G9a Selectively Represses a Class of Late-Replicating Genes at the Nuclear Periphery

Total Page:16

File Type:pdf, Size:1020Kb

Load more

G9a selectively represses a class of late-replicating genes at the nuclear periphery Tomoki Yokochia,1, Kristina Poducha, Tyrone Rybaa, Junjie Lua, Ichiro Hiratania, Makoto Tachibanab, Yoichi Shinkaib, and David M. Gilberta,2 aDepartment of Biological Science, Florida State University, Tallahassee, FL 32306; and bExperimental Research Center for Infectious Diseases, Institute for Virus Research, Kyoto University, Kyoto 606-8507, Japan Edited by Mark T. Groudine, Fred Hutchinson Cancer Research Center, Seattle, WA, and approved September 25, 2009 (received for review June 4, 2009) We have investigated the role of the histone methyltransferase G9a ery and that G9a-null ESCs are selectively depleted of the in the establishment of silent nuclear compartments. Following con- H3K9me2 localized at the periphery (13). Chromatin at the nuclear ditional knockout of the G9a methyltransferase in mouse ESCs, 167 periphery also is replicated late during S-phase, and differentiation genes were significantly up-regulated, and no genes were strongly of ESCs leads to changes in the replication timing of large chro- down-regulated. A partially overlapping set of 119 genes were matin domains, accompanied by the movement of those domains up-regulated after differentiation of G9a-depleted cells to neural toward or away from the nuclear periphery and the respective precursors. Promoters of these G9a-repressed genes were AT rich and silencing or activation of genes within those domains (14). To- H3K9me2 enriched but H3K4me3 depleted and were not highly DNA gether, these results suggested the possibility that G9a may help methylated. Representative genes were found to be close to the establish compartments of facultative heterochromatin at the nu- nuclear periphery, which was significantly enriched for G9a-depen- clear periphery. Here, we have investigated this hypothesis using a dent H3K9me2. Strikingly, although 73% of total genes were early conditional-knockout ESC line that allows acute effects of G9a loss replicating, more than 71% of G9a-repressed genes were late repli- to be evaluated within the first several cell cycles following G9a cating, and a strong correlation was found between H3K9me2 and disruption. We find that G9a loss leads to depletion of H3K9me2 late replication. However, G9a loss did not significantly affect sub- at the nuclear periphery and de-repression of a set of genes with nuclear position or replication timing of any non-pericentric regions H3K9me2-enriched promoters. No genes were down-regulated, of the genome, nor did it affect programmed changes in replication indicating that G9a is not required for the activation of transcription timing that accompany differentiation. We conclude that G9a is a in ESCs. An overlapping set of genes was de-repressed by G9a loss gatekeeper for a specific set of genes localized within the late in neural precursor cells (NPCs) derived from these ESCs. Intrigu- replicating nuclear periphery. ingly, the majority of G9a-repressed genes were late replicating, but the loss of G9a had no detectable effect on the replication timing histone methylation ͉ nucleus ͉ replication timing ͉ transcription of these genes or on the changes in replication timing that took place during ESC differenation to NPCs. We conclude that G9a mediates osttranslational modifications of chromatin are central to the dimethylation of H3K9 within late-replicating chromatin at the Pregulation of many chromosomal functions and are intimately nuclear periphery and is required within this genomic context to tied to transcriptional regulation (1). The histone methyltransferase silence a defined set of genes. (HMTase) G9a, in a complex with G9a-like protein (GLP), is Results responsible for methylation of lysine 9 of histone H3 (H3K9me), commonly associated with gene repression (2, 3). Although H3K9 Changes in Histone Methylation Following G9a Knockout. Stable and can be mono-, di-, or trimethylated (-me1, -me2, -me3, respectively), irreversible genetic knockout often leads to compensatory genetic G9a-knockout ESCs have significantly reduced levels of H3K9me2 and epigenetic changes that can confuse interpretation of the (2, 4, 5). H3K9me2 and H3K9me3 create a platform for the binding resulting phenotypes (15). For example, Suv39h1,2-knockout cells of heterochromatin protein 1 (HP1), usually associated with tran- lose H3K9me3 but also gain H3K27me3 in pericentric heterochro- scriptional silencing but sometimes required for transcriptional matin, where it is not seen in wild-type cells (4). This kind of activation (6). G9a also recruits DNA methyltransferases via its adaptation can be largely circumvented through the use of a ankyrin domain and can promote and/or maintain DNA methyl- conditional-knockout, in which cellular responses to the acute loss ation at target sites independent of its HMTase activity (7–10). G9a of the gene product can be monitored. We have constructed a is an essential gene for development; knockout mice die at day 8.5 conditional knockout of G9a in