Death Receptor 3 (DR3) Gene Duplication in a Chromosome Region 1P36.3: Gene Duplication Is More Prevalent in Rheumatoid Arthritis

FULL PAPER Death receptor 3 (DR3) gene duplication in a chromosome region 1p36.3: gene duplication is more prevalent in rheumatoid arthritis

K Osawa1,2, N Takami1,2, K Shiozawa3, A Hashiramoto1,2,4 and S Shiozawa1,2,4,5 1Department of Rheumatology, Kobe University FHS School of Medicine, Kobe, Japan; 2Division of Bioregulation, Kobe University Graduate School of Medicine, Kobe, Japan; 3Department of Rheumatology, Konan Kakogawa Hospital, Kakogawa, Japan; 4Rheumatic Diseases Division, Kobe University Hospital, Kobe, Japan; 5Investigator of the Center of Excellence (COE), Japan

The death receptor 3 (DR3) gene is a member of the apoptosis-inducing Fas gene family. In the current study, fluorescence in situ hybridization (FISH) and Fiber-FISH revealed the existence of a second DR3 gene B200 kb upstream of the original DR3 gene. The existence of the duplicated DR3 gene was confirmed by sequencing the corresponding human artificial chromosome clones as well as with quantitative PCR that measured the ratio of the DR3 gene mutation (Rm), intrinsic to rheumatoid arthritis (RA) patients, by simultaneous amplification of the normal and mutated DR3 sequences. The DR3 gene duplication measured by FISH was found to be more frequent in patients with RA as compared to healthy individuals. We therefore surmise that the human DR3 gene can be duplicated and that this gene duplication is more prevalent in patients with RA. Genes and Immunity (2004) 5, 439–443. doi:10.1038/sj.gene.6364097 Published online 8 July 2004

Keywords: gene duplication; death receptor 3 (DR3); fluorescence in situ hybridization (FISH); rheumatoid arthritis (RA)

Introduction The current study examines the location of the DR3 gene based on the previous findings of Grenet et al,7 who The death receptor 3 (DR3), also named Ws1, Apo3, showed that the DR3 gene was duplicated and tandemly TRAMP, LARD, TR3 or TNFRSF25, is a member of the located in 1p36.2–1p36.3 in one male healthy donor. The tumor necrosis factor receptor (TNFR) superfamily authors suggested that duplicated genes are hemizy- which includes CD95/Fas, TNFR1, DR4, DR5 and gously deleted and/or possibly translocated to another DR6.1,2 DR3 contains four characteristic cysteine-rich chromosome as revealed in neuroblastoma cell lines. motifs as well as a death domain capable of inducing Using FISH, DNA sequencing and quantitative PCR, we cellular apoptosis and proliferation.3,4 We previously demonstrate here that the human DR3 gene can be assigned three principal chromosome regions of linkage, duplicated and that the duplicated DR3 gene is located D1S253/214, D8S556 and DXS1232, with maximum lod B200 kb upstream of the original DR3 gene sequence. scores (MLSs) 3.77/6.13, 4.20/1.14 and 2.35/3.03, respec- These findings are discussed in relation to the increased tively, by single/multi-point analyses.5 The death recep- frequency of gene duplication found in patients with RA. tor 3 (DR3) gene was mapped in the vicinity of D1S214/ 253 by the GeneBridge 4.0 radiation hybrid panel. Based on the EBI/Sanger Institute ENSEMBL database, D1S214 Results and discussion and D1S253 reside at 6.7 and 6.0 Mb, respectively, and Visual imaging DR3 at 6.2 Mb of chromosome 1p36. We subsequently To locate the DR3 gene using FISH, we used two probes, identified a polymorphism in the DR3 gene containing P1-derived artificial chromosome (PAC) clone 650H14 four single-nucleotide polymorphisms (SNPs) and one (GenBank accession no. AL158217) containing the DR3 locus of a 14 nucleotide deletion within exon 5 and intron gene and control PAC 126A5 (GenBank accession no. 5: g.1755A4G, g.2457_2470delT14, g.2531C4T, AL031447), each spanning the region between D1S214 g.2678A4T and g.2826A4G (GenBank accession nos. and D1S253 (Figure 1a). We found that the number of AB051850 to DR3 and AB051851 to mutant DR3). These fluorescent signals derived from PAC 650H14 was polymorphisms were found to be genetically associated between 2 and 4 (Figure 1b), whereas the number of with rheumatoid arthritis (RA).6 signals from PAC 126A5 was exactly 2, suggesting the existence of gene duplication in the chromosome region containing the DR3 gene. Correspondence: Dr S Shiozawa, Department of Rheumatology, Kobe We tried to confirm this by using the Fiber-FISH University FHS School of Medicine, 7-10-2 Tomogaoka, Sumaku, Kobe 654-0142, Japan. E-mail: [email protected] technique. The result showed that the PAC 650H14 Received 06 February 2004; revised 31 March 2004; accepted 31 (green) and PAC 126A5 (red) hybridization signals were March 2004; published online 8 July 2004 located in tandem. Interestingly, one additional green DR3 gene duplication and rheumatoid arthritis K Osawa et al 440

