A Novel Protein-DNA Interaction Involved with the Cpg Dinucleotide At
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Expression of Cancer-Testis Antigens MAGEA1, MAGEA3, ACRBP, PRAME, SSX2, and CTAG2 in Myxoid and Round Cell Liposarcoma
Modern Pathology (2014) 27, 1238–1245 1238 & 2014 USCAP, Inc All rights reserved 0893-3952/14 $32.00 Expression of cancer-testis antigens MAGEA1, MAGEA3, ACRBP, PRAME, SSX2, and CTAG2 in myxoid and round cell liposarcoma Jessica A Hemminger1, Amanda Ewart Toland2, Thomas J Scharschmidt3, Joel L Mayerson3, Denis C Guttridge2 and O Hans Iwenofu1 1Department of Pathology and Laboratory Medicine, Wexner Medical Center at The Ohio State University, Columbus, OH, USA; 2Department of Molecular Virology, Immunology and Medical Genetics, The Ohio State University Wexner Medical Center, Columbus, OH, USA and 3Department of Orthopedics, The Ohio State University Wexner Medical Center, Columbus, OH, USA Myxoid and round-cell liposarcoma is a frequently encountered liposarcoma subtype. The mainstay of treatment remains surgical excision with or without chemoradiation. However, treatment options are limited in the setting of metastatic disease. Cancer-testis antigens are immunogenic antigens with the expression largely restricted to testicular germ cells and various malignancies, making them attractive targets for cancer immunotherapy. Gene expression studies have reported the expression of various cancer-testis antigens in liposarcoma, with mRNA expression of CTAG1B, CTAG2, MAGEA9, and PRAME described specifically in myxoid and round-cell liposarcoma. Herein, we further explore the expression of the cancer-testis antigens MAGEA1, ACRBP, PRAME, and SSX2 in myxoid and round-cell liposarcoma by immunohistochemistry in addition to determining mRNA levels of CTAG2 (LAGE-1), PRAME, and MAGEA3 by quantitative real-time PCR. Samples in formalin-fixed paraffin-embedded blocks (n ¼ 37) and frozen tissue (n ¼ 8) were obtained for immunohistochemistry and quantitative real-time PCR, respectively. Full sections were stained with antibodies to MAGEA1, ACRBP, PRAME, and SSX2 and staining was assessed for intensity (1–2 þ ) and percent tumor positivity. -
Genome-Wide Analysis of Cancer/Testis Gene Expression
Genome-wide analysis of cancer/testis gene expression Oliver Hofmanna,b,1, Otavia L. Caballeroc, Brian J. Stevensond,e, Yao-Tseng Chenf, Tzeela Cohenc, Ramon Chuac, Christopher A. Maherb, Sumir Panjib, Ulf Schaeferb, Adele Krugerb, Minna Lehvaslaihob, Piero Carnincig,h, Yoshihide Hayashizakig,h, C. Victor Jongeneeld,e, Andrew J. G. Simpsonc, Lloyd J. Oldc,1, and Winston Hidea,b aDepartment of Biostatistics, Harvard School of Public Health, 655 Huntington Avenue, SPH2, 4th Floor, Boston, MA 02115; bSouth African National Bioinformatics Institute, University of the Western Cape, Private Bag X17, Bellville 7535, South Africa; cLudwig Institute for Cancer Research, New York Branch at Memorial Sloan-Kettering Cancer Center, 1275 York Avenue, New York, NY 10021; dLudwig Institute for Cancer Research, Lausanne Branch, 1015 Lausanne, Switzerland; eSwiss Institute of Bioinformatics, 1015 Lausanne, Switzerland; fWeill Medical College of Cornell University, 1300 York Avenue, New York, NY 10021; gGenome Exploration Research Group (Genome Network Project Core Group), RIKEN Genomic Sciences Center (GSC), RIKEN Yokohama Institute, 1-7-22 Suehiro-cho, Tsurumi-ku, Yokohama, Kanagawa, 230-0045, Japan; and hGenome Science Laboratory, Discovery Research Institute, RIKEN Wako Institute, 2-1 Hirosawa, Wako, Saitama, 3510198, Japan Contributed by Lloyd J. Old, October 28, 2008 (sent for review June 6, 2008) Cancer/Testis (CT) genes, normally expressed in germ line cells but expression profile information frequently limited to the original also activated in a wide range of cancer types, often encode defining articles. In some cases, e.g., ACRBP, the original antigens that are immunogenic in cancer patients, and present CT-restricted expression in normal tissues could not be con- potential for use as biomarkers and targets for immunotherapy. -