mouse ESC line TT2 (Fig. 1). This (3). Although the precise lethal event during development of cell line has a single copy of the G9a gene flanked by loxP CELL BIOLOGY G9a-null mice is not known, G9a ESCs can differentiate in culture recombination sites and expresses 4-hydroxytamoxifen (OHT)- but fail to methylate the promoter DNA of a set of genes during inducible Cre fusion protein (16). Addition of OHT results in the differentiation; this failure may affect stable silencing of those rapid deletion of G9a (Fig. 1B), a partial reduction in total promoters (9). Despite the importance of G9a to gene expression H3K9me1 and H3K9me3, and a substantial reduction in total and development, the cohort of genes regulated by G9a has not been reported. Moreover, it is not clear whether G9a always Author contributions,: D.M.G. designed research; T.Y., K.P., J.L., and I.H. performed re- functions as a repressor or whether, as occurs at some promoters search; M.T. and Y.S. contributed new reagents/analytic tools; T.Y., K.P., T.R., J.L., and I.H. occupied by HP1 (6), it also can function to activate certain genes. analyzed data; and D.M.G. wrote the paper. In addition to localized effects at specific promoters, G9a has The authors declare no conflict of interest. global effects on chromatin organization. G9a-null cells show a loss This article is a PNAS Direct Submission. of DNA methylation at major satellite DNA and several classes of Data deposition: The data reported in this paper have been deposited in the Gene Expression repetitive and transposable elements (7). In addition, blocks of Omnibus (GEO) database, www.ncbi.nlm.nih.gov/geo (accession no. GSE18082). G9a-dependent H3K9me2 (large, organized chromatin K9 modi- 1Present address: Chiba Cancer Center Research Institute, 666-2 Nitona, Chuo, Chiba fications, LOCKs) have been identified in mouse ESCs that appear 260-8717, Japan. to overlap strongly with chromatin associated with the nuclear 2To whom correspondence should be addressed. E-mail: [email protected]. lamina (11, 12). Interestingly, we previously showed that H3K9me2, This article contains supporting information online at www.pnas.org/cgi/content/full/ but not H3K9me1 or H3K9me3, is enriched in the nuclear periph- 0906142106/DCSupplemental. www.pnas.org͞cgi͞doi͞10.1073͞pnas.0906142106 PNAS ͉ November 17, 2009 ͉ vol. 106 ͉ no. 46 ͉ 19363–19368 Downloaded by guest on September 26, 2021 G9a + G9a - A C Mock OHT Days 0 1 2 3 5 7 0 1 2 3 5 7 G9a -Tubulin + OHT Probe H3K9me1 (A) Fig. 1. Construction and characterization of a G9a con- H3K9me2 (A) ditional-knockout mouse ESC line. (A) When TT2G9aflox/⌬ ESCs are treated with OHT, the catalytic center of G9a is H3K9me3 (B) deleted, resulting in loss of a HindIII site that converts the 4.6-kb HindIII fragment on the floxed allele to a 5.8-kb OHT H3K9me1 (C) HindIII fragment on the deleted allele. Also shown is the B - + H3K9me2 (C) position of the probe used for Southern blot confirmation in (B). (B) Southern blot confirming genetic deletion of H3K9me3 (C) G9a 2 days after OHT treatment. The constitutively de- Null (7.3 kb) leted allele produces a 7.3-kb fragment (3, 8). (C) Western Del. (5.8 kb) H3K27me1 (A) blots of whole-cell extracts were performed at daily inter- Flox (4.6 kb) vals after OHT or vehicle-only mock treatment and probed H3K27me2 (A) with antibodies against the indicated proteins or histone H3K27me3 (A) modifications. Histone antibodies are designated (A) for Upstate Biotechnology polyclonal antibodies, (B) for poly- clonal anti-2xH3K9me3 antibodies (4), and (C) for mono- H4K20me3 (A) clonal antibodies (17). H3K9me2 (Fig. 1C), but has no effect on mono-, di- or trimethy- mouse ESCs, and that stable G9a-knockout ESCs preferentially lated H3K27 or H4K20me3. The effects on the different methylated lose peripheral H3K9me2 (13). To determine whether acute G9a forms of H3K9 were similar with either commonly used polyclonal loss also preferentially affects peripheral H3K9me2, we performed antibodies or more recently reported monoclonal antibodies (17) immunofluorescence detection of mono-, di- and trimethyl H3K9 and were similar in a stable G9a-null ESC line. Hence, this before and after the addition of OHT (Fig. 2). H3K9me1 was conditional-knockout cell line provides the opportunity to observe distributed throughout the interior of the nucleus, excluding the the effects of acute G9a loss in the absence of complicating adaptive periphery and clusters of pericentric heterochromatin (chromo- changes. centers), whereas H3K9me3 was localized primarily to the chro- We previously reported that H3K9me2 is enriched at the nuclear mocenters; both these modifications show some reduction in signal periphery in human, mouse, and hamster fibroblasts, as well as in after G9a loss but no change in localization. In contrast, H3K9me2 A Mock OHT DNA H3K9me Merge DNA H3K9me Merge me1 me2 me3 B Mock OHT Fig. 2. G9a knockout leads to the selective loss of Single-Nucleus 30-60 Single-Nucleus 30-60 H3K9me2 at the nuclear periphery.
Recommended publications
  • Expression of Cancer-Testis Antigens MAGEA1, MAGEA3, ACRBP, PRAME, SSX2, and CTAG2 in Myxoid and Round Cell Liposarcoma

