the 0009 FIG. 3 shows that lincRNA AF087999 (1/2-sb Staul gene is ubiquitously expressed and is involved in sRNA1) binds to and reduces the abundance of specific SMD mRNA transport and translational control. Staul is associated targets. FIG. 3a shows predicted base-pairing between the with degredation of translationally active mRNAs that bind Alu element within the SERPINE1 or FLJ21870 3'UTR and the double-stranded (ds)RNA binding protein STAU1, a pro the Alu element within /2-sbsRNAL where 1 was defined as cess known as Stual-mediated mRNA decay or SMD. What the first transcribed nucleotide of each mRNA or /2-sbsRNA1 is needed or methods of identifying targets for SMD and (S). FIG. 3b shows at left: Western blotting (WB), using the compositions that can modulate SMD so that disorders asso designated antibody (C), of lysates of HeLa cells treated with ciated with early termination signal in mRNA can be properly the specified siRNA, where Calnexin serves as a loading identified and treated. control. Right: Representation of RT-sqPCR analyses of /2- SbSRNAL SERPINE1 or FLJ21870 mRNA from the same II. SUMMARY OF THE INVENTION lysates, where the normalized level of each transcript in the 0004. In accordance with the purposes of this invention, as presence of Control siRNA was defined as 100. FIG.3c shows embodied and broadly described herein, this invention, in one representation of RT-sqPCR analyses of FLUCSERPINE1 aspect, relates to methods of identifying targets for Staufen 1 3'UTR or FLUC-FLJ21870 3'UTR SMD reporter mRNA in (Staul) mediated decay (SMD); screening for agents that cells that had been transiently transfected with the specified modulate SMD and treating subjects with conditions that siRNA, where the normalized level of each transcript in the result from or modified by affecting SMD. presence of Control siRNA was defined as 100. FIG. 3d 0005 Additional advantages of the invention will be set shows diagrams of expression vectors encoding /2-sbsRNA1 forth in part in the description which follows, and in part will (S)R, which is siRNA-resistant, /2-sbsRNA1(S) or FLUC be obvious from the description, or may be learned by prac with or without 12 copies of the MS2 coat proteinbinding site tice of the invention. The advantages of the invention will be (MS2bs). FIG. 3e shows western blot (upper) or RT-sqPCR realized and attained by means of the elements and combina (lower) before (-) or after immunoprecipitation (IP) using tions particularly pointed out in the appended claims. It is to anti-FLAG or, as a control for nonspecific IP mouse(m) IgG be understood that both the foregoing general description and of lysates of formaldehyde-crosslinked HeLa cells that had the following detailed description are exemplary and been transiently transfected with pFLAGMS2-hMGFP and explanatory only and are not restrictive of the invention, as either the denoted /2-sbsRNA1 (S) expression vector or claimed. pFLUC MS2bs. FIG. 3f shows, s in 3e, except cells were treated with Control or STAU 1 siRNA. Left: Western blot ting. Right: RT-sqPCR, where the co-IP efficiency indicates III. BRIEF DESCRIPTION OF THE DRAWINGS the level of each mRNA-derived product after IP relative to 0006 The accompanying drawings, which are incorpo before IP. Each ratio in the presence of Control siRNA was rated in and constitute a part of this specification, illustrate defined as 100%. Error bars indicates.e.m. Single asterisk, several embodiments of the invention and together with the n=6, P<0.01; double asterisks, n=3, PK0.05. description, serve to explain the principles of the invention. 0010 FIG. 4 shows the predicted base-pairing between the 0007 FIG. 1 shows that 11 of 12 transcripts that were Alu element within the specified mRNA and the partially upregulated in human cells depleted of Staul using three complementary Alu element within the denoted /2-sbsRNA. independently performed microarray analysis are upregu FIG. 4a shows predicted base-pairing between the Alu ele lated using RT-PCR and transcript-specific primers. Notably, ment within the SERPINE1 or FLJ21870 3'UTR and the Alu RNAs analyzed were identical to the RNAs from Control and element within /2-sbsRNAL where 1 was defined as the first Staul siRNA-treated samples analyzed in FIG. 2. The level of transcribed nucleotide of each mRNA or /2-sbsRNA1(5). each test transcript was normalized to the level of SMG7 FIGS. 4b, 4c, and 4d. Essentially as in 4a. US 2013/0317087 A1 Nov. 28, 2013

0011 FIG.5 shows the mapping the 5' end of /2-sbsRNA1 FIG. 8b shows RT-sqPCR analyses of specified RNAs, where (S), and determining that the cellular abundance of /2-sb the level of SMG7 mRNA controlled for variations in RNA sRNA1(S) relative to /2-sbsRNA1(L) is 3:1 in HeLa cells. recovery. FIG. 8c shows phase-contrast microscopy, which FIG. 5a shows /2-sbsRNA1 mapping using an RNase Protec measured the rate of HaCaT keratinocyte wound healing after tion Assay (RPA) and three uniformly 32P-labeled RNA transfection with the specified siRNA for 48 hr followed by probes generated in vitro by transcribing a subclone of Chr11 scrape injury at 0 and 16 hr. Higher levels of SERPINE1 DNA (Chr11 66193000-66191383) to the designated correlate with poorer prognoses for patients with brain restriction site. FIG. 5b shows Single stranded DNA primer tumors as well as breast, ovarian, gastric, colorectal, non extension analysis of poly(A)--HelLa-cell RNA (leftmost Smallcell lung, renal-cell or head-and-neck cancer due to lane) or pcDNA3.1 (+)/Zeo Chr11 66193000-66191383 in increased cancer-cell invasiveness, in at least some the presence of the specified dideoxy NTP (four rightmost instances 1. In fact, SERPINE 1 stimulates “wound healing lanes). 1 specifies the first nucleotide of/2-sbsRNA1 (S). FIG. after Scrape injury to keratinocyte monolayers as monitored 5c shows RTsqPCR analysis of total HeLa-cell RNA, which by the migration rate of human keratinocyte HaCaT cells into corroborated data shown in 5a and 5b, narrowed the 5' end of a denuded wound track2. Likewise, RAB11 family interact /2-sbsRNA1 (S) to reside between positions -14 and +8, ing protein 1 (RAB11 FIP1), which is also encoded by an where +1 is the 5' end defined by primer extension in 5b. The mRNA that contains a single 3'UTR Alu element and is down analysis also demonstrated the presence of/2-sbsRNA1(L)at regulated by STAU1 and /2-sbsRNA1 (FIG. 8a), stimulates one-third the abundance of /2-sbsRNA1(S), i.e., at 0.25fold wound-healing after scrape injury to breast epithelial the abundance of /2-sbsRNA1(S+L). RT was primed using MCF 10A cells3. To test for /2-sbsRNA1 function in wound random hexamers, and sqPCR was performed using one of healing, HaCaT cells were transfected with Control siRNA, the specified sense primers (#1-#9) and the common anti SERPINE1 siRNA, FLJ21870 siRNA, RAB11FIP1 siRNA sense primer. The arrow marks the transcription start site for or '/2-sbsRNA1 siRNA. Each siRNA successfully downregu /2-sbsRNA1 (S), which maps within sense primer #8 as lated its RNA target (FIG.8b). Scrape injury repair assays that denoted by the dotted vertical line. FIG. 5d shows the were monitored over a 16-hr period revealed that SERPINE1 sequence (SEQ ID NO: 50) of fulllength /2-sbsRNA1(S). siRNA or RAB11 FIP1 siRNA inhibited cell movement into Red nucleotides, Alu element; redbox, putative poly(A) sig the wound tract, whereas /2-sbsRNA1 siRNA promoted cell nal; (A)n, poly(A)tail. movement (FIG. 8c). Thus, /2-sbsRNA1 contributes toward 0012 FIG. 6 shows that /2-sbsRNA1 co-immunoprecipi reducing cell migration by targeting SERPINE1 and tates with STAU1 and is required for STAU1 binding to RAB11 FIP1 mRNAs for SMD. Scrape injury repair assays specific SMD targets. FIG. 6a shows western blotting (upper) also indicate that FLJ21870 siRNA promoted cell movement or RT-sqPCR (lower) of lysates of formaldehyde-crosslinked (FIG. 8c). Since FLJ21870 function remains to be character HeLa cells that had been transiently transfected with the ized, and since mechanisms that regulate FLJ21870 mRNA specified siRNA and either empty vector (-) orp/2-sbsRNA1 abundance are unknown aside from the mechanism presented (S)R (+) before or after IP with anti-HA or rat IgG. After IP here, uncovering the significance of the wound-healing result each sample was spiked with in vitrosynthesized E. coli obtained using FLJ21870 siRNA requires future studies. LACZ mRNA. The co-IP efficiency provides the level of each 0015 FIG. 9 shows evidence that /2-sbsRNA2, /3-sb mRNA RT-sqPCR product after IP relative to before IP, where sRNA3 and /2-sbsRNA4 base-pair with particular mRNA each ratio in the presence of Control siRNA was defined as 3'UTRs and decrease mRNA abundance, as do STAU1 and 100%. FIG. 6b shows diagrams of pFLUC-SERPINE1 UPF1. FIG. 9a shows the predicted base-pairing between the 3'UTR FL, which contains the full-length (FL) SERPINE1 3'UTR Alu element of CDCP1 mRNA (Accit: NM 022842) 3'UTR, and 3'UTR deletion variants. Yellow boxes, FLUC and /2-sbsRNA2, or MTAP mRNA (Accit: NM002451) and sequences; blue bars, SERPINE1 3'UTR sequences: A. dele /2-sbsRNA3 as well as /2-sbsRNA4, where 1 was defined as tion: pale green boxes, 3'UTR of FLUC No SBS, which does the first nucleotide listed in the NCBI data base for each not bind STAU1. The 5'-most pale green box ensures that mRNA or lincRNA. FIG.9b is ssentially as in FIG.3b. Error ribosomes translating to the FLUC termination codon do not bars indicates.e.m. Asterisk, n=6, P<0.01. FIG. 9c shows a displace STAU1 that had been recruited to the /2-sbsRNA1 model for how an Alu element containing /2-sbsRNA that is binding site (which is 86 nucleotides as shown in FIG. 4a). polyadenylated and largely cytoplasmic (red) base-pairs with FIG. 6c shows western blotting (upper) and RTsqPCR a partially complementary Alu element, i.e., a half-STAU1 (middle and lower) of lysates of HeLa-cells that had been binding site (/2-SBS), within the 3'UTR of a particular transiently transfected with the noted pFLUC-SERPINE1 mRNA (blue) to trigger SMD. Base-pairing forms a func 3'UTR test construct and the phOMV-MUP reference plas tional SBS. The STAU1-bound SBS triggers SMD in a UPF1 mid. Lower: The normalized level of each FLUC mRNA in dependent mechanism when translation terminates Suffi the presence of Control siRNA was defined as 100%. Error ciently upstream of the SBS so that translating ribosomes do bars indicate s.e.m. Single asterisk, n=6, P-0.01; double not remove boundSTAU1. The /2-sbsRNA is not destroyed in asterisks, n=3, PKO.05. the process. N, nucleus; C, cytoplasm; AUG, translation ini 0013 FIG. 7 shows that downregulating SERPINE1 tiation codon; Ter, termination codon (which is generally, but mRNA or FLJ21870 mRNA does not decrease the efficiency not necessarily, a normal termination codon). with which STAU1-HA3 co-immunoprecipitates with /2-sb 0016 FIG.10 shows that SSM is Critical for Dimerization sRNA1. Essentially as in FIG. 6a, except that HeLa cells were of hSTAU1 SSM-RBD5. FIG. 10a shows diagrams of the transfected with the specified siRNA. modular organization of domains and motifs within 0014 FIG. 8 shows that RAB11 FIP1 mRNA is an SMD hSTAU1, its orthologs and its paralogs. Regions shown target that is down-regulated not only by STAU1 but also by include dsRNA-binding domains (RBDs) 3 and 4 (shaded !/2-sbsRNAL FIG. 8a shows RT-sqPCR was as in FIG. 3b, grey), which have been shown to bind dsRNA, the region that except that RAB11 FIP1 mRNA constituted the test mRNA. binds tubulin (TBD) in vitro (solid grey; amino acids 282-372 US 2013/0317087 A1 Nov. 28, 2013

in STAU1), and the STAU-swapping motif (SSM)-RBD5 ces (green C.1 and C.2) and the RBD5 C-helices (blue C.1 and region (yellow; amino acids 367-476 in hSTAU1, which C.2). Important residues are shown as stick representations, overlaps with the TBD and for which the X-ray crystal struc colored yellow, and labeled. The hydrogen-bonding interac ture was reported). FIG. 10B shows SSM, which typifies tion is shown as a dotted line. hSTAU1 and hSTAU2 paralogs, is conserved in all groups of (0.019 FIG. 13 shows support for SSM-RBD'5-SSM Vertebrates. Multiple sequence alignment was performed RBD5 Domain-Swapping, i.e., a transArrangement. FIG. using vertebrate group representatives from fish (Zebrafish, 13A shows possible cis and trans arrangements of symmetry Danio rerio, NP991 124.1(SEQ ID NO: 143)), amphibians mates in the structure (left) and PISA results (right). FIG. 13B (African clawed frog, Xenopus laevis, NP 001085239.1 for shows interactions of the unfavored, i.e., cis orientation. Resi STAU-1 (SEQID NO: 144), NP 0010869.18.1 for STAU-2 dues of this crystal contact that were used to design SSM (SEQID NO: 145)), reptiles (Carolina anole: Anoliscarolin RBD 5 (E424H, D427V) are shown. ensis, XP 003220668.1 (SEQ ID NO: 142)), birds (zebra 0020 FIG. 14 shows a comparison of the Degenerate finch, Taeniopygia guttata; XP 00218.8609.1 (SEQ ID NO: RBD 5 with a RBD that Binds dsRNA. FIG. 14A shows the 141)), and mammals, i.e., human Homo sapiens (NP structure-based sequence alignment of hSTAU1 RBDS (top 0.04593.2 for STAU1-a(SEQID NO:139), NP 001157856.1 green sequence) (SEQ ID NO: 156) and hTRBP2 RBD1 for STAU2-e(SEQID NO: 146), STAU2-b; NP 001157853. (bottom grey sequence) (SEQ ID NO: 157). Conserved 1(SEQ ID NO: 147)) and mouse Musmusculus (STAU1-2: hydrophobic amino acids are shaded yellow, and conserved NP 001103375.1(SEQ ID NO: 140), STAU2-2: NP Tyrand Lys residues are shaded cyan and green, respectively. 001 104742.1 (SEQ ID NO: 148)). The secondary structure Key residues discussed in the text are blue if positively represented in yellow below the sequence alignments derives charged and red if negatively charged. Small upward-point from the structure reported here. FIG. 10C shows analytical ing arrowheads indicate the position of residues reported for ultracentrifugation results Support a model for the existence hTRBD2 RBD 1 and RBD2 that interact directly with of a SSM-RBD5 monomer dimer equilibrium in solution. dsRNA. FIG. 14B shows a cartoon of superposed hSTAU1 The normalized apparent () sedimentation coefficient distri RBD'5 (green) and hTRBP2 RBD 1 (grey) produced by bution (g(s) is plotted as a function of apparent Svedbergs Dali. FIG. 14C shows X-ray crystal structure of hTRBP2 (s). FIG. 10D shows RBD5 homodimerization in human RBD2 in complex with dsRNA. hTRBP2 RBD2 is shown cells requires SSM. HEK293T cells (1x10/150-mm dish) rather than hTRBP2 RBD1, which is more similar to hSTAU1 were transiently transfected with a pEGFP-RBD'5 (5 ug) RBD'5, since hTRBP1RBD1 lacks a complete Loop 2 (L2). and either pmRFP SSM-RBD'5 (5ug) or pmRFP-RBD5 Protein is blue and in cartoon-form, and dsRNA is in stick (5 Jug). Alternatively, cells were transfected with plGFP representation. The three major interacting RBD regions of SSM-RBD'5 (5 g) and either pmRFP SSM-RBD'5 (5 typical RBDS are approximated using round-edged enclo ug) or pmRFP-RBD'5 (5ug). Cell lysates were immunopre sures to illustrate the important secondary structures. FIG. cipitated in the presence of RNase A using antiCC.)-GFP or, to 14D Shows a cartoon of either hTRBP2 RBD 1 or STAU1 control for nonspecific immunoprecipitation (IP), mouse(m) RBD'5 Superimposed on hTRBP2 RBD2, shown in relation IgG. Western blotting (WB) using the specified antibody, to the position of dsRNA in the TRBP2 RBD2 structure. where calnexinservesto control for IP specificity. Results are Vacuum electrostatic potentials were generated using representative of three independently performed experi PyMOL to illustrate charge variance, where blue is positive, mentS. red is negative, and white is neutral on the Surface represen 0017 FIG. 11 shows that some but not All InvertebrateS tation of each protein. As in C, regions necessary to interact TAU Proteins have an SSM. Multiple protein sequence align with dsRNA are indicated. ments of the STAU proteins in FIG. 10B and STAU proteins (0021 FIG. 15 shows a structural comparison of STAU1 from the following invertebrates: acorn worm, Saccoglossus RBD3 (hSTAU1 RBD3 SEQID NO: 158; dSTAUa RBD3 kowalevskii, XP 002731114.1(SEQID NO: 149); deer tick, (SEQ ID NO: 159)) and STAU1 RBD'5 (SEQID NO: 160) Ixodes scapularis, XP 002433902.1 (SEQ ID NO: 150); Through the Highly Similar NMR Structure of D. melano water flea, Daphnia pulley, EFX74549.1 (SEQ ID NO: 151); gaster STAU RBD3. FIG. 15A shows structure based fruit fly, Drosophila melanogaster, NP 476751.1 (SEQ ID sequence alignment between proteins. FIG. 15B shows NO: 152); mosquito, Anopheles gambiae, XP 308394.4 vacuum electrostatic potentials were calculated using (SEQ ID NO: 153); roundworm, Caenorhabditis elegans, PyMOL for RBD3 (surface) and are shown in complex with CCD62871.1 (SEQID NO: 154); red flour beetle, Tribolium the bound hairpin RNA (sticks). The hSTAU1 RBD5 elec castaneum, EFA11564.1(SEQID NO: 155). The dotted lines trostatic model from FIG. 14D is shown for comparison. between SSM and RBD5 in this figure do not exist in FIG. 1B because weak similarities between D. melanogaster IV. DETAILED DESCRIPTION STAU-A, which lacks an SSM, and the SSM of other proteins 0022. The present invention may be understood more shifts SSM sequences to the left. readily by reference to the following detailed description of 0018 FIG. 12 shows the structure of the SSM-RBD5 preferred embodiments of the invention and the Examples Domain-Swapped Dimer. FIG. 12A shows a cartoon of the included therein and to the Figures and their previous and secondary structure of SSM-RBD5 where one molecule of following description. SSM-RBD5 is green, the other molecule is blue. The two 0023. Before the present compounds, compositions, C-helices of SSM contact the two C-helices of RBD5. Dot articles, devices, and/or methods are disclosed and described, ted lines represent the assumed linkage between SSM and it is to be understood that this invention is not limited to RBD 5 since the crystal structure lacks connecting density. specific synthetic methods, specific recombinant biotechnol The rightmost dimer structure is rotated 90° around the ogy methods unless otherwise specified, or to particular X-axis relative to the leftmost dimer structure. FIG. 12B reagents unless otherwise specified, as such may, of course, shows a close-up of the interaction between the SSM C-heli vary. It is also to be understood that the terminology used US 2013/0317087 A1 Nov. 28, 2013

herein is for the purpose of describing particular embodi within the dendrites of hippocampal neurons in a microtu ments only and is not intended to be limiting. bule-dependent manner, as well as its encapsidation together 0024. As used in the specification and the appended with HIV-1 RNA in virus particles. Additionally, Staul inter claims, the singular forms “a,” “an and “the include plural acts with telomerase RNA, suggesting that it functions during referents unless the context clearly dictates otherwise. Thus, DNA replication, cell division or both, possibly by influenc for example, reference to “a pharmaceutical carrier includes ing telomerase RNA processing or RNP assembly or local mixtures of two or more Such carriers, and the like. ization. 0025 Ranges may be expressed herein as from “about Staul Mediated mRNA Decay (SMD) one particular value, and/or to “about another particular 0034 Staufen 1 (STAU1)-mediated mRNA decay (SMD) value. When Such a range is expressed, another embodiment degrades translationally active mRNAs that bind the double includes from the one particular value and/or to the other stranded (ds)RNA binding protein STAU1 within their 3'-un particular value. Similarly, when values are expressed as translated regions (3'UTRs). The STAU1 binding site (SBS) approximations, by use of the antecedent “about, it will be is within ADP ribosylation factor 1 (ARF1) mRNA as a understood that the particular value forms another embodi 19-basepair stem with a 100-nucleotide apex. However, com ment. It will be further understood that the endpoints of each parable structures within the 3'UTRs of other SMD targets of the ranges are significant both in relation to the other were not identified. Herein is disclosed that SBSs can be endpoint, and independently of the other endpoint. formed in cis by intramolecular base-pairing within an 0026. In this specification and in the claims which follow, mRNA3'UTR, or in trans by imperfect base-pairing between reference will be made to a number of terms which shall be an Alu element within the 3'UTR of an SMD target and defined to have the following meanings: another Alu element within a cytoplasmic and polyadeny 0027 “Optional or “optionally’ means that the subse lated long noncoding RNA (IncRNA). When translation ter quently described event or circumstance may or may not minates sufficiently upstream of an SBS, association of the occur, and that the description includes instances where said ATP-dependent RNA helicase UPF 1 with SBS-bound event or circumstance occurs and instances where it does not. STAU1 triggers mRNA decay analogously to how UPF1 0028 “Primers' are a subset of probes which are capable association with an exon-junction complex that resides suffi of Supporting some type of enzymatic manipulation and ciently downstream of premature termination codon triggers which can hybridize with a target nucleic acid such that the nonsense-mediated mRNA decay. Individual linckNAs can enzymatic manipulation can occur. A primer can be made downregulate a subset of SMD targets, and distinct lincRNAs from any combination of nucleotides or nucleotide deriva can downregulate the same SMD target. These are previously tives or analogs available in the art which do not interfere with unappreciated functions for ncrNAs and Alu elements. the enzymatic manipulation. 0035) Stau1 is involved in mRNA decay. Also, Stau1 0029) “Probes’ are molecules capable of interacting with a mediated mRNA decay involves the nonsense-mediated target nucleic acid, typically in a sequence specific manner, mRNA decay (NMD) factor Upf1. In mammalian cells, the for example through hybridization. The hybridization of expression of protein-encoding genes requires a series of nucleic acids is well understood in the art and discussed steps in which pre-mRNA is processed to mRNA in the herein. Typically a probe can be made from any combination nucleus before mRNA is translated into protein in the cyto of nucleotides or nucleotide derivatives or analogs available plasm. These steps are subject to quality control to ensure that in the art. only completely processed mRNA is exported to the cyto 0030. As used herein, “chemical refers to any reagent that plasm. One form of quality control, called mRNA surveil can bind, mutate, dissolve, cleave, initiate a reaction that lance or NMD. NMD in mammalian cells is generally a results in a new agent, or alter the confirmation of a target splicing-dependent mechanism that degrades newly synthe agent. An example of a chemical would be a small molecule. sized mRNAs that prematurely terminate translation more 0031. As used herein, "pioneer round of translation” or than 50-55 nucleotides upstream of an exon-exonjunction as “pioneering round” refers to an initial round of mRNA trans a means to prevent the synthesis of potentially harmful trun lation prior to steady-state translation. The round is charac cated proteins. By so doing, NMD precludes the synthesis of terized by the presence of CBP80 and CBP20 as the CAP the encoded truncated proteins, which can function in delete binding proteins, PABP2 as a polyadenylation binding pro rious ways. NMD also targets naturally occurring mRNAs tein, and involves Upf2 and Upf3 or Upf3X. Such as certain selenoprotein mRNAS and an estimated one 0032. In one aspect disclosed herein are methods of third of alternatively spliced mRNAs, some of which encode screening, methods of treatment, and compositions related to functional protein isoforms. Staufen 1 mediated mRNA decay (SMD), targets of SMD and 0036. The dependence of NMD on splicing reflects the diseases associated with truncated or erroneous proteins. deposition of an exon junction complex (EJC) of proteins ~20-24 nucleotides upstream of splicing-generated exon Staufen 1 exonjunctions. This EJC includes NMD factors Upf3 (also 0033 Mammalian Staufen 1 (Staul) is an RNA binding called Upf3a) or Upf3X (also called Upf3b), Upf2 and, pre protein that binds to extensive RNA secondary structures, sumably, Upfl. Upf3 and Upf3X appear to play a comparable primarily through one or more double-stranded RNA-binding role in NMD, although different isoforms of Upf3 can form domains. In mammals, the Staul gene is ubiquitously distinct protein complexes. Other constituents of the EJC expressed and generates protein isoforms having apparent include Y14, RNPS1, SRm 160, REF/Aly, UAP56, Mago, molecular weights of 55 and 63 kDa. The 55-kDa isoform Pinin, and eIF4AIII. EJCs are present on mRNA that is bound associates with 40S and 60S ribosomal subunits and co-lo at the cap by the mostly nuclear cap binding protein (CBP) calizes with the rough endoplasmic reticulum. A role for 80-CBP20 heterodimer, which is consistent with data indi Staul in mRNA transport and translational control has been cating that NMD targets CBP80-bound mRNA during a pio inferred from its presence in RNA granules that migrate neer round of translation. US 2013/0317087 A1 Nov. 28, 2013

0037 Mammalian Staul binds the NMD factor Upf1 and RBD that no longer binds dsRNA. In cells, disrupting the 3' untranslated region (UTR) of mRNA that encodes hSTAU1 dimerization either by deleting SSM-RBD5 from ADP-ribosylation factor (Arf)1. As a consequence, Stau1 one of the two interacting proteins, or by expressing exog mediates Arf1 mRNA decay in a mechanism that differs from enous RBD 5 in the presence of two full-length proteins, NMD by occurring independently of splicing or Upf2 and reduces the ability of full-length hSTAU1 to co-immunopre Upf3X. Analogously to the Stau1-mediated mRNA decay cipitate with hUPF 1, and thus, reduces the efficiency of (SMD) of Arfl mRNA, artificially tethering Staul down SMD. stream of a normal termination codon also reduces mRNA 0042. Herein is shown new motif that typifies STAU abundance in a mechanism that depends on the normal ter homologs from all vertebrate classes and is responsible for mination codon and Upf1 but neither splicing nor Upf2. Upf3 human (h)STAU1 homodimerization. The crystal structure or Upf3X. Notably, Staul plays no detectable role in the reveals that this motif, now named SSM for Staufen-swap EJC-dependent NMD of either f3-globin or glutathione per ping motif, and dsRNA-binding domain (RBD)s, which has oxidase 1 mRNA. diverged from a prototypic RBD and no longer binds dsRNA, mediate domain swapping: the two SSM C-helices of one ALU Elements molecule interact mainly through a hydrophobic patch with 0038. Disclsoed herein, Staul can also bing to an binding the two RBD'5C.-helices of a second molecule, and vice site created by the imperfect base pairing on an ALU element versa. RBD 5 adopts the canonical C-B-B-B-C. fold of a func in the 3' UTR of the mRNA of a transcript and an ALU tional RBD, but lacks residues and key features needed to element contained within long noncoding RNA. This is the bind duplexed RNA. In cultured cells, the SSM and N-termi first description of a function for long noncoding RNA (ln nal C-helix of RBD 5 are Sufficient for hSTAU1-hSTAU1 cRNA). Whether present in the lincRNA or in the 3' UTR of dimerization, and dimerization is critical for efficient SMD. the mRNA of a transcript, an ALU element is typically an approximately 300 base pair nucleic acid construct classified Methods of Identifying SMD Targets as short interspersed elements. ALU elements can vary in 0043. Expression of truncated or erroneous proteins can sequence, but generally correspond to the consensus have severe effects on a person expressing said proteins. The sequence as set forth in SEQID NO: 3. truncated or erroneous proteins can have dominant negative Staufen1-Mediated mRNA Decay by Swapping a Conserved effects or result in gain-of function mutations that can have Motif and a Degenerate Double-Stranded RNA-Binding severe consequences and result in cancers and other disor Domain ders. It is the role of SMD to reduce the occurrence of the 0039 Human (h)STAU1 has 496- and 577-amino acid truncated or erroneous proteins before they are expressed. isoforms (NCBI Gene ID:6780; hSTAU1 and hSTAU1, Significantly, knowing the targets of SMD would provide respectively), each of which contains RBDs 2-5, and an addi new targets for treatments of disease, assessment of risks tional isoform with six amino acids inserted into groups for disease, and diagnosis of a disease. Accordingly, hSTAU1RBD3 that in the highly similar mouse ortholog disclosed herein are methods of identifying a Staufen 1 diminishes dsRNA binding. Only RBD3 and RBD4 bind (Stau1)-binding site (SBS) that mediates Stau1-mediated dsRNA in mammaliancells (thus, hereafter RBD2 and RBD5 mRNA decay (SMD) comprising the steps of a) down-regu are referred to as, respectively, RBD2 and RBD'5), and lating Staul or an ALU element-containing long noncoding RBD3 binds dsRNA with higher affinity than does RBD4. All RNA (IncRNA); b) identifying transcripts that are up-regu three hSTAU1 isoforms also contain a tubulin-binding lated at least 1.8-fold upon downregulation of Staul or the domain (TBD) situated between RBD4 and RBD5 that ALU element-containing linckNA, wherein transcripts that probably binds tubulin based on in vitro studies of the highly are up-regulated at least 1.8-fold are SMD targets; and c) similar mouse STAU 1 TBD. identifying an ALU element within the 3' UTR of the tran 0040. The hSTAU1 paralog.hSTAU2, has 479-, 504-, 538 script of the SMD target, wherein the ALU element comprises and 570-amino acid isoforms (NCBI Gene ID: 27067: a first Strand of the SBS. hSTAU2, hSTAU2, hSTAU2, and hSTAU2, respec 0044. The methods disclosed herein utilize the down tively), each of which contain RBDs 2, 3 and 4, and only a regulation of Staul or linckNA to identify SMD targets as partial N-terminal region of what would behSTAU1 RBD'5; Such targets will increase in amount or expression by virtue of additionally, hSTAU2 and hSTAU2 have a complete not being degraded by SMD. It is also understood that one RBD1, whereas hSTAU2° and hSTAU2 contain a trun method of down regulating Staul or lincRNA is through the cated RBD1.hSTAU2 isoforms also have a putative TBD that use of siRNA. Further it is understood and discussed herein shares 17% identity with the hSTAU1 TBD but has yet to be that there are many methods that can be used to detect the shown to bind tubulin. Like hSTAU1, hSTAU2 mediates not up-regulation of genes, mRNA, or proteins that are known in only mRNA decay but also mRNA localization. Each paralog the art and include but are not limited to microarray, northern and even some of their isoforms function and localize differ blot, southern blot, and western blot. ently within cells. 0045. There are many SMD binding sites (SBS) and the 0041. The X-ray crystal structure of a region of hSTAU1 sequence and identity of said sites is associated with SMD includes a new motif that called the STAU-swapping motif targets identified in the Examples below. Thus, disclosed (SSM). SSM is conserved in all examined vertebrate STAU herein are methods of identifying SBS, wherein the SMD homologs, resides N-terminal to RBD'5, to which it is con target is selected from the group consisting of IFI44. nected by a flexible linker, and is responsible for forming FBLIM1, CLDN11, PDLIM3, OASL, TAF7L, NOX4, hSTAU 1 dimers both in vitro and in vivo. The two C-helices AIM1, SERPINE1, DCP2, EIF5A2, CEP135, LRRFIP1, of SSM form a domain-swapped interaction with the N-ter ZFP90, TP53, PHLPP2, EHHADH, CCDC125, NUAK2, minal C-helix of RBD5 so as to result infull-length hSTAU1 AKT2, APPL1, COL16A1, RIPK1, MGC 14799, GNAS, dimerization. This is a previously unappreciated role for an DFFA, CSDA, SEC61A1, PSMD12, C4orf), FLJ10613, US 2013/0317087 A1 Nov. 28, 2013

GNE, FLJ30656, LOC149603, TEGT, MCM4, LOC63929, comprises Upf1 and Staul. Also disclosed are screening KIAA0186, PRKAR2A, NUTF2, GDF1, PAICS, TMPO, methods wherein the complex comprises one of Upf1 and AAMP, IF, FN1, IFIT2, SCG2, STMN3, GAP43, CKMT1, Staul. Thus, for example disclosed are methods of screening OSF-2, FLJ25348, GNG4, FLJ33505, FBLP-1, IGFBP5, for an agent that modulates SMD comprising a) incubating ITGB3, IFIT4, ALP, TAGLN, TFPI2, CTNNAL1, THEBS1, the agent with an SMD target and Staul forming an agent PTPRO, CEB1, MGC29643, FLJ20035, AIM1, C14orf141, SMD target-Staul mixture, and b) assaying the amount of DUSP6, G1P2, FLJ20637, SLAMF1, SCLY, IL7R, SMD target-Staul complex present in the mixture, wherein a ARHGDIB, ACTA2, CXCL1, RIG-1, IFIT1, FLY34064, increase or decrease in the amount of SMD target -Stau1 MGC19764, TLE4, DACT1, C90rf39, JUN, IGA4, TNC, complex relative to the amount of SMD target-Staul com FLJ13621, MICAL2, TMSNB, PTGER4, C14orf128, plex in the absence of the agent indicates that the agent GDAP1, ZFP36L1, UNG, CDKAL1, ALDH1A3, PSMB9, promotes or inhibits SMD, respectively. Also disclosed are PHF11, BANK1, KIAA0143, GBP1, EPPK1, ACTN1, methods of screening for an agent that modulates SMD com RNF20, LRRFIP1, LOC150759, DPYSL3, PSK-1, ZFP90, prisinga) incubating the agent with an SMD target and Staul TP53, LOC148418, TGFB111, ETV1, ARHGAP19, SOCS2, forming an agent-SMD target-Staul mixture, and b) assaying CDK5R1, SDS3, SCDGF-B, HDAC8, HMGB3, KIAA0931, the amount of SMD target present in the mixture, wherein a DFKZp761K1423, PTPRF, TXNRD3, CGI-72, MGC15634, increase or decrease in the amount of SMD target relative to HES1, C11orf), and TOIAL1. the amount of SMD target in the absence of the agent indi 0046. It is further understood that because the SBS can be cates that the agent inhibits or promotes SMD, respectively. the result of imperfect base pairing between an ALU element 0049. Also disclosed is a method of screening for an agent contained within lincKNA and ALU element on an SMD that modulates Stau1-mediated mRNA decay (SMD) com target; where the screening method compises the down regu prising incubating the agent to be screened with a stably lation of Stau1, the method further comprises step d. identi transfected cell comprising a reporter gene with a nonsense fying an ALU element in a cytoplasmic polyadenaleted mutation and Staul, and assaying the amount of SMD in the IncRNA that contains an ALU element that base pairs with the cell, whereina increase or decrease in the amount of mRNA ALU element in the SMD target, wherein the ALU element of relative to the amount of mRNA in the absence of the agent the lincRNA comprises a second strand of the SBS. It is indicates a agent that modulates SMD activity. understood and disclosed herein that there are many methods 0050. It is understood that many fragments or minor vari that may be used to uncover the identity of an incRNA includ ants of the disclosed protein can be used in the disclosed ing, but not limited to, co-immunoprecipitation and the com methods. Thus, specifically disclosed are screening methods putation alalyses employed herein. Thus, for example dis wherein the Staul has at least 80%, 85%, 90%, or 95% closed herein are methods of identifying a SBS of SMD identity to the sequence set forth in SEQ ID NO: 2, or an comprising a) transiently expressing an ALU element-con SMD-active fragment thereof. It is also understood that the taining linckNA linked to a reporter gene; and b) immunopre disclosed methods contemplate that the SBS within the SMD cipitating the ALU element-containing linckNA using an target comprises an ALU element in the 3' UTR ofteh SMD anti-reporter protein antibody; wherein ALU elements within target. It is understood that ALU sequences can vary from RNA that encode proteins other than Staul that are co-immu SMD target to target but typically relect the ALU element noprecipitated with the ALU element of the linckNA is a consensus sequence set forth in SEQ ID NO: 3. Therefore target SMD binding site (see, for example, Example 6). disclosed herein are emthods wherein the ALU element has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% Methods of Screening identity to the consensus ALU element set forth in SEQ ID 0047. An agent that is able to modulate SMD is useful for NO: 3. the treatment and study of SMD related disorders. Thus, 0051 Disclosed herein are methods of screening for an specifically disclosed are methods of screening for an agent agent that modulates Stau1-mediated mRNA decay (SMD) that modulates Stau1-mediated mRNA decay (SMD) com comprising, administering an agent to a system, wherein the prising incubating the agent with a stably transfected cell system comprises the components for SMD activity, and comprising a reporter gene with a 3' UTR ALU element; a assaying the effect of the agent on the amount of SMD activity lincRNA containing a corresponding ALU element; and in the system, a change in the amount of SMD activity present Staul, and assaying the amount of mRNA of the reporter gene in the system compared to the amount of SMD activity in the in the cell. An increase or decrease in the amount of mRNA of system in the absence of the agent indicates the agent is a the reporter gene relative to the amount of mRNA of the modulator. Thus, specifically contemplated and herein dis reporter gene in the absence of the agent indicates an agent or closed are methods of modulating Stau1-mediated mRNA substance that modulates SMD activity. Also disclosed are decay (SMD) activity comprising administering an agent, methods of identifying an agent that binds a SBS comprising wherein the agent is identified by the disclosed screening contacting the SBS with the agent to be screened, wherein the methods. SBS comprises an ALU element from a SMD target and an 0.052 The agents that can be used to modulate SMD can ALU element from a lincRNA that base pairs with the ALU function by inhibiting the binding of Staul to its binding site. element from the SMD target. For example, an agent that competitively binds a Staul bind 0048. It is understood that another means by which one of ing site can inhibit SMD. Therefore, specifically disclosed are skill in the art may use to screen for agents that modulated methods of identifying an agent that binds a Staul binding SMD is through the detection or measurement of complexes site comprising contacting the agent to be screened with the such as an SMD-target-Staul complex. It is understood that Staul binding site. Also disclosed are methods of identifying by “SMD complex' is any combination of one or more of the an agent that binds a Staul binding site wherein one strand of essential components of SMD. Thus, for example, specifi the Staul binding has at least 80%, 85%, 90%, or 95% iden cally disclosed are screening methods wherein the complex tity to the sequence set forth in SEQID NO:3. US 2013/0317087 A1 Nov. 28, 2013