A Gene Expression Signature Identifying Transient DNMT1
Cannuyer et al. Clinical Epigenetics (2015) 7:114 DOI 10.1186/s13148-015-0147-4 RESEARCH Open Access A gene expression signature identifying transient DNMT1 depletion as a causal factor of cancer-germline gene activation in melanoma Julie Cannuyer, Aurélie Van Tongelen, Axelle Loriot and Charles De Smet* Abstract Background: Many human tumors show aberrant activation of a group of germline-specific genes, termed cancer- germline (CG) genes, several of which appear to exert oncogenic functions. Although activation of CG genes in tumors has been linked to promoter DNA demethylation, the mechanisms underlying this epigenetic alteration remain unclear. Twomainprocesseshavebeenproposed:awakingofagametogenic program directing demethylation of target DNA sequences via specific regulators, or general deficiency of DNA methylation activities resulting from mis-targeting or down-regulation of the DNMT1 methyltransferase. Results: By the analysis of transcriptomic data, we searched to identify gene expression changes associated with CG gene activation in melanoma cells. We found no evidence linking CG gene activation with differential expression of gametogenic regulators. Instead, CG gene activation correlated with decreased expression of a set of mitosis/division- related genes (ICCG genes). Interestingly, a similar gene expression signature was previously associated with depletion of DNMT1. Consistently, analysis of a large set of melanoma tissues revealed that DNMT1 expression levels were often lower in samples showing activation of multiple CG genes. Moreover, by using immortalized melanocytes and fibroblasts carrying an inducible anti-DNMT1 small hairpin RNA (shRNA), we demonstrate that transient depletion of DNMT1 can lead to long-term activation of CG genes and repression of ICCG genes at the same time. -
In-Silico Discovery of Cancer-Specific Peptide-HLA Complexes for Targeted Therapy Ankur Dhanik*, Jessica R
Dhanik et al. BMC Bioinformatics (2016) 17:286 DOI 10.1186/s12859-016-1150-2 RESEARCH ARTICLE Open Access In-silico discovery of cancer-specific peptide-HLA complexes for targeted therapy Ankur Dhanik*, Jessica R. Kirshner, Douglas MacDonald, Gavin Thurston, Hsin C. Lin, Andrew J. Murphy and Wen Zhang Abstract Background: Major Histocompatibility Complex (MHC) or Human Leukocyte Antigen (HLA) Class I molecules bind to peptide fragments of proteins degraded inside the cell and display them on the cell surface. We are interested in peptide-HLA complexes involving peptides that are derived from proteins specifically expressed in cancer cells. Such complexes have been shown to provide an effective means of precisely targeting cancer cells by engineered T-cells and antibodies, which would be an improvement over current chemotherapeutic agents that indiscriminately kill proliferating cells. An important concern with the targeting of peptide-HLA complexes is off-target toxicity that could occur due to the presence of complexes similar to the target complex in cells from essential, normal tissues. Results: We developed a novel computational strategy for identifying potential peptide-HLA cancer targets and evaluating the likelihood of off-target toxicity associated with these targets. Our strategy combines sequence-based and structure-based approaches in a unique way to predict potential off-targets. The focus of our work is on the complexes involving the most frequent HLA class I allele HLA-A*02:01. Using our strategy, we predicted the off-target toxicity observed in past clinical trials. We employed it to perform a first-ever comprehensive exploration of the human peptidome to identify cancer-specific targets utilizing gene expression data from TCGA (The Cancer Genome Atlas) and GTEx (Gene Tissue Expression), and structural data from PDB (Protein Data Bank). -