    Expression of Cancer-Testis Antigens MAGEA1, MAGEA3, ACRBP, PRAME, SSX2, and CTAG2 in Myxoid and Round Cell Liposarcoma

    Modern Pathology (2014) 27, 1238–1245 1238 & 2014 USCAP, Inc All rights reserved 0893-3952/14 $32.00 Expression of cancer-testis antigens MAGEA1, MAGEA3, ACRBP, PRAME, SSX2, and CTAG2 in myxoid and round cell liposarcoma Jessica A Hemminger1, Amanda Ewart Toland2, Thomas J Scharschmidt3, Joel L Mayerson3, Denis C Guttridge2 and O Hans Iwenofu1 1Department of Pathology and Laboratory Medicine, Wexner Medical Center at The Ohio State University, Columbus, OH, USA; 2Department of Molecular Virology, Immunology and Medical Genetics, The Ohio State University Wexner Medical Center, Columbus, OH, USA and 3Department of Orthopedics, The Ohio State University Wexner Medical Center, Columbus, OH, USA Myxoid and round-cell liposarcoma is a frequently encountered liposarcoma subtype. The mainstay of treatment remains surgical excision with or without chemoradiation. However, treatment options are limited in the setting of metastatic disease. Cancer-testis antigens are immunogenic antigens with the expression largely restricted to testicular germ cells and various malignancies, making them attractive targets for cancer immunotherapy. Gene expression studies have reported the expression of various cancer-testis antigens in liposarcoma, with mRNA expression of CTAG1B, CTAG2, MAGEA9, and PRAME described specifically in myxoid and round-cell liposarcoma. Herein, we further explore the expression of the cancer-testis antigens MAGEA1, ACRBP, PRAME, and SSX2 in myxoid and round-cell liposarcoma by immunohistochemistry in addition to determining mRNA levels of CTAG2 (LAGE-1), PRAME, and MAGEA3 by quantitative real-time PCR. Samples in formalin-fixed paraffin-embedded blocks (n ¼ 37) and frozen tissue (n ¼ 8) were obtained for immunohistochemistry and quantitative real-time PCR, respectively. Full sections were stained with antibodies to MAGEA1, ACRBP, PRAME, and SSX2 and staining was assessed for intensity (1–2 þ ) and percent tumor positivity.
  • Functional Analysis of Structural Variation in the 2D and 3D Human Genome