0053 Also disclosed are screening and treatment meth refer to a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, ods, wherein the agent binds Upf1, an ALU element contain or 100% reduction as compared to a control. ing lincRNA, an SMD target, the SBS of an SMD target (such 0056. Also disclosed are methods wherein the modulation as for example an ALU element in the 3' UTR of the SMD is an increase in Stau1-mediated mRNA decay. An "increase' target), or Stau1. As used herein, “binds” or “interacts' means can refer to any change that results in a larger amount of a to affect an agent either directly or indirectly through coop Staul mediated mRNA decay activity. Thus, for example, an erative function, competitive inhibition, non-competitive increase in the amount in SMD of a particular mRNA can inhibition, binding, or contacting the agent, a target molecule, include but is not limited to a 10%, 20%, 30%, 40%, 50%, an accessory molecule, or alternative portion of a system so as 60%, 70%, 80%, 90%, or 100% increase. It is understood and to effect at least one function. The interaction can be stimu herein contemplated that an increase in SMD would result in latory or cooperative in nature having an additive or syner a Subsequent decrease in the amount of gene products with gistic effect. The interaction can also result in the inhibition of early or alternative termination sites. a process or target molecule. 0057. It is understood and herein contemplated that the 0054 The disclosed methods function by modulating disclosed screening and treatment methods can utilize the SMD. Herein, it is understood that by “modulation' or modulation of the level of mRNA or protein expression. It is "modulating is meant either an increase or a decrease in also understood and herein contemplated that Staul can SMD activity. Alternatively, Staufen 1 can modulate mRNA increase or decrease the abundance of an mRNA indepen transcripts through the stabilization or destabilization of an dently of SMD. Likewise, it is understood and herein con mRNA. Whether SMD levels are increased or decreased in a templated that not all SMD activity occurs through the Subject with a condition resulting from a mutation that gen involvement of Stau1 and Upf1, but can be Upf1 independent. erates a nonsense codon (including but not limited to a non By “modulating the level of mRNA is meant that the abun sense mutatation) depends on the particular mRNA that is dance of a target transcript can be increased or decreased by affected, the binding of Staufen1 and, where binding of Stau1 the expression of Stau1. The ability to modulate the abun occurs. A decrease in SMD activity could increase the amount dance of target genes can be achieved in conjunction with or of mRNA that is available for translation. Thus, for example, independently of Upf1. It is understood that such effect can be modulation can be measured by, e.g., comparing the level of either director indirect. By “direct effect” is meant that Stau1 the mRNA harboring a premature or alternative termination acts on the targeted mRNA itself and by “indirect effect” is codon relative to an unaffected cellular RNA to the level of meant that Staul acts by an intermediary, including for that mRNA lacking a premature or alternative termination example, a nucleic acid. Thus, Staul down-regulation can codon to the same unaffected cellular RNA. Subsequent non result either directly or indirectly in the down reulation of sense Suppression could be used to increase the amount of the target mRNA levels. It is understood that whether the effect is encoded full-length protein. Conversely, an increase in SMD direct or indirect will depend on the target gene. One of skill activity would decrease the amount of mRNA that is available in the art will be able to determine whether the effect is direct for translation so as to reduce production of the encoded or indirect given the target gene. Thus specifically disclosed truncated protein. Thus, it is understood and herein contem and herein contemplated are methods of identifying genes plated that the disclosed methods can be used to modulate the modulated by the down-regulation of Staul or an ALU con expression of genes by modulating SMD (e.g., to decrease taining linckNA comprising incubating a agent that down mRNA from a truncated protein, one would increase SMD regulates SMD with a stably transfected cell comprising activity. A decrease in SMD activity would be used to Staul and one or more selected genes comprising one or more increase the amount of mRNA of a truncated protein avail nonsense-mutations, and assaying the amount of protein able). Notably, SMD can also target mRNAs that do not have expressed of the gene being screened or mRNA present for a premature or alternative termination codon, providing the gene being screened, whereina increase or decrease in the another means by which gene expression could be regulated. amount of protein or mRNA relative to the amount of protein 0055 Thus, for example, specifically disclosed are meth or mRNA in the absence of the siRNA indicates a gene that is ods wherein the modulation is a decrease in Stau1-mediated modulated by Staul activity. mRNA decay. A “decrease” can refer to any change that 0058. It is understood that these methods can be used to results in a smaller amount of Stau1 mRNA mediated decay. identify genes that are up-regulated or down regulated by the Thus, a “decrease” can refer to a reduction in an activity. An down-regulation of Staul as well as identify those genes agent is also understood to decrease the genetic output of a whose abundance increases or decreases with the down-regu gene when the genetic output of the gene product with the lation of Stau1. It is understood and herein contemplated that agent is less relative to the output of the gene product without one example of an agent that can down regulate SMD is Small the agent. Also for example, a decrease can be a change in the interfering RNA (siRNA) to a component of SMD such as symptoms of a disorder Such that the symptoms are less than Stau1 or IncRNA. previously observed. In the case of a decrease in Stau1 mRNA 0059 Although Staul can modulate mRNA levels inde mediated decay, it is understood and herein contemplated that pendently of Upf1 and SMD, dependent modulation can also a decrease can include, but is not limited to, a 10%, 20%, occur. Thus, disclosed herein are methods of identifying 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% reduction. genes modulated by the down-regulation of Upfl comprising A decrease can but does not have to result in the complete a) transfecting a small interfering RNA (siRNA) that down ablation of a substance or activity. Therefore, for example, a regulates SMD into a cell comprising Upf1 and one or more decrease in SMD would result in the presence of more gene selected genes comprising one or more nonsense-mutations, products with early or alternative termination sites (i.e., a and b) assaying the amount of protein expressed of the gene decrease in SMD activity). It is understood that the term being screened or mRNA present for the gene being screened, “inhibits” or “inhibition” refers to any degree of decrease as wherein a increase or decrease in the amount of protein or compared to a control. Thus, for example, “inhibition can mRNA relative to the amount of protein or mRNA in the US 2013/0317087 A1 Nov. 28, 2013

absence of the siRNA indicates a gene that is modulated by order in a Subject. The improvement can include but is not Upf1 activity. Also disclosed are method of identifying genes limited to a decrease in one or more symptoms of the disorder modulated by the down-regulation of SMD comprising a) such that the disorder is reduced. Treating is understood to transfecting a small interfering RNA (siRNA) that down include Small improvements in the disorder up to and includ regulates SMD into a cell comprising UPfl. Stau1, and one or ing the complete ablation of the disorder. For example, the more selected genes comprising one or more nonsense-mu treatment can result in a 10%, 20%, 30%, 40%, 50%, 60%, tations, and b) assaying the amount of protein expressed of 70%, 80%, 90%, or 100% reduction in the disorder. the gene being screened or mRNA present for the gene being 0067. It is understood and herein contemplated that the screened, wherein a increase or decrease in the amount of disorders to be treated can be the result of or related to the protein or mRNA relative to the amount of protein or mRNA expression truncated or erroneous proteins. Such proteins can in the absence of the siRNA indicates a gene that is modulated be the result of aberrant mRNA splicing that leads to prema by SMD activity. It is understood that the siRNA can be, for ture termination of the mRNA. It is understood that the example, Upf1 siRNA or Staul siRNA. mRNA that encodes the truncated or erroneous protein can 0060 Various assays are known in the art that can be used comprise at least one ALU element in its 3' UTR. There are to measure mRNA levels or protein expression. For example, many disorders that can be treated with the disclosed meth mRNA levels can be measured by microarray or RT-PCR. ods. It is understood and herein contemplated that a “disor Protein expression can be measured by Western blot. It is der” means any inherited or acquired disease or condition understood and herein contemplated that the disclosed meth associated with Staul mediated mRNA decay that has a nega ods of identifying genes can be used with any method of tive effect relative to the wild-type state. For example, the measuring preotein expression or mRNA levels known to disorder can be inherited genetic disorder. Inherited genetic those of skill in the art. disorders are disorders that result from the presence of an 0061 Also disclosed are methods of modulating the level abherent gene or genes that alter the way an interaction, of an mRNA comprising administering to a subject an effec system or pathway works. As used herein, “system” refers to tive amount of an agent that modulates Staul, wherein the any cell, organism, or in vitro assay or culture. Such a system modulation Staul directly or indirectly modulates the includes components necessary for SMD activity. Such com mRNA. Also disclosed are methods of treating a disorder in a ponents can include, for example, but are not limited to Staul Subject comprising administering to the Subject an agent, and Upf1. Thus for example, specifically contemplated are wherein the agent modulates Staul wherein the modulation methods disclosed herein wherein the disorder is a genetic of Staul modulates that level of mRNA abundance of another disorder, and wherein the genetic disorder can be selected gene. from the group consisting of cystic fibrosis, hemophilia, 0062. The disclosed compositions and methods can be mucopolysaccharidoses, muscular dystrophy, anemia, glyco used to evaluate the expression of genes involved in SMD and lytic enzyme deficiency, connective tissue disorder, DNA in particular in or as a result of the pioneer round of transla repair disorder, dementia, Diabetes mellitus type II, Alzhe tion. Specifically contemplated are methods wherein mRNA imer's disease, Marfan's syndrome, B-Thalasimia, Neurofi from a system comprising a nonsense-mutation is assayed bromatosis, Hypercholesterolemia, Sandhoff disease, epider using a micro array. Genes identified as having significantly molysis bullosa simplex, insulin resistance, maple syrup (as determined by the manufacturers specifications of the urine disease, hereditary fructose intolerance, inherited array) increased or decreased expression are comodulators of immunodeficiency, inherited cancer, carbohydrate metabo SMD. lism disorder, amino acid metabolism disorder, lipoprotein 0063 Disclosed are chips where at least one address is the metabolism disorder, lipid metabolism disorder, lysomal sequences or part of the sequences set forth in any of the enzymes disorder, Steroid metabolism disorder, purine nucleic acid sequences disclosed herein. Also disclosed are metabolism disorder, pyrimidine metabolism disorder, metal chips where at least one address is the sequences orportion of metabolism disorder, porphyrin metabolism disorder, and sequences set forth in any of the peptide sequences disclosed heme metabolism disorder. herein. 0068 Also for example, a disorder can be dementia. 0064. Also disclosed are chips where at least one address Dementias can include but are not limited to Alzheimer’s, is a variant of the sequences or part of the sequences set forth Lewy Body dementia, Binswanger's dementia, or dementias in any of the nucleic acid sequences disclosed herein. Also associated with Parkinson's Disease, progressive Supra disclosed are chips where at least one address is a variant of nuclear palsy, Huntington's disease, Pick's disease, the sequences or portion of sequences set forth in any of the Creutzfeldt-Jakob disease, Gerstmann-Straussler-Scheinker peptide sequences disclosed herein. disease, AIDS, or trauma. 0069 Disorders can also include acquired disorders. Methods of Treating Acquired disorders are disorders that result from some exter 0065. The invention described herein in one aspect relates nal insult or injury, or from an unknown mechanism that is not to methods of treating a disorder in a Subject comprising derived from a genetic characteristic. Thus by “acquired dis administering to the Subject an agent, wherein the agent order is meant any disorder that lacks a clear genetically modulates Stau1-mediated mRNA decay (SMD). For inherited link. For example, an infection or malignancy with example disclosed herein are methods of treating a disorder out a clear genetically inherited link. For example, acquired associated with expression of a truncated or erroneous protein disorders can result from chemical exposure, radiation expo in a subject comprising administering to the Subject an agent, Sure, or random mutation in a gene that was not present in the wherein the agent increases SMD of the gene encoding the Subject earlier. Thus for example, an acquired disorder can target protein in the Subject. comprise a cancer. 0066. It is understood and herein contemplated that the 0070 Also disclosed are methods of the invention, term “treating can refer to any method that improves a dis wherein the disorder is an acquired disorder. The acquired US 2013/0317087 A1 Nov. 28, 2013 disorder is, by way of example but not by way of a limitation, topically or the like, although topical intranasal administra a cancer. Such a cancer may be related to mutations such as tion or administration by inhalant is typically preferred. As mutations in p53 or BRCA-1. used herein, “topical intranasal administration” means deliv 0071. The disclosed compositions can be used to treat any ery of the compositions into the nose and nasal passages disease where uncontrolled cellular proliferation occurs such through one or both of the nares and can comprise delivery by as cancers. A representative but non-limiting list of cancers a spraying mechanism or droplet mechanism, or through that the disclosed compositions can be used to treat is the aerosolization of the nucleic acid or vector. The latter may be following: lymphoma, B cell lymphoma, T cell lymphoma, effective when a large number of animals is to be treated leukemia, carcinoma, sarcoma, glioma, blastoma, neuroblas simultaneously. Administration of the compositions by inhal toma, Ewings sarcoma, gastric cancer, lung cancer, plasma ant can be through the nose or mouth via delivery by a spray cytoma, histiocytoma, melanoma, mycosis fungoide, ing or droplet mechanism. Delivery can also be directly to any hypoxic tumor, myeloma, metastatic cancer, bladder cancer, area of the respiratory system (e.g., lungs) via intubation. The brain cancer, nervous system cancer, head and neck cancer, exact amount of the compositions required will vary from ovarian cancer, pancreatic cancer, prostate cancer, skin can Subject to Subject, depending on the species, age, weight and cer, liver cancer, colon cancer, cervical cancer, breast cancer, general condition of the Subject, the severity of the allergic epithelial cancer, renal cancer, genitourinary cancer, pulmo disorder being treated, the particular nucleic acid or vector nary cancer, esophageal carcinoma, hematopoietic cancers, used, its mode of administration and the like. Thus, it is not testicular cancer, and colorectal cancer. possible to specify an exact amount for every composition. 0072 Disclosed and herein contemplated are methods However, an appropriate amount can be determined by one of wherein the SMD occurs in or as a result of the pioneering ordinary skill in the art using only routine experimentation round of translation. Notably, SMD can also occur during given the teachings herein. steady-state translation. During steady-state translation, can 0078 Parenteral administration of the composition, if target eIF4E-bound mRNA. used, is generally characterized by injection. Injectables can 0073. As used herein, “subject” refers to any cell, tissue, be prepared in conventional forms, either as liquid solutions system, or organism used to study or treat a disorder relating or Suspensions, solid forms Suitable for Solution of Suspen to SMD, including, for example, human patients with condi sion in liquid prior to injection, or as emulsions. A more tions that result from SMD or cell lines used to study aspects recently revised approach for parenteral administration of SMD. Thus, in one embodiment the subject is a mammal It involves use of a slow release or Sustained release system Such is specifically contemplated that mammal can include but is that a constant dosage is maintained. See, e.g., U.S. Pat. No. not limited to human or non-human primate. 3,610,795, which is incorporated by reference herein. 0074 Also disclosed are methods of treating a disorder in 007.9 The materials may be in solution, suspension (for a Subject comprising administering to the Subject a substance, example, incorporated into microparticles, liposomes, or wherein the substance modulates Stau1-mediated mRNA cells). These may be targeted to a particular cell type via decay. Modulation of Stau1-mediated mRNA decay can antibodies, receptors, or receptor ligands. The following ref result in a decrease in SMD. The decrease in SMD would erences are examples of the use of this technology to target increase the abundance of the nRNA containing a premature specific proteins to tumor tissue. Vehicles such as “stealth' or alternative termination codon. and other antibody conjugated liposomes (including lipid 0075 Specifically disclosed herein are methods of facili mediated drug targeting to colonic carcinoma), receptor tating Staul-mediated mRNA decay comprising contacting a mediated targeting of DNA through cell specific ligands, system comprising the components for SMD with Stau1. Also lymphocyte directed tumor targeting, and highly specific disclosed are methods of facilitating Stau1-mediated mRNA therapeutic retroviraltargeting of murine glioma cells in vivo. decay comprising contacting with a system, wherein the sys The following references are examples of the use of this tem comprises the components for SMD Such as, for example, technology to target specific proteins to tumor tissue. In gen an ALU element containing linckNA, Upf1, Upf2, or Upf3. eral, receptors are involved in pathways of endocytosis, either Also disclosed are methods of facilitating Stau1-mediated constitutive or ligand induced. These receptors cluster in mRNA decay comprising contacting the SMD target with clathrin-coated pits, enter the cell via clathrin-coated Stau1 and/an ALU element containing linckNA. The combi vesicles, pass through an acidified endoSome in which the nation of Stau1 and linckNA can be simultaneous or sequen receptors are sorted, and then either recycle to the cell surface, tial. become stored intracellularly, or are degraded in lysosomes. 0076. As described above, the compositions can also be The internalization pathways serve a variety of functions, administered in Vivo in a pharmaceutically acceptable carrier. Such as nutrient uptake, removal of activated proteins, clear By “pharmaceutically acceptable' is meant a material that is ance of macromolecules, opportunistic entry of viruses and not biologically or otherwise undesirable, i.e., the material toxins, dissociation and degradation of ligand, and receptor may be administered to a subject, along with the nucleic acid level regulation. Many receptors follow more than one intra or vector, without causing any undesirable biological effects cellular pathway, depending on the cell type, receptor con or interacting in a deleterious manner with any of the other centration, type of ligand, ligand Valency, and ligand components of the pharmaceutical composition in which it is concentration. Molecular and cellular mechanisms of recep contained. The carrier would naturally be selected to mini tor-mediated endocytosis has been reviewed (Brown and mize any degradation of the active ingredient and to minimize Greene, DNA and Cell Biology 10:6, 399-409 (1991)). any adverse side effects in the subject, as would be well 0080. The compositions, including antibodies, can be known to one of skill in the art. used therapeutically in combination with a pharmaceutically 0077. The compositions may be administered orally, acceptable carrier. parenterally (e.g., intravenously), by intramuscular injection, 0081 Pharmaceutical carriers are known to those skilled by intraperitoneal injection, transdermally, extracorporeally, in the art. These most typically would be standard carriers for US 2013/0317087 A1 Nov. 28, 2013

administration of drugs to humans, including Solutions such and the like. Generally, the dosage will vary with the age, as sterile water, saline, and buffered solutions at physiological condition, sex and extent of the disease in the patient and can pH. The compositions can be administered intramuscularly or be determined by one of skill in the art. The dosage can be subcutaneously. Other compounds will be administered adjusted by the individual physician in the event of any coun according to standard procedures used by those skilled in the terindications. Dosage can vary, and can be administered in art. one or more dose administrations daily, for one or several 0082 Pharmaceutical compositions may include carriers, days. thickeners, diluents, buffers, preservatives, Surface active I0089. The disclosed methods and compositions can also agents and the like in addition to the molecule of choice. be used for example as tools to isolate and test new drug Pharmaceutical compositions may also include one or more candidates for a variety of diseases. They can also be used for active ingredients such as antimicrobial agents, antiinflam the continued isolation and study, for example, SMD. There matory agents, anesthetics, and the like. use as exogenous DNA delivery devices can be expanded for 0083. The pharmaceutical composition may be adminis nearly any reason desired by those of skill in the art. tered in a number of ways depending on whether local or systemic treatment is desired, and on the area to be treated. 0090 The disclosed compositions can be used as targets Administration may be topically (including ophthalmically, for any combinatorial technique to identify molecules or vaginally, rectally, intranasally), orally, by inhalation, or macromolecular molecules that interact with the disclosed parenterally, for example by intravenous drip, Subcutaneous, compositions in a desired way. The nucleic acids, peptides, intraperitoneal or intramuscular injection. The disclosed anti and related molecules disclosed herein can be used as targets bodies or other agents can be administered intravenously, for the combinatorial approaches. Also disclosed are the com intraperitoneally, intramuscularly, Subcutaneously, or trans positions that are identified through combinatorial techniques dermally. or screening techniques in which the compositions disclosed 0084 Preparations for parenteral administration include in SEQID NOS:1, 2, orportions thereof, are used as the target sterile aqueous or non-aqueous solutions, Suspensions, and in a combinatorial or screening protocol. emulsions. Examples of non-aqueous solvents are propylene 0091. It is understood that when using the disclosed com glycol, polyethylene glycol, vegetable oils such as olive oil, positions in combinatorial techniques or screening methods, and injectable organic esters such as ethyl oleate. Aqueous molecules, such as macromolecular molecules, will be iden carriers include water, alcoholic/aqueous Solutions, emul tified that have particular desired properties such as inhibition sions or suspensions, including saline and buffered media. or stimulation or the target molecule's function. The mol Parenteral vehicles include sodium chloride solution, Ring ecules identified and isolated when using the disclosed com er's dextrose, dextrose and sodium chloride, lactated Ring positions, such as, Staul, are also disclosed. Thus, the prod er's, or fixed oils. Intravenous vehicles include fluid and ucts produced using the combinatorial or screening nutrient replenishers, electrolyte replenishers (such as those approaches that involve the disclosed compositions, such as, based on Ringer's dextrose), and the like. Preservatives and Staul, are also considered herein disclosed. other additives may also be present such as, for example, 0092 Combinatorial chemistry includes but is not limited antimicrobials, anti-oxidants, chelating agents, and inert to all methods for isolating Small molecules or macromol gases and the like. ecules that are capable of binding either a small molecule or 0085 Formulations for topical administration may another macromolecule, typically in an iterative process. Pro include ointments, lotions, creams, gels, drops, Suppositories, teins, oligonucleotides, and Sugars are examples of macro sprays, liquids and powders. Conventional pharmaceutical molecules. For example, oligonucleotide molecules with a carriers, aqueous, powder or oily bases, thickeners and the given function, catalytic or ligand-binding, can be isolated like may be necessary or desirable. from a complex mixture of random oligonucleotides in what I0086 Compositions for oral administration include pow has been referred to as “in vitro genetics' (Szostak, TIBS ders or granules, Suspensions or Solutions in water or non 19:89, 1992). One synthesizes a large pool of molecules aqueous media, capsules, Sachets, or tablets. Thickeners, fla bearing random and defined sequences and Subjects that com Vorings, diluents, emulsifiers, dispersing aids or binders may plex mixture, for example, approximately 10' individual be desirable. sequences in 100 ug of a 100 nucleotide RNA, to some selec 0087. Some of the compositions may potentially be tion and enrichment process. Through repeated cycles of administered as a pharmaceutically acceptable acid- or base affinity chromatography and PCR amplification of the mol addition salt, formed by reaction with inorganic acids such as ecules bound to the ligand on the column, Ellington and hydrochloric acid, hydrobromic acid, perchloric acid, nitric Szostak (1990) estimated that 1 in 10' RNA molecules acid, thiocyanic acid, Sulfuric acid, and phosphoric acid, and folded in such a way as to bind a small molecule dyes. DNA organic acids such as formic acid, acetic acid, propionic acid, molecules with Such ligand-binding behavior have been iso glycolic acid, lactic acid, pyruvic acid, oxalic acid, malonic lated as well (Ellington and Szostak, 1992; Bocket al., 1992). acid, Succinic acid, maleic acid, and fumaric acid, or by Techniques aimed at similar goals exist for Small organic reaction with an inorganic base Such as Sodium hydroxide, molecules, proteins, antibodies and other macromolecules ammonium hydroxide, potassium hydroxide, and organic known to those of skill in the art. Screening sets of molecules bases such as mono-, di-, trialkyl and arylamines and Substi for a desired activity whether based on small organic libraries, tuted ethanolamines. oligonucleotides, or antibodies is broadly referred to as com 0088. The dosage ranges for the administration of the binatorial chemistry. Combinatorial techniques are particu compositions are those large enough to produce the desired larly Suited for defining binding interactions between mol effect in which the symptoms disorder are effected. The dos ecules and for isolating molecules that have a specific binding age should not be so large as to cause adverse side effects, activity, often called aptamers when the macromolecules are Such as unwanted cross-reactions, anaphylactic reactions, nucleic acids. US 2013/0317087 A1 Nov. 28, 2013

0093. There are a number of methods for isolating proteins 0098. The disclosed compositions can be used as targets which either have de novo SMD activity or a modified activ for any molecular modeling technique to identify either the ity. For example, phage display libraries have been used to structure of the disclosed compositions or to identify poten isolate numerous peptides that interact with a specific target. tial or actual molecules, such as Small molecules, which inter 0094. A preferred method for isolating proteins that have a act in a desired way with the disclosed compositions. The given function is described by Roberts and Szostak (Roberts nucleic acids, peptides, and related molecules disclosed R. W. and Szostak J. W. Proc. Natl. Acad. Sci. USA, 94(23) herein can be used as targets in any molecular modeling 12997-302 (1997). This combinatorial chemistry method program or approach. couples the functional power of proteins and the genetic 0099. It is understood that when using the disclosed com power of nucleic acids. An RNA molecule is generated in positions in modeling techniques, molecules, such as macro which a puromycin molecule is covalently attached to the molecular molecules, will be identified that have particular 3'-end of the RNA molecule. An in vitro translation of this desired properties such as inhibition or stimulation or the modified RNA molecule causes the correct protein, encoded target molecule's function. The molecules identified and iso by the RNA to be translated. In addition, because of the lated when using the disclosed compositions, such as, Staul attachment of the puromycin, a peptidyl acceptor which can and Upf1, are also disclosed. Thus, the products produced not be extended, the growing peptide chain is attached to the using the molecular modeling approaches that involve the puromycin which is attached to the RNA. Thus, the protein disclosed compositions, such as, Staul and Upf1, are also molecule is attached to the genetic material that encodes it. considered herein disclosed. Normal in vitro selection procedures can now be done to 0100 Thus, one way to isolate molecules that bind a mol isolate functional peptides. Once the selection procedure for ecule of choice is through rational design. This is achieved peptide function is complete traditional nucleic acid manipu through structural information and computer modeling. lation procedures are performed to amplify the nucleic acid Computer modeling technology allows visualization of the that codes for the selected functional peptides. After amplifi three-dimensional atomic structure of a selected molecule cation of the genetic material, new RNA is transcribed with and the rational design of new compounds that will interact puromycin at the 3'-end, new peptide is translated and another with the molecule. The three-dimensional construct typically functional round of selection is performed. Thus, protein depends on data from X-ray crystallographic analyses or selection can be performed in an iterative manner just like NMR imaging of the selected molecule. The molecular nucleic acid selection techniques. The peptide which is trans dynamics require force field data. The computer graphics lated is controlled by the sequence of the RNA attached to the systems enable prediction of how a new compound will link puromycin. This sequence can be anything from a random to the target molecule and allow experimental manipulation sequence engineered for optimum translation (i.e. no stop of the structures of the compound and target molecule to codons etc.) or it can be a degenerate sequence of a known perfect binding specificity. Prediction of what the molecule RNA molecule to look for improved or altered function of a compound interaction will be when Small changes are made known peptide. The conditions for nucleic acid amplification in one or both requires molecular mechanics Software and and in vitro translation are well known to those of ordinary computationally intensive computers, usually coupled with skill in the art. user-friendly, menu-driven interfaces between the molecular design program and the user. 0095. Another preferred method for combinatorial meth ods designed to isolate peptides is described in Cohen et al. 0101 Examples of molecular modeling systems are the (Cohen B. A., et al., Proc. Natl. Acad. Sci. USA 95(24): CHARMm and QUANTA programs, Polygen Corporation, 14272-7 (1998)). This method utilizes and modifies two Waltham, Mass. CHARMm performs the energy minimiza hybrid technology. Yeast two-hybrid systems are useful for tion and molecular dynamics functions. QUANTA performs the detection and analysis of protein: protein interactions. The the construction, graphic modeling and analysis of molecular two-hybrid system, initially described in the yeast Saccharo structure. QUANTA allows interactive construction, modifi myces cerevisiae, is a powerful molecular genetic technique cation, visualization, and analysis of the behavior of mol for identifying new regulatory molecules, specific to the pro ecules with each other. tein of interest. Cohen et al. modified this technology so that 0102 Although described above with reference to design novel interactions between synthetic or engineered peptide and generation of compounds which could alter binding, one sequences could be identified which bind a molecule of could also screen libraries of known compounds, including choice. The benefit of this type of technology is that the natural products or synthetic chemicals, and biologically selection is done in an intracellular environment. The method active materials, including proteins, for compounds which utilizes a library of peptide molecules that attached to an alter Substrate binding or enzymatic activity. acidic activation domain. (0103. The term “antibodies” is used herein in a broad sense and includes both polyclonal and monoclonal antibod 0096. Using methodology well known to those of skill in ies. In addition to intact immunoglobulin molecules, also the art, in combination with various combinatorial libraries, included in the term “antibodies' are fragments or polymers one can isolate and characterize those Small molecules or of those immunoglobulin molecules, and human or human macromolecules, which bind to or interact with the desired ized versions of immunoglobulin molecules or fragments target. The relative binding affinity of these compounds can thereof, as described herein. The antibodies are tested for be compared and optimum compounds identified using com their desired activity using the in vitro assays described petitive binding studies, which are well known to those of herein, or by analogous methods, after which their in vivo skill in the art. therapeutic and/or prophylactic activities are tested according 0097. As used herein combinatorial methods and libraries to known clinical testing methods. included traditional Screening methods and libraries as well 0104. The term “monoclonal antibody” as used herein as methods and libraries used in interactive processes. refers to an antibody obtained from a substantially homoge US 2013/0317087 A1 Nov. 28, 2013

neous population of antibodies, i.e., the individual antibodies mice, rats, or rabbits) are naturally antigenic in humans, and within the population are identical except for possible natu thus can give rise to undesirable immune responses when rally occurring mutations that may be present in a small administered to humans. Therefore, the use of human or subset of the antibody molecules. The monoclonal antibodies humanized antibodies in the methods of the invention serves herein specifically include “chimeric' antibodies in which a to lessen the chance that an antibody administered to a human portion of the heavy and/or light chain is identical with or will evoke an undesirable immune response. homologous to corresponding sequences in antibodies 0110. The human antibodies of the invention can be pre derived from a particular species or belonging to a particular pared using any technique. Human antibodies of the invention antibody class or subclass, while the remainder of the chain(s) (and fragments thereof) can also be produced using phage is identical with or homologous to corresponding sequences display libraries. in antibodies derived from another species or belonging to 0111. The human antibodies of the invention can also be another antibody class or Subclass, as well as fragments of obtained from transgenic animals. For example, transgenic, Such antibodies, as long as they exhibit the desired antago mutant mice that are capable of producing a full repertoire of nistic activity. human antibodies, in response to immunization, have been 0105 Monoclonal antibodies of the invention can be pre described (see, e.g., Jakobovits et al., Proc. Natl. Acad. Sci. pared using hybridoma methods. Such as those described by USA,90:2551-255 (1993); Jakobovits et al., Nature, 362:255 Kohler and Milstein, Nature, 256:495 (1975). In a hybridoma 258 (1993); Bruggermann et al., Year in Immunol., 7:33 method, amouse or other appropriate host animal is typically (1993)). Specifically, the homozygous deletion of the anti immunized with an immunizing agent to elicit lymphocytes body heavy chain joining region (J(H)) gene in these chimeric that produce or are capable of producing antibodies that will and germ-line mutant mice results in complete inhibition of specifically bind to the immunizing agent. Alternatively, the endogenous antibody production, and the Successful transfer lymphocytes may be immunized in vitro, e.g., using the Staul of the human germ-line antibody gene array into Such germ or Upf1 described herein. line mutant mice results in the production of human antibod 0106 The monoclonal antibodies may also be made by ies upon antigen challenge. recombinant DNA methods. DNA encoding the monoclonal 0112 Antibody humanization techniques generally antibodies of the invention can be readily isolated and involve the use of recombinant DNA technology to manipu sequenced using conventional procedures (e.g., by using oli late the DNA sequence encoding one or more polypeptide gonucleotide probes that are capable of binding specifically chains of an antibody molecule. Accordingly, a humanized to genes encoding the heavy and light chains of murine anti form of a non-human antibody (or a fragment thereof) is a bodies). Libraries of antibodies or active antibody fragments chimeric antibody or antibody chain (or a fragment thereof, can also be generated and screened using phage display tech such as an Fv, Fab, Fab', or other antigen-binding portion of niques. an antibody) which contains a portion of an antigen binding 0107. In vitro methods are also suitable for preparing site from a non-human (donor) antibody integrated into the monovalent antibodies. Digestion of antibodies to produce framework of a human (recipient) antibody. fragments thereof, particularly, Fab fragments, can be accom 0113 To generate a humanized antibody, residues from plished using routine techniques known in the art. For one or more complementarity determining regions (CDRs) of instance, digestion can be performed using papain. Papain a recipient (human) antibody molecule are replaced by resi digestion of antibodies typically produces two identical anti dues from one or more CDRs of a donor (non-human) anti gen binding fragments, called Fab fragments, each with a body molecule that is known to have desired antigen binding single antigenbinding site, and a residual Fc fragment. Pepsin characteristics (e.g., a certain level of specificity and affinity treatment yields a fragment that has two antigen combining for the target antigen). In some instances, FV framework (FR) sites and is still capable of cross-linking antigen. residues of the human antibody are replaced by correspond 0108. The fragments, whether attached to other sequences ing non-human residues. Humanized antibodies may also or not, can also include insertions, deletions, Substitutions, or contain residues which are found neither in the recipient other selected modifications of particular regions or specific antibody nor in the imported CDR or framework sequences. amino acids residues, provided the activity of the antibody or Generally, a humanized antibody has one or more amino acid antibody fragment is not significantly altered or impaired residues introduced into it from a source which is non-human. compared to the non-modified antibody or antibody frag In practice, humanized antibodies are typically human anti ment. These modifications can provide for Some additional bodies in which some CDR residues and possibly some FR property, Such as to remove/add amino acids capable of dis residues are substituted by residues from analogous sites in ulfide bonding, to increase its bio-longevity, to alter its secre rodent antibodies. Humanized antibodies generally contain at tory characteristics, etc. In any case, the antibody orantibody least a portion of an antibody constant region (Fc), typically fragment must possess a bioactive property, Such as specific that of a human antibody. binding to its cognate antigen. Functional or active regions of 0114 Methods for humanizing non-human antibodies are the antibody or antibody fragment may be identified by well known in the art. For example, humanized antibodies can mutagenesis of a specific region of the protein, followed by be generated according to the methods of Winter and co expression and testing of the expressed polypeptide. Such workers, by substituting rodent CDRs or CDR sequences for methods are readily apparent to a skilled practitioner in the art the corresponding sequences of a human antibody. and can include site-specific mutagenesis of the nucleic acid 0115 Antibodies of the invention are preferably adminis encoding the antibody or antibody fragment. (Zoller, M. J. tered to a Subject in a pharmaceutically acceptable carrier as Curr. Opin. Biotechnol. 3:348-354, 1992). described above. Effective dosages and schedules for admin 0109. As used herein, the term “antibody” or “antibodies” istering the antibodies may be determined empirically, and can also refer to a human antibody and/or a humanized anti making Such determinations is within the skill in the art. body. Many non-human antibodies (e.g., those derived from Those skilled in the art will understand that the dosage of US 2013/0317087 A1 Nov. 28, 2013

antibodies that must be administered will vary depending on, by injection. Injectables can be prepared in conventional for example, the subject that will receive the antibody, the forms, either as liquid solutions or Suspensions, Solid forms route of administration, the particular type of antibody used Suitable for Solution of suspension in liquid prior to injection, and other drugs being administered. A typical daily dosage of or as emulsions. A more recently revised approach for the antibody used alone might range from about 1 ug/kg to up parenteral administration involves use of a slow release or to 100 mg/kg of body weight or more per day, depending on Sustained release system such that a constant dosage is main the factors mentioned above. tained. See, e.g., U.S. Pat. No. 3,610,795, which is incorpo 0116. Following administration of an antibody for treat rated by reference herein. For additional discussion of suit ing, inhibiting, or preventing a condition, the efficacy of the able formulations and various routes of administration of therapeutic antibody can be assessed in various ways well therapeutic compounds. known to the skilled practitioner. Specifically, SMD can be assessed directly or indirectly as taught herein. Compositions 0117. In the methods described above which include the I0121 The disclosed screening and treatment methods administration and uptake of exogenous DNA into the cells of make use of agents administered to a subject to achieve a a subject (i.e., gene transduction or transfection), the nucleic desired effect. It is understood and herein contemplated that acids of the present invention can be in the form of naked "agent' can refer to any compound, functional nucleic acid, DNA or RNA, or the nucleic acids can be in a vector for siRNA, peptide, protein, antibody, or small molecule. Thus, delivering the nucleic acids to the cells, whereby the anti for example, one embodiment of the disclosed methods is a body-encoding DNA fragment is under the transcriptional method of treating a subject with an agent wherein the Sub regulation of a promoter, as would be well understood by one stance is Stau1, an ALU element-containing linckNA that of ordinary skill in the art. The vector can be a commercially base pairs with the ALU element in the mRNA of the 3' UTR available preparation, such as an adenovirus vector (Quantum of the truncated or erroneous protein, or a complex compris Biotechnologies, Inc. (Laval, Quebec, Canada). Delivery of ing one or more of an ALU element-containing linckNA, the nucleic acid or vector to cells can be via a variety of Staul Upf1, Upf2, and Upf3. Thus, for example, disclosed It mechanisms. As one example, delivery can be via a liposome, is understood that by “SMD complex' is any combination of using commercially available liposome preparations such as one or more of the essential components of SMD. Such LIPOFECTIN, LIPOFECTAMINE (GIBCO-BRL, Inc., administration can be direct or indirect. For example, the Gaithersburg, Md.), SUPERFECT (Qiagen, Inc. Hilden, Ger Staul can be administered directly or by transferr with a many) and TRANSFECTAM (Promega Biotec, Inc., Madi subject with a Staul encoding nucleic acid or by administer son, Wis.), as well as other liposomes developed according to ing to the subject a compound that modulates SMD. procedures standard in the art. In addition, the nucleic acid or I0122) An agent that modulates SMD can be a nucleic acid. vector of this invention can be delivered in vivo by electropo Therefore specifically disclosed and herein contemplated is ration, the technology for which is available from Genetron an agent, wherein the agent is a vector comprising a nucleic ics, Inc. (San Diego, Calif.) as well as by means of a acid that encodes an SMD modulator. Also disclosed is a SONOPORATION machine (ImaRX Pharmaceutical Corp., vector comprising a nucleic acid that encodes an SMD modu Tucson, Ariz.). lator. Also disclosed is a cell comprising the disclosed vec 0118. As one example, vector delivery can be via a viral tOrS. system, Such as a retroviral vector system which can package I0123 Thus specifically contemplated and disclosed a recombinant retroviral genome. The recombinant retrovirus herein is an agent that modulates SMD, wherein the substance can then be used to infect and thereby deliver to the infected is an siRNA that modulates SMD. It is understood that the cells nucleic acid encoding a broadly neutralizing antibody siRNA can bind any factor that modulates SMD. For (or active fragment thereof) of the invention. The exact example, specifically disclosed is an siRNA, wherein the method of introducing the altered nucleic acid into mamma siRNA binds Upfl. Also disclosed is a substance comprising lian cells is, of course, not limited to the use of retroviral siRNA, wherein the siRNA binds Staul. It is further under vectors. Other techniques are widely available for this proce stood that providing additional components of SMD can dure including the use of adenoviral vectors, adeno-associ facilitate increased SMD activity. For example, wherein the ated viral (AAV) vectors, lentiviral vectors, pseudotyped ret agent is Stau1, additional Staul will be available to bind to the roviral vectors. Physical transduction techniques can also be SBS. Additionally, wherein the agent is an ALU element used. Such as liposome delivery and receptor-mediated and containing lincRNA, an additional component of the SBS is other endocytosis mechanisms. This invention can be used in provided to bind with the ALU element in the 3' UTR of the conjunction with any of these or other commonly used gene SMD target. Thus disclosed herein are agents, wherein the transfer methods. agent is Stau1, an incRNA, oran siRNA that binds to an ALU 0119. As one example, if the antibody-encoding nucleic element. acid of the invention is delivered to the cells of a subject in an 0.124 Disclosed are the components to be used to prepare adenovirus vector, the dosage for administration of adenovi the disclosed compositions as well as the compositions them rus to humans can range from about 107 to 10 plaque forming selves to be used within the methods disclosed herein. These units (pfu) per injection but can be as high as 10' pful per and other materials are disclosed herein, and it is understood injection. A subject can receive a single injection, or, if addi that when combinations, Subsets, interactions, groups, etc. of tional injections are necessary, they can be repeated at six these materials are disclosed that while specific reference of month intervals (or other appropriate time intervals, as deter each various individual and collective combinations and per mined by the skilled practitioner) for an indefinite period mutation of these compounds may not be explicitly disclosed, and/or until the efficacy of the treatment has been established. each is specifically contemplated and described herein. For 0120 Parenteral administration of the nucleic acid or vec example, if a particular Staul or ALU element is disclosed tor of the present invention, if used, is generally characterized and discussed and a number of modifications that can be made US 2013/0317087 A1 Nov. 28, 2013