(MAGEA1) (NM 004988) Human Tagged ORF Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC202134 MAGE 1 (MAGEA1) (NM_004988) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: MAGE 1 (MAGEA1) (NM_004988) Human Tagged ORF Clone Tag: Myc-DDK Symbol: MAGEA1 Synonyms: CT1.1; MAGE1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC202134 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCTCTTGAGCAGAGGAGTCTGCACTGCAAGCCTGAGGAAGCCCTTGAGGCCCAACAAGAGGCCCTGG GCCTGGTGTGTGTGCAGGCTGCCGCCTCCTCCTCCTCTCCTCTGGTCCTGGGCACCCTGGAGGAGGTGCC CACTGCTGGGTCAACAGATCCTCCCCAGAGTCCTCAGGGAGCCTCCGCCTTTCCCACTACCATCAACTTC ACTCGACAGAGGCAACCCAGTGAGGGTTCCAGCAGCCGTGAAGAGGAGGGGCCAAGCACCTCTTGTATCC TGGAGTCCTTGTTCCGAGCAGTAATCACTAAGAAGGTGGCTGATTTGGTTGGTTTTCTGCTCCTCAAATA TCGAGCCAGGGAGCCAGTCACAAAGGCAGAAATGCTGGAGAGTGTCATCAAAAATTACAAGCACTGTTTT CCTGAGATCTTCGGCAAAGCCTCTGAGTCCTTGCAGCTGGTCTTTGGCATTGACGTGAAGGAAGCAGACC CCACCGGCCACTCCTATGTCCTTGTCACCTGCCTAGGTCTCTCCTATGATGGCCTGCTGGGTGATAATCA GATCATGCCCAAGACAGGCTTCCTGATAATTGTCCTGGTCATGATTGCAATGGAGGGCGGCCATGCTCCT GAGGAGGAAATCTGGGAGGAGCTGAGTGTGATGGAGGTGTATGATGGGAGGGAGCACAGTGCCTATGGGG AGCCCAGGAAGCTGCTCACCCAAGATTTGGTGCAGGAAAAGTACCTGGAGTACCGGCAGGTGCCGGACAG TGATCCCGCACGCTATGAGTTCCTGTGGGGTCCAAGGGCCCTTGCTGAAACCAGCTATGTGAAAGTCCTT GAGTATGTGATCAAGGTCAGTGCAAGAGTTCGCTTTTTCTTCCCATCCCTGCGTGAAGCAGCTTTGAGAG -
Analysis of DNA Methylation-Driven Genes for Predicting the Prognosis of Patients with Colorectal Cancer
www.aging-us.com AGING 2020, Vol. 12, No. 22 Research Paper Analysis of DNA methylation-driven genes for predicting the prognosis of patients with colorectal cancer Boshi Fu1,2,*, Cheng Du1,2,*, Zhikun Wu1,2, Mingwei Li1,2, Yi Zhao1,2, Xinli Liu3, Huizhe Wu1,2, Minjie Wei1,2 1Department of Pharmacology, School of Pharmacy, China Medical University, Shenyang 110122, P. R. China 2Liaoning Key Laboratory of Molecular Targeted Anti-Tumor Drug Development and Evaluation, Liaoning Cancer Immune Peptide Drug Engineering Technology Research Center, Key Laboratory of Precision Diagnosis and Treatment of Gastrointestinal Tumors, Ministry of Education, China Medical University, Shenyang 110122, P. R. China 3Department of Digestive Oncology, Cancer Hospital of China Medical University, Shenyang 110042, Liaoning Province, P. R. China *Equal contribution Correspondence to: Xinli Liu, Huizhe Wu, Minjie Wei; email: [email protected], https://orcid.org/0000-0002-2050-8501; [email protected]; [email protected] Keywords: methylation-driven, biomarker, CRC, prognosis, pharmaceutical response Received: May 26, 2020 Accepted: August 8, 2020 Published: November 16, 2020 Copyright: © 2020 Fu et al. This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Aberrant promoter methylation and ensuing abnormal gene expression are important epigenetic mechanisms that contribute to colorectal oncogenesis. Yet, the prognostic significance of such methylation-driven genes in colorectal cancer (CRC) remains obscure. Herein, a total of 181 genes were identified as the methylation-driven molecular features of CRC by integrated analysis of the expression profiles and the matched DNA methylation data from The Cancer Genome Atlas (TCGA) database. -
A Comprehensive Analysis of the MAGE Family As Prognostic and Diagnostic Markers for Hepatocellular Carcinoma