    Functional Analysis of Structural Variation in the 2D and 3D Human Genome

    FUNCTIONAL ANALYSIS OF STRUCTURAL VARIATION IN THE 2D AND 3D HUMAN GENOME by Conor Mitchell Liam Nodzak A dissertation submitted to the faculty of The University of North Carolina at Charlotte in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Bioinformatics and Computational Biology Charlotte 2019 Approved by: Dr. Xinghua Mindy Shi Dr. Rebekah Rogers Dr. Jun-tao Guo Dr. Adam Reitzel ii c 2019 Conor Mitchell Liam Nodzak ALL RIGHTS RESERVED iii ABSTRACT CONOR MITCHELL LIAM NODZAK. Functional analysis of structural variation in the 2D and 3D human genome. (Under the direction of DR. XINGHUA MINDY SHI) The human genome consists of over 3 billion nucleotides that have an average distance of 3.4 Angstroms between each base, which equates to over two meters of DNA contained within the 125 µm3 volume diploid cell nuclei. The dense compaction of chromatin by the supercoiling of DNA forms distinct architectural modules called topologically associated domains (TADs), which keep protein-coding genes, noncoding RNAs and epigenetic regulatory elements in close nuclear space. It has recently been shown that these conserved chromatin structures may contribute to tissue-specific gene expression through the encapsulation of genes and cis-regulatory elements, and mutations that affect TADs can lead to developmental disorders and some forms of cancer. At the population-level, genomic structural variation contributes more to cumulative genetic difference than any other class of mutation, yet much remains to be studied as to how structural variation affects TADs. Here, we study the func- tional effects of structural variants (SVs) through the analysis of chromatin topology and gene activity for three trio families sampled from genetically diverse popula- tions from the Human Genome Structural Variation Consortium.
  • Functional Annotation of Genes Overlapping Copy Number Variants in Autistic Patients: Focus on Axon Pathfinding

    Functional Annotation of Genes Overlapping Copy Number Variants in Autistic Patients: Focus on Axon Pathfinding

    136 Current Genomics, 2010, 11, 136-145 Functional Annotation of Genes Overlapping Copy Number Variants in Autistic Patients: Focus on Axon Pathfinding Silvia Sbacchi1, Francesco Acquadro2, Ignazio Calò1, Francesco Calì3 and Valentino Romano*,1,3 1Dipartimento di Oncologia Sperimentale e Applicazioni Cliniche, Università degli Studi di Palermo, Palermo; 2Molecular Cytogenetics Group, Centro Nacional de Investigaciones Oncologicas (C.N.I.O.), and Centro de Investiga- ciones de Enfermidades Raras (CIBERER), Madrid, Spain; 3Associazione Oasi Maria SS. (I.R.C.C.S.), Troina (EN), Italy Abstract: We have used Gene Ontology (GO) and pathway analyses to uncover the common functions associated to the genes overlapping Copy Number Variants (CNVs) in autistic patients. Our source of data were four published studies [1- 4]. We first applied a two-step enrichment strategy for autism-specific genes. We fished out from the four mentioned stud- ies a list of 2928 genes overall overlapping 328 CNVs in patients and we first selected a sub-group of 2044 genes after excluding those ones that are also involved in CNVs reported in the Database of Genomic Variants (enrichment step 1). We then selected from the step 1-enriched list a sub-group of 514 genes each of which was found to be deleted or dupli- cated in at least two patients (enrichment step 2). The number of statistically significant processes and pathways identified by the Database for Annotation, Visualization and Integrated Discovery and Ingenuity Pathways Analysis softwares with the step 2-enriched list was significantly higher compared to the step 1-enriched list. In addition, statistically significant GO terms, biofunctions and pathways related to nervous system development and function were exclusively identified by the step 2-enriched list of genes.
  • The Identification of 64 Novel Genetic Loci Provides an Expanded View on the Genetic Architecture of Coronary Artery Disease

    The Identification of 64 Novel Genetic Loci Provides an Expanded View on the Genetic Architecture of Coronary Artery Disease