to a number of molecules including the Staul or the ALU Enzymol. 183:281-306, 1989 which are herein incorporated element are discussed, specifically contemplated is each and by reference for at least material related to nucleic acid align every combination and permutation of Stau1 and the ALU ment. element and the modifications that are possible unless spe I0129. There are a variety of molecules disclosed herein cifically indicated to the contrary. Thus, if a class of mol that are nucleic acid based, including for example the nucleic ecules A, B, and Care disclosed as well as a class of molecules acids that encode, for example Stau1 and Upf1, as well as D, E, and F and an example of a combination molecule, A-D various functional nucleic acids. The disclosed nucleic acids is disclosed, then even if each is not individually recited each are made up of for example, nucleotides, nucleotide analogs, is individually and collectively contemplated meaning com or nucleotide Substitutes. Non-limiting examples of these and binations, A-E, A-F B-D, B-E, B-F, C-D, C-E, and C F are other molecules are discussed herein. It is understood that for considered disclosed. Likewise, any Subset or combination of example, when a vector is expressed in a cell, that the these is also disclosed. Thus, for example, the Sub-group of expressed mRNA will typically be made up of A, C, G, and U. A-E, B-F, and C-E would be considered disclosed. This con Likewise, it is understood that if, for example, an antisense cept applies to all aspects of this application including, but not molecule is introduced into a cell or cell environment through limited to, steps in methods of making and using the disclosed for example exogenous delivery, it is advantageous that the compositions. Thus, if there are a variety of additional steps antisense molecule be made up of nucleotide analogs that that can be performed it is understood that each of these reduce the degradation of the antisense molecule in the cel additional steps can be performed with any specific embodi lular environment. ment or combination of embodiments of the disclosed meth 0.130. A nucleotide is a molecule that contains a base moi ods. ety, a Sugar moiety and a phosphate moiety. Nucleotides can 0.125. As used throughout, when reference is made to a be linked together through their phosphate moieties and Sugar particular protein or nucleic acid, Some variation in amino moieties creating an internucleoside linkage. The base moiety acid or nucleotide sequence is expected without a substantial of a nucleotide can be adenin-9-yl (A), cytosin-1-yl (C), decline in function. Thus, Staul can include proteins or guanin-9-yl (G), uracil-1-yl (U), and thymin-1-yl (T). The nucleic acid sequences having at least 80%, 85%, 90%, or Sugar moiety of a nucleotide is a ribose or a deoxyribose. The 95% identity to the sequence set forth in SEQID NO: 1 or 2, phosphate moiety of a nucleotide is pentavalent phosphate. or fragment thereof. Also disclosed are methods of the inven An non-limiting example of a nucleotide would be 3'-AMP tion, wherein the ALU element of the lincPNA has at least (3'-adenosine monophosphate) or 5'-GMP (5'-guanosine 50%, 55%, 60%. 65%, 70%, 75%, 80%, 85%, 90%, or 95% monophosphate). identity to the sequence set forth in SEQID NO:3, or frag I0131) A nucleotide analog is a nucleotide which contains ment thereof. Some type of modification to either the base, Sugar, or phos 0126. It is understood that one way to define any known phate moieties. Modifications to the base moiety would variants and derivatives or those that might arise, of the dis include natural and synthetic modifications of A, C, G, and closed genes and proteins herein is through defining the vari T/U as well as different purine or pyrimidine bases, such as ants and derivatives in terms of homology to specific known uracil-5-yl (psi), hypoxanthin-9-yl (I), and 2-aminoadenin sequences. For example SEQID NO: 1 sets forth a particular 9-yl. A modified base includes but is not limited to 5-meth sequence of a Staul encoding nucleic acid, and SEQID NO: ylcytosine (5-me-C), 5-hydroxymethyl cytosine, Xanthine, 2 sets forth a particular sequence of the protein encoded by hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl SEQ ID NO: 1, an Staul protein. Specifically disclosed are derivatives of adenine and guanine, 2-propyl and other alkyl variants of these and other genes and proteins herein dis derivatives of adenine and guanine, 2-thiouracil, 2-thiothym closed which have at least, 70, 71, 72,73, 74, 75, 76, 77,78, ine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl 79,80, 81, 82, 83, 84, 85,86, 87, 88, 89,90,91, 92,93, 94, 95, uracil and cytosine, 6-azo uracil, cytosine and thymine, 96.97, 98.99 percent homology to the stated sequence. Those 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, of skill in the art readily understand how to determine the 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted homology of two proteins or nucleic acids, such as genes. For adenines and guanines, 5-halo particularly 5-bromo, 5-trif example, the homology can be calculated after aligning the luoromethyl and other 5-substituted uracils and cytosines, two sequences so that the homology is at its highest level. 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 0127. Another way of calculating homology can be per 3-deazaguanine and 3-deaZaadenine. Additional base modi formed by published algorithms. Optimal alignment of fications can be found for example in U.S. Pat. No. 3,687,808, sequences for comparison may be conducted by the local Englisch et al., Angewandte Chemie, International Edition, homology algorithm of Smith and Waterman Adv. Appl. 1991, 30, 613, and Sanghvi, Y. S., Chapter 15, Antisense Math. 2: 482 (1981), by the homology alignment algorithm of Research and Applications, pages 289-302, Crooke, S.T. and Needleman and Wunsch, J. Mol. Biol. 48: 443 (1970), by the Lebleu, B. ed., CRC Press, 1993. Certain nucleotide analogs, search for similarity method of Pearson and Lipman, Proc. Such as 5-substituted pyrimidines, 6-azapyrimidines and N-2, Natl. Acad. Sci. U.S.A. 85: 2444 (1988), by computerized N-6 and O-6 Substituted purines, including 2-aminopropylad implementations of these algorithms (GAP, BESTFIT, enine, 5-propynyluracil and 5-propynylcytosine. 5-methyl FASTA, and TFASTA in the Wisconsin Genetics Software cytosine can increase the stability of duplex formation. Often Package, Genetics Computer Group, 575 Science Dr. Madi time base modifications can be combined with for example a son, Wis.), or by inspection. Sugar modification, such as 2'-3-methoxyethyl, to achieve 0128. The same types of homology can be obtained for unique properties such as increased duplex stability. nucleic acids by for example the algorithms disclosed in I0132) Nucleotide analogs can also include modifications Zuker, M. Science 244:48-52, 1989, Jaeger et al. Proc. Natl. of the Sugar moiety. Modifications to the Sugar moiety would Acad. Sci. USA 86:7706-7710, 1989, Jaeger et al. Methods include natural modifications of the ribose and deoxyribose US 2013/0317087 A1 Nov. 28, 2013

as well as synthetic modifications. Sugar modifications or heterocyclic internucleoside linkages. These include those include but are not limited to the following modifications at having morpholino linkages (formed in part from the Sugar the 2' position: OH: F: O— S , or N-alkyl: O S , or portion of a nucleoside); siloxane backbones; Sulfide, Sulfox N-alkenyl; O-, S- or N-alkynyl: or O-alkyl-O-alkyl, wherein ide and sulfone backbones; formacetyl and thioformacetyl the alkyl, alkenyl and alkynyl may be substituted or unsub backbones; methylene formacetyl and thioformacetyl back stituted C to Co., alkyl or C to Coalkenyl and alkynyl. 2" bones; alkene containing backbones; Sulfamate backbones; Sugar modifications also include but are not limited to methyleneimino and methylenehydrazino backbones; Sul —O(CH), O, CH, —O(CH), OCH —O(CH), NH, fonate and Sulfonamide backbones; amide backbones; and —O(CH), CH, O(CH), ONH, and —O(CH)ON others having mixed N, O, S and CH component parts. (CH), CH), where n and mare from 1 to about 10. 0.138. It is also possible to link other types of molecules 0133. Other modifications at the 2' position include but are (conjugates) to nucleotides or nucleotide analogs to enhance not limited to: C to Co lower alkyl, substituted lower alkyl, for example, cellular uptake. Conjugates can be chemically alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH, OCN, Cl, linked to the nucleotide or nucleotide analogs. Such conju Br, CN, CF, OCF, SOCH, SO, CH, ONO, NO, N, gates include but are not limited to lipid moieties such as a NH, heterocycloalkyl, heterocycloalkaryl, aminoalky cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. lamino, polyalkylamino, Substituted silyl, an RNA cleaving USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., group, a reporter group, an intercalator, a group for improving Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a thioether, the pharmacokinetic properties of an oligonucleotide, or a e.g., hexyl-5-tritylthiol (Manoharan et al., Ann. N.Y. Acad. group for improving the pharmacodynamic properties of an Sci., 1992, 660, 306–309; Manoharan et al., Bioorg. Med. oligonucleotide, and other substituents having similar prop Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Ober erties. Similar modifications may also be made at other posi hauser et al., Nucl. Acids Res., 1992, 20, 533-538), an ali tions on the Sugar, particularly the 3' position of the Sugar on phatic chain, e.g., dodecandiol or undecyl residues (Saison the 3' terminal nucleotide or in 2'-5' linked oligonucleotides Behmoaras et al., EMBO.J., 1991, 10, 1111-1118; Kabanov et and the 5' position of 5' terminal nucleotide. Modified sugars al., FEBS Lett., 1990, 259,327-330; Svinarchuk et al., Bio would also include those that contain modifications at the chimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl bridging ring oxygen, Such as CH and S. Nucleotide Sugar rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac analogs may also have Sugar mimetics such as cyclobutyl glycero-3-H-phosphonate (Manoharan et al., Tetrahedron moieties in place of the pentofuranosyl Sugar. Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 0134) Nucleotide analogs can also be modified at the phos 1990, 18, 3777-3783), a polyamine or a polyethylene glycol phate moiety. Modified phosphate moieties include but are chain (Manoharan et al., Nucleosides & Nucleotides, 1995, not limited to those that can be modified so that the linkage 14, 969-973), or adamantane acetic acid (Manoharan et al., between two nucleotides contains a phosphorothioate, chiral Tetrahedron Lett., 1995, 36, 3651-3654), a palmityl moiety phosphorothioate, phosphorodithioate, phosphotriester, ami (Mishra et al., Biochim. Biophys. Acta, 1995, 1264. 229 noalkylphosphotriester, methyl and other alkyl phosphonates 237), or an octadecylamine or hexylamino-carbonyl-oxycho including 3'-alkylene phosphonate and chiral phosphonates, lesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, phosphinates, phosphoramidates including 3'-amino phos 277,923-937. phoramidate and aminoalkylphosphoramidates, thionophos 0.139. There are a variety of sequences related to the Stau1 phoramidates, thionoalkylphosphonates, thionoalkylphos and Upfl gene having the following Genbank Accession photriesters, and boranophosphates. It is understood that Numbers: BC050432 and NM 002911, respectively. These these phosphate or modified phosphate linkage between two sequences and others are herein incorporated by reference in nucleotides can be through a 3'-5' linkage or a 2'-5' linkage, their entireties as well as for individual Subsequences con and the linkage can contain inverted polarity Such as 3'-5' to tained therein. 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts and free acid 0140. One particular sequence set forth in SEQID NO: 1 forms are also included. and having Genbank accession number BC050432 is used 0135) It is understood that nucleotide analogs need only herein, as an example, to exemplify the disclosed composi contain a single modification, but may also contain multiple tions and methods. It is understood that the description related modifications within one of the moieties or between different to this sequence is applicable to any sequence related to Staul moieties. unless specifically indicated otherwise. Those of skill in the 0136. Nucleotide substitutes are molecules having similar art understand how to resolve sequence discrepancies and functional properties to nucleotides, but which do not contain differences and to adjust the compositions and methods relat a phosphate moiety, such as peptide nucleic acid (PNA). ing to a particular sequence to other related sequences (i.e. Nucleotide substitutes are molecules that will recognize sequences of Upf1, SMD targets, ALU elements, ALU ele nucleic acids in a Watson-Crick or Hoogsteen manner, but ment containing linckNA). Primers and/or probes can be which are linked together through a moiety other than a designed for any Staul or Upf1 sequence given the informa phosphate moiety. Nucleotide substitutes are able to conform tion disclosed herein and known in the art. to a double helix type structure when interacting with the 0.141 Functional nucleic acids are nucleic acid molecules appropriate target nucleic acid. that have a specific function, such as binding a target mol 0137 Nucleotide substitutes are nucleotides or nucleotide ecule or catalyzing a specific reaction. Functional nucleic analogs that have had the phosphate moiety and/or Sugar acid molecules can be divided into the following categories, moieties replaced. Nucleotide substitutes do not contain a which are not meant to be limiting. For example, functional standard phosphorus atom. Substitutes for the phosphate can nucleic acids include antisense molecules, aptamers, be for example, short chain alkyl or cycloalkyl internucleo ribozymes, triplex forming molecules, and external guide side linkages, mixed heteroatom and alkyl orcycloalkyl inter sequences. The functional nucleic acid molecules can act as nucleoside linkages, or one or more short chain heteroatomic affectors, inhibitors, modulators, and stimulators of a specific US 2013/0317087 A1 Nov. 28, 2013

activity possessed by a target molecule, or the functional tity between both the siRNA and the target RNA. For nucleic acid molecules can possess a de novo activity inde example, WO 02/44321 discloses siRNAs capable of pendent of any other molecules. sequence-specific degradation of target mRNAS when base paired with 3' overhanging ends. The direction of dsRNA 0142 Antisense molecules are designed to interact with a processing determines whether a sense or an antisense target target nucleic acid molecule through either canonical or non RNA can be cleaved by the produced siRNA endonuclease canonical base pairing. The interaction of the antisense mol complex. Thus, siRNAs can be used to modulate transcrip ecule and the target molecule is designed to promote the tion, for example, by silencing genes such as Staul and Upfl. The effects of siRNAs have been demonstrated in cells from destruction of the target molecule through, for example, a variety of organisms, including Drosophila, C. elegans, RNAseH mediated RNA-DNA hybrid degradation. Alterna insects, frogs, plants, fungi, mice and humans. In certain tively the antisense molecule is designed to interrupt a pro examples, siRNAS are directed against certain target genes to cessing function that normally would take place on the target down regulate gene expression. For example, Staul, ALU molecule. Such as transcription or replication. Antisense mol element containing lincRNA, SMD targets, or Upfl expres ecules can be designed based on the sequence of the target sion can be down regulated by specifically targeting the molecule. Numerous methods for optimization of antisense siRNA to Stau1 or Upf1. efficiency by finding the most accessible regions of the target (0145 As discussed herein there are numerous variants of molecule exist. Exemplary methods would be in vitro selec the Staul protein and Upf1 protein that are known and herein tion experiments and DNA modification studies using DMS contemplated. In addition, to the known functional Staul and and DEPC. It is preferred that antisense molecules bind the Upf1 strain variants, there are derivatives of the Stau1 and target molecule with a dissociation constant (k) less than Upf1 proteins which also function in the disclosed methods 10. It is more preferred that antisense molecules bind with and compositions. Protein variants and derivatives are well a kless than 10. It is also more preferred that the antisense understood to those of skill in the art and in can involve amino molecules bind the target molecule with a k, less than 10'. acid sequence modifications. For example, amino acid It is also preferred that the antisense molecules bind the target sequence modifications typically fall into one or more of three molecule with a k, less than 10°. classes: Substitutional, insertional or deletional variants. 0143 Aptamers are molecules that interact with a target Insertions include amino and/or carboxyl terminal fusions as molecule, preferably in a specific way. Typically aptamers are well as intrasequence insertions of single or multiple amino small nucleic acids ranging from 15-50 bases in length that acid residues. Insertions ordinarily will be smaller insertions fold into defined secondary and tertiary structures, such as than those of amino or carboxyl terminal fusions, for stem-loops or G-quartets. Aptamers can bind Small mol example, on the order of one to four residues. Immunogenic ecules, such as ATP and theophiline, as well as large mol fusion protein derivatives, such as those described in the ecules, such as reverse transcriptase and thrombin. Aptamers examples, are made by fusing a polypeptide Sufficiently large can bind very tightly with ks from the target molecule of less than 10 M. It is preferred that the aptamers bind the target to confer immunogenicity to the target sequence by cross molecule withak, less than 10°. It is more preferred that the linking in vitro or by recombinant cell culture transformed aptamers bind the target molecule with a k, less than 10. It with DNA encoding the fusion. Deletions are characterized is also more preferred that the aptamers bind the target mol by the removal of one or more amino acid residues from the ecule with a k, less than 10'. It is also preferred that the protein sequence. Typically, no more than about from 2 to 6 aptamers bind the target molecule with a k, less than 10°. residues are deleted at any one site within the protein mol Aptamers can bind the target molecule with a very high ecule. These variants ordinarily are prepared by site specific degree of specificity. For example, aptamers have been iso mutagenesis of nucleotides in the DNA encoding the protein, lated that have greater than a 10000 fold difference in binding thereby producing DNA encoding the variant, and thereafter affinities between the target molecule and another molecule expressing the DNA in recombinant cell culture. Techniques that differ at only a single position on the molecule (U.S. Pat. for making Substitution mutations at predetermined sites in No. 5,543.293). It is preferred that the aptamer have ak with DNA having a known sequence are well known, for example the target molecule at least 10 fold lower than the k with a M13 primer mutagenesis and PCR mutagenesis. Amino acid background binding molecule. It is more preferred that the Substitutions are typically of single residues, but can occurat aptamer have a k with the target molecule at least 100 fold a number of different locations at once; insertions usually will lower than the k with a background binding molecule. It is be on the order of about from 1 to 10amino acid residues; and more preferred that the aptamer have a k with the target deletions will range about from 1 to 30 residues. Deletions or molecule at least 1000 fold lower than the k with a back ground binding molecule. It is preferred that the aptamer have insertions preferably are made in adjacent pairs, i.e. a deletion ak with the target molecule at least 10000 fold lower than the of 2 residues or insertion of 2 residues. Substitutions, dele k with a background binding molecule. It is preferred when tions, insertions or any combination thereofmay be combined doing the comparison for a polypeptide for example, that the to arrive at a final construct. The mutations must not place the background molecule be a different polypeptide. sequence out of reading frame and preferably will not create complementary regions that could produce secondary mRNA 0144. It is understood herein that “siRNA referes to double-stranded RNAS that can induce sequence-specific structure. Substitutional variants are those in which at least post-transcriptional gene silencing, thereby decreasing or one residue has been removed and a different residue inserted even inhibiting gene expression. In one example, an siRNA in its place. Such substitutions generally are made in accor triggers the specific degradation of homologous RNA mol dance with the following Tables 1 and 2 and are referred to as ecules, such as mRNAS, within the region of sequence iden conservative Substitutions. US 2013/0317087 A1 Nov. 28, 2013 17

TABLE 1. 0147 For example, the replacement of one amino acid residue with another that is biologically and/or chemically Amino Acid Abbreviations similar is known to those skilled in the art as a conservative substitution. For example, a conservative substitution would Amino Acid Abbreviations be replacing one hydrophobic residue for another, or one alanine Ala: A polar residue for another. The substitutions include combina arginine Arg; R asparagine ASn; N tions such as, for example, Gly, Ala; Val, Ile, Leu, Asp, Glu; aspartic acid Asp;D ASn, Gln: Ser. Thr; Lys, Arg; and Phe, Tyr. Such conserva cysteine Cys; C tively substituted variations of each explicitly disclosed glutamic acid Glu; E sequence are included within the mosaic polypeptides pro glutamine Gln: Q vided herein. glycine Gly: G histidine His; H 0148 Substitutional or deletional mutagenesis can be isolelucine Ile: I employed to insert sites for N-glycosylation (Asn-X-Thr/Ser) leucine Leu; L lysine Lys; K or O-glycosylation (Seror Thr). Deletions of cysteine or other methionine Met; M labile residues also may be desirable. Deletions or substitu phenylalanine Phe, F tions of potential proteolysis sites, e.g. Arg, is accomplished proline Pro; P for example by deleting one of the basic residues or substi serine Ser:S tuting one by glutaminyl or histidyl residues. threonine Thr; T tyrosine Tyr;Y 0149 Certain post-translational derivatizations are the tryptophan Trp; W result of the action of recombinant host cells on the expressed valine Val; V polypeptide. Glutaminyl and asparaginyl residues are fre quently post-translationally deamidated to the corresponding glutamyl and asparyl residues. Alternatively, these residues are deamidated under mildly acidic conditions. Other post TABLE 2 translational modifications include hydroxylation of proline Amino Acid Substitutions and lysine, phosphorylation of hydroxyl groups of Seryl or Original Residue Exemplary Conservative threonyl residues, methylation of the o-amino groups of Substitutions, others are known in the art. lysine, arginine, and histidine side chains (T. E. Creighton, Ala: Ser Proteins: Structure and Molecular Properties, W. H. Freeman Arg; Lys, Gln & Co., San Francisco pp 79-86 1983), acetylation of the ASn; Glin; His Asp: Glu N-terminal amine and, in some instances, amidation of the Cys; Ser C-terminal carboxyl. Glin; ASn; Lys 0150. It is understood that one way to define the variants Glu: Asp Gly: Pro and derivatives of the disclosed proteins herein is through His; ASn; Glin defining the variants and derivatives in terms of homology/ Ile: Leu; Val identity to specific known sequences. For example, SEQID Leu: Ile: Val NO: 2 sets forth a particular sequence of Stau1. Specifically Lys; Arg: Gln; disclosed are variants of these and other proteins herein dis Met; Leu: Ile Phe: Met; Leu: Tyr closed which have at least, 70% or 75% or 80% or 85% or Ser: Thr 90% or 95% homology to the stated sequence. Those of skill Thr; Ser in the art readily understand how to determine the homology Trp; Tyr of two proteins. For example, the homology can be calculated Tyr; Trp; Phe after aligning the two sequences so that the homology is at its Val: Ile: Leu highest level. 0151. Another way of calculating homology can be per 0146 Substantial changes in function or immunological formed by published algorithms. Optimal alignment of identity are made by selecting Substitutions that are less con sequences for comparison may be conducted by the local servative than those in Table 2, i.e., selecting residues that differ more significantly in their effect on maintaining (a) the homology algorithm of Smith and Waterman Adv. Appl. structure of the polypeptide backbone in the area of the sub Math. 2:482 (1981), by the homology alignment algorithm of stitution, for example as a sheet or helical conformation, (b) Needleman and Wunsch, J. Mol. Biol. 48: 443 (1970), by the the charge or hydrophobicity of the molecule at the target site search for similarity method of Pearson and Lipman, Proc. or (c) the bulk of the side chain. The substitutions which in Natl. Acad. Sci. U.S.A. 85: 2444 (1988), by computerized general are expected to produce the greatest changes in the implementations of these algorithms (GAP, BESTFIT, protein properties will be those in which (a) a hydrophilic FASTA, and TFASTA in the Wisconsin Genetics Software residue, e.g. seryl or threonyl, is substituted for (or by) a Package, Genetics Computer Group, 575 Science Dr. Madi hydrophobic residue, e.g. leucyl, isoleucyl, phenylalanyl. son, Wis.), or by inspection. valyl or alanyl; (b) a cysteine or proline is substituted for (or 0152. It is understood that the description of conservative by) any other residue; (c) a residue having an electropositive mutations and homology can be combined together in any side chain, e.g., lysyl, arginyl, or histidyl, is Substituted for (or combination, such as embodiments that have at least 70% by) an electronegative residue, e.g., glutamyl or aspartyl; or homology to a particular sequence wherein the variants are (d) a residue having a bulky side chain, e.g., phenylalanine, is conservative mutations. Substituted for (or by) one not having a side chain, e.g., 0153. As this specification discusses various proteins and glycine, in this case, (e) by increasing the number of sites for protein sequences it is understood that the nucleic acids that Sulfation and/or glycosylation. can encode those protein sequences are also disclosed. This US 2013/0317087 A1 Nov. 28, 2013

would include all degenerate sequences related to a specific other viral vectors, and for this reason are a commonly used protein sequence, i.e. all nucleic acids having a sequence that vector. However, they are not as useful in non-proliferating encodes one particular protein sequence as well as all nucleic cells. Adenovirus vectors are relatively stable and easy to acids, including degenerate nucleic acids, encoding the dis work with, have high titers, and can be delivered in aerosol closed variants and derivatives of the protein sequences. formulation, and can transfect non-dividing cells. Pox viral Thus, while each particular nucleic acid sequence may not be vectors are large and have several sites for inserting genes, written out herein, it is understood that each and every they are thermostable and can be stored at room temperature. sequence is in fact disclosed and described herein through the A preferred embodiment is a viral vector which has been disclosed protein sequence. For example, one of the many engineered so as to Suppress the immune response of the host nucleic acid sequences that can encode the protein sequence organism, elicited by the viral antigens. Preferred vectors of set forth in SEQID NO:2 is set forth in SEQID NO:1. It is this type will carry coding regions for Interleukin 8 or 10. understood that all of the nucleic acid sequences that encode 0158 Viral vectors can have higher transaction (ability to this particular derivative of the Staul are also disclosed introduce genes) abilities than chemical or physical methods including for example SEQID NO:1 which set forth two of to introduce genes into cells. Typically, viral vectors contain, the degenerate nucleic acid sequences that encode the par nonstructural early genes, structural late genes, an RNA poly ticular polypeptide set forth in SEQID NO:2. It is also under merase III transcript, inverted terminal repeats necessary for stood that while no amino acid sequence indicates what par replication and encapsidation, and promoters to control the ticular DNA sequence encodes that protein within an transcription and replication of the viral genome. When engi organism, where particular variants of a disclosed protein are neered as Vectors, viruses typically have one or more of the disclosed herein, the known nucleic acid sequence that early genes removed and a gene or gene/promotor cassette is encodes that protein in the particular Staul from which that inserted into the viral genome in place of the removed viral protein arises is also known and herein disclosed and DNA. Constructs of this type can carry up to about 8 kb of described. foreign genetic material. The necessary functions of the 0154 There are a number of compositions and methods removed early genes are typically Supplied by cell lines which which can be used to deliver nucleic acids to cells, either in have been engineered to express the gene products of the early vitro or in vivo. These methods and compositions can largely genes in trans. be broken down into two classes: viral based delivery systems 0159. A retrovirus is an animal virus belonging to the virus and non-viral based delivery systems. For example, the family of Retroviridae, including any types, Subfamilies, nucleic acids can be delivered through a number of direct genus, or tropisms. A retrovirus is essentially a package delivery systems such as, electroporation, lipofection, cal which has packed into it nucleic acid cargo. The nucleic acid cium phosphate precipitation, plasmids, viral vectors, viral cargo carries with it a packaging signal, which ensures that nucleic acids, phage nucleic acids, phages, cosmids, or via the replicated daughter molecules will be efficiently pack transfer of genetic material in cells or carriers such as cationic aged within the package coat. In addition to the package liposomes. Appropriate means for transfection, including signal, there are a number of molecules which are needed in viral vectors, chemical transfectants, or physico-mechanical cis, for the replication, and packaging of the replicated virus. methods such as electroporation and direct diffusion of DNA, Typically a retroviral genome, contains the gag, pol, and env are described by, for example, Wolff, J.A., et al., Science, 247, genes which are involved in the making of the protein coat. It 1465-1468, (1990); and Wolff, J. A. Nature, 352, 815-818, is the gag, pol, and env genes which are typically replaced by (1991) Such methods are well known in the art and readily the foreign DNA that it is to be transferred to the target cell. adaptable for use with the compositions and methods Retrovirus vectors typically contain a packaging signal for described herein. In certain cases, the methods will be modi incorporation into the package coat, a sequence which signals fied to specifically function with large DNA molecules. Fur the start of the gag transcription unit, elements necessary for ther, these methods can be used to target certain diseases and reverse transcription, including a primer binding site to bind cell populations by using the targeting characteristics of the the tRNA primer of reverse transcription, terminal repeat carrier. sequences that guide the switch of RNA strands during DNA 0155 Transfer vectors can be any nucleotide construction synthesis, a purine rich sequence 5' to the 3' LTR that serve as used to deliver genes into cells (e.g., a plasmid), or as part of the priming site for the synthesis of the second strand of DNA a general strategy to deliver genes, e.g., as part of recombinant synthesis, and specific sequences near the ends of the LTRS retrovirus or adenovirus. that enable the insertion of the DNA state of the retrovirus to 0156. As used herein, plasmid or viral vectors are agents insert into the host genome. The removal of the gag, pol, and that transport the disclosed nucleic acids, such as Stau1 and enV genes allows for about 8 kb of foreign sequence to be Upf1 into the cell without degradation and include a promoter inserted into the viral genome, become reverse transcribed, yielding expression of the gene in the cells into which it is and upon replication be packaged into a new retroviral par delivered. ticle. This amount of nucleic acid is sufficient for the delivery 0157 Viral vectors are, for example, Adenovirus, Adeno of a one to many genes depending on the size of each tran associated virus, Herpes virus, Vaccinia virus, Polio virus, script. It is preferable to include either positive or negative AIDS virus, neuronal trophic virus, Sindbis and other RNA selectable markers along with other genes in the insert. viruses, including these viruses with the HIV backbone. Also 0160 Since the replication machinery and packaging pro preferred are any viral families which share the properties of teins in most retroviral vectors have been removed (gag, pol, these viruses which make them suitable for use as vectors. and env), the vectors are typically generated by placing them Retroviruses include Murine Maloney Leukemia virus, into a packaging cell line. A packaging cell line is a cell line MMLV, and retroviruses that express the desirable properties which has been transfected or transformed with a retrovirus of MMLV as a vector. Retroviral vectors are able to carry a that contains the replication and packaging machinery, but larger genetic payload, i.e., a transgene or marker gene, than lacks any packaging signal. When the vector carrying the US 2013/0317087 A1 Nov. 28, 2013