A Comprehensive Analysis of the MAGE Family as Prognostic and Diagnostic Markers for Hepatocellular Carcinoma Rong Li Guangdong Provincial Key Laboratory of Liver Disease Research, Guangdong province engineering laboratory for transplantation medicine, Third Aliated Hospital of Sun Yat-sen University Jiao Gong Department of Laboratory Medicine, Third Aliated Hospital of Sun Yat-sen University Cuicui Xiao Department of Anesthesiology, Cell-Gene therapy Translational Medicine Research Center, Third Aliated Hospital of Sun Yat-sen University Shuguang Zhu Department of Hepatic Surgery and Liver Transplantation Center, The Third Aliated Hospital of Sun Yat-sen University Zhongying Hu Guangdong provincial Key Laboratory of Liver Disease Research, Third Aliated Hospital of Sun Yat- sen University Jinliang Liang Guangdong Provincial Key Laboratory of Liver Disease Research, Third Aliated Hospital of Sun Yat- sen University Xuejiao Li Guangdong Provincial Key Laboratory of Liver Disease Research, Third Aliated Hospital of Sun Yat- sen University Xijing Yan Department of Hepatic Surgery and Liver Transplantation Center, Third Aliated Hospital of Sun Yat-sen University Xijian Zhang Department of Hepatic Surgery and Liver Transplantation Center, Third Aliated Hospital of Sun Yat-sen University Danyang Li Department of Infectious Diseases, Third Aliated Hospital of Sun Yat-sen University Wei Liu Guangdong Provincial Key Laboratory of Liver Disease Research, Guangdong province engineering laboratory for transplantation medicine, Third Aliated Hospital -
UNIVERSITY of CALIFORNIA SANTA CRUZ the CELLULAR CONSEQUENCES of PASD1 EXPRESSION in HUMAN CANCER a Thesis Submitted in Partial
UNIVERSITY OF CALIFORNIA SANTA CRUZ THE CELLULAR CONSEQUENCES OF PASD1 EXPRESSION IN HUMAN CANCER A thesis submitted in partial satisfaction of the requirements for the degree of MASTER OF ARTS in MOLECULAR, CELL, AND DEVELOPMENTAL BIOLOGY by Ashley M. Kern March 2016 The Thesis of Ashley M. Kern is approved: ____________________________________ Carrie Partch, Ph.D., chair ____________________________________ Seth Rubin, Ph.D. ____________________________________ Grant Hartzog, Ph.D. _______________________________ Tyrus Miller Vice-Provost and Dean of Graduate Studies ii Table of Contents Title Page I Table of Contents iii Abstract v Acknowledgements vi Figure/Experimental Contributions vii Introduction 1 Results 23 Discussion 39 Experimental Procedures 46 Figures 3- 45 Figure 1 3 Figure 2 6 Figure 3 12 Figure 4 14 Figure 5 15 Figure 6 22 Figure 7 27 Figure 8 30 Figure 9 36 Figure 10 38 Figure 11 42 iii Figure 12 45 References 48 iv ABSTRACT The Cellular Consequences of PASD1 Expression in Human Cancer Ashley M. Kern There are nearly 1,000 human proteins that are expressed only in the germline. Cancer /Testis antigens (CT antigens) represent a subset of germline-specific proteins that become reactivated in somatic cells that have undergone oncogenic transformation. Human PAS Domain containing protein 1 (PASD1) is an X-linked CT Antigen. In 2015, the Partch Laboratory established that PASD1 prevents the core circadian transcription factor, CLOCK:BMAL1, from rhythmically transcribing its target genes to suppress circadian rhythms after it becomes upregulated in cancer cells. In addition to this striking phenotype, PASD1 also promotes mitotic defects that could favor tumor progression. These phenotypes may go hand in hand; over 43% of the mammalian genome, including many cell cycle genes, is under circadian control. -
MAGE-A Tumor Antigens Target P53 Transactivation Function Through Histone Deacetylase Recruitment and Confer Resistance to Chemotherapeutic Agents