    University of Groningen Identification of 64 Novel Genetic Loci Provides an Expanded View on the Genetic Architecture of Coronary Artery Disease van der Harst, Pim; Verweij, Niek Published in: Circulation research DOI: 10.1161/CIRCRESAHA.117.312086 IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below. Document Version Publisher's PDF, also known as Version of record Publication date: 2018 Link to publication in University of Groningen/UMCG research database Citation for published version (APA): van der Harst, P., & Verweij, N. (2018). Identification of 64 Novel Genetic Loci Provides an Expanded View on the Genetic Architecture of Coronary Artery Disease. Circulation research, 122(3), 433-443. https://doi.org/10.1161/CIRCRESAHA.117.312086 Copyright Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons). The publication may also be distributed here under the terms of Article 25fa of the Dutch Copyright Act, indicated by the “Taverne” license. More information can be found on the University of Groningen website: https://www.rug.nl/library/open-access/self-archiving-pure/taverne- amendment. Take-down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim. Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal.
  • Genome-Wide Analysis of Cancer/Testis Gene Expression

    Genome-Wide Analysis of Cancer/Testis Gene Expression

    Genome-wide analysis of cancer/testis gene expression Oliver Hofmanna,b,1, Otavia L. Caballeroc, Brian J. Stevensond,e, Yao-Tseng Chenf, Tzeela Cohenc, Ramon Chuac, Christopher A. Maherb, Sumir Panjib, Ulf Schaeferb, Adele Krugerb, Minna Lehvaslaihob, Piero Carnincig,h, Yoshihide Hayashizakig,h, C. Victor Jongeneeld,e, Andrew J. G. Simpsonc, Lloyd J. Oldc,1, and Winston Hidea,b aDepartment of Biostatistics, Harvard School of Public Health, 655 Huntington Avenue, SPH2, 4th Floor, Boston, MA 02115; bSouth African National Bioinformatics Institute, University of the Western Cape, Private Bag X17, Bellville 7535, South Africa; cLudwig Institute for Cancer Research, New York Branch at Memorial Sloan-Kettering Cancer Center, 1275 York Avenue, New York, NY 10021; dLudwig Institute for Cancer Research, Lausanne Branch, 1015 Lausanne, Switzerland; eSwiss Institute of Bioinformatics, 1015 Lausanne, Switzerland; fWeill Medical College of Cornell University, 1300 York Avenue, New York, NY 10021; gGenome Exploration Research Group (Genome Network Project Core Group), RIKEN Genomic Sciences Center (GSC), RIKEN Yokohama Institute, 1-7-22 Suehiro-cho, Tsurumi-ku, Yokohama, Kanagawa, 230-0045, Japan; and hGenome Science Laboratory, Discovery Research Institute, RIKEN Wako Institute, 2-1 Hirosawa, Wako, Saitama, 3510198, Japan Contributed by Lloyd J. Old, October 28, 2008 (sent for review June 6, 2008) Cancer/Testis (CT) genes, normally expressed in germ line cells but expression profile information frequently limited to the original also activated in a wide range of cancer types, often encode defining articles. In some cases, e.g., ACRBP, the original antigens that are immunogenic in cancer patients, and present CT-restricted expression in normal tissues could not be con- potential for use as biomarkers and targets for immunotherapy.
  • A Gene Expression Signature Identifying Transient DNMT1