DNA of choice is transfected into these cell lines, the vector heterologous DNA-150 kb to specific cells. EBV recombi containing the gene of interest is replicated and packaged into nants can maintain large pieces of DNA in the infected B-cells new retroviral particles, by the machinery provided in cis by as episomal DNA. Individual clones carried human genomic the helper cell. The genomes for the machinery are not pack inserts up to 330 kb appeared genetically stable The mainte aged because they lack the necessary signals. nance of these episomes requires a specific EBV nuclear 0161 The benefit of the use of these viruses as vectors is protein, EBNA1, constitutively expressed during infection that they are limited in the extent to which they can spread to with EBV. Additionally, these vectors can be used for trans other cell types, since they can replicate within an initial fection, where large amounts of protein can be generated infected cell, but are unable to form new infectious viral transiently in vitro. Herpesvirus amplicon systems are also particles. Recombinant adenoviruses have been shown to being used to package pieces of DNA-220 kb and to infect achieve high efficiency gene transfer after direct, in vivo cells that can stably maintain DNA as episomes. delivery to airway epithelium, hepatocytes, vascular endot 0169. Other useful systems include, for example, replicat helium, CNS parenchyma and a number of other tissue sites ing and host-restricted non-replicating vaccinia virus vectors. Recombinant adenoviruses achieve gene transduction by 0170 The disclosed compositions can be delivered to the binding to specific cell surface receptors, after which the virus target cells in a variety of ways. For example, the composi is internalized by receptor-mediated endocytosis, in the same tions can be delivered through electroporation, or through manner as wild type or replication-defective adenovirus. lipofection, or through calcium phosphate precipitation. The 0162. A viral vector can be one based on an adenovirus delivery mechanism chosen will depend in part on the type of which has had the E1 gene removed and these virons are cell targeted and whether the delivery is occurring for generated in a cell line such as the human 293 cell line. In example in vivo or in vitro. another preferred embodiment both the E1 and E3 genes are 0171 Thus, the compositions can comprise, lipids such as removed from the adenovirus genome. liposomes, such as cationic liposomes (e.g., DOTMA, 0163 Another type of viral vector is based on an adeno DOPE, DC-cholesterol) or anionic liposomes. Liposomes associated virus (AAV). This defective parvovirus is a pre can further comprise proteins to facilitate targeting a particu ferred vector because it can infect many cell types and is lar cell, if desired. Administration of a composition compris nonpathogenic to humans. AAV type Vectors can transport ing a compound and a cationic liposome can be administered about 4 to 5 kb and wild type AAV is known to stably insert to the blood afferent to a target organ or inhaled into the into chromosome 19. Vectors which contain this site specific respiratory tract to target cells of the respiratory tract. Fur integration property are preferred. An especially preferred thermore, the compound can be administered as a component embodiment of this type of vector is the P4.1 C vector pro of a microcapsule that can be targeted to specific cell types, duced by Avigen, San Francisco, Calif., which can contain the Such as macrophages, or where the diffusion of the compound herpes simplex virus thymidine kinase gene, HSV-tk, and/or or delivery of the compound from the microcapsule is a marker gene. Such as the gene encoding the green fluores designed for a specific rate or dosage. cent protein, GFP. 0.172. In the methods described above which include the 0164. In another type of AAV virus, the AAV contains a administration and uptake of exogenous DNA into the cells of pair of inverted terminal repeats (ITRs) which flank at least a subject (i.e., gene transduction or transfection), delivery of one cassette containing a promoter which directs cell-specific the compositions to cells can be via a variety of mechanisms. expression operably linked to a heterologous gene. Heterolo As one example, delivery can be via a liposome, using com gous in this context refers to any nucleotide sequence or gene mercially available liposome preparations such as LIPOFEC which is not native to the AAV or B19 parvovirus. TIN, LIPOFECTAMINE (GIBCO-BRL, Inc., Gaithersburg, 0.165 Typically the AAV and B19 coding regions have Md.), SUPERFECT (Qiagen, Inc. Hilden, Germany) and been deleted, resulting in a safe, noncytotoxic vector. The TRANSFECTAM (Promega Biotec, Inc., Madison, Wis.), as AAV ITRs, or modifications thereof, confer infectivity and well as other liposomes developed according to procedures site-specific integration, but not cytotoxicity, and the pro standard in the art. In addition, the nucleic acid or vector of moter directs cell-specific expression. this invention can be delivered in vivo by electroporation, the 0166 The vectors of the present invention thus provide technology for which is available from Genetronics, Inc. (San DNA molecules which are capable of integration into a mam Diego, Calif.) as well as by means of a SONOPORATION malian chromosome without Substantial toxicity. machine (ImaRX Pharmaceutical Corp., Tucson, Ariz.). 0167. The inserted genes in viral and retroviral usually 0173 The materials may be in solution, suspension (for contain promoters, and/or enhancers to help control the example, incorporated into microparticles, liposomes, or expression of the desired gene product. A promoter is gener cells). These may be targeted to a particular cell type via ally a sequence or sequences of DNA that function when in a antibodies, receptors, or receptor ligands. These techniques relatively fixed location in regard to the transcription start can be used for a variety of other speciifc cell types. Vehicles site. A promoter contains core elements required for basic Such as 'stealth’ and other antibody conjugated liposomes interaction of RNA polymerase and transcription factors, and (including lipid mediated drug targeting to colonic carci may contain upstream elements and response elements. noma), receptor mediated targeting of DNA through cell spe 0168 Molecular genetic experiments with large human cific ligands, lymphocyte directed tumor targeting, and herpesviruses have provided a means whereby large heterolo highly specific therapeutic retroviral targeting of murine gous DNA fragments can be cloned, propagated and estab glioma cells in vivo. The following references are examples lished in cells permissive for infection with herpesviruses of the use of this technology to target specific proteins to (Sun et al., Nature genetics 8: 33-41, 1994; Cotter and Rob tumor tissue. In general, receptors are involved in pathways of ertson, Curr Opin Mol Ther 5: 633-644, 1999). These large endocytosis, either constitutive or ligand induced. These DNA viruses (herpes simplex virus (HSV) and Epstein-Barr receptors cluster in clathrin-coated pits, enter the cell via virus (EBV), have the potential to deliver fragments of human clathrin-coated vesicles, pass through an acidified endoSome US 2013/0317087 A1 Nov. 28, 2013 20 in which the receptors are sorted, and then either recycle to the conveniently obtained as an SV40 restriction fragment which cell Surface, become stored intracellularly, or are degraded in also contains the SV40 viral origin of replication. The imme lysosomes. The internalization pathways serve a variety of diate early promoter of the human cytomegalovirus is conve functions, such as nutrient uptake, removal of activated pro niently obtained as a HindIII E restriction fragment. Of teins, clearance of macromolecules, opportunistic entry of course, promoters from the host cellor related species also are viruses and toxins, dissociation and degradation of ligand, useful herein. and receptor-level regulation. Many receptors follow more 0180 Enhancer generally refers to a sequence of DNA that than one intracellular pathway, depending on the cell type, functions at no fixed distance from the transcription start site receptor concentration, type of ligand, ligand Valency, and and can be either 5' to the transcription unit. Furthermore, ligand concentration. enhancers can be within an intron (Banerji, J. L. et al., Cell 33: 0174 Nucleic acids that are delivered to cells which are to 729 (1983)) as well as within the coding sequence itself be integrated into the host cell genome, typically contain (Osborne, T. F., et al., Mol. Cell. Bio. 4: 1293 (1984)). They integration sequences. These sequences are often viral related are usually between 10 and 300 bp in length, and they func sequences, particularly when viral based systems are used. tion in cis. Enhancers function to increase transcription from These viral intergration systems can also be incorporated into nearby promoters. Enhancers also often contain response ele nucleic acids which are to be delivered using a non-nucleic ments that mediate the regulation of transcription. Promoters acid based system of deliver, Such as a liposome, so that the can also contain response elements that mediate the regula nucleic acid contained in the delivery system can be come tion of transcription. Enhancers often determine the regula integrated into the host genome. tion of expression of a gene. While many enhancer sequences 0175 Other general techniques for integration into the are now known from mammalian genes (globin, elastase, host genome include, for example, systems designed to pro albumin, C.-fetoprotein and insulin), typically one will use an mote homologous recombination with the host genome. enhancer from a eukaryotic cell virus for general expression. These systems typically rely on sequence flanking the nucleic Preferred examples are the SV40 enhancer on the late side of acid to be expressed that has enough homology with a target the replication origin (bp 100-270), the cytomegalovirus sequence within the host cell genome that recombination early promoter enhancer, the polyoma enhancer on the late between the vector nucleic acid and the target nucleic acid side of the replication origin, and adenovirus enhancers. takes place, causing the delivered nucleic acid to be integrated 0181. The promotor and/or enhancer may be specifically into the host genome. These systems and the methods neces activated either by light or specific chemical events which sary to promote homologous recombination are known to trigger their function. Systems can be regulated by reagents those of skill in the art. Such as tetracycline and dexamethasone. There are also ways 0176). As described above, the compositions can be admin to enhance viral vector gene expression by exposure to irra istered in a pharmaceutically acceptable carrier and can be diation, such as gamma irradiation, or alkylating chemo delivered to the subjects cells in vivo and/or ex vivo by a therapy drugs. variety of mechanisms well known in the art (e.g., uptake of 0182. In certain embodiments the promoter and/or naked DNA, liposome fusion, intramuscular injection of enhancer region can act as a constitutive promoter and/or DNA via a gene gun, endocytosis and the like). enhancer to maximize expression of the region of the tran 0177. If ex vivo methods are employed, cells or tissues can Scription unit to be transcribed. In certain constructs the pro be removed and maintained outside the body according to moter and/or enhancer region be active in all eukaryotic cell standard protocols well known in the art. The compositions types, even if it is only expressed in a particular type of cell at can be introduced into the cells via any gene transfer mecha a particular time. A preferred promoter of this type is the nism, such as, for example, calcium phosphate mediated gene CMV promoter (650 bases). Other preferred promoters are delivery, electroporation, microinjection or proteoliposomes. SV40 promoters, cytomegalovirus (full length promoter), The transduced cells can then be infused (e.g., in a pharma and retroviral vector LTF. ceutically acceptable carrier) or homotopically transplanted 0183. It has been shown that all specific regulatory ele back into the subject per standard methods for the cell or ments can be cloned and used to construct expression vectors tissue type. Standard methods are known for transplantation that are selectively expressed in specific cell types such as or infusion of various cells into a subject. melanoma cells. The glial fibrillary acetic protein (GFAP) 0.178 The nucleic acids that are delivered to cells typically promoter has been used to selectively express genes in cells of contain expression controlling systems. For example, the glial origin. inserted genes in viral and retroviral systems usually contain 0.184 Expression vectors used in eukaryotic host cells promoters, and/or enhancers to help control the expression of (yeast, fungi, insect, plant, animal, human or nucleated cells) the desired gene product. A promoter is generally a sequence may also contain sequences necessary for the termination of or sequences of DNA that function when in a relatively fixed transcription that may affect mRNA expression. These location in regard to the transcription start site. A promoter regions are transcribed as polyadenylated segments in the contains core elements required for basic interaction of RNA untranslated portion of the mRNA encoding tissue factor polymerase and transcription factors, and may contain protein. The 3' untranslated regions also include transcription upstream elements and response elements. termination sites. It is preferred that the transcription unit also 0179 Preferred promoters controlling transcription from contain a polyadenylation region. One benefit of this region is vectors in mammalian host cells may be obtained from Vari that it increases the likelihood that the transcribed unit will be ous sources, for example, the genomes of viruses such as processed and transported like mRNA. The identification and polyoma, Simian Virus 40 (SV40), adenovirus, retroviruses, use of polyadenylation signals in expression constructs is hepatitis-B Virus and most preferably cytomegalovirus, or well established. It is preferred that homologous polyadeny from heterologous mammalian promoters, e.g. beta actin pro lation signals be used in the transgene constructs. In certain moter. The early and late promoters of the SV40 virus are transcription units, the polyadenylation region is derived US 2013/0317087 A1 Nov. 28, 2013 from the SV40 early polyadenylation signal and consists of dominant selection use the drugs neomycin, mycophenolic about 400 bases. It is also preferred that the transcribed units acid, or hygromycin. The three examples employ bacterial contain other standard sequences alone or in combination genes under eukaryotic control to convey resistance to the with the above sequences improve expression from, or stabil appropriate drug G418 or neomycin (geneticin), Xgpt (myco ity of the construct. phenolic acid) or hygromycin, respectively. Others include 0185. The viral vectors can include a nucleic acid the neomycin analog G418 and puramycin. sequence encoding a marker product. This marker product is 0188 Disclosed herein are kits that are drawn to reagents used to determine if the gene has been delivered to the cell and that can be used in practicing the methods disclosed herein. once delivered is being expressed. Preferred marker genes are The kits can include any reagent or combination of reagents the E. Coli lac7 gene, which encodes B-galactosidase, and discussed herein or that would be understood to be required or green fluorescent protein. beneficial in the practice of the disclosed methods. For 0186. In some embodiments the marker may be a select example, the kits could include primers to perform the ampli able marker. Examples of suitable selectable markers for fication reactions discussed in certain embodiments of the mammalian cells are dihydrofolate reductase (DHFR), thy methods, as well as the buffers and enzymes required to use midine kinase, neomycin, neomycin analog G418, hydromy the primers as intended. The kits could include systems com cin, and puromycin. When Such selectable markers are suc prising the essential elements of SMD activity. cessfully transferred into a mammalian host cell, the 0189 The compositions disclosed herein and the compo transformed mammalian host cell can Survive if placed under sitions necessary to perform the disclosed methods can be selective pressure. There are two widely used distinct catego made using any method known to those of skill in the art for ries of selective regimes. The first category is based on a cells that particular reagent or compound unless otherwise specifi metabolism and the use of a mutant cell line which lacks the cally noted. ability to grow independent of a Supplemented media. Two 0190. The following examples are put forth so as to pro examples are: CHODHFR-cells and mouse LTK-cells. These vide those of ordinary skill in the art with a complete disclo cells lack the ability to grow without the addition of such Sure and description of how the compounds, compositions, nutrients as thymidine or hypoxanthine. Because these cells articles, devices and/or methods claimed herein are made and lack certain genes necessary for a complete nucleotide Syn evaluated, and are intended to be purely exemplary of the thesis pathway, they cannot survive unless the missing nucle invention and are not intended to limit the scope of what the otides are provided in a Supplemented media. An alternative inventors regard as their invention. Efforts have been made to to supplementing the media is to introduce an intact DHFR or ensure accuracy with respect to numbers (e.g., amounts, tem TK gene into cells lacking the respective genes, thus altering perature, etc.), but some errors and deviations should be their growth requirements. Individual cells that were not accounted for. Unless indicated otherwise, parts are parts by transformed with the DHFR or TK gene will not be capable of weight, temperature is in C. or is at ambient temperature, Survival in non-Supplemented media. and pressure is at or near atmospheric. 0187. The second category is dominant selection which refers to a selection scheme used in any cell type and does not Example 1 require the use of a mutant cell line. These schemes typically use a drug to arrest growth of a host cell. Those cells that have a novel gene would express a protein conveying drug resis Identification of mRNAs Bound by Staufen-1 tance and would survive the selection. Examples of such (0191) TABLE 3 Genes that Encode Putative Staul-binding mRNAs as Determined by Microarray Analysis Gene Symbol Accession Number Unigene Name ARF1 AA58OOO)4 ADP-ribosylation factor 1 MGC14799 BCOOS995 hypothetical protein MGC14799 GNAS AFO64O92 GNAS complex locus DFFA NMOO44O1 DNA fragmentation factor 45kDa alpha polypeptide CSDA NM OO3651 cold shock domain protein A SEC61A1 NM O13336 Sec61 alpha 1 subunit (S. cerevisiae) PSMD12 NM OO2816 proteasome (prosome macropain) 26S subunit non-ATPase 12 EIFSA NM OO1970 eukaryotic translation initiation factor 5A C4orf RO6783 chromosome 4 open reading frame 9 FLJ10613 NM O19067 hypothetical protein FLJ10613 GNE NM O05476 glucosamine (UDP-N-acetyl)-2-epimerase/N- acetylmannosamine kinase FLJ30656 AW873564 H. sapiens transcribed sequences LOC149603 AAO85748 hypothetical protein LOC149603 TEGT NM O03217 estis enhanced gene transcript (BAX inhibitor 1) MCM4 AI8S986S MCM4 minichromosome maintenance deficient 4 (S. cerevisiae) LOC63929 NM O22098 hypothetical protein LOC63929 KIAAO186 NM O21067 KIAA0186 gene product PRKAR2A BF246917 protein kinase cAMP-dependent regulatory type II alpha NUTF2 NM OO5796 nuclear transport factor 2 US 2013/0317087 A1 Nov. 28, 2013 22

TABLE 3-continued

Genes that Encode Putative Stau1-binding mRNAs as Determined by Microarray Analysis

Gene Symbol Accession Number Unigene Name

GDF1 NM OO1492 growth differentiation factor 1 PAICS AA902652 phosphoribosylaminoimidazole carboxylase phosphoribosylaminoimidazole Succinocarboxamide synthetase TMPO AF113682 thymopoietin AAMP NM 001087 angio-associated migratory cell protein

293 cells were transiently transfected with a plasmid that expressed Staul-HA or, to control for nonspecific IP Stau1-6xHis, Biotin-labeled cRNA was synthesized fromRNA that had been immunopurified using anti-HA antibody and hybridized to Affymetrix U133A microarrays. Changes of at least 2.5-fold were scored as Staul-interacting transcripts,

TABLE 4 Transcripts up-regulated after down-regulating Stau1 in two independently performed analyses (Note: Redundancies reflect different wells in each microarray) AFFX-M27830 5 at Unknown transcript 211506 s at Unknown transcript (don't know if same as above) 205660 at 2'-5'-oligoadenylate synthetase-like 210797 s at 2'-5'-oligoadenylate synthetase-like // 2'-5'-oligoadenylate synthetase-like 212543 at absent in melanoma 1 200974 at actin alpha 2 Smooth muscle aorta 204470 at chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity alpha) 228335 at claudin 11 (oligodendrocyte transmembrane protein) 202712 s at creatine kinase mitochondrial 1 (ubiquitous) 2198.63 at cyclin-Ebinding protein 1 210764 sat cysteine-rich angiogenic inducer 61 232165 at epiplakin 1 232164 sat epiplakin 1 216442 x at fibronectin 1 210495 X at fibronectin 1 212464 S at fibronectin 1 211719 x at fibronectin 1 fibronectin 1 212473 s at flavoprotein oxidoreductase MICAL2 226269 a ganglioside-induced differentiation-associated protein 1 204471 a growth associated protein 43 205184 a guanine nucleotide binding protein (G protein) gamma 4 209657 s at heat shock transcription factor 2 227547 a Homo sapiens transcribed sequence with moderate similarity to protein ref:NP 071431.1 (H. sapiens) cytokine receptor-like factor 2; cytokine receptor CRL2 precusor Homo sapiens 230831 a Homo sapiens transcribed sequences 218986 s at hypothetical protein FLJ20035 235417 a hypothetical protein FLJ25348 1562415 a. at hypothetical protein FLJ25348 212909 a hypothetical protein MGC29643 211959 a insulin-like growth factor binding protein 5 214453 s at interferon-induced protein 44 226757 a interferon-induced protein with tetratricopeptide repeats 2 22.9450 a interferon-induced protein with tetratricopeptide repeats 4 205798 a interleukin 7 receptor 202859 x at interleukin 8 201650 a keratin 19 keratin 19 224657 a mitogen-inducible gene 6 242456 a MRE 11 meiotic recombination 11 homolog A (S. cerevisiae) 210809 s at osteoblast specific factor 2 (fasciclin I-like) 201288 a Rho GDP dissociation inhibitor (GDI) beta 204035 a. Secretogranin II (chromogranin C) 597.05 at Selenocysteine lyase 222557 a stathmin-like 3 221477 s at Superoxide dismutase 2 mitochondrial 220325 a. TAF7-like RNA polymerase IITATA box binding protein (TBP)- associated factor 50kDa 235086 a thrombospondin 1 201108 s at thrombospondin 1 201109s at thrombospondin 1 209277 a tissue factor pathway inhibitor 2 US 2013/0317087 A1 Nov. 28, 2013

TABLE 4-continued Transcripts up-regulated after down-regulating Stau1 in two independently performed analyses (Note: Redundancies reflect different wells in each microarray) 205547 s at transgelin 1555724 sat transgelin 206508 at tumor necrosis factor (ligand) Superfamily member 7 202330 s at uracil-DNA glycosylase

0.192 The microarray results indicate that SMD can be (0194 To construct pcFLuc(UAA->CAA)-MS2bs, which utilized by mammalian cells to regulate the abundance of lacks a termination codon upstream of the MS2 binding sites, hundreds of cellular transcripts and, hence, expression of the pcFLuc-8bs that had been digested with NotI and EcoRV was encoded proteins. Transcripts identified to be regulated by ligated to a PCR-amplified fragment that contains C-terminus SMD have a broad range of cellular functions that include of FLuc in which the UAA codon was converted to a CAA signal transduction, cell proliferation, cell metabolism, codon and had been digested with NotI and EcoRV. The PCR immune response, DNA repair, and transcriptional regula reactions were performed using pR/HCV/F and two primers: tion. Therefore, SMD can play a key role in establishing and 5'-TTGACCGCTTGAAGTCTTTAATTAAATAC-3 (sense) maintaining cellular homeostasis. For example, SMD natu (SEQ ID NO. 34) and 5'-CGAAGCGGCCGCAATTA rally targets transcripts encoding the IL-7 receptor (IL-7R). CATTTTGCAATTTGG ACTTTCCGCCCTTCTTGGC-3' c-JUN, and SERPINE1 (also called PAI1). Down regulating (antisense) (SEQID NO:35). Underlined nucleotides specify cellular Staufen 1 or Upf1 but not Upf2 increased the abun a Not site. dance of each cellular mRNA. Example 3 Example 2 A Minimized Staul Binding Site Resides 67 Identification of HeLa-Cell Transcripts are Nucleotides Downstream of the Normal Termination Regulated Upon Staul Depletion Codon of Arf1 mRNA and Mediates mRNA Decay (0195 To identify physiologic SMD targets, HeLa-cell 0193 The finding in two independently performed RNA from three independently performed transfections, in microarray analyses that there are at least 23293-cell mRNAs which the level of cellular Staul was depleted to as little as that bind Staul (Table 3) indicates that SMD is used by cells 4% of normal (where normal is defined as the level in the to coordinately regulate a battery of genes—a number of presence of Control siRNA), was separately hybridized to which are involved in cell growth, division or both in microarrays. Sequences from 18.279 HeLa-cell transcripts response to changes in the cellular abundance or specific were analyzed, representing 34% of the array probesets, in all activity of Stau1, Upf1 or both (see below). If binding is three hybridization experiments. It was observed that 124 Sufficiently downstream of the normal termination codon, transcripts, or 1.1% of the HeLa-cell transcriptome that was then these mRNAs should, like Arf1 mRNA, be natural tar analyzed, were upregulated at least 2-fold in all three trans gets of SMD in a mechanism that is EJC-independent. fections (Table 5). TABLE 5 Transcripts upregulated in human cells depleted of Staul in three independently performed microarray analyses Transcript Fold change Abbreviation Probe set Homo sapiens hypothetical protein LOC3394.68 mRNA 9.79 1562908 at (cDNA clone IMAGE: 5166507) partial cols I factor (complement) 8.78 IF 1555564 a at fibronectin 1 7.98 FN1 216442 X at interferon-induced protein with tetratricopeptide repeats 2 7.51 IFIT2 226757 a S.91 211506 s at interferon-induced protein 44 5.88 IFI44 214059 a secretogranin II (chromogramin C) S.62 SCG2 204035 a. stathmin-like 3 5.53 STMN3 222557 a growth associated protein 43 S.48 GAP43 204471 a creatine kinase mitochondrial 1 (ubiquitous) 5.35 CKMT1 202712 s at osteoblast specific factor 2 (fasciclin I-like) 5.30 OSF-2 210809 s at hypothetical protein FLJ25348 4.77 FL2S348 1562415 a. at guanine nucleotide binding protein (G protein) gamma 4 4.75 GNG4 205184 a hypothetical protein FLJ33505 4.73 FLJ33505 1561114 a at filamin-binding LIM protein-1 4.71 FBLP-1 1555480 a. at claudin 11 (oligodendrocyte transmembrane protein) 4SO CLDN11 228335 a. Homo sapiens transcribed sequence with weak similarity to 4.46 235629 a protein ref: NP 060265.1 (H. sapiens) hypothetical protein FLJ20378 Homo sapiens insulin-like growth factor binding protein 5 4.30 IGFBP5 211959 a integrin beta 3 (platelet glycoprotein IIIa antigen CD61) 4.18 ITGB3 204627 s at interferon-induced protein with tetratricopeptide repeats 4 4.13 IFIT4 22.9450 a US 2013/0317087 A1 Nov. 28, 2013 24

TABLE 5-continued Transcripts upregulated in human cells depleted of Staul in three independently performed microarray analyses Transcript Fold change Abbreviation Probe set alpha-actinin-2-associated LIM protein 3.97 ALP 210170 at transgelin 3.94 TAGLN 205547 s at 2'-5'-oligoadenylate synthetase-like // 2'-5'-oligoadenylate 3.86 OASL 210797 s at synthetase-like issue factor pathway inhibitor 2 3.82 TFPI2 209277 at catenin (cadherin-associated protein) alpha-like 1 3.80 CTNNAL1 213712 at Homo sapiens cDNA: FLJ20914 fisclone ADSE00646 3.76 234597 at hrombospondin 1 3.73 THEBS1 201108 s at protein tyrosine phosphatase receptor type O 3.62 PTPRO 1554199 at cyclin-E binding protein 1 3.60 CEB1 2198.63 at NADPH oxidase 4 3.59 NOX4 219773 at hypothetical protein MGC29643 3.58 MGC29643 212909 at Homo sapiens uncharacterized gastric protein ZA43P mRNA 3.43 232696 at partial cols Homo sapiens similar to KIAA0563-related gene 3.42 1562921 at (LOC376854) mRNA hypothetical protein FLJ20035 3.40 FL2OO3S 218986 s at Homo sapiens cDNA FLJ41180 fisclone BRACE2043142 3.40 227890 a issue factor pathway inhibitor 2 3.35 TFPI2 209278 s at absent in melanoma 1 3.34 AIM1 212543 a chromosome 14 open reading frame 141 3.29 C14orf141 223690 a dual specificity phosphatase 6 3.29 DUSP6 208891 a interferon alpha-inducible protein (clone IFI-15K) 3.19 G1P2 205483 s at serine (or cysteine) proteinase inhibitor clade E (nexin 3.16 SERPINE1 202628 s at plasminogen activator inhibitor type 1) member 1 Homo sapiens cDNA FLJ23692 fisclone HEP10227 3.13 235846 a hypothetical protein FLJ20637 3.04 FLU20637 219352 a signaling lymphocytic activation molecule family member 1 3.00 SLAMF1 206181 a Selenocysteine lyase 2.98 SCLY 597.05 at interleukin 7 receptor 2.97 ILTR 205798 a Rho GDP dissociation inhibitor (GDI) beta 2.94 ARHGDIB 201288 a actin alpha 2 Smooth muscle aorta 2.94 ACTA2 200974 a chemokine (C-X-C motif) ligand 1 (melanoma growth 2.84 CXCL1 204470 a stimulating activity alpha) DEAD H (Asp-Glu-Ala-Asp/His) box polypeptide 2.83 RIG-I 218943 s at insulin-like growth factor binding protein 5 2.78 IGFBP5 211958 a interferon-induced protein with tetratricopeptide repeats 1 2.78 IFIT1 203153 a Homo sapiens hypothetical protein LOC285103 mRNA 2.76 227966 s at (cDNA clone IMAGE: 5273139) partial cols decapping enzyme hDcp2 2.74 DCP2 212919 a hypothetical protein FLJ34064 2.73 FLJ34O64 1553244 at eukaryotic translation initiation factor 5A2 2.73 EIFSA2 235289 a hypothetical protein MGC19764 2.71 MGC19764 1557078 at Homo sapiens BIC noncoding mRNA complete sequence 2.69 2294.37 a transducin-like enhancer of split 4 (E(Sp1) homolog 2.68 TLE4 235765 a Drosophila) dapper homolog 1 antagonist of beta-catenin (xenopus) 2.67 DACT1 219179 a chromosome 9 open reading frame 39 2.64 C9orf39 220095 a Homo sapiens transcribed sequences 2.61 229242 a. v-jun sarcoma virus 17 oncogene homolog (avian) 2.58 JUN 201466 s at integrin alpha 4 (antigen CD49D alpha 4subunit of VLA-4 2.56 ITGA4 205885 s at receptor) Homo sapiens cDNA FLJ40697 fisclone THYMU2025406 2.53 235203 a Homo sapiens transcribed sequences 2.53 236817 a tenascin C (hexabrachion) 2.52 TNC 201645 a. hypothetical protein FLJ13621 2.50 FLJ13621 207286 a flavoprotein oxidoreductase MICAL2 2.47 MICAL2 212473 s at Homo sapiens cDNA FLJ46457 fisclone THYMU3020856 2.44 225007 a thymosin beta identified in neuroblastoma cells 2.44 TMSNB 205347 s at prostaglandin E receptor 4 (subtype EP4) 2.42 PTGER4 204897 a chromosome 14 open reading frame 128 2.41 C14orf128 228889 a ganglioside-induced differentiation-associated protein 1 2.41 GDAP1 226269 a Zinc finger protein 36 C3H type-like 1 2.38 ZFP36L1 211965 a. uracil-DNA glycosylase 2.37 UNG 202330 s at hypothetical protein MGC27277 2.37 MGC27.277 242283 a Homo sapiens cDNA FLJ10158 fisclone HEMBA1003463. 2.35 232125 a. CDK5 regulatory subunit associated protein 1-like 1 2.34 CDKAL1 214877 a Homo sapiens transcribed sequence with moderate similarity 2.32 227547 a to protein ref: NP 071431.1 (H.Sapiens) cytokine receptor like factor 2 US 2013/0317087 A1 Nov. 28, 2013 25

TABLE 5-continued Transcripts upregulated in human cells depleted of Staul in three independently performed microarray analyses Transcript Fold change Abbreviation Probe set aldehyde dehydrogenase 1 family member A3 2.32 ALDH1A3 203180 a proteasome (prosome macropain) subunit beta type 9 (large 2.29 PSMB9 204279 a multifunctional protease 2) PHD finger protein 11 2.27 PHF11 221816 s at B-cell scaffold protein with ankyrin repeats 1 2.27 BANK1 219667 s at KIAA.0143 protein 2.26 KIAAO143 212150 a guanylate binding protein 1 interferon-inducible 67kDa 2.26 GBP1 202270 a epiplakin 1 2.25 EPPK1 232164 sat actinin alpha 1 2.24 ACTN1 211160 x at ring finger protein 20 2.22 RNF2O 222683 a eucine rich repeat (in FLII) interacting protein 1 2.22 LRRFIP1 223492 s at Homo sapiens cDNA FLJ39819 fisclone SPLEN2010534. 2.21 1556111s at hypothetical protein LOC150759 2.21 LOC150759 213703 a dihydropyrimidinase-like 3 2.20 DPYSL3 201431 s at type I transmembrane receptor (seizure-related protein) 2.20 PSK-1 233337 s at Zinc finger protein 90 homolog (mouse) 2.20 ZFP90 235698 a tumor protein p53 (Li-Fraumeni syndrome) 2.20 TP53 211300 s at Homo sapiens cDNA FLJ11465 fisclone HEMBA1001636. 2.19 228632 a dna-like protein 2.17 LOC148418 2294.02 a transforming growth factor beta 1 induced transcript 1 2.15 TGFB11 209651 a ets variant gene 1 2.15 ETV1 221911 a Rho GTPase activating protein 19 2.14 ARHGAP19 212738 a Homo sapiens hypothetical LOC284120 (LOC284120) 2.13 241394 a mRNA Suppressor of cytokine signaling 2 2.13 SOCS2 203373 a cyclin-dependent kinase 5 regulatory subunit 1 (p35) 2.11 CDK5R1 204995 a ikely ortholog of mouse Sds3 2.11 SDS3 233841 s at Homo sapiens transcribed sequences 2.09 244091 a spinal cord-derived growth factor-B 2.09 SCDGF-B 219304 sat Homo sapiens cDNA FLJ37290 fisclone BRAMY2014.469. 2.09 231026 a histone deacetylase 8 2.07 HDAC8 223908 a 2.06 1567079 at Homo sapiens transcribed sequence with weak similarity to 2.06 2353.02 a protein pir: I38588 (H. sapiens) I38588 reverse transcriptase homolog-human retrotransposon L1 Homo sapiens full length insert cDNA clone YP61C10 2.06 1561631 at high-mobility group box 3 2.05 HMGB3 225601 a KIAA0931 protein 2.05 KIAAO931 213407 a Homo sapiens cDNA FLJ33441 fisclone BRACE2021932. 2.04 1556081 at hypothetical protein DKFZp761K1423 2.04 DKFZp761K 218613 a 1423 protein tyrosine phosphatase receptor type F 2.04 PTPRF 200635 s at hioredoxin reductase 3 2.03 TXNRD3 59631 at CGI-72 protein 2.03 CGI-72 231967 a hypothetical protein MGC15634 2.03 MGC15634 242923 a enoyl-Coenzyme A hydratase 3-hydroxyacyl Coenzyme A 2.03 EHEHADH 205222 a. dehydrogenase hairy and enhancer of split 1 (Drosophila) 2.02 HES1 203394 sat chromosome 11 open reading frame 9 2.00 C11orf 204073 s at TIA1 cytotoxic granule-associated RNA binding protein 2.00 TIA1 1554890 a. at 0196. The validity of the microarray results was tested for 12 of the upregulated transcripts and 6 of the downregulated transcripts using RT-PCR and a primer pair that is specific for each transcript (Table 6). TABLE 6 Primer pairs used to amplify transcripts found in microarray analyses to be upregulated or downregulated in human cells

Gene Primer (Sense) Primer (AntiSense) c - JUN 5'- CTT GAA AGC TCA GAA SEO ID NO: 4 5'-TCA GCC CCC GAC GGT SEO ID NO : 5 CTC GG-3' CTC. TC-3

SERPINE1 5'-ACC GCC AAT CGC AAG SEO ID NO : 6 5'-GCT GAT CTC ATC CTT SEQ ID NO: 7 GCA CC-3' GTT CC-3'

IL7R 5'-AAG TGG CTA TGC TCA SEO ID NO: 8 5'-TTC AGG CAC TTT ACC SEO ID NO: 9 AAA TG-3 TCC AC-3' US 2013/0317087 A1 Nov. 28, 2013 26

TABLE 6 - continued Primer pairs used to amplify transcripts found in microarray analyses to be upreculated or downreculated in human cells Gene Primer (Sense) Primer (AntiSense)

IF 5'- CCT TCA CCT TCG GTT SEO ID NO : 1 O 5'-ATT TGC AAT GGA AGC SEO ID NO : 11 TCA AC-3 CTT TG-3

GAP43 5'-TGT GCT GTA TGA GAA SEO ID NO: 12 5'-GCT TCA TCC TTC TTA SEO ID NO : 13 GAA CC-3' TTA GC-3'

CKMT1 5' - GAC TGG CCA GAT GCT SEO ID NO: 14 5'-ATC TTT GGG AAG CGG SEO ID NO : 15 CGT GG-3 CTA TC-3'

STMN3 5'- CCA TGG CCA GCA CCA SEO ID NO: 16 5'-ACC TCG GCC GCG TGC SEO ID NO : 17 TTT CC-3 AGC TC-3'

TAGLN 5'-TCC TTC CTG CGA GCC SEO ID NO: 18 5'-GCA CTG CTG CCA TGT SEO ID NO : 19 CTG AG-3 CTT TG-3

OASI 5'-TGC AAT CAT TGA GGA SEO ID NO: 2O 5'- CAC TGT CAA GTG GAT SEO ID NO: 21 TTG TG-3' GTC TC-3'

GDI1 5 - GAC AGA. GAC GTG SEO ID NO: 22 5'- CCA TAA ATG TTG CTT SEO ID NO: 23 AAG CAC TG-3 TAT CC-3'

CXCL1 5'- CCT GGT AGC CGC TGG SEO ID NO: 24 5 - CTT CTG GTC AGT TGG SEO ID NO: 25 CCG GC-3 ATT TG-3'

DCP2 5'-GAT TTA TGT TGT TGT SEO ID NO: 26T 5'- CCA AGC AGC CAA TT SEO ID NO: 27 AGT TG-3 TAT TG-3'

TMSL.8 5'-ACA GCC TTT CAC GAG SEO ID NO: 28 5'- CTG CTG TTG GGA. GGC SEO ID NO : 29 TCT TO-3 GAT CC-3

PSMB9 5'-GCG GGA GAA GTC CAC SEQ ID NO: 3 O 5'-AGG CTG TCG AGT CAG SEQ ID NO : 31 ACC GG-3 CAT TC-3'

GDAP1 5'-AGT TAA CTG TGG ACT SEO ID NO: 32 5'-ACT TTC TCC AAC TCA SEO ID NO : 33 TCA AG-3

Results demonstrated that 11 of the 12 were increased in TABLE 7-continued abundance by 1.5-fold to 8.5-fold (FIG. 1) upon Staul deple tion. Therefore, the microarray results can generally be TranscriptSupregulated in human cells depleted of either viewed as a reliable assessment of changes in transcript abun Stau1 (three independently performed microarray dance upon Staul depletion. analyses in this study) or Upfil (Mendell et al., 2004 Relative increase Example 4 microarray value Stau1 Upf1 Staul or Upf1 Depletion Increases the Abundance of Transcript Product function depletion depletion c-JUN, SERPINE and IL7R 3' mRNAs type 1) member 1 (SERPINE1) and protein C 0.197 Four of the transcripts that were found to be upregu Interleukin 7 receptor (IL7R) Receptor for 3.0 2.1 lated when Staul is depleted were also found in microarray interleukin 7 v-jun sarcoma virus 17 Proto oncogene 2.6 5.3 analyses to be upregulated when Upf1 is depleted (Table 7). oncogene homolog (avian) (c-JUN) TABLE 7 Protein tyrosine phosphatase Cell adhesion 2.0 2.8 receptor type F (PTPRF) receptor Transcripts upregulated in human cells depleted of either Stau1 (three independently performed microarray analyses in this study) or Upfil (Mendell et al., 2004 Interestingly, the upregulation of three of these transcripts Relative increase could not be explained by the EJC-dependent rule that applies microarray value to NMD. The three transcripts encode serine (or cysteine) Stau1 Upf1 proteinase inhibitor Glade E (nexin plasminogen activator Transcript Product function depletion depletion inhibitor type 1) member 1 (Serpine1), interleukin 7 receptor (IL7R), and V-jun sarcoma virus 17 oncogene homolog Serine (or cysteine) proteinase Bait for tissue 3.2 3.8 (avian) (c-jun). inhibitor clade E (nexin plasminogen plasminogen activator inhibitor activator, urokinase, 0198 To assess the possibility that each transcript is an SMD target, HeLa cells were transiently transfected with one US 2013/0317087 A1 Nov. 28, 2013 27 of six small interfering (si) RNAs (Kim et al., 2005): Staul or AUUUA) AU-rich element (ARE)(Peng et al., 1996) plus 45 Stau1(A) siRNA, which targeted a different Stau1 mRNA flanking nucleotides; (ii) nucleotides 1-1575 of the SER sequence; Upf1 or Upf1(A) siRNA, which targeted a different PINE1 3' UTR or (iii) nucleotides 1-339 of IL7R mRNA were UPF1 mRNA sequence; Upf2 siRNA, which has no effect on inserted immediately downstream of the Firefly (F) SMD; or a nonspecific Control siRNA. Two days later, pro Luciferase (Luc) translation termination codon within tein and RNA were isolated for analysis using Western blot pcFLuc. For each 3' UTR, nucleotide 1 is defined as the ting and RT-PCR, respectively. nucleotide immediately 3' to the normal termination codon. (0199 Western blotting revealed that Stau1 or Staul (A) The encoded hybrid transcripts were tested for Staul-HA siRNA depleted the cellular level of Staul to 21% or 3% of binding. normal, respectively, Upfl or Upf1(A) siRNA depleted the cellular the level of Upf1 to 1% or 2% of normal, respectively, Example 6 and Upf2 siRNA depleted the cellular level of Upf2 to 1% of linckNAS Transactivate SMD by Duplexing with 3' normal (FIG. 2A, where normal in each case is defined as the UTRS Via Alu Elements level in the presence of Control siRNA after normalization to the level of Vimentin). It was found that c-JUN, SERPINE 0201 The failure using Mfold to identify dsRNA struc and IL7R transcripts were upregulated 2.1-fold to 3.8-fold tures similar to the SBS of ARF1 mRNA within the 3'UTRS of when Staul or Upfl was depleted, but unaffected when Upf2 other SMD targets led to the observation that two well char was depleted (FIG.2B, where each transcript is normalized to acterized SMD targets plasminogen activator inhibitor type the level of SMG7 mRNA). These results indicate that each 1 (SERPINE1) mRNA and hypothetical protein FLJ21870 transcript is targeted for SMD. mRNA contain a single 3'UTR Alu element. Approximate ly13% of the ~1.6% of protein-encoding transcripts in human Example 5 epithelial HeLa cells that are upregulated at least 1.8-fold upon STAU 1 downregulation in three independently per Staul binds the 3' UTR of c-JUN, SERPINE and formed microarray analyses contain a single 3'UTR Alu ele IL7R 3' mRNAS ment (Table 8). This percentage is higher than the ~4% of HeLa-cell protein encoding transcripts that contain one or 0200. To further investigate whether each of the three tran more 3'UTR Alu elements, indicating that 3'UTR Alu ele scripts is an SMD target, (i) nucleotides 481-671 of the c-JUN ments are enriched in SMD targets relative to the bulk of 3' UTR, which include the 151-nucleotide class III (i.e., non cellular mRNAs. TABLE 8 Human genes encoding transcripts that are upregulated at least 1.8-fold upon STAU1 downregulation and contain a single 3'UTR Alu element Gene NCBI Fold Alu motif symbol accession # upregulation in 3'UTR Full name of gene IFI44 NM OO6417 5.88 AluSq interferon-induced protein 44 FBLIM1 NM 017556 4.71 AluSz filamin-binding LIM protein 1 CLDN11 NM OO56O2 4SO Alub claudin 11 PDLIM3 NM O14476 3.97 AluSX PDZ and LIM domain 3 OASL NM 003733 3.86 AluJo 2'-5'-oligoadenylate synthetase-like TAF7L NM O24.885 3.72 FLAM A TAF7-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 50kDa NOX4 NM 016931 3.59 AluSg7 NADPH oxidase 4 AIM1 NM OO1624 3.34 Alub absent in melanoma 1 SERPINE1 NM OOO602 3.16 AluJo Serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 DCP2 NM 152624 2.74 AluSp DCP2 decapping enzyme homolog (S. cerevisiae) EIFSA2 NM O2O390 2.73 AuSx3 eukaryotic translation initiation factor 5A2 CEP135 NM O25009 2.50 AluSX1 centrosomal protein 135kDa LRRFIP1 NM OO4735 2.22 AluSq2 leucine-rich repeat (in FLII) interacting protein 1 ZFP90 NM 133458 2.20 Alub zinc-finger protein 90 homolog (mouse) TP53 NM OOO546 2.20 Alub tumor protein p53 PHLPP2 NM O15020 2.05 AluSX PH domain and leucine-rich repeat protein phosphatase 2 EHHADH NM OO1966 2.03 AluJr enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase CCDC125 NM 176816 1.99 AuY coiled-coil domain-containing 125 CDCP1 NM 022842 1.98 Alub CUB domain-containing protein 1 NUAK2 NM 030952 1.96 AluSp NUAK family, SNF1-like kinase, 2 v-akt murine thymoma viral oncogene AKT2 NM OO1626 1.84 AluJr homolog 2 APPL1 NM 012096 1.83 AuY adaptor protein, phosphotyrosine interaction, PH domain and leucine Zipper-containing 1 US 2013/0317087 A1 Nov. 28, 2013 28

TABLE 8-continued Human genes encoding transcripts that are upregulated at least 1.8-fold upon STAU1 downregulation and contain a single 3'UTR Alu element Gene NCBI Fold Alu motif symbol accession # upregulation* in 3'UTR Full name of gene COL16A1 NM OO1856 1.81 FLAM A collagen, type XVI, alpha 1 RIPK1 NM OO3804 1.81 AluJo receptor (TNFRSF)-interacting serine threonine kinase 1 Minimum fold upregulation in each of three independently performed microarray analyses