MAGE-A tumor antigens target p53 transactivation function through histone deacetylase recruitment and confer resistance to chemotherapeutic agents Martin Monte*, Marta Simonatto*†, Leticia Y. Peche*†, Debora R. Bublik*, Stefania Gobessi*‡, Marco A. Pierotti§, Monica Rodolfo§, and Claudio Schneider*¶ʈ *Laboratorio Nazionale del Consorzio Interuniversitario per le Biotecnologie, Area Science Park, Padriciano 99, 34012 Trieste, Italy; §Istituto Nazionale Tumori, Via G. Venezian 1, 20133 Milan, Italy; and ¶Dipartimento di Scienze e Tecnologie Biomediche, Universita`di Udine, p.le Kolbe 4, 33100 Udine, Italy Edited by George R. Stark, Cleveland Clinic Foundation, Cleveland, OH, and approved June 5, 2006 (received for review December 15, 2005) The MAGE gene family is characterized by a conserved domain members such as MageA1, -A4, and -A11 have been involved in (MAGE Homology Domain). A subset of highly homologous MAGE transcription regulation through specific binding to transcription genes (group A; MAGE-A) belong to the chromosome X-clustered complexes (14–16). It was recently reported that BORIS, a cancer͞ cancer͞testis antigens. MAGE-A genes are normally expressed in testis antigen discovered as a novel CTCF paralogous, is able to the human germ line and overexpressed in various tumor types; transcriptionally induce several MAGE-A genes (17) and poten- however, their biological function is largely unknown. Here we tially promote cell proliferation and transformation (18). present evidence indicating that MageA2 protein, belonging to the Here we report that MageA2 interacts and represses p53 activity MAGE-A subfamily, confers wild-type-p53-sensitive resistance to by recruiting transcription repressors [histone deacetylases etoposide (ET) by inducing a novel p53 inhibitory loop involving (HDACs)] to p53 transcription sites. -
Genome-Wide Gene Expression Profiling of Randall's Plaques In
CLINICAL RESEARCH www.jasn.org Genome-Wide Gene Expression Profiling of Randall’s Plaques in Calcium Oxalate Stone Formers † † Kazumi Taguchi,* Shuzo Hamamoto,* Atsushi Okada,* Rei Unno,* Hideyuki Kamisawa,* Taku Naiki,* Ryosuke Ando,* Kentaro Mizuno,* Noriyasu Kawai,* Keiichi Tozawa,* Kenjiro Kohri,* and Takahiro Yasui* *Department of Nephro-urology, Nagoya City University Graduate School of Medical Sciences, Nagoya, Japan; and †Department of Urology, Social Medical Corporation Kojunkai Daido Hospital, Daido Clinic, Nagoya, Japan ABSTRACT Randall plaques (RPs) can contribute to the formation of idiopathic calcium oxalate (CaOx) kidney stones; however, genes related to RP formation have not been identified. We previously reported the potential therapeutic role of osteopontin (OPN) and macrophages in CaOx kidney stone formation, discovered using genome-recombined mice and genome-wide analyses. Here, to characterize the genetic patho- genesis of RPs, we used microarrays and immunohistology to compare gene expression among renal papillary RP and non-RP tissues of 23 CaOx stone formers (SFs) (age- and sex-matched) and normal papillary tissue of seven controls. Transmission electron microscopy showed OPN and collagen expression inside and around RPs, respectively. Cluster analysis revealed that the papillary gene expression of CaOx SFs differed significantly from that of controls. Disease and function analysis of gene expression revealed activation of cellular hyperpolarization, reproductive development, and molecular transport in papillary tissue from RPs and non-RP regions of CaOx SFs. Compared with non-RP tissue, RP tissue showed upregulation (˃2-fold) of LCN2, IL11, PTGS1, GPX3,andMMD and downregulation (0.5-fold) of SLC12A1 and NALCN (P,0.01). In network and toxicity analyses, these genes associated with activated mitogen- activated protein kinase, the Akt/phosphatidylinositol 3-kinase pathway, and proinflammatory cytokines that cause renal injury and oxidative stress. -