    A Gene Expression Signature Identifying Transient DNMT1

    Cannuyer et al. Clinical Epigenetics (2015) 7:114 DOI 10.1186/s13148-015-0147-4 RESEARCH Open Access A gene expression signature identifying transient DNMT1 depletion as a causal factor of cancer-germline gene activation in melanoma Julie Cannuyer, Aurélie Van Tongelen, Axelle Loriot and Charles De Smet* Abstract Background: Many human tumors show aberrant activation of a group of germline-specific genes, termed cancer- germline (CG) genes, several of which appear to exert oncogenic functions. Although activation of CG genes in tumors has been linked to promoter DNA demethylation, the mechanisms underlying this epigenetic alteration remain unclear. Twomainprocesseshavebeenproposed:awakingofagametogenic program directing demethylation of target DNA sequences via specific regulators, or general deficiency of DNA methylation activities resulting from mis-targeting or down-regulation of the DNMT1 methyltransferase. Results: By the analysis of transcriptomic data, we searched to identify gene expression changes associated with CG gene activation in melanoma cells. We found no evidence linking CG gene activation with differential expression of gametogenic regulators. Instead, CG gene activation correlated with decreased expression of a set of mitosis/division- related genes (ICCG genes). Interestingly, a similar gene expression signature was previously associated with depletion of DNMT1. Consistently, analysis of a large set of melanoma tissues revealed that DNMT1 expression levels were often lower in samples showing activation of multiple CG genes. Moreover, by using immortalized melanocytes and fibroblasts carrying an inducible anti-DNMT1 small hairpin RNA (shRNA), we demonstrate that transient depletion of DNMT1 can lead to long-term activation of CG genes and repression of ICCG genes at the same time.
  • In-Silico Discovery of Cancer-Specific Peptide-HLA Complexes for Targeted Therapy Ankur Dhanik*, Jessica R

    In-Silico Discovery of Cancer-Specific Peptide-HLA Complexes for Targeted Therapy Ankur Dhanik*, Jessica R

    Dhanik et al. BMC Bioinformatics (2016) 17:286 DOI 10.1186/s12859-016-1150-2 RESEARCH ARTICLE Open Access In-silico discovery of cancer-specific peptide-HLA complexes for targeted therapy Ankur Dhanik*, Jessica R. Kirshner, Douglas MacDonald, Gavin Thurston, Hsin C. Lin, Andrew J. Murphy and Wen Zhang Abstract Background: Major Histocompatibility Complex (MHC) or Human Leukocyte Antigen (HLA) Class I molecules bind to peptide fragments of proteins degraded inside the cell and display them on the cell surface. We are interested in peptide-HLA complexes involving peptides that are derived from proteins specifically expressed in cancer cells. Such complexes have been shown to provide an effective means of precisely targeting cancer cells by engineered T-cells and antibodies, which would be an improvement over current chemotherapeutic agents that indiscriminately kill proliferating cells. An important concern with the targeting of peptide-HLA complexes is off-target toxicity that could occur due to the presence of complexes similar to the target complex in cells from essential, normal tissues. Results: We developed a novel computational strategy for identifying potential peptide-HLA cancer targets and evaluating the likelihood of off-target toxicity associated with these targets. Our strategy combines sequence-based and structure-based approaches in a unique way to predict potential off-targets. The focus of our work is on the complexes involving the most frequent HLA class I allele HLA-A*02:01. Using our strategy, we predicted the off-target toxicity observed in past clinical trials. We employed it to perform a first-ever comprehensive exploration of the human peptidome to identify cancer-specific targets utilizing gene expression data from TCGA (The Cancer Genome Atlas) and GTEx (Gene Tissue Expression), and structural data from PDB (Protein Data Bank).
  • Mouse Asz1 Conditional Knockout Project (CRISPR/Cas9)

    Mouse Asz1 Conditional Knockout Project (CRISPR/Cas9)

    https://www.alphaknockout.com Mouse Asz1 Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Asz1 conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Asz1 gene (NCBI Reference Sequence: NM_023729 ; Ensembl: ENSMUSG00000010796 ) is located on Mouse chromosome 6. 13 exons are identified, with the ATG start codon in exon 1 and the TAA stop codon in exon 13 (Transcript: ENSMUST00000010940). Exon 3~4 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Asz1 gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP23-39F14 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Homozygous null male mice are sterile resulting from a block in spermatid development. Exon 3 starts from about 14.46% of the coding region. The knockout of Exon 3~4 will result in frameshift of the gene. The size of intron 2 for 5'-loxP site insertion: 3504 bp, and the size of intron 4 for 3'-loxP site insertion: 26235 bp. The size of effective cKO region: ~1899 bp. The cKO region does not have any other known gene. Page 1 of 7 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 3 4 13 Targeting vector Targeted allele Constitutive KO allele (After Cre recombination) Legends Exon of mouse Asz1 Homology arm cKO region loxP site Page 2 of 7 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats.
  • Homology-Based Negative Data Sampling Method for Genome-Scale Reconstruction of Human Protein–Protein Interaction Networks