0202 Alu elements are the most prominent repeats in the TABLE 9-continued human genome: they constitute more than 10% of DNA sequences, are present at up to 1.4 million copies per cell, and Features of IncRNAs that contain a single Alu elemen share a 300-nucleotide consensus sequence of appreciable ASO1362 FLAM C O -21.9 O -23.9 similarity among Subfamilies. To date, Alu elements have ASO1379 FLAMC O o -40.1 o been documented to be cis-effectors of protein encoding gene ASO1392 Alub O O -107.9 O expression by influencing transcription initiation or elonga- AS t A. t 2: g l tion, alternative splicing, A-to-I editing or translation 1n1t1a- ASO1433 FLAMC O O -26.4 O tion. Since incRNAs that perfectly basepair with mRNA can RNA-Ala function in trans to generate endogenous siRNAS, imperfect ASO1445 GCY O -23 O -27.9 base-pairing between the Alu element of a ncRNA and the ASO1446 (NRA O -85.2 O -80.6 -AI8 Alu element of an mRNA 3'UTR can create an SBS SO aS to ASO1450 GCY O O -32.9 O regulate mRNA decay. The focus of the experiments dis- ASO1456 FLAMC O O -34.8 O closed herein were on mRNAs that contain a single 3'UTR ASO1470 AuSX -18.8 O O -21.4 Alu-element to avoid the possibility- - - - - of intramolecular base- A. 42. ?", C 5 g 3. 1974 pairing between inverted Alu elements, which can result in ASO1483 AluSx o -68 -316 -66.4 A-to-I editing and nuclear retention. ASO1487 Alub -37.1 -83.3 O -83.2 ------ASO1488 FLAMC O -25.5 -42.7 O 0203 Analysis of Antisense incRNA Pipeline identified ASO1496 FLAMC O O -66.8 O 378 linckNAs that contain a single Alu element (Table 9). ASO1497 Alub O -19.1 -69.8 -17.9 ASO1498 AluSX O -18.4 -103.8 -24.4 ASO1500 FLAMC O -21.8 -66.3 -18.1 TABLE 9 ASO1503 FLAMC O -24.1 O O RNA-Thr ASO151 ACA O O O O Features of IncRNAs that contain a single Alu elemen ASO1514 Alub -49.6 -99.2 O -94.3 RNA-Ala ASO152 GCY O O O -19.5 AG (kcal/mol) of predicted duplexes ASO1523 AluSx O -88.5 O -43.8 formed between the Alu element of each specified incRNA and the 3'UTR Alu ASO1535 Alb -48.5 -66.8 O -66.3 element of four proven SMD targets *** ASO1544 Alub -48.1 -99.7 O -96.4 incRNA - - - ASO1546 Alub -48.3 -65.4 -24.9 -13.2 IncRNA Alu SERPINE1 FLJ21870 CDCP1 MTAP ASO1566 FLAMC O -17 -47.4 -15.2 accession # * motif mRNA mRNA mRNA mRNA ASO1569 AluSX O -22.8 -71.5 -27.2 ASO1026 FLAMC -48.5 -100.5 O -100.5 ASO1601 AluSX O -71 -21.1 -74.4 ASO1113 AuSX O O -44.2 -21.8 ASO1632 Alub -99.5 -222.1 -24.7 -84.2 ASO1151 FLAM C O -60.9 O -38.7 ASO1636 Alub -84.8 -85.5 -9.7 -103.2 ASO1162 AluSX -37.8 -43.7 -12.8 -31.8 ASO1668 ALY O O -112.8 O ASO117O FRAM O -19.2 -91.3 O ASO1674 AluSx -35.7 -53.6 O -116.7 ASO1178 FLAM C O -60.7 O -70.6 ASO 1700 AY -46 -122.6 -35.1 -125.6 ASO1183 SVA A O -83.2 -25.1 -24.7 AS 2. RAM g g 6 ags ASO1195 FLAMC O -81.4 -21.1 -65.1 A. 719 N. O 172 14s6 -25.4 ASO1208 SWAF -28.8 O O -45.6 SX i. -ty. 2. ASO1213 SVAF -28.8 O O -45.6 ASO172 Alub -119.7 -99.2 -22.9 -77 ASO1220 AY -22.7 -90.5 - 18.5 -83.9 ASO1726 AuSX O O -118.6 O ASO1259 Alb O -25.7 -716 O AS 2 As g g St. -52 ASO1267 Alb -28.7 -21.2 -107.9 O A Alu -. ASO1282 Alub O O -90.6 -19.9 ASO1736 AluSX -70.3 -258.5 -314 -230.1 ASO1285 AluSX O -61.4 O -38.9 ASO1737 AY -68.2 -339 -226 -235.5

ASO1296AsO29 AlubFAM C -12.5Q -48.39 -55-9.7 s -26.8234 A CE E. VJ.E. a.a.C. E.VJJ. -.E. ASO1320 FLAMC -43 -28.4 O -28.4 ASO1757 FLAMC -110.8 -163.4 -18.1 -88.9

ASO1323ASO132 AuSXAlub -246O -86.8-54 O -17.4-42.1 l -ly.. . i. .J. - cy. . ASO1326 Alub O -29.5 -114.2 0 ASO1768 Alb O O -128.2 O ASO1770 AY O -26.7 -175.9 -32.5 ASO1781 AluSx -61.9 -255.5 -36.7 -166 US 2013/0317087 A1 Nov. 28, 2013 29

TABLE 9-continued TABLE 9-continued

Features o IncRNAS that contain a single Alu elemen Features of IncRNAs that contain a single Alu elemen

ASO1787 Alb -57.9 -236 -49.9 -104.8 ASO2147 AGA -23.7 O -19.3 -19.8 ASO1794 FRAM O -52.8 -16.3 -71.9 ASO2153 ub O -21.7 -121.2 -25.9 ASO1803 AluSX -16.5 O -214.9 O ASO2160 Y -62.1 -208.4 -18.8 -218.5 ASO1808 Alub -279 -133.9 -39.9 ASO21.68 ub O -25.1 -144 -30.9 ASO1810 Alub -28.4 -1.89.3 -32.6 ASO2179 ub O -26.5 -202.3 O ASO1812 AuSX -226.2 O -348.3 ASO2181 Y -66.2 -210.7 -26.4 -286.2 ASO1818 AY -407.9 -23.6 -229.1 ASO2185 uSX -70.8 -233.4 O -360.9 ASO1821 AuSX -108.9 -19.5 -126.2 ASO2186 uSX -69.1 -116 -15.4 -103.5 ASO1823 Alub -146.4 -26.6 -280.7 ASO2188 Y -23.6 -196.1 -29.5 ASO1825 AuSX -118.7 -23.7 -120.8 ASO2192 uSX O -118.6 O ASO1827 AuSX -262.6 O -260 ASO2209 uSX -96.3 -147.9 -39.9 -150.6 ASO1829 FLAMC -137.3 -22.3 -92.1 ASO2218 RAM -60.9 -79.6 -20.1 -114.9 ASO1841 Alub -22.9 -99.6 -20.8 ASO2236 -20 -96.5 -33.9 ASO1862 AluSX O -176.7 -33 ASO2239 LA M C O -114.3 -40.9 ASO1871 FLAMC -159.7 -12.2 -79.7 ASO2241 -33.3 -193.9 -15.6 ASO1876 AluSX -203.4 -11.3 -197.5 ASO2242 -279 -54.5 O -90.9 ASO1880 Alub -110.3 -16.6 -95.4 ASO2262 -116.5 -279.2 O -105.5 ASO1885 Alb -16.3 -358.2 O ASO2282 -12.7 -165.3 -29.5 ASO1895 Alb -157 -27 -113.5 ASO2287 O -189.6 -12.6 ASO1897 ASX -101.1 -18.5 -121.4 ASO2299 O -78.4 O ASO1901 AluSX -204.9 -20.9 -341.3 ASO2301 -42.8 -25.6 -20.4 -41 ASO1906 AluSX O -193.9 -30.6 ASO2319 -50.9 -60.1 O -17.9 ASO1912 AuSX -445.6 -21.1 -255.7 ASO2320 -21.2 -79.8 -19.9 ASO1928 Alub -208 -83 -105.5 ASO2321 -41.3 -53.5 O -16.2 ASO1934 Alub O -135.9 O ASO2347 -42.2 -79.9 O -53.7 ASO1957 ASX -232.4 O -300 ASO2356 -40.7 O ASO1959 ALSx -35.5 -1814 -34 ASO2360 -77.7 O -29.3 ASO1966 AuSX O -214.9 O ASO1980 AuSX -27.5 -192.2 -30.6 ASO2362 -279 -21.2 -98.8 -24.4 ASO2368 -49.6 -57.5 -30.2 ASO1993 AluSX -136.8 -38.8 -77.6 ASO2370 -24.2 -12.3 -23.4 -31.8 ASO1994 Alub -2O7.7 -19.7 -105.5 ASO2373 -14.4 O ASO1995 ASX -118.6 O ASO2378 -28 O

ASO2385 -46.7 O ASO2002 A ASO2395 -60.5 -33.1 -23.2 ASO2003 AluSX -118.6 O ASO2414 -68.3 -53 ASO2015 AuSX -118.6 O ASO2418 -25.4 -85.4 -40.4 ASO2016 AuSX O -125.8 ASO2443 -25.9 -41.8 -12.2 -36.7 ASO2020 AuSX -118.6 O ASO2469 -61.3 -106.3 -39.2 -102.4 ASO2026 Alub -23.1 -99.1 ASO2474 -28.3 ASO2028 AuSX -34.2 -128.7 ASO2479 -48.6 -111.1 -20.1 -94.5 ASO2029 Alub -23.1 -99.1 ASO2488 -39.3 ASO2O31 AuSX -157.2 - 13.1 RN -Al8 ASO2O37 ASX -22.4 -103.5 ASO2490 -21.7 ASO2O42 FLAMC -68.8 O ASO2495 -534 -63.3 -22.2 -55.4 ASO2046 AuSX -118.6 O ASO2510 -39 -72.6 -7.2 -48.6 ASO2O59 FRAM -31.5 -65.2 ASO2515 -49.6 -57.5 -30.2 ASO2066 Alub -21.7 -121.2 -25.9 ASO2518 -57 -120.5 -11.7 -99.6 ASO2O70 ASX -114.2 -447.6 -19.7 -190.2 ASO2S2O -56.6 ASO2O87 FLAMC -116.1 -163.8 -36.5 -87 ASO2532 -41.8 -24.8 ASO2100 FLAMC -153.3 O ASO2565 -29.2 -21.2 -98.1 ASO2101 AluSX -1791 -29.8 ASO2570 l b -21.4 -63.4 -19.8 -68.6 ASO2120 Alub -240.5 -21.7 ASO2576 FLAMC -28.1 ASO2124 FLAMC -89.4 -102.7 -37.4 -30.7 tRNA-Ala ASO2126 Alub -13.2 -36.1 -136 -39.8 ASO2580 GCY -25.5 -40.1 ASO2127 AuSX -210.2 -26.2 ASO2593 FRAM -22.9 -52.3 -38.1 ASO2128 FLAMC -115.2 -155.5 O -71.8 ASO26O1 AluSx O -21.2 -47.3 -23 ASO2131 AuSX O O -159.1 -16.3 RNA-Arg US 2013/0317087 A1 Nov. 28, 2013 30

TABLE 9-continued TABLE 9-continued

Features of IncRNAs that contain a single Alu elemen Features of IncRNAs that contain a single Alu elemen

ASO2603 ub -49.5 -90.4 O -105.2 ASO3061 Alub -21.2 -111 O ASO2605 RAM -50.5 -88.5 - 13.2 -69 ASO3O64 FLAMC O -60.3 O ASO2608 ub -34.2 -40.3 -20.3 -50.1 RNA-Ala ASO2610 uSX -29.2 -21.2 -98.1 ASO3O70 O -9.9 O ASO2616 uSX -77.7 O -29.3 ASO3O86 O -30.1 O ASO2617 ub -73.5 O -30.2 ASO3093 -49.7 -70.8 O -59.4 ASO262O ub -56.8 O -64.5 ASO3103 -30.9 -52 -20.1 -46.7 ASO2633 uSX -78.8 -18.5 -64 ASO3111 -43 -89.5 O -69.7 ASO2634 uSX -87.7 - 22.2 -65.3 ASO3112 O -57.2 -24.3 ASO2640 uSX -34.2 -14.9 -36.7 ASO3116 O -46.9 O ASO2643 AMC -66.3 O -64.9 ASO3137 -52.7 -112.4 O -82.2 ASO2659 AMC -69.5 O -50 ASO3154 -48.3 -99.4 O -86.6 ASO2665 ub O -41.9 ASO3167 -32.2 -51.7 O -59.9 ASO2672 uSX O -85.3 -19.9 ASO2673 ub -22.1 -27.7 -26.3 ASO3179 -18.9 -18.7 O ASO2674 LAMC O -45.5 ASO2684 LAMC -614 -15.7 -61.1 ASO3181 O -12.7 O ASO2689 ub -76.7 -25.8 -72.3 ASO31.83 -22.4 -47.8 - 15.8 ASO2704 uSX –31.4 -96.2 O -84.5 ASO3200 -25 -76.1 -18.6 -71.2 ASO2713 ub -48.6 -100.7 - 10.7 -93.4 ASO3209 -13.5 O -77.3 O ASO2719 AMC -49.7 -97.9 O -50.6 ASO3222 O -52.2 -26.8 ASO2725 uSX -58.1 -1144 -22.2 -90.4 ASO3245 -45 -71.8 O -67.1 ASO2741 ub -12.1 -68.5 O -75.8 ASO3260 O -33.6 O ASO2753 LAMC -60.3 -113.9 O -72.3 ASO3267 -46.1 O -24.6 ASO2759 SWA A -22.9 O O -73.7 ASO3268 -23 -34.2 O -43 ASO2768 uSX -13 -70.9 -20.5 RNA-Thr ASO2769 uSX O -81.5 ASO328O -16.7 -16.8 -18.5 O ASO2774 ub -13.9 -73.1 -18.6 -66.6 ASO3281 A ub -21.8 -85.3 O ASO2776 RAM -99.6 O -86.6 ASO3286 FLA M C -20.1 -29.3 -26.3 -50.1 ASO2785 LAMC -17.7 O -54.6 ASO3290 -17.2 -107.2 -11.3 -95.9 ASO2806 uSX -48.6 -106.5 - 13.6 -57.6 ASO3300 -51.3 -114.4 O -99.9 ASO2815 RAM -20.3 -20 -48.5 -21.9 ASO3303 -53.7 -20.6 O -43.6 ASO2834 Y O -39.2 -18.7 ASO3304 -11.2 -76.3 -11.2 -61.2 ASO2846 ub -24.6 O -74 ASO3307 -27.9 -102.1 -24.1 RNA-Ala ASO3310 FLA C -19.9 -69.8 -21 ASO2867 O O -22.9 ASO3329 -50.1 -30.4 -42.3 ASO2883 i.s -25.4 -85.4 -40.4 ASO3334 -83 O -8.7 ASO2894 -21.7 O -33.4 ASO3347 -18.7 -24.8 O ASO2897 Gs -100.5 -25.9 -86.3 ASO3351 A.V X -59.7 -30.3 -23.2 ASO2907 uSX O -20.1 ASO3355 AluSx O -61.6 -17.8 ASO291 -64.3 -11.3 -53.9 ASO3357 AluSx -39 -25.5 -40.3 ASO2913 -30.6 -50.6 ASO3360 BC2OO -35.2 -20.1 -35.8 ASO2930 RsJJ s -74.7 -31.9 -39 ASO3363 tRNA-Ala O O -29.6 ASO293 ub -109.6 -23.7 -104.3 GCY RNA tRNA-Ala ASO2936 GCY O O ASO3365 GCA O O O RNA tRNA-Ala ASO294 GCY O O ASO3369 GCY O O O tRNA-Ala ASO3378 AluSx -22.4 -59.1 O ASO295 GCA O O tRNA-Ala ASO2966 Alub -46.8 -110.7 - 13.2 -95.9 ASO3383 GCY -31.3 O -25.7 ASO298 AluSx -50.9 -103.1 O -96.8 ASO3389 Alub -21.8 -536 -19.2 ASO3OO3 Alub -24 -20.8 -110.2 ASO3390 FLAMC -32.9 -62.4 O -25.1 ASO3O15 AluSx -25.6 -21.2 -37.7 ASO3397 FLAMC O -41.5 O ASO3O25 Alub O -56.1 -18.9 ASO3406 AluY -42.6 -73.1 O -85.2 ASO3037 Alub -18.4 -42.5 -26.6 -52 ASO3413 Alub -40.7 -104.3 -21 -94.6 ASO3428 AluSx O O -321.7 -25.6 ASO3436 Alub -85 -97.7 -34.7 -126.7 US 2013/0317087 A1 Nov. 28, 2013 31

TABLE 9-continued TABLE 9-continued Features of IncRNAs that contain a single Alu elemen Features of IncRNAs that contain a single Alu elemen ASO3695 ASX O O -104.4 O ASO3698 AluSX -12.5 O -124.8 O ASO3442 ub -118.6 -189.7 O -106.4 ASO3710 FLAMC -99.8 -77.7 O -59.6 ASO3455 LAMC -100.3 -46.3 O -49.5 ASO3717 ASX O O -100.3 O ASO3457 uSX -118.5 -382.1 -25.2 -253

ASO3459 ub -75.1 -94.2 -20.3 -74.7 ASO3721 AuSX O O -118.6 O ASO3462 Y O O -205.2 -29.2 ASO3722 AuSX -65.5 -111.8 O -125 ASO3466 ub -138.4 -155 -24.1 -183.9 ASO3735 ASX O O -118.6 O ASO3467 AMC -99.8 -74.3 -71.5 ASO3739 ASX O -19.8 -2O7 -25.6 ASO3470 uSX O O -89 -19.6 ASO3742 AuSX O -29.8 -231.9 -16.3 ASO3476 Y O -31.1 -117.9 -25.7 ASO3745 ASX -86.5 -350.5 -25.8 -260.7 ASO3478 uSX O O -135.9 ASO3746 AuSX O -34.7 -211.3 -20.8 ASO3481 ub O -27.7 -150.2 -18.7 ASO3747 Alb -50.4 -98.4 -11.4 -68.1 ASO3755 FLAMC O O -98.3 -27.2 ASO3491 A ub -101.9 -156.1 -22.2 -142.2 ASO3761 AluSX -61.3 -109.1 O -119.2 ASO3493 A -122 -263.5 -252.5 ASO3780 ASX -66.5 -127.9 -20.1 -134 ASO3498 A -26.9 -1985 -34.7 ASO3803 AluSX -124.7 -3O8.8 -20.4 -202 ASO35O2 A -29.9 -29.8 -96.7 -31.2 ASO3804. FLAMC -120.1 -124.7 O -75.9 ASO3505 A -61.3 -116 -21.1 -142.5 ASO3809 AluSX O O -118.6 O ASO3506 A -49.9 -150.9 -153.9 ASO3813 AuSX -13.9 O -157.2 -13.1 ASO3517 AluSx -17.2 -216.8 -36.6 ASO3817 FRAM -60.8 -97.6 -226 -107.7 ASO3520 A -118.6 ASO382O Alb O O -100.4 -18.4 ASO3521 A -118.6 ASO3821. Alub -82.1 -1.78.7 -16.3 -101.7 ASO3528 A -62.7 -326.8 -18.1 -403.8 ASO3822 AuSX O O -163.3 -18.9 ASO3534 A -30.6 -166.4 -15.5 ASO3837 Alb -122.4 -163.1 -8 -142.8 ASO3535 A -118.2 -88.2 -20.6 -107.8 ASO3838 ASX O O -118.6 O ASO3539 A -93 ASO3847 AY -47.3 -1734 -26.4 -167.5 ASO3545 F s -59.2 -66.7 -39.3 -85.4 ASO3851 ASX -112.6 -3O4.3 -34.7 -172.8 ASO3861 Alub -134.1 -177.1 -16.3 -78.2 ASO3546 -98.4 -352.8 -26.7 -144 ASO3864 AluSX -107.6 -235.8 -30.3 -249.5 ASO3548 s s -101.8 -214.3 -163.2 ASO3556 -125.2 -223.9 -34.2 -128.7 ASO3872 FLAM C O O -124.5 O ASO3557 -100.8 ASO3873 ASX -65.2 -2O7.1 -20.8 -342 s ASO3874 AluSX O O -159.1 -16.3 ASO3563 l S X -80.9 -124.3 -145.5 ASO3875 ASX O O -118.6 O ASO3566 -41.7 -44.4 -82.3 ASO3573 -42.8 -56.2 -55 ASO3876 Ab O O -71.1 O EAM ASO3878 AY O O -112.6 O ASO3583 -29.2 ASO3584 s s -31.3 ASO3881 Alb -99.6 -92.1 -19.2 -120.7 ASO3586 -99.6 -83.9 -59.4 ASO3882 FLAMC O -30.9 -68.7 O AMC ASO3891 AluSX -13.5 -17.2 -127.7 -17.6 ASO3593 uSX -109.1 -245.4 -245.8 ASO3595 uSX -65.5 -111.8 -125 ASO3893 AY -69.7 -202.2 -24.6 -4.04.1 ASO3900 Alb -91.4 -119.5 O -89.1 ASO36O1 uSX -82.9 ASO3902 AluSX O -15.6 -189.1 -27 ASO3604 RAM -87.8 -65 -78.3 ASO3606 uSX -117.8 -362.6 -248.3 ASO3906 AluSX O O -159.1 -16.3 ASO3908 Alb -69.8 -157.8 -28.7 -88.9 ASO3609 Y -31.9 -19.3 ASO3629 uSX ASO3911 AuSX O -28.8 -3O2.9 -21.1 ASO3913 AuSX -98.4 -352.8 -26.7 -144 ASO3630 uSX -420.4 -210.7 ASO3946 Alub -75.1 -94.2 -20.3 -74.7 ASO3633 AMC -96.3 -112.2 ASO3635 uSX -220.9 -163.2 ASO3947 Alb -150.2 -214.4 -22.2 -106.5 ASO3948 AY O O -115.4 O ASO3645 uSX -39.8 ASO3950 FRAM -67.6 -103.4 -13.6 -64.1 ASO3661 uSX -89.9 -72.5 ASO3952 ASX O -26.9 -105.7 -25 ASO3960 AluSX -86.5 -350.5 -25.8 -260.7 ASO3668 uSX -45.7 -110.5 -42.2 ASO3673 Y O -71.1 ASO3961 AluSX -111.4 -360.3 -39.9 -262.4 ASO3973 Alb -32 O -298.5 O ASO3674 O -22.8 -60.8 LAMC ASO3974 AluSX -99 -366.7 -36.2 -262.2 ASO368O LAMC -118.4 -178.6 -23.2 ASO3682 ub -62.4 -85.8 ASO3690 uSX -74.1 -220.9 -43.4 * From Antisense lincRNA Pipeline ** Motifsearch using REPEATMASKER for Alu sequences within the specific IncRNA *** Free energy (DG) calculation considered duplexes that contain a 10 continuous base pairs; otherwise, free energy was designated to be 0. Grey highlights denote studiedlincRNAs; ASO1998, /2-sbsRNA4; ASO3488,/2-sbsRNA3; ASO3667, /2-sbsRNA2; ASO3720, /2-sbsRNA1 Among them, the Alu element of lncRNA AF087999 (NCBI) has the potential to base-pair with the Alu element within SERPINE1 and FLJ21870 3'UTRs (FIG.3a; FIG.4a) with AG values of, respectively, -151.7 kcal/mol and -182.1 kcal/mol (Table 9; where -151.7 kcal/mol defined the most stable duplex predicted to form between SERPINE1 mRNA and any of the 378 linckNAs). IncRNA AF087999, which for reasons that follow is designated /2-sbsRNAL derives from chromosome 11. RT-semiquantitative (sq)PCR demonstrated US 2013/0317087 A1 Nov. 28, 2013 32 that /2-sbsRNA1 is detected in cytoplasmic but not nuclear FLUC-MS2bs mRNA (FIG. 3d) and (ii) FLAG-MS2 HeLa-cell fractions and is polyadenylated. Downregulating hMGFP, which consists of FLAG-tagged MS2 coat protein the cellular abundance of the two major isoforms of STAU1 to fused to hMGFP, were immunoprecipitated using anti FLAG. As expected, prior to IP /2-sbsRNA1(S) as well as <10% of normal (see, e.g., below) did not affect either the !/2-sbsRNA1(S)-MS2bs decreased the abundance of SER cellular distribution or the abundance of /2-sbsRNAL /2- PINE1 and FLJ21870 mRNAs but not SMD targets that sbsRNA1 is present in every human tissue that was examined encode interleukin 7 receptor (IL7R). CUG domain-contain /2-sbsRNA1 is not a substrate for Dicer or AGO2 and thus is ing protein 1 (CDCP1) or methylthioadenosine phosphory distinct from the lincRNAs that generate endogenous siRNAs. lase (MTAP) (FIG. 3e; see below). In support of the finding 0204 Two forms of /2-sbsRNA1 have been reported that /2-sbsRNA1 creates an SBS with partially complemen (NCBI). They differ at their 5' end but share a common Alu tary mRNA sequences, using lysates of cells expressing /2- element and a common 3' end that contains a putative poly sbsRNA1(S)-MS2bs, the anti-FLAG IP of FLAG-MS2 adenylation signal (AUUAAA) situated 13 nucleotides hMGFP bound tO !/2-sbsRNA1(S)-MS2bs upstream of a poly(A) tract. RNase protection assays con co-immunoprecipitated endogenous STAU1, SERPINE1 firmed the presence of one short (S) and one long (L) form of mRNA and F1121870 mRNA as well as the UPF 1 SMD /2-sbsRNA1 that have a different 5' end and a relative abun factor (FIG. 3e). In contrast, irrelevant proteins, such as Cal dance in HeLa cells of 3:1 (FIG. 5a). Primer extension (FIG. nexin, the dsRNA binding protein ILF3, the single-stranded 5b) and RT-sqPCR (FIG. 5c) mapped the 5' end of /2-sb RNA binding protein FMR1, and mRNAs that are not pre sRNA1(S) to a C residue. Therefore, /2-sbsRNA1 (S) consists dicted to base-pair with /2-sbsRNAL such as those encoding of 688 nucleotides excluding the poly(A) tract (FIG. 5d). SMG7, IL7R, CDCP1 or MTAP were not coimmunoprecipi While some transcripts that are annotated as ncRNAs may be tated (FIG. 3e). STAU1 siRNA reduced the co-IP of the translated, data indicate that /2-sbsRNA1(S) is not translated. SERPINE1 mRNA as well as F1121870 mRNA with /2- 0205 Remarkably, not only STAU1 siRNA but also /2- sbsRNA1(S)-MS2bs to, respectively, ~19% or ~15% of nor SbsRNA1 siRNA increased the levels of SERPINE1 and mal (FIG. 3f), indicating that STAU1 stabilizes the duplex FLJ21870 mRNAs to 2-to-4.5-fold above normal (FIG. 3b formed between SERPINE1 or FLJ21870 mRNA and /2- and Table 10). SbsRNA1. TABLE 10 Comparison of RT-SqPCR shown in FIG. 1 and RT-qPCR RT-sqPCR RT-qPCR. siRNA Control STAU1 /2-sbsRNA1 Control STAU1 1/2-sbsRNA1 FIG. 1b /3-sbsRNA1 1OO 103 - 5 614 100 1074 643 SERPINE1 mRNA 1OO 451 - 5 3O8 S 100 443 - 7 336 - 10 FL21870 mRNA 1OO 32S 15 2OO 10 100 3O3 - 22 2012 FIG 1c FLUC-SEPRINE1 135 827 443 117 824 484 3'UTR mRNA FLUC-FL21870 113 937 65 6 165 92 6 683 3'UTR mRNA *sqPCR and qPCR used the same RT reactions **See FIG, 3c legend for details

Furthermore, experiments that employed cycloheximide 0207. As additional evidence that /2-sbsRNA1 creates an indicated that the /2-sbsRNA1-mediated reduction in SER SBS by base-pairing with the SERPINE1 or FLJ21870 PINE1 and FLJ21870 mRNA abundance depends on transla 3'UTR, only STAU1-HA3 but not ILF3 or FMR1 coimmu tion, as does SMD. The reduction in SERPINE1 and noprecipitated with /2-sbsRNA1. FLJ21870 mRNA abundance is attributable to their respec (0208. To determine if /2-sbsRNA1 is required for the co tive 3'UTR sequences since /2-sbsRNA1 siRNA also IP of STAU1 with SERPINE1 or FLJ21870 mRNA, HeLa increased the levels of FLUC-SERPINE1 3'UTR and FLUC cells that transiently expressed STAU1-HA3 and Control FLJ218703'UTR reporter mRNAs relative to FLUC-No SBS siRNA or /2-sbsRNA1 siRNA in the presence or absence of mRNA (FIG. 3c and Table 10). The /2-sbsRNA1 siRNA /2-sbsRNA1(S)R were immunoprecipitated using anti-HA. mediated increase in the abundance of SERPINE1 or Compared to Control siRNA, /2-sbsRNA1 siRNA, which FLJ21870 mRNA was reversed by co-expressing /2-sb reduced the level of/2-sbsRNA1 to ~50% of normal, reduced sRNA1(S)R, which is resistant to siRNA, arguing against by -2-fold the co-IP of STAU1-HA3 with SERPINE1 or siRNA-mediated off-target effects. Significantly, /2-sb FLJ21870 mRNA (FIG. 6a). In contrast, restoring the level of sRNA1 siRNA did not affect the expression of other FLUC /2-sbsRNA1 to ~100% of normal by expressing /2-sbsRNA1 reporter mRNAs that contain the 3'UTR of SMD targets not siRNA together with /2-sbsRNA1(S)R restored the co-IP of predicted to base-pair with /2-sbsRNA1. STAU1-HA3 with SERPINE1 or FLJ21870 mRNA to near 0206. If /2-sbsRNA1 were to create an SBS by base-pair normal (FIG. 6a). As expected, the level of IL7R mRNA, ing with the 3'UTR of SERPINE1 or FLJ21870 mRNA, then which binds STAU1 but does not contain sequences comple it should be possible to co-immunoprecipitate complexes of mentary to /2-sbsRNA1, was unaffected by any condition the linckNA and each mRNA. To test this possibility, lysates either before or after IP (FIG. 6a). of HeLa cells that transiently expressed (i)/2-sbsRNA1 (S)- 0209 Thus, the SMD of SERPINE1 or FLJ21870 mRNA MS2bs, which contains 12 copies of the MS2 coat protein involves basepairing between their 3'UTR Alu element and binding site (MS2bs) upstream of the linckNA polyadenyla the Alu element within /2-sbsRNA1 Basepairing creates an tion signal or, as a negative control, /2-sbsRNA1 (S) or SBS that is stabilized by STAU1. Furthermore, the level of US 2013/0317087 A1 Nov. 28, 2013