Table S1. 103 Ferroptosis-Related Genes Retrieved from the Genecards
Table S1. 103 ferroptosis-related genes retrieved from the GeneCards. Gene Symbol Description Category GPX4 Glutathione Peroxidase 4 Protein Coding AIFM2 Apoptosis Inducing Factor Mitochondria Associated 2 Protein Coding TP53 Tumor Protein P53 Protein Coding ACSL4 Acyl-CoA Synthetase Long Chain Family Member 4 Protein Coding SLC7A11 Solute Carrier Family 7 Member 11 Protein Coding VDAC2 Voltage Dependent Anion Channel 2 Protein Coding VDAC3 Voltage Dependent Anion Channel 3 Protein Coding ATG5 Autophagy Related 5 Protein Coding ATG7 Autophagy Related 7 Protein Coding NCOA4 Nuclear Receptor Coactivator 4 Protein Coding HMOX1 Heme Oxygenase 1 Protein Coding SLC3A2 Solute Carrier Family 3 Member 2 Protein Coding ALOX15 Arachidonate 15-Lipoxygenase Protein Coding BECN1 Beclin 1 Protein Coding PRKAA1 Protein Kinase AMP-Activated Catalytic Subunit Alpha 1 Protein Coding SAT1 Spermidine/Spermine N1-Acetyltransferase 1 Protein Coding NF2 Neurofibromin 2 Protein Coding YAP1 Yes1 Associated Transcriptional Regulator Protein Coding FTH1 Ferritin Heavy Chain 1 Protein Coding TF Transferrin Protein Coding TFRC Transferrin Receptor Protein Coding FTL Ferritin Light Chain Protein Coding CYBB Cytochrome B-245 Beta Chain Protein Coding GSS Glutathione Synthetase Protein Coding CP Ceruloplasmin Protein Coding PRNP Prion Protein Protein Coding SLC11A2 Solute Carrier Family 11 Member 2 Protein Coding SLC40A1 Solute Carrier Family 40 Member 1 Protein Coding STEAP3 STEAP3 Metalloreductase Protein Coding ACSL1 Acyl-CoA Synthetase Long Chain Family Member 1 Protein -
View a Copy of This Licence, Visit
Colemon et al. Genes and Environment (2020) 42:24 https://doi.org/10.1186/s41021-020-00162-2 RESEARCH Open Access DNA hypomethylation drives changes in MAGE-A gene expression resulting in alteration of proliferative status of cells Ashley Colemon1, Taylor M. Harris2 and Saumya Ramanathan2,3* Abstract Melanoma Antigen Genes (MAGEs) are a family of genes that have piqued the interest of scientists for their unique expression pattern. A subset of MAGEs (Type I) are expressed in spermatogonial cells and in no other somatic tissue, and then re-expressed in many cancers. Type I MAGEs are often referred to as cancer-testis antigens due to this expression pattern, while Type II MAGEs are more ubiquitous in expression. This study determines the cause and consequence of the aberrant expression of the MAGE-A subfamily of cancer-testis antigens. We have discovered that MAGE-A genes are regulated by DNA methylation, as revealed by treatment with 5-azacytidine, an inhibitor of DNA methyltransferases. Furthermore, bioinformatics analysis of existing methylome sequencing data also corroborates our findings. The consequence of expressing certain MAGE-A genes is an increase in cell proliferation and colony formation and resistance to chemo-therapeutic agent 5-fluorouracil and DNA damaging agent sodium arsenite. Taken together, these data indicate that DNA methylation plays a crucial role in regulating the expression of MAGE-A genes which then act as drivers of cell proliferation, anchorage-independent growth and chemo-resistance that is critical for cancer-cell survival. Keywords: Cancer, Cancer-testis antigens, Melanoma antigen genes, Anchorage-independent growth, Epigenetics, DNA methylation, Gene expression, Cell proliferation, Chemo-resistance Introduction antigens, and located on the X-chromosome, whereas Type Melanoma Antigen Genes (MAGEs) were first discovered II MAGEs are ubiquitous in expression and some members because a patient with melanoma and a few melanoma cell such as MAGEL2 are located on autosomes [3].