    Homology-Based Negative Data Sampling Method for Genome-Scale Reconstruction of Human Protein–Protein Interaction Networks

    International Journal of Molecular Sciences Article Neglog: Homology-Based Negative Data Sampling Method for Genome-Scale Reconstruction of Human Protein–Protein Interaction Networks Suyu Mei 1,* and Kun Zhang 2,* 1 Software College, Shenyang Normal University, Shenyang 110034, China 2 Bioinformatics Facility of Xavier NIH RCMI Cancer Research Center, Department of Computer Science, Xavier University of Louisiana, New Orleans, LA 70125, USA * Correspondence: [email protected] (S.M.); [email protected] (K.Z.) Received: 27 September 2019; Accepted: 11 October 2019; Published: 12 October 2019 Abstract: Rapid reconstruction of genome-scale protein–protein interaction (PPI) networks is instrumental in understanding the cellular processes and disease pathogenesis and drug reactions. However, lack of experimentally verified negative data (i.e., pairs of proteins that do not interact) is still a major issue that needs to be properly addressed in computational modeling. In this study, we take advantage of the very limited experimentally verified negative data from Negatome to infer more negative data for computational modeling. We assume that the paralogs or orthologs of two non-interacting proteins also do not interact with high probability. We coin an assumption as “Neglog” this assumption is to some extent supported by paralogous/orthologous structure conservation. To reduce the risk of bias toward the negative data from Negatome, we combine Neglog with less biased random sampling according to a certain ratio to construct training data. L2-regularized logistic regression is used as the base classifier to counteract noise and train on a large dataset. Computational results show that the proposed Neglog method outperforms pure random sampling method with sound biological interpretability.
  • Specification and Epigenetic Resetting of the Pig Germline Exhibit Conservation with the Human Lineage

    Specification and Epigenetic Resetting of the Pig Germline Exhibit Conservation with the Human Lineage

    bioRxiv preprint doi: https://doi.org/10.1101/2020.08.07.241075; this version posted August 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Specification and epigenetic resetting of the pig germline exhibit conservation with the human lineage Qifan Zhu1#, Fei Sang2#, Sarah Withey1^§, Walfred Tang3,4^, Sabine Dietmann3^, Doris Klisch1, Priscila Ramos-Ibeas1§, Haixin Zhang1§, Cristina E. Requena5,6, Petra Hajkova5,6, Matt Loose2, M. Azim Surani3,4,7*, Ramiro Alberio1* 1 School of Biosciences, University of Nottingham, Sutton Bonington Campus, LE12 5RD, UK. 2 School of Life Sciences, University of Nottingham, Nottingham, NG7 2RD, UK. 3 Wellcome Trust/Cancer Research UK Gurdon Institute, University of Cambridge, Tennis Court Road, Cambridge CB2 1QN, UK. 4 Department of Physiology, Development and Neuroscience, University of Cambridge, Downing Street, Cambridge CB2 3DY, UK. 5 MRC London Institute of Medical Sciences (LMS), London, UK. 6 Institute of Clinical Sciences (ICS), Faculty of Medicine, Imperial College London, London, UK. 7 Wellcome Trust Medical Research Council Stem Cell Institute, University of Cambridge, Tennis Court Road, Cambridge CB2 1QR, UK § Current address: P.R-I.: Animal Reproduction Department, National Institute for Agricultural and Food Research and Technology, Madrid 28040, Spain; S.W.: Stem Cell Engineering Group, Australian Institute for Bioengineering and Nanotechnology, University of Queensland, Building 75, St Lucia, QLD 4072, Australia. # Equal contribution, ^ Equal contribution * Co-corresponding authors Email addresses of corresponding authors: [email protected]; [email protected] Lead contact: Ramiro Alberio 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.08.07.241075; this version posted August 7, 2020.
  • A Novel Protein-DNA Interaction Involved with the Cpg Dinucleotide At