STAU1 and, thus, the efficiency of SMD does not alter the mally 1.8-fold upon STAU 1 downregulation (Table 8). How level of /2-sbsRNA1. The finding that down-regulating SER ever, since MTAP mRNA was upregulated only ~1.5-fold, it PINE1 or FLJ21870 mRNA to 50% and 25% of normal, is not included in Table 8. respectively, failed to detectably decrease the co-IP of 0213. It is important to note that AG values are not in STAU1-HA3 with /2-sbsRNA1 (FIG. 7) indicates that I/2- themselves absolute predictors of SBS function. For example, SbsRNA1 can bind to more than SERPINE1 and FLJ21870 while /2-sbsRNA2 is predicted to base-pair with the 3'UTR mRNAs to recruit STAU1 if not trigger SMD. Alu element of BAGS mRNA with a AG of -416 kcal/mol, 0210. The presence of UPF1 in the anti-FLAG IP of BAGS mRNA is not targeted for SMD in HeLa cells. The FLAG-MS2-hMGFP (FIG.3e) is consistent with the idea that 3'UTR Alu element of BAGS mRNA may be physically inac STAU1 that is bound to a /2-sbsRNA1-created SBS associ cessible to base-pairing with /2-sbsRNA2. Nevertheless, ates with UPF1, analogously to how STAU1 that is bound to base-pairing per se may not be sufficient for SBS function the ARF1 SBS associates with UPF1. Furthermore, down since converting the 100-nt apex of the intramolecular ARF1 regulating UPF1, like downregulating STAU1, increases the SBS to a 4-nt loop that is not predicted to disrupt the adjacent abundance of SERPINE1 mRNA, FLJ21870 mRNA and 19-bp stem of the ARF1 SBS reduces STAU1 binding in vivo FLUCSERPINE1 3'UTR mRNA by increasing mRNA half by 50%. life. To test for UPF1 function in conjunction with /2-sb 0214. Herein is disclosed a previously unforeseen role for sRNA1 the effects of various siRNAs on the production of some of the lincKNAS that contain Alu elements: the creation FLUC-SERPINE1 3'UTR mRNA in which the 3'UTR was of SBSs by intermolecular base-pairing with an Alu element intact, precisely lacked the region that was partially comple within the 3'UTR of one or more mRNAs. Thus, SBSs can mentary to /2-sbsRNA1 or contained solely this region (FIG. form either through intramolecular base-pairing, as exempli 6b) were analyzed. Relative to Control siRNA, STAU1 fied by the ARF 1 SBS, or intermolecular basepairing siRNA, UPF1 siRNA or 1/2-sbsRNA1 siRNA did not affect between a /2-SBS within an mRNA 3'UTR and a comple the level of FLUC-SERPINE1 3'UTR mRNA that lacked the mentary /2-sbsRNA in the form of a largely cytoplasmic /2-sbsRNA1 binding site (FIG. 6c), but each siRNA lncRNA (FIG.9c). increased the levels of FLUC-SERPINE1 3'UTR mRNA and 0215. There are estimated to be tens of thousands of FLUC mRNA that contained only the /2-sbsRNA1-BS (FIG. human linckNAs that have little or no ability to direct protein 6c). Thus, as indicated by its name, /2-sbsRNA1 base-pairs synthesis and that are distinct from rRNAs, tRNAs, snRNAs, with the 3'UTR of SERPINE1 mRNA and, by analogy, snoRNAs, small interfering RNAS or microRNAs. Thus, the FLJ21870 mRNA so as to recruit STAU1 and its binding paradigm that partially complementary ncRNA-mRNA partner UPF1 in a way that triggers a reduction in mRNA duplexes can form SBSs can extend to the creation of binding abundance. Consistent with previous studies of SMD, the sites for other dsRNA binding proteins. Since only 23% of STAU1- and /2-sbsRNA1-mediated reduction in mRNA lincKNAs were found to contain one or more Alu elements, abundance is due to a decrease in mRNA half-life. With IncRNA-mRNA duplexes that do not involve Alu elements regard to function, scrape injury repair assays revealed that expand the number ofncRNAS that regulate gene expression /2-sbsRNA1 contributes toward reducing cell migration by via SMD or a different dsRNA binding protein-dependent targeting SERPINE1 and RAB11 FIP1 mRNAs for SMD pathway. (FIG. 8). 0211 Characterizing seven other linckNAs that contain a Example 7 single Alu element and consist of <1000 nucleotides (Table 9) confirmed that they, too, are largely cytoplasmic and poly Computational Analyses adenylated and have the potential to base-pair with the single 0216. The Perl program “Alu Mask' was designed to Alu element within at least one mRNA3'UTR (FIG.9a: FIG. define Alu elements within known and putative SMD targets 4b,c,d Table 9). Individually downregulating three of these and noRNAs based on results obtained using REPEAT IncRNAs linckNA BCO58830 (/2-sbsRNA2), lincRNA MASKER AF075069 (1/2-sbsRNA3) or linckNA BC009800 (/2-sb 0217. The Perl program “RNA RNA anneal” was devel sRNA4) upregulated those tested mRNAs that (i) contain a oped to predict Alu-element base-pairing between linckNA partially complementary Alu element and (ii) are upregulated AF087999 (1/2-sbsRNA1) and the SERPINE1 or FLJ21870 upon STAU1 or UPF1 downregulation; each linckNA failed mRNA 3'UTR, lincRNA BCO58830 (/2-sbsRNA2) and the to upregulate mRNAS that lack a partially complementary CDCP1 mRNA 3'UTR, as well as lincRNA AF075069 (/2- Alu element (FIG. 9b). While /2-sbsRNA2 targeted the sbsRNA3) or linckNA BC009800 (/2-sbsRNA4) and the 3'UTR Alu element of CDCP1 mRNA (FIG.9b and Table 9, MTAP or FLJ21870 mRNA 3'UTR. Potential duplexes were where AG=-153.7 kcal/mol), /2-sbsRNA3 and 1/2- first fixed using what was predicted to be the most stably and sbsRNA4 targeted the 3'UTR Alu element of MTAP mRNA perfectly base-paired region and then expanded in both direc (FIG.9b and Table 9, where AG=-203.1 and -264.2 kcal/ tions, allowing for bulges or loops of up to 10 nucleotides mol, respectively). Furthermore, none of the three linckNAs until base-pairing was no longer predicted. Briefly, “RNA downregulated SERPINE1 mRNA (FIG. 9b and Table 9, RNA anneal uses a recursive algorithm that predicts the where AG=0, -66.4 and -108.2 kcal/mol, respectively) but most stable base-pairs and their AG value based on thermo two downregulated FLJ21870 mRNA -2-fold (FIG.9b and dynamic data that were extracted from RNA Structure 4.6. Table 9, where AG=-261.9 and -444.2 kcal/mol). Duplexes between other incRNAs and mRNA 3'UTRs were 0212. These findings illustrate the potentially complex likewise predicted using this approach. All data from "RNA network of regulatory events that are controlled by lincRNA RNA anneal were validated using RNA structure 4.6, which mRNA duplexes that bind STAU1 and is reminiscent of the provides folding free energy changes. web of regulatory mechanisms that are mediated by miRNAs. 0218. Notably, to follow up the finding that -13% of the Notably, both CDCP1 mRNA and MTAP mRNA were ~1.6% of HeLa-cell proteinencoding transcripts that are upregulated at least 2-fold upon STAU 1 downregulation in upregulated at least 1.8-fold upon STAU 11.2 contain a single experiments disclosed herein (FIG.9b), and indeed CDCP1 Alu element, a random resampling of 1.6% of total-cell mRNA is among those mRNAs that were upregulated mini mRNAs (NCBI) 10,000 times revealed that the presence of US 2013/0317087 A1 Nov. 28, 2013 34 one or more Alu elements in the 3'UTRs of potential SMD identify the Avril site. The resulting PCR product was targets (Table 8) was enriched -3.58-fold (p<0.001). digested with Avril and inserted into the Avril site of pl/2- sbsRNA1(S). Example 8 0225. To construct pFLUC-FLJ21870 3'UTR, two frag ments of the FLJ21870 3'UTR were amplified using HeLa Plasmid Constructions cell genomic DNA and the primer pair 5'-GATGTCTA GAGTGATCAACTTCGCCAACAAACACCAG-3' (sense) 0219. To COnStruct pcDNA3.1 (+)/Zeo Chr11 (SEQ ID NO: 65) and 5'-CAGAAGGCTAGCCCGAA 66193000-66191383, HeLa-cell genomic DNA was purified GAGAAC-3' (antisense) (SEQ ID NO: 66), or 5'-CTCT using DNeasy Blood & Tissue Kit (Qiagen) and PCR-ampli TCGGGCTAGCCTTCTGG-3 (sense) (SEQID NO: 67) and fied using the primer pair: 5'-GATGCTCGAGTGGCATTG 5'-GTCAGGGCCCGAGACAGAGTCTCCGTTGCCC-3' GCTTTCACCACCTATG-3' (sense) (SEQ ID NO: 51) and (antisense) (SEQ ID NO: 68), where underlined nucleotides 5'-GTCAGGATCCTGCCTCAAGTCCAAAGCA denote a Xbal, Nhe or Apal site. The resulting PCR frag CAACTG-3 (antisense) (SEQID NO:52), where underlined ments were digested using Nhe and either Xbal or Apal, nucleotides specify a XhoI or BamHI site. The resulting PCR respectively, and inserted simultaneously into pFLUC-SER product was cleaved with XhoI and BamHI and inserted into PINE1 3'UTR5 that had been digested with Xbaland Apal. XhoI- and BamHI-cleaved pcDNA3.1 (+)/Zeo (Invitrogen). 0226. To create pFLUC-SERPINE1 3'UTR A(/2-sb 0220. To generate p/2-sbsRNA1(S) or p/2-sbsRNA1(S)- sRNA1-BS), two regions of the SERPINE1 3'UTR were MS2bs, pcDNA3.1 (+)/Zeo Chr11 66193000-66191383 amplified using pFLUC-SERPINE1 3'UTR and primer pairs was amplified using the primer pair 5'-GAGTCAA AGCT 5'-GAGTCAAAGCTTGGCATTCCGGTACTGTTGG-3' TAAAGGAGAGACAGTCTCACTCTG-3' (sense) (SEQID (sense) (SEQ ID NO: 69) and 5'-CATCCATCTTTGTGC NO:53) and, respectively, 5'-GTCAGCGGCCGCCAGTTG CCTACCC-3 (antisense) (SEQ ID NO: 70) or 5-TCTT TAAGCATATTTGGGTTAC-3 (antisense) (SEQID NO:54) TAAAAATATATATATTTTAAATATAC-3 (sense) (SEQ ID O 5'-GTCAGGATCCCAGTTGTAAG NO: 71) and 5'-TAGAAGGCACAGTCGAGG-3 (antisense) CATATTTGGGTTAC-3' (antisense) (SEQ ID NO: 55), (SEQ ID NO: 72), where underlined nucleotides denote a where underlined nucleotides denote a HindIII, Not or HindIII site. The resulting PCR fragments were phosphory BamHI site. The resulting PCR products were cleaved with lated using T4 polynucleotide kinase, digested with HindIII HindIII and either Not or BamHI, respectively, and inserted or Apal, respectively, and inserted simultaneously into into HindIII- and Noti-cleaved or HindIII— or BamHI pFLUC-SERPINE1 3'UTR that had been digested with Hin cleaved pcDNA3-MS2bs. dIII and ApaI. 0221 Overlap-extension PCR was used to construct p"/2- 0227. To generate pFLUC-SERPINE1 1/2-sbsRNA1-BS, sbsRNA1(S)R. Two rounds of site-directed mutagenesis were the /2-sbsRNA1-BS was amplified using pFLUC-SER performed using p/2-sbsRNA1 (S) and the primer pairs PINE1 3'UTR and the primer pair 5'-GATGTTTAAATAAT 5'-GATATTCATTACTAACCCCTGAAC GCACTTTGGGAGGCCAAGG-3 (sense) (SEQID NO: 73) CCATACAGTTCAGCTTACCACTACAGTACTT CT-3' and 5'-GATGTTTAAAGACGGGGGTCTTGGTAT (sense) (SEQ ID NO. 56) and 5'-GAAGTACTGTAGTGG GTTGC-3' (antisense) (SEQ ID NO: 74), where underlined TAAGCTGAACTGTATGGGTTCAGGGGT nucleotides denote a Dral site. The resulting PCR product TAGTAATGAATA TC-3 (antisense) in the first round, and was then digested with DraI. Meanwhile, pFLUC No SBS 5'-CCTGAACCCATACAGTTCAGCTCAGAAC was digested with HindIII and Apal, and the released the TACAGTACTTCTGTAGT-3' (sense) (SEQID NO: 57) and FLUC No SBS region was subsequently digested with DraI. 5'-ACTACAGAAGTACTGTAGTTCTGAGCT All three fragments from the pFLUCNo SBS digestions were GAACTGTATGGGTTCAGG-3 (antisense) (SEQ ID NO: then ligated to the PCR product. 58) in the second round, where mutagenic nucleotides are 0228 To generate pTRE-FLUC-SERPINE1 3'UTR or underlined. pTRE-FLUC-FLJ21870 3'UTR, FLUC-SERPINE1 3'UTR 0222 To generate pFLUC-MS2bs, pcFLUC was PCR or FLUC-FLJ21870 3'UTR was amplified using, respec amplified using the primers pair 5'-GAGTCAA AGCTTATG tively, pFLUC-SERPINE1 3'UTR and the primer pair GAAGACGCCAAAAACATAAAGAAAGGC-3' (sense) 5'-GATACCGCGGATGGAAGACGCCAAAAA (SEQ ID NO. 59) and 5'-GTCAGGATCCTTACAATTTG CATAAAG-3' (sense) (SEQID NO:75) and 5'-GTCAGAAT GACTTTCCGCCCTTCTTGGC-3' (antisense) (SEQ ID TCGCTTCTATTAGATTACATTCATTTCAC-3 (antisense) NO: 60), where underlined nucleotides specify a HindIII or (SEQID NO: 76), orpFLUCFLJ218703'UTR and the primer BamHI site. The resulting PCR product was digested with pair 5'-GATACCGCGGATGGAAGACGCCAAAAA HindIII and BamHI and inserted into HindIII—and BamHI CATAAAG-3' (sense) (SEQID NO:77) and 5'-GTCAGAAT cleaved pcDNA3-MS2bs. TCGAGACAGAGTCTCCGTTGCCC-3' (antisense) (SEQ 0223) To construct pFLAG-MS2-hMGFP. pMS2-HA was ID NO: 78), where underlined nucleotides denote a SacII or amplified using the primer pair 5'-GATGGCTAGCCGC EcoRI site. The resulting PCR product was digested with CATGGACTACAAAGACGATGACGA SacII and EcoRI and inserted into SacII- and EcoRI-cleaved CAAGGGATCCGCTTCT AACTTTACTCAGTTCG-3' pTRE (Clontech). (sense) (SEQ ID NO: 61) and 5'-GTCAGATATCGTAGAT GCCGGAGTTTGCTGCG-3' (antisense) (SEQID NO: 62), Example 9 where underlined nucleotides specify a Nhe or EcoRV site. The resulting PCR product was digested using Nhe and EcoRV and inserted into Nhel- and EcoRV-cleaved phMGFP Cell Culture, Transient Transfection, and (Promega). Formaldehyde Crosslinking 0224) To create p/2-sbsRNA1(S)-hMGFP, phMGFP was 0229 Human HeLa or HaCaT cells (2x10/60-mm dish or amplified using the primer pair 5'-GATGCCTAGGGGCGT 7.5x10/150-mm dish) were grown in DMEM (Gibco-BRL) GATCAAGCCCGACATG-3' (sense) (SEQID NO: 63) and containing 10% fetal bovine serum (Gibco-BRL). Cells were 5'-GTCACCTAGGGCCGGCCTGGCGGGGTAGTCC-3' transiently transfected with the specified plasmids using (antisense) (SEQ ID NO: 64), where underlined nucleotides Lipofectamine 2000 (Invitrogen) or the specified siRNA US 2013/0317087 A1 Nov. 28, 2013 using Oligofectamine (Invitrogen). SiRNAS consisted of was down-regulated using 5'-r(CCUAUAACUACAA STAU1 siRNA, /2-sbsRNA1 siRNA (5'-CCUGUACCCUU CAUGAG).d(TT)-3' (SEQ ID NO. 84). Protein was purified CAGCUUACdTaT-3) (SEQ ID NO: 79), /2-sbsRNA1(A) from half of the cells using passive lysis buffer (Promega) and siRNA (5'-AUGACUUUGGGCAAAGUACdTdT-3") (SEQ used to determine the extent of down-regulation. RNA was ID NO: 80), Dicer1 siRNA (Ambion), AGO2 siRNA (Am purified from the other half using TRIZol Reagent (Invitro bion), SERPINE1 siRNA (Ambion), FLJ21870 siRNA (Am gen), 72 h after siRNA introduction, and analyzed using bion), RAB11 FIP1 siRNA (Ambion), /2-sbsRNA2 (5'- microarrays. Stau1(A) siRNA consisted of 5'-r(GU GGUGCAAAGACAGCAUUCCdTaT-3) (SEQID NO: 81), UUGAGAUUGCACUUAAA)d(TT)-3' (SEQ ID NO. 85), /2-sbsRNA3 (5'-UAGUAGUCAAGACCAAUUCUAdTdT and Upf1(A) siRNA consisted of 5'-r(AACGUUUGC 3') (SEQ ID NO: 82), /2-sbsRNA4 (5'-UGGCAUUCCAG CGUGGAUGAG)d(TT)-3' (SEQID NO. 86). UUGAGUUUdTdT-3") (SEQID NO: 83), or the nonspecific Example 12 Silencer Negative Control #1 (Ambion). Notably, all linckNA Tethering Experiments siRNAS used in this study target a sequence outside of the Alu 0234. HeLa cells (2x10) were transiently transfected element. For all immunoprecipitations (IPs), cells were using Lipofectamine Plus (Invitrogen) with 0.3 ug of the crosslinked using 1% formaldehyde for 10 min at room tem reporter plasmid pcFLuc or pcFLuc-MS2bs, 0.02 ug of the perature and subsequently quenched with 0.25M glycine for reference plasmid pRLuc, and 5 Jug of one of the following 5 min at room temperature prior to lysis. In experiments that effector plasmids: pMS2-HA, pMS2-HA-Stau1, pcNMS2, blocked protein synthesis, cells were incubated with 300 pcNMS2-Upf1, pcNMS2-Upf2 or pcNMS2-Upf3. Cells ug/ml of cycloheximide (Sigma) 3-hr prior to lysis. were harvested two days later. Protein was purified from half 0230. For mRNA half-life measurements, HeLa Tet-Off of the cells using passive lysis buffer (Promega), and total cells (Clontech) were transfected with the specified siRNA in RNA was purified from the other half using TRIZol Reagent the presence of 2 ug/ml of doxycycline (Clontech). After (Invitrogen). 48-hr, the medium was replaced to remove doxycycline, and cells were transfected with the indicated reporter and refer Example 13 ence plasmids. Four-hr later, an aliquot of cells was harvested RT-PCR at time 0, 2 g/ml of doxycycline was added to the remaining 0235 FLuc-MS2bs mRNA or FLuc(UAA->CAA)- cells to silence reporter-gene transcription, and aliquots of MS2bs mRNA was amplified using the primers 5'-CAACAC cells were harvested as a function of time thereafter. CCCAACATCTTCG-3' (SEQ ID NO. 87) (sense) and 0231 Scrape injury repair assays were essentially as pub 5'-CTTTCCGCCCTTCTTGGCC-3' (SEQID NO. 88) (anti lished. Briefly, two days after transfection using siRNA, sense). G1-MS2bs or Gl(UAA->UAC)-MS2bs was ampli monolayer cultures of HaCaT cells at 90% confluence in fied using the primers 5'-AATACGACTCACTATAGGGA-3' 100-mm dishes were scratched in nine places using a P200 (SEQID NO. 89) (sense), which anneals to the T7 promoter, pipette tip (VWR) and uniform pressure to create denuded and 5'-GATACTTGTGGGCCAGGGCA-3' (SEQ ID NO. areas that were 0.9 mm wide. Cells were washed once with 90) (antisense). FLuc-Arfl mRNA was amplified using the growth medium, which removes scratch-generated debris and same T7 promoter primer (sense) and 5'-TCTAGAGGATA GAATGGCG-3 (SEQ ID NO. 91) (antisense). PAICS generates Smooth wound edges, and cultured for an additional mRNA was amplified using the primers 5'-AGCAGGCTG 16 hr with monitoring. GTACCGGTCCG-3' (SEQ ID NO. 92) (sense) and 5'-AC CAATGTTCAGTACCTCAG-3' (SEQ ID NO. 93) (anti Example 10 sense). Protein Purification, IP and Western Blotting Example 14 Microarray Analyses 0232 HeLa cells were lysed, and protein was isolated using hypotonic buffer that consists of 10 mM Tris-Cl (pH 0236. HeLa-cell RNA was purified using TriZol reagent 7.4), 150 mM NaCl, 2 mM EDTA, 0.5% Triton X-100, 2 mM (Invitrogen) and deemed to be intact using an RNA 6000 benzamidine, 1 mM PMSF and 1 tablet of protease inhibitor Nano LabChip(R) (Agilent) together with a Bioanalyser 2100 cocktail (Roche). If crosslinked, cells were sonicated six and Biosizing software (Agilent). Biotin-labeled cRNAs times for 30 sec to facilitate lysis. IP was performed. In were generated and hybridized to U133 Plus 2.0 Array human experiments that involved formaldehyde crosslinking, gene chips (comprising more than 47,000 transcripts and crosslinks were reversed by heating at 65° C. for 45 min after variants). Hybridized chips were scanned using an Affyme IP. HeLa cells were cultured as described above but in 150 trix GENECHIP(R) 3000 Scanner. Results were recorded mm dishes. Transfections and immunopurifications (IPs) using the GENECHIPR) Operating Software (GCOS) plat were performed as described. Western blotting was per form, which included the GENECHIPR) Scanner 3000 high formed. Antibodies consisted of anti-STAU1, anti-Calnexin resolution Scanning patch that enables feature extraction (Af (Calbiochem), anti-FLAG (Sigma), anti-ILF3 (Santa Cruz), fymetrix). Notably, the Affymetrix Gene Expression Assay anti-FMR1 (Santa Cruz), anti-HA (Roche), anti-Dicer 1 identifies changes that are greater than 2-fold with 98% accu (Santa Cruz), anti-AGO2 (Santa Cruz) and anti-BAGS (Ab racy. Arrays were undertaken using three independently gen cam). erated RNA samples. Transcripts that showed at least a 1.8- fold increase in abundance with a p value of less than 005 in Example 11 each of the three analyses were scored as potential SMD targets. siRNA-Mediated Down-Regulation of Human Stau1 Example 15 0233. HeLa cells (5x10) were grown in DMEM medium RNA Purification, Poly(A)-- RNA Preparation, and (Gibco-BRL) containing 10% fetal bovine serum (Gibco RT Coupled to Either Semiquantitative (sq) or BRL) in 100-mm dishes and transiently transfected with 50 Realtime (q)PCR nM of in vitro-synthesized small interfering (si)RNA (Dhar 0237 RNA was purified from total, nuclear or cytoplas macon) using Oligofectamine Reagent (Invitrogen). Staul mic HeLa-cell fractions or immunoprecipitated from total

US 2013/0317087 A1 Nov. 28, 2013 37

In a few experiments RT primed using oligo(dT) 18 rather hSTAU 1. These amino acids consist of the C-terminus of than random hexamers. RT-sqPCR analyses situated under hSTAU1 and include RBD'5 (FIG. 10A), which is referred wedges in the leftmost lanes of figures utilized 2-fold dilu to as RBD5 considering it has only 18% sequence identity to tions of RNA and show that data fall in the linear range. the prototypical hSTAU1 RBD3 and, more to the point, fails RT-PCR values include the standard deviation obtained in the to bind dsRNA. Using Clustal W, multiple sequence align specified number of independently performed experiments. ments of full-length hSTAU1 with hSTAU2 and STAU homologs in different species, including representatives of Example 16 the five major vertebrate classes (mammals, reptiles, amphib RNase Protection Assay (RPA) and Primer ians, birds, and fish), revealed a conserved sequence residing Extension N-terminal to RBD5 that consists of amino acids 371-390 of 0238. The RPA employed the RPA III RNase Protection hSTAU1 (FIG.10B). This motif is called the Staufen-swap Assay Kit (Ambion). Uniformly labeled RNA probes (107 ping motif (SSM; FIG. 10B) for reasons explained below. cpm/ug) were generated by transcribing linearized pcDNA3. Despite an identifiable RBD'5, SSM is absent from D. mela 1(+)/Zeo Chr11 66193000-66191383 in vitro using nogaster STAU as well as some invertebrates such as Cae C-P32-UTP (Perkin Elmer) and the MAXIscript Kit (Am norabditis elegans (FIG. 11). However, STAU in other inver bion). Each probe (105 cpm) was incubated with poly(A)-- tebrates, including the acorn worm Saccoglossus kowalevskii HeLa-cell RNA (10 ug) or yeast RNA (10 ug) in hybridization and the deer tick Ixodess capularis, contain both RBD5 and buffer (Ambion) at 42° C. overnight and subsequently SSM (FIG. 11). cleaved using RNase A and RNase T1 (Ambion; 1:200) at 37° 0244 SSM is interesting given its proximity to the TBD. C. for 30 min. Input probe (1/1000) and cleaved products which spans amino acids 282-372 (FIG. 10A), and its overlap were resolved in a 3.5% polyacrylamide-denaturing gel and with the region that recruits hUPF 1 during SMD, which visualized using a Typhoon Phosphorimager (GE Health spans amino acids 272-405. Sequence alignments also dem care). onstrated that, compared to hSTAU1 RBD'5, RBD'5 of all 0239 Primer extension was performed using poly(A)+ hSTAU2 isoforms lacks the predicted B-sheet and the N-ter HeLa-cell RNA (10 ug), Superscript II (Invitrogen) and the minus of Cl2 (FIG. 10B). /2-sbsRNA1-specific antisense primer 5'-GAGTTAAAA Example 19 GAGGCTGCAGTG-3'(SEQID NO: 138). DNA sequencing was executed using the SILVER SEQUENCING DNA SSM-RBD5Forms a Homodimer in Solution and in Sequencing System (Promega), the same antisense primer Human Cells and pcDNA3.1 (+)/Zeo Chr11 66193000-66191383. Primer extension and sequencing products were resolved in 0245 Since sequence conservation generally implies an 8% polyacrylamide-denaturing gel and visualized using a function, and considering that dimerization required that one Typhoon Phosphorimager. of the interacting molecules consist of full-length hSTAU1, whether SSM-RBD'5, rather than RBD5 alone, forms a Example 17 homodimer was tested. The use of SSM-RBD5 was further Fluorescence and Phase-Contrast Microscopy justified because a search for a region of hSTAU1 that includes RBD' S, is stable in solution, and is suitable for 0240 Cells were visualized using a Nikon Eclipse crystallographic studies revealed that amino acids 367-476, TE2000-U inverted fluorescence microscope and, for phase i.e., SSM-RBD'5, gave the best Xtal Pred score, although microscopy, a 480-nm excitation spectra. Images were cap the score was below suboptimal. This is largely because tured utilizing TILLVISION software (TILL Photonics). RBD5 has a higher instability index than does SSM 0241 Throughout this application, various publications RBD5. Thus, at least theoretically, SSM provides stability are referenced. The disclosures of these publications in their to RBD5. entireties are hereby incorporated by reference into this appli 0246. After purifying GST-hSTAU1 (367-476) from E. cation in order to more fully describe the state of the art to coli and removing the GST tag, SSM-RBD5 migrated dur which this invention pertains. The references disclosed are ing gel filtration at the size of a dimer Sedimentation velocity also individually and specifically incorporated by reference determinations using analytical ultracentrifugation con herein for the material contained in them that is discussed in firmed that the average weight distribution of SSM-RBD'5 the sentence in which the reference is relied upon. shifted to lower Svedberg values at lower concentrations 0242. It will be apparent to those skilled in the art that (FIG. 10C). The best-fit model for SSM-RBD'5 (0.0090 various modifications and variations can be made in the mg/ml root mean standard deviation (rmsd) with 95% confi present invention without departing from the scope or spirit of dence limits) was one of rapid monomer (1.32+0.02/-0.03 the invention. Other embodiments of the invention will be S)-dimer (2.21+0.01 S) equilibrium where the dimer K was apparent to those skilled in the art from consideration of the 799 uM. specification and practice of the invention disclosed herein. It 0247 To obtain a physiologically relevant assay, RBD'5 is intended that the specification and examples be considered was tested to determine if it is Sufficient for SSM-RBD5 as exemplary only, with a true scope and spirit of the invention homodimer formation in human cells. RBD5 was expressed being indicated by the following claims. with an N-terminal tag since experiments using E. coli-pro Example 18 duced RBD5 revealed that an N-terminal GST tag or SSM moiety was required for stability and/or solubility in vitro. STAU in All Classes of Vertebrates Shares a Human embryonic kidney (HEK)293T cells were transiently Conserved Motif N-Terminal to RBD5 transfected with a mixture of two plasmids: (i) pEGFP 0243 Using yeast two-hybrid analyses, full-length human RBD'5, which produces monomeric enhanced green fluo (h)STAU1 was shown to interact with amino acids 408-496 of rescence protein (EGFP)-RBD5 and either pmRFP-SSM US 2013/0317087 A1 Nov. 28, 2013 38

RBD5 or pmRFP-RBD'5, which produce monomeric red (FIG. 12A). The V-shape created by the RBD5 helices in fluorescence protein (mRFP) SSM-RBD5 or mRFP turn straddles SSM al (FIG. 12A,B). RBD'5, respectively; or (ii) pEGFP-SSM-RBD5 and 0252. The interactions between SSM and RBD5 form a either pmRFP-SSM-RBD5 or pmRFP-RBD'5 (FIG. 1D, core composed of residues with hydrophobic side chains upper). Notably, EGFP and mRFP harbor mutations that dis (FIG. 12B). The external solvent boundary of this core is rupt dimer formation that interferes with the analyses. Cell defined by T371 of the longer of the two SSM C-helices, C.1; lysates were immunoprecipitated in the presence of RNase A the hydrophobic methyl group of T371 inserts into the hydro using anti-GFP or, to control for nonspecific immunoprecipi phobic core, and the T371 hydroxyl group points outward tation (IP), mouse(m)IgG. (FIG. 12B). 1374, A375, L378 and L379 of SSM C1 also 0248 Western blotting demonstrated that both EGFP contribute to the hydrophobic core as do A387 of SSMC2 and tagged proteins were expressed at comparable levels prior to RBD5 C.1 constituents P408 (which startsal), L412, the ring IP, as were both mRFP-tagged proteins (FIG. 10D, lower). of Y414, L415, and the B and Y carbons of the Q419 (which Furthermore, anti-GFP immunoprecipitated comparable ends C.1) (FIG. 12B). Additionally, RBD5 C2 contributes amounts of each EGFP-tagged protein but did not immuno A465, L469 and L472 (FIG.12B). Of the RBD5 hydropho precipitatecalnexin, and mIgG failed to detectably immuno bic core-contributing and SSM-interacting residues, P408 is precipitate any protein (FIG. 10D, lower). EGFP-SSM absent from nearly all STAU proteins that lack an SSM. RBD'5co-immunoprecipitated with mRFP-SSM-RBD However, regardless of the presence of an SSM, L412, L415 SandmRFP-RBD5 with comparable efficiencies, whereas and A465 are invariant, and Y414, L469 and L472 are gener EGFP-RBD'5co-immunoprecipitated with mRFP-SSM ally conserved (FIG. 11). RBD5 but not mRFP-RBD'5 (FIG. 10D, lower). Both 0253) Two polar interactions exist at the interface between EGFP-RBD 5 and EGFP-SSM-RBD5 also co-immuno SSM and RBD5 and appear to position SSM and RBD'5 precipitated with endogenous hSTAU1 isoforms (FIG. 10D, relative to one another to facilitate what is largely a hydro lower), consistent with the finding that RBD5 alone can phobic-driven interaction. In the first, the side-chain hydroxyl interact with full-length hSTAU1 in yeast two-hybrid analy group of SSM T371 and the main-chain oxygen of K367 ses. hSTAU1 RBD'5-RBD5 dimerization cannot occur hydrogen bond with the amine group of RBDS Q419, while between two proteins that each contain only RBD5 but can the -amine of K567 interacts with the hydroxyl group of Q419 occur if one of two RBD'5-containing molecules contributes (FIG. 12B). All vertebrate STAU proteins contain a residue an SSM. having similar character and position to T371 e.g., Ser replaces Thr in human and mouse STAU2 proteins (FIGS. Example 20 11), and Q419 is strictly conserved. The second polar inter action involves a strongly conserved basic charge (in all ver Structure of hSTAU1 SSM-RBD5 tebrate STAU proteins examined except D. rerio STAU, 0249. To understand the atomic details of this dimeriza where the residue is ASn: FIG. 10B) contributed by SSM tion interaction, the X-ray crystal structure of SSM-RBD5 R376 in hSTAU1 that interacts with a citrate ligand present in at 1.7 A resolution was determined (Table 12). the crystal structure; otherwise, R376 interacts with the main TABLE 12 Top matches to STAU1 RBDS identified by Dali. Bound to dsRNA in Dali Z Binds this PDB-Chain SCO CC. rmsd (A) % ID Protein Organism dsRNA? structure? *3LLH- *10.8/10.7 81.3.1.1 *19.20 TARBP2 Hono Yes No BA RBD1 Sapiens *2NUE- *10.6.10.6 2.0.1.8 *22/22 RNase III Aquifex Yes Yes AB aeolicits 1YYK-A 1O.S 2.0 22 RNase III Aquifex Yes Yes aeolicits 1D2-A 1O.S 1.5 22 XIrbpa Xenopis Yes Yes RBD2 laevis 2NUG-B 1O.S 1.9 22 RNase III Aquifex Yes Yes aeolicits

(0250 Results indicated that RBD5 does adopt the C-B- chain oxygen of E474 near the C-terminus of RBD5 C.2, B-B-C. topology of a prototypical RBD (FIG. 12A). One mol which is also invariant in vertebrate STAU homologs (FIG. ecule is present per asymmetric unit, indicating that any exist 10B). ing dimer in the crystal structure is derived from 0254 Interestingly, residues without strict conservation crystallographic symmetry mates. within SSM, i.e., M373, Y380, G381, T383 and P385, are positioned on its solvent-exposed side, opposite to the inter 0251 SSM, which directly binds RBD'5 (FIG. 12A,B), face that interacts with RBD5. This indicates that the con forms two C-helices (SSMC1 and C.2) that are connected by servation of SSM residues has been driven by a requirement a tight turn. These helices form a V-shape that straddles to interact with RBD'5. Furthermore, RBD'S Q419 and RBD5 al (FIG. 12A,B). RBD'5C1 and C2 pack behind the G420, the latter of which is most likely needed to end C.1 and -sheet that connects the two helices in the primary sequence supply flexibility to the T371:Q419 interaction, are strictly US 2013/0317087 A1 Nov. 28, 2013 39 conserved in all SSM-containing STAU proteins that were shortened and is unable to reach the minor groove of dsRNA, examined, whereas no STAU protein that lacks an SSM con lacks a His residue that in hTRPB2 RBD1 interacts with the tained either of these residues (FIG. 11). These findings indi dsRNA minor grove (FIG. 14A). In hSTAU1 RBD5 region cate that SSM and RBD5 have co-evolved to interact with 3, the positively charged residues of hTRBP2 RBD1 that one another either in cis (i.e., when STAU is a monomer), in interact with the negatively charged phosphate backbone trans (i.e., when STAU is a dimer), or both. spanning the dsRNA major groove are negatively charged and can actually repel dsRNA (FIG. 14A, C, and D). Consistent Example 21 with this view, D. melanogaster STAU RBD3 and hTRBP2 RBD 1 maintain a basic charge in region 3 despite having SSM and RBD5 are Domain-Swapped Between differences in the lengths of L4 and C2. In fact, D. melano Two Symmetry-Related Molecules in the Crystal gaster STAURBD3 RNA binding was lost when either of the Structure first two conserved Lys residues (K59 and K60 in hTRBP2 0255. There is little-to-no electron density in the X-ray RBD 1: FIG. 14A) of region 3 were mutated to alanine. As crystal structure for amino acids 397-404 in the loop that inferred from the NMR structure of D. melanogaster STAU connects SSM and RBD'5 (FIG. 12A). This high level of RBD3, hSTAU1 RBD3 likewise maintains a basic charge in disorder led to difficulties in interpreting whether SSM is region 3. The absence of the conserved H is residue or a bound in cisto its own RBD5 or RBD5 derives from an functional equivalent in hSTAU1 RBD5 L2 of region 2 adjacent molecule in the crystal lattice, i.e., is the conse contributes to the loss of dsRNA binding as evidenced by the quence of domain-swapping between two molecules. finding that D. melanogaster STAURBD3 RNA binding was 0256 Assuming the cis-configuration, proximal mol lost when this L2 H is was changed to Ala. ecules in the crystal lattice were examined using PISA (FIG. 13A,B) to define the dimer interface. The largest symmetric Example 23 crystal-packing interface, which was only ~764 A (from each molecule), was formed between the RBD'5s of adja SSM-RBD5Domain-Swapping Facilitates the cent molecules (FIG. 13A,B) and was defined by a PISA Interaction Between hSTAU1AhSTAU1 as Well complexation significance score of Zero (i.e., the least signifi as hSTAU1AhSTAU2, where RBD5 C1 is Key cant), indicating it is not biologically relevant. Furthermore, 0260 From the structure, the two C-helices of RBD5 SSM-RBD5(E424H, D427V), which contains mutations at interact with the two C-helices of SSM. However, the finding this interface (FIG. 13B), produced a gel-filtration chromato that hSTAU1 can interact with all hSTAU2 isoforms, the gram identical to that of SSM-RBD'5(WT) (FIG. 13C), i.e., smallest of which (hSTAU2) has a C-terminus that ends five dimers and not monomers were observed. amino acids after RBD5 C1 (FIG. 10B), indicates that C1 0257. A perfect CSS score of 1.0 was obtained for thetrans must constitute the minimal region of RBD 5 necessary to configuration (FIG. 13A), in which a highly conserved SSM interact with SSM. of one molecule binds to the RBD'5 of a second molecule 0261) To test this idea, HEK293T cells were transiently (FIG.12B) to create a 38-residue surface area of-1249 A for transfected with hSTAU1-HA and one of three siRNA each molecule (FIG. 13A). Possibly, the interaction occurs in resistant (R) plasmids that produce either hSTAU1 ciswhen hSTAU1 is a monomer and in trans when it is a FLAG, hSTAU1A(C-Term)-FLAG or hSTAU1A dimer. (SSM-RBD5)-FLAG, each of which was expressed at the level of cellular hSTAU 1. hSTAU1A(C-Term)-FLAG Example 22 lacks all amino acids C-terminal to RBD5 A1. Cell lysates were immunoprecipitated in the presence of RNaseA using Comparison of RBD5 to an RBD that Binds anti-FLAG or, as a negative control, mIgG. dsRNA 0262 Western blotting demonstrated that the three FLAG 0258. The structural elements that render RBD5 unable tagged proteins were expressed at comparable levels prior to to bind dsRNA were addressed. Remarkably, the three RBD IP, were immunoprecipitated with comparable efficiencies structures that according to the Dali server are most similar to using anti-FLAG, and were not immunoprecipitated with RBD5 do bind dsRNA (Table 12). These structures are mIgG. The level of hSTAU1-HA or cellular hUPF1 that RBD1 of human TAR RNA-binding protein 2 (hTRBP2: co-immunoprecipitated with hSTAU155(A(SSM PDB ID 3LLH: Z-score=10.8: rmsd=1.3 A), the RBD of RBD'5) FLAG was only ~10% the level of, respectively, RNase III from the thermophilic prokaryote Aquifexaeolicus hSTAU1-HA or cellular hUPF1 that co-immunoprecipi (PDB ID 2NUE: Z-score=10.6: rmsd=2.0 A), and RBD2 of tated with hSTAU15'-FLAG or hSTAU1 (A(C-Term)- Xenopuslaevis RNA-binding protein A (Xlrbpa; PDB ID FLAG. IPs of the same transfections using either anti-HA, or 1D12: Z-score=10.5: rmsd=1.5A). rIgG as a negative control, revealed that the level of 0259 hTRBP2 RBD1 is the most similar to hSTAU1 hSTAU1A(SSM-RBD'5) FLAG that co-immunopre RBD5. To address how STAU1 RBD5 adopt a fold similar cipitated with hSTAU1-HA was only ~10% the level to that of hTRBP2 RBD1 yet fail to bind RNA, the two hSTAU1-FLAG orhSTAU1A(C-Term)-FLAG that structures were superimposed (FIG. 14A) to create a struc co-immunoprecipitated with hSTAU1-HAs. These results ture-based sequence alignment (FIG. 14B). While the two indicate that domain-swapping between SSM and RBD5 is structures are nearly identical, hSTAU1 RBD5 has a shorter the major determinant of hSTAU1 homodimerization and that loop 2 (L2) and a longer L3 compared to hTRBP2 RBD1. RBD5 O." is necessary and sufficient to interact with SSM. Furthermore, none of the key residues that typify the three 0263. Since hSTAU1 recruits hUPF1 to SMD targets dur RNA-binding regions of canonical RBDs and are present in ing SMD, cellular hUPF 1 was also assayed. Remarkably, the hTRBP2 RBD1 are found in hSTAU1 RBD5. The most co-IP of hUPF 1 with each hSTAU1-FLAG variant cor apparent differences reside in regions 2 and 3. L2, which is related with homodimerization ability. Consistent with this, US 2013/0317087 A1 Nov. 28, 2013 40 the co-IP of hUPF 1 with hSTAU1-HA did not vary among transfected with plasmid producing hSTAU19-FLAG, transfections (FIG. 4B, lower). Assays of the three detectable hSTAU15-HA, and either mRFP-RBD 5 (from pmRFP cellular hSTAU2 isoforms demonstrated that hSTAU2 co RBD5') or no protein (from pmRFP). Lysates were immu immunoprecipitates with each hSTAU19-FLAG variant noprecipitated in the presence of RNase A using anti-FLAG with the same relative efficiency as didhSTAU1-HAs. or, as a negative control, mIgG. 0264. Since hSTAU1A(SSM-RBD'5)-FLAG still 0268 Western blotting demonstrated that comparable had residual dimerization activity (10% that of hSTAU1 amounts of hSTAU1'-FLAG were expressed and immu FLAG), and in view of reports that hSTAU1 RBD2 amino noprecipitated using anti-FLAG in the presence or absence of acids 37-79 can interact with full-length hSTAU1, the ability RBD'5, and hSTAU1 FLAG and hSTAU1-HA of E. coli-produced RBD2-RBD3 amino acids 43-173 to were each expressed at a level comparable to that of cellular dimerize was assayed. Gelfiltration demonstrated that hSTAU1. RBD5 expression reduced the amount of RBD2-RBD3 indeed migrated at the position expected of hSTAU1-HA that co-immunoprecipitated withhSTAU1 an RBD2-RBD3 RBD2-RBD3 dimer. (R)-FLAG to 35-40% of the amount that co-immunoprecipi tated in the absence of RBD5 expression. The finding that Example 24 RBD5 expression reduced the amount of cellular hUPF1 that co-immunoprecipitated withhSTAU1-FLAG also to Domain-Swapping of SSM and RBD5 C1 is 35-40% of the amount that co-immunoprecipitated in the Important for SMD absence of RBD5 expression indicates that hUPF1 binds 0265. To test the importance of hSTAU1 dimerization to hSTAU 1 dimers more efficiently than it binds hSTAU1 mono SMD, HEK293T cells were transiently transfected with: (i) CS. STAU1 (A)siRNA; (ii) plasmid expressing one of the three hSTAU1-FLAG variants or, as a control, no protein; (iii) Example 25 three plasmids that produce a firefly luciferase (FLUC) reporter mRNA, i.e., FLUC-No SBS mRNA, which lacks an SBS, FLUC-hARF1 SBS mRNA, which contains the hARF1 hSTAU1 Homodimerization Occurs Through the SBS, and FLUC-hSERPINE1 3' UTR, which contains the 3' SSM UTR and, thus SBS of mRNA encoding serpin peptidase 0269. The hSTAU1 SSM, which is a two-helix motif that inhibitor Gladee, member 1; and (iv) a reference plasmid that interacts with the dsRNA-binding-deficient RBD'5 of produces renilla luciferase (RLUC) mRNA. In parallel, cells another hSTAU1 molecule. A complete SSM and all of were transfected with (i) Control siRNA, (ii) plasmid produc RBD'5, which are required for this interaction, can be found ingno hSTAU 1-FLAG protein, (iii) the three FLUC in the STAU proteins of all vertebrate classes. The majority of reporter plasmid DNAs, and (iv) the RLUC reference plas the RBD5 hydrophobic residues that contribute to SSM mid. RBD5 homodimerization via domain-swapping are gener 0266 Western blotting of cell lysates demonstrated that ally present in other RBDs. In particular, that P408, L412, STAU1 (A)siRNA reduced the abundance of cellular hSTAU1 A465, L469 and L472 are conserved between hSTAU1 to ~10% the level in Control siRNA-treated cells and that RBD5 and hTRBP2 RBD1 (FIG. 14B) most likely explains each hSTAU1-FLAG variant was expressed at compa why hSTAU1 RBD5 and hTRBP2 RBD1 can be structurally rable abundance. When semi-quantitative RT-PCR was used superimposed (FIG. 14A). However, hSTAU1 RBD5 resi to normalize the level of each FLUC mRNA to the level of dues Y414 and L415, which are positioned, respectively, in or RLUC mRNA, which controls for variations in transfection proximal to dsRNA-interacting region 1, are not conserved in efficiencies and RNA recovery, the normalized level of other RBDs (FIG. 14B). SSM is a modular adaptation in FLUC-No SBS mRNA, which is not an SMD target, was many if not all vertebrate STAU homologs that, through its found to be essentially identical in all transfections, as interaction with RBD'5, adds greater functionality to full expected. In contrast, the normalized level of FLUC-haRF1 SBS mRNA or FLUC-hSERPINE1 3' UTR mRNA was length protein, i.e., the potential for STAU to dimerize if not increased -2-fold in the presence of STAU1(A) siRNA alone, multimerize considering the RBD2- RBD2 interaction. consistent with an inhibition of SMD. This inhibition was reversed by 50% when hSTAU155*)-FLAG or hSTAU155*) Example 26 A(C-Term)-FLAG were expressed but not when hSTAU1. (R)A(SSM-RBD5) FLAG was expressed. Thus, hSTAU1 Homodimerization Contributes to SMD hSTAU1 () FLAG and hSTAU15'A(C-Term)-FLAG can functionally compensate for the siRNA-mediated down (0270 Compared to hSTAU1 monomers, hSTAU1 dimers regulation of cellular hSTAU1 more efficiently than can bind hUPF1 more efficiently and mediate SMD more effec hSTAU 1 (R)A(SSM-RBD 5) FLAG. tively. Thus, cells can regulate SMD by controlling hSTAU1 0267 hSTAU1 dimerization is important for SMD, dimerformation. Since homodimers of SSM-RBD5 are less because hSTAU 1 dimers bind an SBS and/or UPF1 more stable (K. uM; see also FIG. 10C) than are complexes of efficiently than hSTAU1 monomers, but also because full-length hSTAU1 and dsRNA (K-10M), hSTAU1 bind hSTAU1 (A(SSM-RBD'5) FLAG can bind hUPF1 ing to dsRNA can nucleate hSTAU 1 dimerization. Proteins inefficiently. Considering that deleting the TBD and adjacent known to dimerize on double-stranded nucleic acid are exem SSM of hSTAU1 ablated hUPF1 binding to an essentially plified by transcriptional activators, the adenosine deami undetectable level, and that RBD5 alone does not bind nases ADAR1 and ADAR2, and protein kinase RNA-acti hUPF1 (FIG.10D), whether inhibiting hSTAU1 dimerization vated (PKR), where binding to viral dsRNA promotes PKR by expressing RBD5 inhibited hSTAU1 binding to hUPF1 phosphorylation activity by allowing dimerization of the was tested. To this end, HEK293T cells were transiently kinase domain. US 2013/0317087 A1 Nov. 28, 2013

Example 27 Example 30 RBD5 has Diverged from a True RBD to Serve a New Function Protein Crystallization and Structure Determinations (0271 Assuming RBD5 evolved from a functional RBD, 0276 Native crystal datasets were obtained using crystals it not only lost the ability to bind dsRNA but gained the ability produced from gel-filtration-purified hSTAU1 SSM-RBD5 to interact with SSM. The structure together with models that and either the hanging-drop method for remote data collec compare RBD5 to true RBDs, such as hTRBD2 RBD1 and tion at the Stanford Synchrotron Radiation Lightsource RBD2 in association with dsRNA, clearly illustrate that RBD (SSRL) or the sitting-drop method for data collection at the regions 2 and 3, which interact with the minor groove and Cornell High Energy Synchrotron Source (CHESS) (Table bridge the proximal major groove of dsRNA, respectively, are 12). An initial model was built using low-resolution experi altered in RBD'5 (FIG. 14D). The role of region 1 in C1, at mental phases obtained from in-house single anomalous dis least fortrue RBDs, determines RNA recognition specificity, persion phases from an ethyl mercuric phosphate-soaked where C.1 can bind the major groove or possibly distinguish crystal. These coordinates were used for molecular-replace ing features such as loops at the apex of dsRNA. In RBD'5, ment and refined againsta 2.2 A native dataset (Table 12). The C.1 specifies SSM recognition, although RBD5 al interacts final model was refined against a subsequent, 1.7 A native with SSM using a face that is orthogonal to the face that data set. A consistent set of reflections for the free R-factor interacts with dsRNA in a true RBD. The data indicate that was maintained throughout. Structure figures were generated RBD5 C1 is sufficient for hSTAU 1 dimerization and, using PyMOL (Schrödinger, LLC). See Extended Experi together with four L1 amino acids, is the only region of mental Procedures for crystallization and structure determi RBD5 that exists in the smallest STAU2 isoform (FIG. nation details. 10B). (0272 Interestingly, what remains of RBD5 in the Example 31 hSTAU2 isoforms with the longest C-termini corresponds to the regions of hSTAU1 RBD5 that contact SSM directly, HEK239T-Cell Transfections, and Protein and RNA i.e., RBD'5al and the C-terminus of RBD'5C2 (FIG. 10B: Purification 12B). Due to the lack of a sufficiently sized loop residing (0277 Human HEK293T cells were grown in Dulbecco's- between hSTAU2 RBD'5C1 and the remains of RBD'5C2, modified eagle medium (Gibco-BRL) containing 10% fetal details of the dimerization interaction between hSTAU2-hS bovine serum (Gibco-BRL). Cells were transiently trans TAU2 and hSTAU1-hSTAU1 can differ. However, residues of fected with plasmids using Lipofectamine 2000 (Invitrogen) hSTAU2 RBD5 residing C-terminal to alare dispensable for or with siRNA using Oligofectamine (Invitrogen) as indi the SSM-mediated dimerization of hSTAU2, since they are cated in the figure legends. siRNAs consisted of hSTAU1 dispensable for the SSM-mediated dimerization of hSTAU1. siRNA(A) and Negative Control #1 siRNA (Ambion). Pro tein was isolated using passive lysis buffer (Promega), and Example 28 RNA was purified using TRIZol Reagent (Invitrogen). The RBD Fold as a Platform for New Functions 0273. As reported here, the combination of a modified Example 32 RBD, e.g., hSTAU1 RBD'5, within the context of an adapter region, e.g., hSTAU1 SSM, can promote greater functionality Plasmid Constructions within the larger, often modular and flexible framework of (0278. To generate pGEX-6p-1-hSTAU1-SSM-RBD'5, proteins that contain one or more RBDs that bind dsRNA. In the online servers MeDor (Lieutaudet al., 2008) and XtalPred Support of this view, modifications that consist of anL1 Cys (which gave an average score of 3) were used to guide the and anL3 H is within the RBD of the Schizosaccharomyces choice of boundaries that include hSTAU 1 SSM and RBD5 pombe Dicer DCR1 protein work together with a 33-amino and provide optimal protein stability and crystallization. The acid region that resides C-terminal to the RBD to form a region of hSTAU1 clNA that encodes amino acids 367-476 Zinc-coordination motif that is required for nuclear retention. was PCR-amplified using pRSET-B hSTAU1 and the primer Since this RBD binds dsRNA and dsDNA, these and other pair 5'-AAAA changes can additionally contribute to dsDNA binding. GGATCCAAGGCCACGGTAACTGCCATG-3' (sense, (0274 RBD's that fail to bind dsRNA can acquire new where the BamHI site is underlined) (SEQID NO: 161) and functions independently of adjacent regions. As one example 5'-AAAA of this, RBD5 region of Drosophila Staufen has adapted to GAATTCTTATCAGTCCAACTCAGACAGCAAC-3 (anti bind the Miranda protein required for proper localization of sense, where the EcoRI site is underlined) (SEQID NO: 162). prospero mRNA. As another example, hTRBP2 contains The resulting PCR product was cleaved with BamHI and three RBDs, and the C-terminal RBD binds Dicer instead of EcoRIand inserted into the BamHI and EcoRI sites of pGEX dsRNA. Additionally, in contrast to the SSM-mediated 6p-1 (GE Healthcare) to generate pGEX-6p-1-hSTAU1 dimerization of hSTAU1 RBD'5, RBD3 of Xlrbpa and its SSM-RBD5. Notably, upon removing the GST-tag using human homolog, p53-associated cellular protein PACT, PreScission Protease (GE Healthcare), the resulting protein appear to homodimerize independent of an accessory region. contains the amino acids GPLGS N-terminal to hSTAU1 Example 29 amino acids 367-476. 0279. To constructpGEX-6p-1-hSTAU1-SSM-RBD'5 Sequence Alignments (E424H, D427V), the QuikChangeTM method was used but (0275 Sequences were obtained from NCBI. Multiple pro with KOD DNA polymerase (Novagen), pGEX-6p-1-hS tein sequence alignments were performed using Clustal W TAU1-SSM-RBD5 as template, and the primer pair 5'-GAT within BioEdit, which was used to generate figures. TCCAGGTTCATTACAAAGTCTTCCCCAAAAAC-3' US 2013/0317087 A1 Nov. 28, 2013 42

(sense) (SEQ ID NO: 163) and 5'-GTTTTTGGGGAAG relative to the NCBI sequence. This change derives from the ACTTTGTAATGAACCTGGAATC-3' (antisense) (SEQ ID original pcDNA3/RSV-hSTAU-HA plasmid. NO: 164). (0284. To generate pGEX-6p-1-hSTAU1-RBD2-RBD3, 0280. To construct pEGFP-hSTAU1-SSM-RBD5 or pRSET B-His-STAU1 was PCR-amplified using 5'-AAAA pEGFP-hSTAU1-RBD'5, pRSET B-STAU1 was PCR-am GGATCCCCTTTACTTTATCAAGTGG-3 (sense, BamHI plified using 5'-AAAAGAATTCTTATCA GTCCAACTCA site is underlined) (SEQ ID NO: 178) and 5'-AAAA GACAGCAAC-3 (antisense, EcoRI site is underlined) (SEQ GAATTCTTATCACGGTAACTTCTTCAGCTCCTC-3' ID NO: 165) and, respectively, 5'-AAAAAAGCTTAAGGC (antisense, EcoRI site is underlined) (SEQID NO: 179). The CACGGTAACTGCCATG-3' (sense, HindIII site is under PCR product was digested with BamHI and EcoRI and lined) (SEQ ID NO: 166) or 5'-AAAA inserted into pGEX-6p-1 (GE Healthcare). AAGCTTAGACCCTCTGAGCAACTGGAC-3' (sense, HindIII site is underlined) (SEQID NO: 167). PCR products Example 33 were cleaved using EcoRI and HindIII and inserted into pEGFP-C3 (BD Biosciences Clontech). Protein Expression in E. coliand Protein Purification (0281. To construct pmRFP-hSTAU1-SSM-RBD5 or (0285 E. coli BL21 (DE3) transformed with pGEX-6p-1- pmRFP-hSTAU1-RBD'5, pRSETB-STAU1 was PCR-ampli hSTAU1-SSM-RBD5 was propagated in multiple 1-liter fied using the same antisense primer that was used to amplify cultures of Luria Broth supplemented with amplicillin (100 thepEGFP plasmids and, respectively, 5'-AAAA mg/l), to an O.D.600 of -0.5, at which time 300 ul of 1M AAGCTTCTAAGGCCACGGTAACTGCCATG-3' (sense, isopropyl B-D-1-thiogalactopyranoside was added to each HindIII site is underlined) (SEQ ID NO: 168) or 5'-AAAA liter and the temperature was reduced from 37° C. to 30° C. AAGCTTCTAGACCCTCTGAGCAACTGGAC-3' (sense, The following morning, cells were collected at ~7,000xg and HindIII site is underlined) (SEQID NO: 169). PCR products 4°C. and either used directly or flash-frozen in liquid N-for were cleaved using EcoRI and HindIII and inserted into storage at -80°C. pmRFP pmRFP derives from posRed-Express-C1 (Clontech 0286 Cell pellets were resuspended in ~40 ml of Buffer A Laboratories, Inc.) and contains mutations that render DSRed (1M NaCl, 25 mMTris-HCl pH 8) to which was added 55 ul (i.e. mRFP) monomeric. of 0.93 Mdithiothreitol(DTT), 500 ul of 100 mM PMSF, 50 0282. STAU1(A) siRNA-resistant phSTAU1-HA ul of 0.5 M EDTA pH 8,500 ul of 80 mg/ml lysozyme, and a was derived from the PCR-amplification of pcDNA3/RSV protease inhibitor tablet (Roche). Cells were lysed using soni hSTAU-HAs using two sets of primer pairs: 5'-CACCACAT cation, and lysates were cleared by centrifugation at TGGTGTGCACCTCCAAGCTTGG-3 (sense A) (SEQ ID 17,000xg for 30 minutes at 4°C. The soluble portion was NO: 170) and 5'-CCGcTTCAGGGCGATTTC removed and loaded on a GSTrapTM HP column (GE Health GAACACTTGACTTATTTCAGATTT-3' (antisense A, care), washed with 1M NaCl, 25 mMHepes pH 8 (which was where underlined nucleotides confer siRNA-resistance, and) sometimes replaced with Buffer A), washed with gel-filtra (SEQID NO: 171), and 5'-AAATCTGAAATAAGTCAAGT tion (GF) buffer (100 mMNaCl, 10 mMTris-HCl pH 8, 1.3 GTTCGAAATCGCCCTGAAgCGG-3 (sense B, where mMDTT; this step was sometimes omitted), and then eluted underlined nucleotides.confer siRNA-resistance, and the two with 0.3 g of glutathione (reduced, free acid) dissolved in 100 lower case letters were ineffective in directing a change from ml of GF buffer. A -1 mg aliquot of PreScissionTM Protease the wild-type sequence) (SEQ ID NO: 172) and 5'-GAAG (GE Healthcare) was added to ~50 ml of eluted sample and GCACAGTCGAGGCTGATCAGCGAG-3' (antisense B) left at 4° C. overnight. The following day, the sample was (SEQ ID NO: 173). The resulting two PCR products were applied to a HiTrapTM Q HP column (GE Healthcare) to mixed and PCR-amplified using the first sense A and anti remove GST. The flow-through was concentrated to ~ml sense B primers. This PCR product was cleaved with KpnI using a CORNING(R) SPIN-X(R) UF 20 5K column (MW and Xbaland inserted into pcDNA3/RSV-hSTAU-HA cut-offat 5 kDa), and loaded using an AKTAFPLCTM system (0283) To generate pcI-neo-hSTAU1-FLAG, pcI-neo (GE Healthcare) onto a 120-ml HiLoadTMSuperdexTM 75 hSTAU1A(C-Term)-FLAG or pcI-neo-hSTAU1A 16/60 prep grade column (GE Healthcare) gel-filtration col (SSM-RBD'5)-FLAG, phSTAU19-HA was PCR-am umn that was pre-equilibrated with GF buffer. hSTAU1 plified using 5'-AAAAGCTAGCGCCACC SSM-RBD5 peak fractions were concentrated as above and ATG AAACTTGGAAAAAAACCAATG-3 (sense, NheI used immediately or stored for short periods at 4°C. site is underlined, and the Kozak sequence is bold with start (0287 Procedures for expressing pGEX-6p-1-hSTAU1 codon also italicized) (SEQID NO: 174) and, respectively, RBD2-RBD3 were identical to those for used for express 5'-AAAACTCGAGCTATTACTTGTCGT CATCGTCT ing hSTAU-SSM-RBD'5. However, Buffer A contained 5% TTGTAGTCCCCCCC GCACCTCCCACACACAGAC-3' glycerol and the GSTrapTM column elution was with a solu (antisense) (SEQID NO:175), 5'-AAAACTCGAGCTATTA tion prepared by dissolving 0.3 g glutathione (reduced, free CTTGTCGT CATCGTCTTTGTAGTCCCCCCCCTG acid), a protease inhibitor tablet (Roche) and 405ul of 0.93 M GAATCCCTGGACTCTGGAAAG-3' (antisense) (SEQ ID DTT in 100 ml of GF buffer. After PreScissionTM Protease NO: 176) or 5'-AAAACTCGAGCTATTACTTGTCGT treatment overnight, the solution was loaded onto a HiTrapTM CATCGTCT TTGTAGTCCCCCCC CGGAGCTGC SPFF column (GE Healthcare) and eluted using a linear NaCl CCTGGTAAAATCTTTGG-3 (antisense) (SEQ ID NO: gradient of GF buffer and glycerol-containing Buffer A using 177), where for each antisense primer the XhoI site is under a BioLogicDuoFlowTM FPLC system. Peak fractions were lined and the FLAG sequence introduced by the primer is collected, concentrated as above, and loaded onto a HiTrapTM bold, underlined and italicized). PCR products were digested Q HP column to remove contaminating RNAs. The flow using Nhe and XhoI and inserted into pcI-neo (Promega). through was concentrated and loaded on a 120 ml Each STAU1 plasmid encodes an R323Kamino acid change HiLoadTMSuperdexTM 200 16/60 prep grade column (GE US 2013/0317087 A1 Nov. 28, 2013

Healthcare) that was equilibrated with GF buffer containing days, bi-pyrimidal shaped crystals (Figure S11) were found 2.97 mMDTT using the BioLogicDuoFlowTMFPLC system. using JCSG Core Suite II condition #96 (or H12). The screen ing solution was dehydrated ~1.3 fold and therefore con Example 34 tained 130 mM citric acid pH 2.5 and 26% (w/v) PEG 6000 with a final pH of 4. Analytical Ultracentrifugation 0291. Using the hanging drop method and the Stanford 0288 hSTAU1-SSM-RBD5 was purified as above, Synchrotron Radiation Lightsource (SSRL), a native crystal except the final GF buffer contained 2.97 mM DTT, and dataset was generated using the conditions described above, submitted to the University of Connecticut Analytical Ultra except that drops were 3 ul and the reservoir contained 1 ml of centrifugation Facility for sedimentation Velocity analysis. A 0.1 M citric acid pH 2.5 and 35% PEG 6000. Crystals (20-30 Beckman-Coulter XL-I analytical ultracentrifuge with ul), the largest of which were on average 240 m tip-to-tip, double-sector synthetic boundary cells having Sapphire win were transferred to a 50/50 (v/v) mixture of silicon and dows was used to take interference scans. Measuring refrac PARATONE R N oils, moved around in the cryoprotectant tive index rather than absorbance was especially useful con with a nylon loop until free of phase-separated Sweat, col sidering the low extinction coefficient at Aso that typifies lected with the loop, and flash-frozen in liquid N. The native SSM-RBD5; which lacks tryptophan residues. Interference crystal dataset was collected under a cryostream remotely at scans were collected at 55,000 RPM and 20° C. every minute the SSRL beamline 9-2 on a MAR-325 CCD detector (Table for 7 hours. Data were analyzed using: 1) DcDt+, version 12). 2.0.9 (Philo, 2000; 2006), to determine the sedimentation coefficient distribution that was independent of a model, 2) 0292 A second native dataset was collected at the Cornell Sedfit, version 10.09beta (Schuck, 2000), to produce a High Energy Synchrotron Source (CHESS) on a crystal pro model-based continuous sedimentation coefficient distribu duced similarly to the SSRL dataset crystal, except 31 drops tion using the Lamm equation or c(s) to identify the number of were made by mixing 1.5 ul of hSTAU1 SSM-RBD5 pro species (e.g., monomers VS dimers) in Solution, and 3) Seda tein at a concentration of 5 mg/ml (determined at Aso with an nal, version 5.60 to combine datasets from the three highest of es of 4,470) with 1.5 ul of crystallization buffer (127 mM four concentrations tested, perform a global analysis, and citric acid pH 2.5 and 25.9% PEG 6000 (final pH 4)). Drops determine the protein association model using the Lamm were placed on a Micro-Bridge (Hampton Research, HR3 equation. 310) over 1 ml of 118 mM citric acid pH 2.5 and 29% PEG 6000 in the sealed wells of a 24-well plate. Data were col Example 36 lected under a cryostream at the CHESS beamline F1 on an ADSC Q-270 CCD detector (Table 12). Size Determination Using Gel-Filtration 0293. The crystal used for SAD phasing was produced Chromatography similarly to the CHESS native crystal, but using a 4 ul-drop 0289 Size standards were prepared by dissolving dried and a reservoir of 130 mM citric acid pH 2.5 and 26.5% PEG proteins in 2 ml of GF buffer containing 2.97 mM DTT. 6000. A 10 ul soaking-solution of 10 mM ethyl mercuric Proteins consisted of 3.8 mg of conalbumin (75 kDa), 2.3 mg phosphate (EMP. Hampton Research, HR2-446) in 127 mM carbonic anhydrase (29 kDa) and 6.7 mg aprotinin(6.5 kDa), citric acid pH 2.5 and 28.2% PEG 6000 (final pH 4) was each from the Low Molecular Weight Gel Filtration Calibra added directly to the drop containing the crystal, and a thick tion Kit (GE Healthcare; #28-4038-41), and 6 mg of glass coverslip was placed over the Micro-Bridge. After ~45 lysozyme (14.3 kDa) (Sigma; iL6876-10G). The dissolved minat room temperature, the crystal was transferred to 20LA Solution (1 ml, determined using a 1 ml loop) was loaded onto of cryoprotectant solution and flash-frozen. Data were col a 120 ml HiLoadTMSuperdexTM 20016/60 prep-grade column lected in-house under a cryostream using a Bruker AXS X8 (GE Healthcare) and separated at a 1 ml/min flow rate using Prospector Ultra X-ray generator system equipped with an the BioLogic DuoFlowTMFPLC system. For size estimations, APEX II CCD detector (Table 12). gel-filtration of SSM-RBD'5 (WT), SSM-RBD'5 (E424H, 0294 Data integration and Scaling were performed using D427V) and RBD2-RBD3 was performed as described for HKL2000for both native synchrotron datasets. Alternatively, the size standards. SSM-RBD5 (WT) was loaded at 8 PROTEUM2 (Bruker AXS Inc.) was used for the in-house mg/ml, SSM-RBD'5 (E424H, D427V) was loaded, and SAD dataset (Table 12). RBD2-RBD3 was loaded at 6 mg/ml. 0295 CTRUNCATE within CCP4 (CCP4, 1994) was Example 37 used to convert the SAD dataset intensities for input into Autosol within Phenix, where anomalous signals identified Extended Protein Crystallization and Structure two Hg sites at each of the only two Cys residues. The result Determination Procedures ing density-modified Resolve map and the FFFEAR and FFJOIN programs were used to locate O.-helices. Combina 0290 Gel-filtration -purified hSTAU1 SSM-RBD5 was tions of Autobuild, hand-building with Coot, and rounds of screened for crystal formation using the JCSG Core Suites refinement using Phenix at this and all Subsequent stages I-IV (QIAGEN: Lesley and Wilson, 2005) and a Mosquito yielded a low-resolution model of RBD5 and the SSM two robot. Using the sitting drop method and CrystalOuickTM C.-helices. A molecular-replacement (MR) search using this (Greiner) plates, 0.2 ul of protein in GF buffer (10 mMTris model, Phaser (McCoy et al., 2007), and the 1.7 ASSRL HCl pH 8, 100 mMNaCl, and 1.3 mM DTT) at 15 mg/ml dataset was unsuccessful. However, a solution was found (determined using the Bradford assay) was mixed with 0.2 ul using the 2.2 ACHESS dataset (Table 12). Following further of reservoir solution, which was 70 ul. Plates were covered refinement assisted by placing a homology model for RBD'5 with ClearSealFilmTM and incubated at 18° C. After four using I-TASSER (Roy et al., 2010), a MR solution was US 2013/0317087 A1 Nov. 28, 2013 44 obtained for the 1.7 ASSRL dataset and used the final stages (0309 Bond, C. S. (2003). TopDraw: a sketchpad for pro of refinement. Structure figures were generated using tein structure topology cartoons. Bioinformatics 19, 311 PyMOL (Schrödinger, LLC). 312. 0310 Bono, F., Ebert, J., Unterholzner, L., Guttler, T., Exmple 38 Izaurralde, E., and Conti, E. (2004). Molecular insights into the interaction of PYM with the Mago-Y14 core of the Western Blotting, RT-PCR and exonjunction complex. EMBO Rep. 5, 304-310. Immunoprecipitations 0311 Broadus, J., Fuerstenberg, S., and Doe, C. Q. 0296 Protein was electrophoresed in SDS-polyacryla (1998). Staufen-dependent localization of prospero mide, transferred to Hybond ECL nitrocellulose (Amer mRNA contributes to neuroblast daughter-cell fate. Nature sham), and probed with antibodies that recognize FLAG 391, 792-795. (Sigma), HA (Roche), calnexin (StressGen). UPF1 (Gong et 0312 Campbell, R. E., Tour, O., Palmer, A. E., Steinbach, al. 2009), STAU1, RFP (Abcam), GFP (Abeam) or STAU2 P.A., Baird, G.S., Zacharias, D.A., and Tsien, R.Y. (2002). (Sigma) Immunoreactivity was assessed using SuperSignal A monomeric red fluorescent protein. Proc. Natl. Acad. West Pico or Femto (Pierce Biotechnology). After autorad Sci. USA99, 7877-7882. iography, films were quantitated using ImageOuant (Molecu 0313 CCP4. (1994). The CCP4 suite: programs for pro lar Dynamics). tein crystallography. ActaCrystallogr. D. Biol. Crystallogr. 0297 Reverse transcriptions (RTs) and PCR amplifica 50, 760-763. tions were performed as previously described. RT-PCR prod 0314 Chan, C. C., Dostie, J., Diem, M. D., Feng, W., ucts were electrophoresed in 5% polyacrylamide and quanti Mann, M., Rappsilber, J., and Dreyfuss, G. (2004). eIF4A3 tated by Phosphorimaging (Molecular Dynamics). is a novel component of the exonjunction complex. RNA 10, 200-209. 0298 Immunoprecipitations were performed using anti 0315 Chen, C. Y. & Shyu, A. B. AU-rich elements: char GFP (Abeam), anti-HA (Roche) or anti-FLAG (Sigma). acterization and importance in mRNA degradation. Trends REFERENCES Biochem. Sci. 20, 465-470 (1995). 0316 Chen, L. L., DeCerbo, J. N., & Carmichael, G. G. 0299 Adams, P. D., Afonine, P.V., Bunkoczi, G., Chen, V. Alu element-mediated gene silencing. EMBO.J. 27, 1694 B., Davis, I. W. Echols, N., Headd, J. J., Hung, L. W., 1705 (2008). Kapral, G. J. Grosse-Kunstleve, R. W., et al. (2010). 0317 Chiu, S.Y. Lejeune, F. Ranganathan, A. C., and PHENIX: a comprehensive Python-based system for mac Maquat, L. E. (2004). The pioneer translation initiation romolecular structure solution. ActaCrystallogr. D. Biol. complex is functionally distinct from but structurally over Crystallogr. 66,213-221. laps with the steady-state translation initiation complex. 0300 Allison, R., Czaplinski, K., Git, A., Adegbenro, E., Genes Dev. 18, 745-754. Stennard, F., Houliston, E., and Standart, N. (2004). Two 0318 Cho, D. S., Yang, W., Lee, J. T., Shiekhattar, R., distinct Staufen isoforms in Xenopus are vegetally local Murray, J. M., and Nishikura, K. (2003). Requirement of ized during oogenesis. RNA 10, 1751-1763. dimerization for RNA editing activity of adenosine deami 0301 Amoutzias, G. D., Robertson, D. L., Van de Peer.Y., nases acting on RNA. J. BiolChem 278, 17093-17102. and Oliver, S. G. (2008). Choose your partners: dimeriza 0319 Cole, J. L. (2007). Activation of PKR: an open and tion in eukaryotic transcription factors. Trends Biochem shut case? Trends BiochemSci 32, 57-62. Sci 33, 220-229. 0320 Coller, J. M., Gray, N. K., and Wickens, M. P. 0302 Ashley, C. T., Jr., Wilkinson, K. D., Reines, D., & (1998). mRNA stabilization by poly(A) binding protein is Warren, S. T. FMR1 protein: conserved RNP family independent of poly(A) and requires translation. Genes domains and selective RNA binding. Science 262,563-566 Dev. 12, 3226-3235. (1993). 0321 Cordaux, R. & Batzer, M. A. The impact of ret 0303 Bachand, F., Triki, I., and Autexier, C. (2001). rotransposons on human genome evolution. Nat. Rev. Human telomerase RNA-protein interactions. Nucleic Genet. 10,691-703 (2009). Acids Res. 29, 3385-3393. 0322 Cowtan, K. (1998). Modified phased translation 0304 Barraud, P., Emmerth, S., Shimada, Y., Hotz, H. R., functions and their application to molecular-fragment Allain, F. H., and Buhler, M. (2011). An extended dsRBD location. ActaCrystallogr D. Biol. Crystallogr. 54, 750 with a novel zinc-binding motif mediates nuclear retention 756. of fission yeast Dicer. EMBO.J. 30, 4223-4235. 0323 Curatola, A. M., Nadal, M. S. & Schneider, R. J. 0305 Bartel, D. P. MicroRNAs: target recognition and Rapid degradation of AU-rich element (ARE) mRNAs is regulatory functions. Cell 136, 215-233 (2009). activated by ribosome transit and blocked by secondary 0306 Batzer, M. A. & Deininger, P. L. Alu repeats and structure at any position 5' to the ARE. Mol. Cell. Biol. 15, human genomic diversity. Nat. Rev. Genet. 3, 370-379 6331-6340 (1995). (2002). 0324 Donaldson, J. G., and Jackson, C. L. (2000). Regu 0307 Belgrader, P., and Maquat, L. E. (1994). Nonsense lators and effectors of the ARF GTPases. Curr. Opin. Cell but not missense mutations can decrease the abundance of Biol. 12, 475-482. nuclear mRNA for the mouse major urinary protein, while 0325 Duchaine, T., Wang, H.J., Luo, M., Steinberg, S.V., both types of mutations can facilitate exon skipping. Mol. Nabi, I. R., and DesGroseillers, L. (2000). A novel murine Cell. Biol. 14, 6326-6336. Staufen isoform modulates the RNA content of Staufen 0308 Binder, B. R. & Mihaly, J. The plasminogen activa complexes. Mol. Cell. Biol. 20, 5592-5601. tor inhibitor “paradox” in cancer. Immunol. Lett. 118, 116 0326 Duchaine, T. F., Hemraj, I., Furic, L., Deitinghoff, 124 (2008). A., Kiebler, M.A., and DesGroseillers, L. (2002). Staufen2 US 2013/0317087 A1 Nov. 28, 2013

isoforms localize to the Somatodendritic domain of neu pathways that contribute to myogenesis: effects on PAX3 rons and interact with different organelles. J. Cell Sci. 115, and myogenin mRNAs. Genes Dev. 23, 54-66. 3285-3295. 0343 Goodrich, J. S., Clouse, K. N., and Schupbach, T. 0327 Emsley, P. Lohkamp, B., Scott, W. G., and Cowtan, (2004). Hrb27C. Sqd and Otu cooperatively regulate K. (2010). Features and development of Coot. ActaCrystal gurken RNA localization and mediate nurse cell chromo logr. D. Biol. Crystallogr. 66,486-501. Some dispersion in Drosophila oogenesis. Development 0328 Engstrom, P. G. et al. Complex Loci in human and 131, 1949-1958. mouse genomes. PLoS Genet. 2, e47 (2006). (0344 Gorlach, M., Burd, C. G., and Dreyfuss, G. (1994). 0329 Ephrussi, A., Dickinson, L. K., and Lehmann, R. The mRNA poly(A)-binding protein: localization, abun (1991). Oskar organizes the germ plasm and directs local dance, and RNA-binding specificity. Exp. Cell Res. 211, ization of the posterior determinant nanos. Cell 66, 37-50. 400-407. 0330. Ferraiuolo, M.A., Lee, C. S. Ler, L. W., Hsu, J. L., 0345 Grentzmann, G., Ingram, J. A., Kelly, P. J., Gest Costa-Mattioli, M., Luo, M. J., Reed, R., and Sonenberg, eland, R. F., and Atkins, J. F. (1998). A dual-luciferase N. (2004). A nuclear translation-like factor eIF4AIII is reporter system for studying recoding signals. RNA 4. recruited to the mRNA during splicing and functions in 479–486. nonsense-mediated decay. Proc. Natl. Acad. Sci. USA 101, (0346 Guruprasad, K., Reddy, B. V., and Pandit, M. W. 41 18-4123. (1990). Correlation between stability of a protein and its 0331 Ferrandon, D., Elphick, L., Nusslein-Volhard, C. & dipeptide composition: a novel approach for predicting in St Johnston, D. Staufen protein associates with the 3'UTR vivo stability of a protein from its primary sequence. Pro of bicoid mRNA to form particles that move in a microtu tein Eng. 4, 155-161. bule-dependent manner. Cell 79, 1221-1232 (1994). 0347 Haase, A. D., Jaskiewicz, L., Zhang, H., Laine, S., 0332 Forch, P., Puig, O., Martinez, C., Seraphin, B. & Sack, R., Gatignol, A., and Filipowicz, W. (2005). TRBP, a Valcarcel, J. The splicing regulator TIA-1 interacts with regulator of cellular PKR and HIV-1 virus expression, U1-C to promote U1 snRNP recruitment to 5' splice sites. interacts with Dicer and functions in RNA silencing. EMBO.J. 21, 6882-6892 (2002). EMBO Rep. 6,961-967. 0333 Frischmeyer, P. A., and Dietz, H. C. (1999). Non 0348 Hachet, O., and Ephrussi, A. (2001). Drosophila sense-mediated mRNA decay in health and disease. Hum. Y14 shuttles to the posterior of the oocyte and is required Mol. Genet. 8, 1893-1900. for oskar mRNA transport. Curr. Biol. 11, 1666-1674. 0334) Fuerstenberg, S., Peng, C.Y., Alvarez-Ortiz, P., Hor, (0349 Hachet, O., and Ephrussi, A. (2004). Splicing of T., and Doe, C. Q. (1998). Identification of Miranda protein oskar RNA in the nucleus is coupled to its cytoplasmic domains regulating asymmetric cortical localization, cargo localization. Nature 428, 959-963. binding, and cortical release. Mol. Cell. Neurosci. 12,325 0350 Hall, T. A. (1999). BioEdit: a user-friendly biologi 339. cal sequence alignment editor and analysis program for 0335 Furic, L., Maher-Laporte, M., and DesGroseillers, Windows 95/98/NT. Nucl. Acids. Symp. Ser. 41,95-98 L. (2008). A genome-wide approach identifies distinct but 0351 Hammond, L. E., Rudner, D. Z., Kanaar, R., and overlapping subsets of cellular mRNAs associated with R10, D.C. (1997). Mutations in the hrp48 gene, which Staufen 1- and Staufen2-containing ribonucleoprotein encodes a Drosophila heterogeneous nuclear ribonucle complexes. RNA 14,324-335. oprotein particle protein, cause lethality and developmen 0336 Gan, J., Shaw, G., Tropea, J. E. Waugh, D.S., Court, tal defects and affect P-element third-intron splicing in D. L., and Ji, X. (2008). A stepwise model for double vivo. Mol. Cell. Biol. 17, 7260-7267. stranded RNA processing by ribonuclease III. Mol. Micro 0352 Hasler, J. & Strub, K. Alu elements as regulators of biol. 67, 143-154. gene expression. Nucleic Acids Res. 34, 5491-5497 0337 Gan, J., Tropea, J. E., Austin, B. P. Court, D. L., (2006). Waugh, D. S., and Ji, X. (2005). Intermediate states of 0353 Hentze, M. W., and Kulozik, A. E. (1999). A perfect ribonuclease III in complex with double-stranded RNA. message: RNA Surveillance and nonsense-mediated decay. Structure 13, 1435-1442. Cell 96, 307-310. 0338 Gatfield, D., Unterholzner, L., Ciccarelli, F. D., 0354) Hillman RT et al., 2004 An unappreciated role for Bork, P., and Izaurralde, E. (2003). Nonsense-mediated RNA Surveillance. Genome Biol. 5:R8. mRNA decay in Drosophila: at the intersection of the yeast 0355 Hitti, E. G., Sallacz, N. B., Schoft, V. K., and and mammalian pathways. EMBO J. 22, 3960-3970. Jantsch, M. F. (2004). Oligomerization activity of a 0339 Gehring, N. H., Neu-Yilik, G., Schell, T., Hentze, double-stranded RNA-binding domain. FEBS Lett 574, M. W., and Kulozik, A. E. (2003).Y14 and hUpf3b forman 25-30. NMD-activating complex. Mol. Cell. 11,939-949. 0356. Holm, L., and Rosenstrom, P. (2010). Dali server: 0340 Gibson, T. J., and Thompson, J. D. (1994). Detec conservation mapping in 3D. Nucleic Acids Res. 38, tion of dsRNA-binding domains in RNA helicase A and W545-549. Drosophila maleless: implications for monomeric RNA 0357 Inoue, K. Khajavi, M., Ohyama, T., Hirabayashi, helicases. Nucleic Acids Res. 22, 2552-2556. S., Wilson, J., Reggin, J. D., Mancias, P. Butler, I.J., 0341 Gong, C., Kim, Y. K., Woeller, C. F., Tang, Y. & Wilkinson, M. F. Wegner, M., and Lupski, J. R. (2004). Maquat, L. E. SMD and NMD are competitive pathways Molecular mechanism for distinct neurological pheno that contribute to myogenesis: effects on PAX3 and myo types conveyed by allelic truncating mutations. Nat. Genet. genin mRNAs. Genes Dev. 23, 54-66 (2009). 36,361-369. 0342 Gong, C., Kim, Y. K., Woeller, C. F., Tang, Y., and 0358 Ishigaki, Y., L1, X. Serin, G., and Maquat, L. E. Maquat, L. E. (2009). SMD and NMD are competitive (2001). Evidence for a pioneer round of mRNA translation: US 2013/0317087 A1 Nov. 28, 2013 46

mRNAS Subject to nonsense-mediated decay in mamma 0375 Kuwano, Y. et al. NF90 selectively represses the lian cells are bound by CBP80 and CBP20. Cell 106,607 translation of target mRNAS bearing an AU-rich signature 617. motif Nucleic Acids Res. 38, 225-238. 0359 Izaurralde, E. Lewis, J., McGuigan, C., Jankowska, 0376 Lau, C. K. Diem, M. D., Dreyfuss, G., and Van M., Darzynkiewicz, E., and Mattaj, I.W. (1994). A nuclear Duyne, G. D. (2003). Structure of the Y14-Magoh core of cap binding protein complex involved in pre-mRNA splic the exonjunction complex. Curr. Biol. 13, 933-941. ing. Cell 78,657-668. 0377 Le Hir, H., Gatfield, D., Izaurralde, E., and Moore, 0360 Kapranov, P. Willingham, A.T., & Gingeras, T. R. M.J. (2001). The exon-exonjunction complex provides a Genome-wide transcription and the implications for binding platform for factors involved in mRNA export and genomic organization. Nat. Rev. Genet. 8,413-423 (2007). nonsense-mediated mRNA decay. EMBO J. 20, 4987 0361 Kataoka, N., Yong, J., Kim, V. N., Velazquez, F., 4997. Perkinson, R. A. Wang, F., and Dreyfuss, G. (2000). Pre 0378 Le Hir, H., Izaurralde, E., Maquat, L.E., and Moore, mRNA splicing imprints mRNA in the nucleus with a M.J. (2000a). The spliceosome deposits multiple proteins novel RNA-binding protein that persists in the cytoplasm. 20-24 nucleotides upstream of mRNA exon-exon junc Mol. Cell. 6, 673-682. tions. EMBO.J. 19, 6860-6869. 0362 Kiebler, M.A., Hemraj, I., Verkade, P. Kohrmann, 0379 Le Hir, H., Moore, M.J., and Maquat, L. E. (2000b). M., Fortes, P., Marion, R. M., Ortin, J., and Dotti, C. G. Pre-mRNA splicing alters mRNP composition: evidence (1999). The mammalian staufen protein localizes to the for stable association of proteins at exon-exon junctions. Somatodendritic domain of cultured hippocampal neurons: Genes Dev. 14, 1098-1108. implications for its involvement in mRNA transport. J. (0380 Le, S., Sternglanz, R., and Greider, C. W. (2000). Neurosci. 19, 288-297. Identification of two RNA-binding proteins associated 0363 Kim, H. H. et al. HuR recruits let-7/RISC to repress with human telomerase RNA. Mol. Biol. Cell 11, 999 c-Myc expression. Genes Dev. 23, 1743-1748 (2009). 1010. 0364 Kim, V. N. Kataoka, N., and Dreyfuss, G. (2001). 0381 Lee, C. M., Haun, R. S., Tsai, S. C., Moss, J., and Role of the nonsense-mediated decay factor hUpf3 in the Vaughan, M. (1992). Characterization of the human gene splicing-dependent exon-exonjunction complex. Science encoding ADP-ribosylation factor 1, a guanine nucleotide binding activator of cholera toxin. J. Biol. Chem. 267, 293, 1832-1836. 9028-9034. 0365 Kim, Y. K., Lee, S. H., Kim, C. S., Seol, S. K., and 0382 Lejeune, F. Ishigaki, Y., L1, X., and Maquat, L. E. Jang, S. K. RNA. (2003). Long-range RNA-RNA interac (2002). The exonjunction complex is detected on CBP80 tion between the 5' nontranslated region and the core bound but not eIF4E-bound mRNA in mammalian cells: coding sequences of hepatitis C virus modulates the IRES dynamics of mRNP remodeling. EMBO.J. 21, 3536-3545. dependent translation. RNA 9, 599–606. 0383 Lejeune, F., Li, X., and Maquat, L. E. (2003). Non 0366 Kim, Y.K. et al. Staufen1 regulates diverse classes sense-mediated mRNA decay in mammaliancells involves of mammalian transcripts. EMBO.J. 26, 2670–2681 (2007). decapping, deadenylating, and exonucleolytic activities. 0367 Kim, Y. K. Furic, L., Desgroseillers, L., and Mol. Cell. 12, 675-687. Maquat, L. E. (2005). Mammalian Staufen1 recruits Upf1 (0384 Lesley, S.A., and Wilson, I. A. (2005). Protein pro to specific mRNA3'UTRs so as to elicit mRNA decay. Cell duction and crystallization at the joint center for structural 120, 195-208. genomics. J StructFunct Genomics 6, 71-79. 0368. Kim, Y. K. Furic, L., Parisien, M., Major, F. Des (0385 Li, P., Yang, X. Wasser, M., Cai, Y., and Chia, W. Groseillers, L., and Maquat, L. E. (2007). Staufen1 regu (1997). Inscuteable and Staufen mediate asymmetric local lates diverse classes of mammalian transcripts. EMBO J. ization and segregation of prospero RNA during Droso 26, 2670–2681. phila neuroblast cell divisions. Cell 90, 437-447. 0369. Kim-Ha, J., Kerr, K., and Macdonald, P. M. (1995). (0386 Li, S., and Wilkinson, M. F. (1998). Nonsense sur Translational regulation of oskar mRNA by bruno, an ova veillance in lymphocytes? Immunity 8, 135-141. rian RNA-binding protein, is essential. Cell 81, 403-412. (0387 Li, W., Simarro, M., Kedersha, N. & Anderson, P. 0370 Kim-Ha, J., Smith, J. L., and Macdonald, P. M. FAST is a survival protein that senses mitochondrial stress (1991). Oskar mRNA is localized to the posterior pole of and modulates TIA-1-regulated changes in protein expres the Drosophila oocyte. Cell 66, 23-35. sion. Mol. Cell. Biol. 24, 10718-10732 (2004). 0371 Kohrmann, M., Luo, M., Kaether, C. Des 0388 Liang, C. C., Park, A. Y., & Guan, J. L. In vitro Groseillers, L., Dotti, C. G., and Kiebler, M. A. (1999). scratch assay: a convenient and inexpensive method for Microtubule-dependent recruitment of Staufen-green fluo analysis of cell migration in vitro. Nat. Protoc. 2, 329-333 rescent protein into large RNA-containing granules and (2007). Subsequent dendritic transport in living hippocampal neu (0389 Lieutaud, P., Canard, B., and Longhi, S. (2008). rons. Mol. Biol. Cell 10, 2945-2953. MeDor: a metaserver for predicting protein disorder. BMC 0372 Krause, S., Fakan, S., Weis, K., and Wahle, E. Genomics 9 Suppl 2, S25. (1994) Immunodetection of poly(A) binding protein II in 0390 Luo, M. L., Zhou, Z. Magni, K., Christoforides, C., the cell nucleus. Exp. Cell Res. 214, 75-82. Rappsilber, J., Mann, M., and Reed, R. (2001). Pre-mRNA 0373) Krichevsky, A. M., and Kosik, K. S. (2001). Neu splicing and mRNA export linked by direct interactions ronal RNA granules: a link between RNA localization and between UAP56 and Aly. Nature. 413, 644-647. stimulation-dependent translation. Neuron 32, 683-696. 0391 Luo, M., Duchaine, T. F., and DesGroseillers, L. 0374 Krissinel, E., and Henrick, K. (2007). Inference of (2002). Molecular mapping of the determinants involved in macromolecular assemblies from crystalline state. J. Mol. human Staufen-ribosome association. Biochem. J. 365, Biol. 372, 774-797. 817-824. US 2013/0317087 A1 Nov. 28, 2013 47