    A Novel Protein-DNA Interaction Involved with the Cpg Dinucleotide At

    ARTICLECell Research, 14 (4), Aug 2004 Cell Research (2004); Jie 14 ZHANG (4):283-294 et al http://www.cell-research.com A novel protein-DNA interaction involved with the CpG dinucleotide at -30 upstream is linked to the DNA methylation mediated transcription silencing of the MAGE-A1 gene Jie ZHANG, Jian YU, Jun GU, Bao Mei GAO, Ying Jun ZHAO, Peng WANG, Hong Yu ZHANG, Jing De ZHU* The State-key Laboratory for Oncogenes and Related Genes, Shanghai Cancer Institute, Shanghai Jiao Tong University, LN 2200/25, Xietu Road, Shanghai 200032, China. ABSTRACT To understand the DNA-methylation mediated gene silencing mechanisms, we analyzed in cell culture of the pro- moter function of the MAGE-A1 gene, which is frequently demethylated and over-expressed in human hepatocellular carcinoma. We have established the correlation of the DNA methylation of the promoter CpG island with expression status of this gene in a panel of the established liver cancer cell lines. The crucial CpG dinucleotide(s) within the minimal promoter subjected to the control mediated by DNA methylation with profound biological functions was also delineated. Furthermore, a novel sequence-specific DNA-protein interaction at the -30 CpG dinucleotide upstream of the gene was found having a vital part to play in the DNA methylation mediated transcription silencing of the MAGE-A1 gene. Our results would not only provide new insights into the DNA methylation mediated mechanisms over transcription of the MAGE-A1 gene, but also pave the way for further defining the cross-talk among DNA methylation, histone modifica- tion and chromatin remodeling in detail.
  • (MAGEA1) (NM 004988) Human Tagged ORF Clone Product Data

    (MAGEA1) (NM 004988) Human Tagged ORF Clone Product Data

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC202134 MAGE 1 (MAGEA1) (NM_004988) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: MAGE 1 (MAGEA1) (NM_004988) Human Tagged ORF Clone Tag: Myc-DDK Symbol: MAGEA1 Synonyms: CT1.1; MAGE1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC202134 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCTCTTGAGCAGAGGAGTCTGCACTGCAAGCCTGAGGAAGCCCTTGAGGCCCAACAAGAGGCCCTGG GCCTGGTGTGTGTGCAGGCTGCCGCCTCCTCCTCCTCTCCTCTGGTCCTGGGCACCCTGGAGGAGGTGCC CACTGCTGGGTCAACAGATCCTCCCCAGAGTCCTCAGGGAGCCTCCGCCTTTCCCACTACCATCAACTTC ACTCGACAGAGGCAACCCAGTGAGGGTTCCAGCAGCCGTGAAGAGGAGGGGCCAAGCACCTCTTGTATCC TGGAGTCCTTGTTCCGAGCAGTAATCACTAAGAAGGTGGCTGATTTGGTTGGTTTTCTGCTCCTCAAATA TCGAGCCAGGGAGCCAGTCACAAAGGCAGAAATGCTGGAGAGTGTCATCAAAAATTACAAGCACTGTTTT CCTGAGATCTTCGGCAAAGCCTCTGAGTCCTTGCAGCTGGTCTTTGGCATTGACGTGAAGGAAGCAGACC CCACCGGCCACTCCTATGTCCTTGTCACCTGCCTAGGTCTCTCCTATGATGGCCTGCTGGGTGATAATCA GATCATGCCCAAGACAGGCTTCCTGATAATTGTCCTGGTCATGATTGCAATGGAGGGCGGCCATGCTCCT GAGGAGGAAATCTGGGAGGAGCTGAGTGTGATGGAGGTGTATGATGGGAGGGAGCACAGTGCCTATGGGG AGCCCAGGAAGCTGCTCACCCAAGATTTGGTGCAGGAAAAGTACCTGGAGTACCGGCAGGTGCCGGACAG TGATCCCGCACGCTATGAGTTCCTGTGGGGTCCAAGGGCCCTTGCTGAAACCAGCTATGTGAAAGTCCTT GAGTATGTGATCAAGGTCAGTGCAAGAGTTCGCTTTTTCTTCCCATCCCTGCGTGAAGCAGCTTTGAGAG