0392 Lykke-Andersen, J., Shu, M. D., and Steitz, J. A. 04.06 Miki, T., Takano, K., andYoneda.Y. (2005). The role (2000). Human Upf proteins target an mRNA for non of mammalian Staufen on mRNA traffic: a view from its sense-mediated decay when bound downstream of a termi nucleocytoplasmic shuttling function. Cell Struct. Funct. nation codon. Cell 103, 1121-1131. 30, 51-56. 0393 Lykke-Andersen, J., Shu, M. D., and Steitz, J. A. (0407 Mohr, S. E., Dillon, S.T., and Boswell, R. E. (2001). (2001). Communication of the position of exon-exonjunc The RNA-binding protein Tsunagi interacts with Mago tions to the mRNA surveillance machinery by the protein Nashi to establish polarity and localize oskar mRNA dur RNPS1. Science 293, 1836-1839. ing Drosophila oogenesis. Genes Dev. 15, 2886-2899. 0394 Macchi, P. Kroening, S. Palacios, I. M., Baldassa, 0408 Monshausen, M., Putz, U., Rehbein, M., Schweizer, S. Grunewald, B., Ambrosino, C., Goetze, B., Lupas, A., M., DesGroseillers, L., Kuhl, D., Richter, D., and Kindler, St Johnston, D., and Kiebler, M. (2003). BarentsZ, a new S. (2001). Two rat brain staufen isoforms differentially component of the Staufen-containing ribonucleoprotein bind RNA. J. Neurochem. 76, 155-165. particles in mammalian cells, interacts with Staufen in an 04.09 Moriarty, P. M., Reddy, C. C., and Maquat, L. E. RNA-dependent manner. J. Neurosci. 23,5778-5788. (1998). Selenium deficiency reduces the abundance of 0395. Mallardo, M., Deitinghoff, A., Muller, J., Goetze, mRNA for Se-dependent glutathione peroxidase 1 by a B., Macchi, P., Peters, C., and Kiebler, M.A. (2003). Iso UGA-dependent mechanism likely to be nonsense codon lation and characterization of Staufen-containing ribo mediated decay of cytoplasmic mRNA. Mol. Cell. Biol. nucleoprotein particles from rat brain. Proc. Natl. Acad. 18, 2932-2939. Sci. USA 100, 2100-2105. 0410 Mouland, A. J., Mercier, J., Luo, M., Bernier, L., 0396 Maquat, L. E. (2004a). Nonsense-mediated mRNA DesGroseillers, L., and Cohen, E. A. (2000). The double decay : A comparative analysis of different species. Curr. stranded RNA-binding protein Staufen is incorporated in Genomics 5, 175-190. human immunodeficiency virus type 1: evidence for a role 0397 Maquat, L. E. (2004b). Nonsense-mediated mRNA in genomic RNA encapsidation. J. Virol. 74,5441-5451. decay: Splicing, translation and mRNP dynamics. Nat. 0411 Nagy, E., and Maquat, L. E. (1998). A rule for ter Rev. Mol. Cell. Biol. 5, 89-99. mination-codon position within intron-containing genes: 0398 Maquat, L. E., and Gong, C. (2009). Gene expres when nonsense affects RNA abundance. Trends Biochem. sion networks: competing mRNA decay pathways in mam Sci. 23, 198-199. 0412 Ohashi, S. Koike, K., Omori, A., Ichinose, S., malian cells. BiochemSoc. Trans 37, 1287-1292. Ohara, S. Kobayashi, S., Sato, T.A., and Anzai, K. (2002). 0399 Marchler-Bauer, A., Lu, S., Anderson, J. B., Chit Identification of mRNA/protein (mRNP) complexes con saz, F., Derbyshire, M. K., DeWeese-Scott, C., Fong, J. H., taining Puralpha, mStaufen, fragile X protein, and myosin Geer, L. Y., Geer, R. C., Gonzales, N. R. et al. (2011). Va and their association with rough endoplasmic reticulum CDD: a Conserved Domain Database for the functional equipped with a kinesin motor. J. Biol. Chem. 277.37804 annotation of proteins. Nucleic AcidsRes. 39, D225-229. 3781O. 0400 Marion, R. M., Fortes, P., Beloso, A., Dotti, C., and 0413 Otwinowski, Z., Minor, W. (1997). Processing of Ortin, J. (1999). A human sequence homologue of Staufen X-ray Diffraction Data Collected in Oscillation Mode. is an RNA-binding protein that is associated with poly Method. Enzymol. 276,307-326. Somes and localizes to the rough endoplasmic reticulum. 0414 Pal, M., Ishigaki, Y., Nagy, E., and Maquat, L. E. Mol. Cell. Biol. 19, 2212-2219. (2001). Evidence that phosphorylation of human Upf1 pro 0401 Martel, C., Dugre-Brisson, S., Boulay, K., Breton, tein varies with intracellular location and is mediated by a B., Lapointe, G., Armando, S., Trepanier, V., Duchaine, T., wortmannin-sensitive and rapamycin-sensitive PI 3-ki Bouvier, M., and Desgroseillers, L. (2010). Multimeriza nase-related kinase signaling pathway. RNA 7, 5-15. tion of Staufen 1 in live cells. RNA 16, 585-597. 0415 Palacios, I. M., Gatfield, D., St Johnston, D., and 0402 Mathews, D. H., Sabina, J., Zuker, M., & Turner, D. Izaurralde, E. (2004). An eIF4AIII-containing complex H. Expanded sequence dependence of thermodynamic required for mRNA localization and nonsense-mediated parameters improves prediction of RNA secondary struc mRNA decay. Nature 427, 753-757. ture. J. Mol. Biol. 288,911-940 (1999). 0416 Pang, K. C. et al. RNAdb 2.0-an expanded database 0403. Matsuzaki, F., Ohshiro, T., Ikeshima-Kataoka, H., of mammalian non-coding RNAs. Nucleic Acids Res. 35, and Izumi, H. (1998). miranda localizes staufen and pros D178-182 (2007). pero asymmetrically in mitotic neuroblasts and epithelial 0417 Papworth, C., Bauer, J. C., Braman, J., and Wright, cells in early Drosophila embryogenesis. Development D. A. (1996). Site directed mutagenesis in one day with 125,4089-4098. >80% efficiency. Strategies 3, 3-4. 0404 McCoy, A. J., Grosse-Kunstleve, R. W., Adams, P. 0418 Parker, G. S., Maity, T. S., and Bass, B. L. (2008). D., Winn, M. D., Storoni, L. C., and Read, R. J. (2007). dsRNA binding properties of RDE-4 and TRBP reflect Phaser crystallographic software. J ApplCrystallogr. 40, their distinct roles in RNAi. J. Mol. Biol. 384,967-979. 658-674. Mendell, J.T., Sharifi, N.A., Meyers, J. L., Mar 0419 Peng, S. S., Chen, C. Y. & Shyu, A. B. Functional tinez-Murillo, F. & Dietz, H. C. Nonsense surveillance characterization of a non-AUUUA AU-rich element from regulates expression of diverse classes of mammalian tran the c-jun proto-oncogene mRNA: evidence for a novel scripts and mutes genomic noise. Nat. Genet. 36, 1073 class of AU-rich elements. Mol. Cell. Biol. 16, 1490-1499 1078 (2004). (1996). 0405 Micklem, D. R., Adams, J., Grunert, S., and St 0420 Philo, J. S. (2000). A method for directly fitting the Johnston, D. (2000). Distinct roles of two conserved time derivative of sedimentation velocity data and an alter Staufen domains in oskar mRNA localization and transla native algorithm for calculating sedimentation coefficient tion. EMBO J. 19, 1366-1377. distribution functions. Anal Biochem 279,151-163. US 2013/0317087 A1 Nov. 28, 2013 48

0421) Philo, J. S. (2006). Improved methods for fitting 0437 St Johnston, D., Beuchle, D., and Nusslein-Volhard, sedimentation coefficient distributions derived by time C. (1991). Staufen, a gene required to localize maternal derivative techniques. Anal Biochem 354, 238-246. RNAs in the Drosophila egg. Cell 66, 51-63. 0422 Piecyk, M. etal. TIA-1 is a translational silencer that 0438 St Johnston, D., Brown, N. H., Gall, J. G., and selectively regulates the expression of TNF-alpha. EMBO Jantsch, M. (1992). A conserved double-stranded RNA J. 19, 4154-4163 (2000). binding domain. Proc. Natl. Acad. Sci. USA 89, 10979 0423 Providence, K. M. et al. SERPINE1 (PAI-1) is 10983. deposited into keratinocyte migration “trails” and required 0439 Stafford, W. F., and Sherwood, P.J. (2004). Analysis for optimal monolayer wound repair. Arch. Dermatol. Res. of heterologous interacting systems by sedimentation 300, 303-310 (2008). Velocity: curve fitting algorithms for estimation of sedi 0424 Ramos, A., Grunert, S., Adams, J., Micklem, D. R., mentation coefficients, equilibrium and kinetic constants. Proctor, M. R., Freund, S., Bycroft, M., St Johnston, D., BiophysChem 108, 231-243. and Varani, G. (2000). RNA recognition by a Staufen double-stranded RNA-binding domain. EMBO.J. 19,997 0440 Stefl, R., Oberstrass, F.C., Hood, J. L., Jourdan, M., 1009. Zimmermann, M., Skrisovska, L., Maris, C., Peng, L., 0425 Roy, A., Kucukural, A., and Zhang, Y. (2010). Hofr, C., Emeson, R. B., and Allain, F. H. (2010). The I-TASSER: a unified platform for automated proteinstruc solution structure of the ADAR2 dsRBM-RNA complex ture and function prediction. Nat. Protoc. 5, 725-738. reveals a sequence-specific readout of the minor groove. 0426 Ryter, J. M., and Schultz, S. C. (1998). Molecular Cell 143, 225-237. basis of double-stranded RNA-protein interactions: struc 0441 Sun, X. Perlick, H. A., Dietz, H. C., and Maquat, L. ture of a dsRNA-binding domain complexed with dsRNA. E. (1998). A mutated human homologue to yeast Upf1 EMBO.J. 17,7505-7513. protein has a dominant-negative effect on the decay of 0427 Schuck, P. (2000). Size-distribution analysis of nonsense-containing mRNAS in mammalian cells. Proc. macromolecules by sedimentation Velocity ultracentrifu Natl. Acad. Sci. USA 95, 10009-10014. gation and lamm equation modeling. Biophys J78, 1606 0442 Tange, T. O., Nott, A. & Moore, M. J. The ever 1619. increasing complexities of the exon junction complex. 0428 Schuldt, A.J., Adams, J.H., Davidson, C.M., Mick Curr. Opin. Cell Biol. 16, 279-284 (2004). lem, D. R., Haseloff, J., St Johnston, D., and Brand, A. H. 0443 Terwilliger, T.C. (2000). Maximum-likelihoodden (1998). Miranda mediates asymmetric protein and RNA sity modification. ActaCrystallogr. D. Biol. Crystallogr. localization in the developing nervous system. Genes Dev. 56,965-972. 12, 1847-1857. 0444 Terwilliger, T. C. Grosse-Kunstleve, R. W., Afo 0429 Serin, G., Gersappe, A., Black, J. D., Aronoff, R., nine, P. V., Moriarty, N. W., Zwart, P. H., Hung, L. W., and Maquat, L. E. (2001). Identification and characteriza Read, R. J., and Adams, P. D. (2008). Iterative model tion of human orthologues to Saccharomyces cerevisiae building, structure refinement and density modification Upf2 protein and Upf3 protein (Caenorhabditis elegans with the PHENIX AutoBuild wizard. ActaCrystallogr. D. SMG-4). Mol. Cell. Biol. 21, 209-223. Biol. Crystallogr. 64, 61-69. 0430 Shcherbo, D., Merzlyak, E. M., Chepurnykh, T. V., 0445 Thompson, J. D., Higgins, D. G., and Gibson, T. J. Fradkov, A. F., Ermakova, G. V., Solovieva, E. A., Luky (1994). CLUSTAL W: improving the sensitivity of pro anov, K.A., Bogdanova, E. A., Zaraisky, A.G., Lukyanov, gressive multiple sequence alignment through sequence S., and Chudakov, D. M. (2007). Bright far-red fluorescent weighting, position-specific gap penalties and weight protein for whole-body imaging. Nat Methods 4, 741-746. matrix choice. Nucleic Acids Res. 22, 4673-4680. 0431 Shen, C. P. Knoblich, J. A., Chan, Y. M., Jiang, M. 0446 Tian, B., Bevilacqua, P. C., Diegelman-Parente, A., M. Jan, L. Y., and Jan, Y. N. (1998). Miranda as a multi domain adapter linking apically localized Inscuteable and and Mathews, M. B. (2004). The double-stranded-RNA basally localized Staufen and Prospero during asymmetric binding motif interference and much more. Nat. Rev. Mol. cell division in Drosophila. Genes Dev. 12, 1837-1846. Cell. Biol. 5, 1013-1023. 0432. Shetty, S. & Idell, S. Posttranscriptional regulation 0447 Valente, L., and Nishikura, K. (2007). RNA bind of plasminogen activator inhibitor-1 in human lung carci ing-independent dimerization of adenosine deaminases noma cells in vitro. Am. J. Physiol. Lung Cell Mol. Physiol. acting on RNA and dominant negative effects of nonfunc 278, L148-156 (2000). tional subunits on dimer functions. J BiolChem 282, 0433 Shibuya, T., Tange, T.O., Sonenberg, N., and Moore, 16054-16061 M.J. (2004). eIF4AIII binds spliced mRNA in the exon 0448 van Eeden, F. J., Palacios, I. M., Petronczki, M., junction complex and is essential for nonsense-mediated Weston, M. J., and St Johnston, D. (2001). BarentsZ, is decay. Nat. Struct. Mol. Biol. 11,346-351. essential for the posterior localization of oskar mRNA and 0434 Siebel, C. W., Kanaar, R., and R10, D. C. (1994). colocalizes with it to the posterior pole. J. Cell. Biol. 154, Regulation of tissue-specific P-element pre-mRNA splic 511-523. ing requires the RNA-binding protein PSI. Genes Dev 8, 0449 Villace, P., Marion, R. M., and Ortin, J. (2004). The 1713-1725. composition of Staufen-containing RNA granules from 0435 Slabinski, L., Jaroszewski, L., Rychlewski, L., Wil human cells indicates their role in the regulated transport son, I.A., Lesley, S.A., and Godzik, A. (2007). XtalPred: a and translation of messenger RNAs. Nucleic Acids Res. web server for prediction of protein crystallizability. Bio 32, 2411-2420. informatics 23, 34.03-3405. 0450 Walters, R. D., Kugel, J. F., & Goodrich, J. A. 0436 St Johnston, D. (1995). The intracellular localiza InVAluable junk: the cellular impact and function of Alu tion of messenger RNAs. Cell 81, 161-170. and B2 RNAs. IUBMB Life 61,831-837 (2009). US 2013/0317087 A1 Nov. 28, 2013 49

0451 Wang, Z., Jiao, X. Carr-Schmid, A. & Kiledjian, M. 0458 Yamashita, S., Nagata, T., Kawazoe, M., Takemoto, The hDcp2 protein is a mammalian mRNA decapping C., Kigawa, T., Guntert, P. Kobayashi, N., Terada, T., enzyme. Proc. Natl. Acad. Sci. USA 99, 12663-12668 Shirouzu, M., Wakiyama, M., et al. Structures of the first (2002). and second double-stranded RNA-binding domains of human TAR RNA-binding protein. Protein Sci. 20, 118 0452 Wickham, L., Duchaine, T., Luo, M., Nabi, I.R., and 130. DesGroseillers, L. (1999). 0459 Yang, S. W., Chen, H. Y., Yang, J., Machida, S., 0453 Mammalian staufen is a double-stranded-RNA- and Chua, N. H., and Yuan, Y.A. (2010). Structure of Arabi tubulin-binding protein which localizes to the rough endo dopsis HYPONASTICLEAVES1 and its molecular impli plasmic reticulum. Mol. Cell. Biol. 19, 2220-2230. cations for miRNA processing. Structure 18, 594-605. 0454) Wilusz. C. J., Wang, W., and Peltz, S. W. (2001). 0460 Yulug, I. G., Yulug, A., & Fisher, E. M. The fre Curbing the nonsense: the activation and regulation of quency and position of Alu repeats in cDNAs, as deter mRNA surveillance. Genes Dev. 15, 2781-2785. mined by database searching. Genomics 27, 544-548 (1995). 0455 Wilusz, J. E., Sunwoo, H., & Spector, D. L. Long 0461) Zhang, J. et al. RCP is a human breast cancer-pro noncoding RNAs: functional surprises from the RNA moting gene with Ras-activating function. J. Clin. Invest. world. Genes Dev. 23, 1494-1504 (2009). 119, 2171-2183 (2009). 0456 Wodicka, L., Dong, H., Mittmann, M., Ho, M. H., 0462 Zhang, J., Sun, X., Qian, Y., and Maquat, L. E. and Lockhart, D. J. (1997). Genome-wide expression (1998). Intron function in the nonsense-mediated decay of monitoring in Saccharomyces cerevisiae. Nat. Biotechnol. beta-globin mRNA: indications that pre-mRNA splicing in 15, 1359–1367. the nucleus can influence mRNA translation in the cyto 0457 Xia, T. et al. Thermodynamic parameters for an plasm. RNA 4, 801-815. expanded nearest-neighbor model for formation of RNA 0463 Zuker, M. Mfold web server for nucleic acid folding duplexes with Watson-Crick base pairs. Biochemistry 37, and hybridization prediction. Nucleic Acids Res. 31,3406 14719-14735 (1998). 3415 (2003).

Staufen1 (Stau1) (Genbank No: BC050432) nucleotide sequence SEO ID NO: 1 aaccacttaa cct ct cagaa citgaacaaag acaa.cattgttcc toggaacg ccct citttitt 61 aaaaaaaggt agaactittag actt catago actgaattaa cct gcactgaaagctgttta 121 cctdcatttgttcactitttgttgaaagtga ccatgtctica agttcaagtg caagttcaga 181 acccatctgc tigct ct ct ca gggagccaaa tactgaacaa gaaccagt ct cittct ct cac 241 agcc tittgat gagtatt cct tc tact act a gct citctgcc citctgaaaat gcagg tagac 301 cc attcaaan citctgctitta cc ct ctdcat citattacatc. caccagtgca gctgcagaaa 361 goat aacc cc tact.gtagaa ctaaatgcac tdtgcatgaa acttggaaaa aaaccaatgt 421 ataagcctgt tdaccc.ttac totcggatgc agtic caccita taactacaac atgagaggag 481 gtgctitat co cocgagg tac titttacccat titccagttcc acctitt actt tat caagtgg 541 aactittctgt gggaggacag caatttaatg gcaaaggaaa gacaagacag gctg.cgaaac 601 acgatgctgc tigccaaag.cg ttgaggat.cc to agaatga gcc cctgcca gagaggctgg 661 aggtgaatgg aagagaatcc galagaagaaa atct caataa atctgaaata agt caagtgt 721 ttgagattgc acttaaacgg aacttgcctg. taattitcga ggtggc.ccgg gagagtggcc 781 cacccCacat galagaactitt gtgaccalagg tttcggttgg ggagtttgttgggggalaggtg 841 aagggaaaag caagaagatt to aaagaaaa atgcc.gc.cat agctgttctt gaggagctga 901 agaagttacc gcc.cct gcct gcagttgaac gagtaaagcc tagaatcaaa aagaaaacaa 961 aaccolatagt caa.gc.cacag acaag.cccag aatatggcca ggggat caat cogattagcc 1021 gactggcc.ca gatc.ca.gcag gcaaaaaagg agaaggagcc agagtacacg ct cct cacag 1081 agcgaggcct cocgc.gc.cgc agggagtttgttgatgcaggt galaggttgga aaccacactg 1141 Cagaaggaac gggg accaac aagaaggtgg C caa.gc.gcaa to agc.cgag alacatgctgg 1201 agat.ccttgg ttt caaagtic cc.gcaggcgc agcc caccala accc.gc actic aagttcagagg 1261 agaaga cacc cataaagaaa cc aggggatg galagaaaagt aaccttittitt galacctggct 1321 ctggggatga aaatgggact agtaataaag aggatgagtt Caggatgcct tat ctaagtic

US 2013/0317087 A1 Nov. 28, 2013 53

- Continued

22 Os. FEATURE: <223> OTHER INFORMATION: Description of artificial sequence note = synthetic construct

<4 OOs, SEQUENCE: 2

Met Ser Glin Wall Glin Wall Glin Wall Glin Asn. Pro Ser Ala Ala Lieu. Ser 1. 5 1O 15 Gly Ser Glin Ile Lieu. Asn Lys Asn Glin Ser Lieu Lleu Ser Glin Pro Lieu. 2O 25 3O Met Ser Ile Pro Ser Thr Thr Ser Ser Leu Pro Ser Glu Asn Ala Gly 35 4 O 45 Arg Pro Ile Glin Asn Ser Ala Leu Pro Ser Ala Ser Ile Thr Ser Thr SO 55 6 O

Ser Ala Ala Ala Glu Ser Ile Thr Pro Thr Wall Glu Lieu. Asn Ala Lieu 65 70 7s 8O Cys Met Lys Lieu. Gly Lys Llys Pro Met Tyr Llys Pro Val Asp Pro Tyr 85 90 95 Ser Arg Met Glin Ser Thr Tyr Asn Tyr Asn Met Arg Gly Gly Ala Tyr 1OO 105 11 O Pro Pro Arg Tyr Phe Tyr Pro Phe Pro Val Pro Pro Leu Lieu. Tyr Glin 115 12 O 125 Val Glu Lieu. Ser Val Gly Gly Glin Glin Phe Asn Gly Lys Gly Lys Thr 13 O 135 14 O Arg Glin Ala Ala Lys His Asp Ala Ala Ala Lys Ala Lieu. Arg Ile Lieu. 145 150 155 160 Glin Asn. Glu Pro Lieu Pro Glu Arg Lieu. Glu Val Asn Gly Arg Glu Ser 1.65 17O 17s Glu Glu Glu Asn Lieu. Asn Llys Ser Glu Ile Ser Glin Val Phe Glu Ile 18O 185 19 O Ala Lieu Lys Arg Asn Lieu Pro Val Asn. Phe Glu Val Ala Arg Glu Ser 195 2OO 2O5 Gly Pro Pro His Met Lys Asn Phe Val Thr Llys Val Ser Val Gly Glu 21 O 215 22O Phe Val Gly Glu Gly Glu Gly Lys Ser Lys Lys Ile Ser Lys Lys Asn 225 23 O 235 24 O Ala Ala Ile Ala Val Lieu. Glu Glu Lieu Lys Llys Lieu Pro Pro Lieu Pro 245 250 255 Ala Val Glu Arg Val Llys Pro Arg Ile Llys Llys Llys Thr Llys Pro Ile 26 O 265 27 O Val Llys Pro Gln Thr Ser Pro Glu Tyr Gly Glin Gly Ile Asin Pro Ile 27s 28O 285 Ser Arg Lieu Ala Glin Ile Glin Glin Ala Lys Lys Glu Lys Glu Pro Glu 29 O 295 3 OO Tyr Thr Lieu. Lieu. Thr Glu Arg Gly Lieu Pro Arg Arg Arg Glu Phe Val 3. OS 310 315 32O Met Glin Val Llys Val Gly Asn His Thr Ala Glu Gly Thr Gly Thr Asn 3.25 330 335 Llys Llys Val Ala Lys Arg Asn Ala Ala Glu Asn Met Lieu. Glu Ile Lieu. 34 O 345 35. O Gly Phe Llys Val Pro Glin Ala Glin Pro Thr Llys Pro Ala Leu Lys Ser 355 360 365 Glu Glu Lys Thr Pro Ile Llys Llys Pro Gly Asp Gly Arg Llys Val Thr 37 O 375 38O US 2013/0317087 A1 Nov. 28, 2013 54

- Continued

Phe Phe Glu Pro Gly Ser Gly Asp Glu Asin Gly Thr Ser Asn Lys Glu 385 390 395 4 OO Asp Glu Phe Arg Met Pro Tyr Lieu Ser His Glin Gln Leu Pro Ala Gly 4 OS 41O 415 Ile Leu Pro Met Val Pro Glu Val Ala Glin Ala Val Gly Val Ser Glin 42O 425 43 O Gly His His Thir Lys Asp Phe Thr Arg Ala Ala Pro Asn Pro Ala Lys 435 44 O 445 Ala Thr Val Thir Ala Met Ile Ala Arg Glu Lieu. Lieu. Tyr Gly Gly Thr 450 45.5 460 Ser Pro Thr Ala Glu Thir Ile Leu Lys Asn Asn Ile Ser Ser Gly His 465 470 47s 48O Val Pro His Gly Pro Lieu. Thir Arg Pro Ser Glu Gln Lieu. Asp Tyr Lieu. 485 490 495 Ser Arg Val Glin Gly Phe Glin Val Glu Tyr Lys Asp Phe Pro Lys Asn SOO 505 51O Asn Lys Asn Glu Phe Val Ser Lieu. Ile Asn Cys Ser Ser Glin Pro Pro 515 52O 525 Lieu. Ile Ser His Gly Ile Gly Lys Asp Val Glu Ser Cys His Asp Met 53 O 535 54 O Ala Ala Lieu. Asn. Ile Lieu Lys Lieu. Lieu. Ser Glu Lieu. Asp Glin Glin Ser 5.45 550 555 560 Thr Glu Met Pro Arg Thr Gly Asn Gly Pro Met Ser Val Cys Gly Arg 565 st O sts

<210s, SEQ ID NO 3 &211s LENGTH: 290 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of artificial sequence note = synthetic construct

<4 OOs, SEQUENCE: 3 ggc.cgggcgc ggtggcticac gcctgtaatc C cagc actitt gggaggc.cga ggcgggcgga 6 O t cacct gagg tdaggagttc gagaccagcc tigccaa.cat ggtgaaaccc ct ct ct act 12 O aaaaatacaa aaattagc.cg ggcgtggtgg cc.gc.gc.ctg taatcc.ca.gc tact.cgggag 18O gctgaggcag gagaatcgct taac ccggg aggcggaggit to agtgagc cgagat.cgc.g 24 O

C Cactgcact C cagoctggg cacagagcg agacticcgtc. tcaaaaaaaa 29 O

<210s, SEQ ID NO 4 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of artificial sequence note = synthetic construct

<4 OOs, SEQUENCE: 4 Cttgaaagct Cagaacticgg 2O

<210s, SEQ ID NO 5 &211s LENGTH: 2O &212s. TYPE: DNA US 2013/0317087 A1 Nov. 28, 2013 55

- Continued <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of artificial sequence note = synthetic construct

<4 OOs, SEQUENCE: 5 t cagc.ccc.cg acggtct citc 2O

<210s, SEQ ID NO 6 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of artificial sequence note = synthetic construct

<4 OOs, SEQUENCE: 6 accgc.caatc gcaaggcacc 2O

<210s, SEQ ID NO 7 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of artificial sequence note = synthetic construct

<4 OO > SEQUENCE: 7 gctgatctoa tocttgttcc 2O

<210s, SEQ ID NO 8 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of artificial sequence note = synthetic construct

<4 OOs, SEQUENCE: 8 aagtggct at gct caaaatg 2O

<210s, SEQ ID NO 9 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of artificial sequence note = synthetic construct

<4 OOs, SEQUENCE: 9 ttcaggcact ttacct coac 2O

<210s, SEQ ID NO 10 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of artificial sequence note = synthetic construct

<4 OOs, SEQUENCE: 10 ccttgacctt gggitttcaac 2O

<210s, SEQ ID NO 11 &211s LENGTH: 2O US 2013/0317087 A1 Nov. 28, 2013 56

- Continued

&212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of artificial sequence note = synthetic construct

<4 OOs, SEQUENCE: 11 atttgcaatig gaa.gc.ctttg 2O

<210s, SEQ ID NO 12 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of artificial sequence note = synthetic construct

<4 OOs, SEQUENCE: 12 tgtgctgt at gagaagaacc 2O

<210s, SEQ ID NO 13 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of artificial sequence note = synthetic construct

<4 OOs, SEQUENCE: 13 gctt catcct tct tattagc 2O

<210s, SEQ ID NO 14 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of artificial sequence note = synthetic construct

<4 OOs, SEQUENCE: 14 gactggc.cag atgctctgg 2O

<210s, SEQ ID NO 15 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of artificial sequence note = synthetic construct

<4 OOs, SEQUENCE: 15 atctttggga agcggctatc 2O

<210s, SEQ ID NO 16 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of artificial sequence note = synthetic construct

<4 OOs, SEQUENCE: 16 c catggc.cag caccatttico 2O

<210s, SEQ ID NO 17 US 2013/0317087 A1 Nov. 28, 2013 57

- Continued

&211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of artificial sequence note = synthetic construct

<4 OOs, SEQUENCE: 17 acct cqgc.cg cgtgcagctic 2O

<210s, SEQ ID NO 18 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of artificial sequence note = synthetic construct

<4 OOs, SEQUENCE: 18 t cct tcctgc gagcc.ctgag 2O

<210s, SEQ ID NO 19 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of artificial sequence note = synthetic construct

<4 OOs, SEQUENCE: 19 gcactgctgc catgtc.tttg 2O

<210s, SEQ ID NO 2 O &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of artificial sequence note = synthetic construct

<4 OOs, SEQUENCE: 2O tgcaat catt gaggattgttg 2O

<210s, SEQ ID NO 21 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of artificial sequence note = synthetic construct

<4 OOs, SEQUENCE: 21 Cactgtcaag tatgtctic 2O

<210s, SEQ ID NO 22 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of artificial sequence note = synthetic construct

<4 OOs, SEQUENCE: 22 gacagagacg taagcactg 2O US 2013/0317087 A1 Nov. 28, 2013 58

- Continued <210s, SEQ ID NO 23 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of artificial sequence note = synthetic construct

<4 OOs, SEQUENCE: 23 c cataaatgt togctittatcc 2O

<210s, SEQ ID NO 24 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of artificial sequence note = synthetic construct

<4 OOs, SEQUENCE: 24 Cctggtagcc gctggc.cggc 2O

<210s, SEQ ID NO 25 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of artificial sequence note = synthetic construct

<4 OOs, SEQUENCE: 25 Cttctggt ca gttggatttg 2O

<210s, SEQ ID NO 26 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of artificial sequence note = synthetic construct

<4 OOs, SEQUENCE: 26 gatt tatgtt gttgtagttg 2O

<210s, SEQ ID NO 27 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of artificial sequence note = synthetic construct

<4 OOs, SEQUENCE: 27 c caa.gcagcc aattittattg 2O

<210s, SEQ ID NO 28 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of artificial sequence note = synthetic construct

<4 OOs, SEQUENCE: 28 acagcc titt.c acgagt ctitc 2O US 2013/0317087 A1 Nov. 28, 2013 59

- Continued

<210s, SEQ ID NO 29 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of artificial sequence note = synthetic construct

<4 OOs, SEQUENCE: 29 Ctgctgttgg gaggcgatcc 2O

<210s, SEQ ID NO 3 O &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of artificial sequence note = synthetic construct

<4 OOs, SEQUENCE: 30 gcgggagaag ticcacaccgg 2O

<210s, SEQ ID NO 31 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of artificial sequence note = synthetic construct

<4 OOs, SEQUENCE: 31 aggctgtcga gtcagcattc 2O

<210s, SEQ ID NO 32 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of artificial sequence note = synthetic construct

<4 OOs, SEQUENCE: 32 agittaactgt ggactic catg 2O

<210s, SEQ ID NO 33 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of artificial sequence note = synthetic construct

<4 OOs, SEQUENCE: 33 actittct c ca act catcaag 2O

<210s, SEQ ID NO 34 &211s LENGTH: 29 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of artificial sequence note = synthetic construct

<4 OOs, SEQUENCE: 34 ttgaccgctt gaagttctitta attaaatac 29 US 2013/0317087 A1 Nov. 28, 2013 60

- Continued

<210s, SEQ ID NO 35 &211s LENGTH: 51 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of artificial sequence note = synthetic construct

<4 OOs, SEQUENCE: 35 cgaag.cggcc gcaattacat tittgcaattt ggactitt cog ccc.ttcttgg c 51

<210s, SEQ ID NO 36 &211s LENGTH: 124 212. TYPE : RNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of artificial sequence note = synthetic construct

<4 OOs, SEQUENCE: 36 ugaaaggcca ggcauggugg Cucaugcclug ulaaluccCagg acuuugggag gcc.gaggcag 6 O gluggalucacul lugaggcCagg aguluugaaac Cagccluggcc alacalugguga aaacclugucu. 12 O

Clac 124

<210s, SEQ ID NO 37 &211s LENGTH: 120 212. TYPE : RNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of artificial sequence note = synthetic construct

<4 OO > SEQUENCE: 37 acuu.ccg.ucu. CC9ucaccga gugaggacau ulaggauugug acccuccgac ulccgc.ccucc 6 O ulagugaacuc gggucculcala gullclugglucg gauccgulugu aucgulu.clugg gacagagalug 12 O

<210s, SEQ ID NO 38 &211s LENGTH: 82 212. TYPE : RNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of artificial sequence note = synthetic construct

<4 OOs, SEQUENCE: 38 ugugacccuC cgacuccgcc cucculaguga acucgggucc ulcalagullclug glucggauccg 6 O ulugu.aucgulu clugggacaga ga 82

<210s, SEQ ID NO 39 &211s LENGTH: 83 212. TYPE : RNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of artificial sequence note = synthetic construct

<4 OOs, SEQUENCE: 39 acululugggag gccalaggcgg gaggallugcll lugagccCagg agullcaaga C Cagcclugggc 6 O aacaulaccaa gaccc.ccg.uc ulcu 83