Figure 1 FISH and Fiber-FISH study. (a) Location of PAC 650H14 clone containing the DR3 gene and control PAC 126A5 clone. We performed FISH using PAC clone 650H14 (54 kb) and PAC 126A5 (112 kb). According to the NCBI and EBI/Sanger Institute ENSEMBL databases, PAC 650H14 contains the DR3 gene. Location of DR3 mutation was depicted in relation to transmembrane (TM) and death domain (DD) portions. a: g.1755A4G, b: g.2457_2470delT14, c: g.2531C4T, d: g.2678A4T and e: g.2826A4G (GenBank accession no. AB051850) corresponded to a: g.3658A4G, b: g.4360_4373delT14, c: g.4434C4T, d: g.4581A4T and e: g.4729A4G according to GenBank accession no. AY254324. Numbered boxes represented exons. cDNA nucleotide and amino acid numbered according to Marsters et al.4 (b) FISH imaging by using rhodamine-labeled PAC 650H14. Human peripheral blood mononuclear cells (PBMC), cultured with 10 mg/ml of phytohaemagglutinin (PHA) for 72 h, were treated with 40 ng/ml of colcemid for 15 min and a hypotonic 75 mM KCl solution at 371C for 20 min, followed by fixation in methanol-acetate (3:1). A drop of fixed cell suspension was placed on a glass slide at 721C and air-dried. DNA of PAC clones was labeled by nick translation with biotin-16-dUTP or digoxigenin-11-dUTP. The slides of metaphase chromosomes were denatured, dehydrated and air-dried. Denatured biotin- or digoxigenin-labeled DNA probes were then applied and hybridized signals were detected with avidin- FITC and biotinylated anti-avidin D for biotin-labeled probes or with Fab fragment of rhodamine-labeled anti-digoxigenin-fluorescein for digoxigenin-labeled probes. After counter-staining with 40,6-diamidino-2-phenylindole dihydrochloride (DAPI), more than 20 metaphase chromosomes were analyzed for the hybridization signals for each sample under Laser Scan Microscope LSM510 (Carl Zeiss GmbH, Stuttgalt, Germany). Four red dots indicated duplicated DR3 genes (arrows). (c) Fiber-FISH signal of PAC 126A5 (red) and PAC 650H14 (green) clones. For chromatin DNA fiber stream preparation (Fiber-FISH), glass slides containing a drop of fixed cell suspension were placed in phosphate- buffered saline, and a solution containing NaOH and ethanol was dragged over the cells using the short edge of a long coverslip. The slides were rinsed with methanol, air-dried and observed under LSM510.16,17 The position of duplicated gene revealed in relation to original PAC 650H14 and PAC 126A5 clones in a short chromosome 1p36.3 region prepared from a representative patient with RA.

signal from PAC 650H14 was found in the upstream encompassing DR3 as TNFRSF12L to the NCBI database region of the DNA fiber towards the microsatellite without exactly locating its position. They simultaneously marker D1S214 (Figure 1c). As all signal lengths were reported in a separate manuscript, however, that the DR3 normalized according to the size of the probes gene as well as a duplicate copy of the gene were both (B0.01 mm/kb), the location of the duplicated region of located at 1p36 and separated by several megabases. PAC 650H14 was estimated to be B200 kb upstream of Second, Gururajan et al8 reported that the human Cdc2L1 the original PAC 650H14 towards the direction of the and Cdc2L2 genes, encoding almost identical protein centromere. This type of gene duplication was not kinases, were located at 1p36 in close proximity to p73 observed for PAC 126A5 or for the chromosomes and that the two genes were separated by only B50 kb. containing only one DR3 allele as revealed by FISH. Third, the two genes of the human Rhesus (RH) blood The DR3 gene duplication was not clearly assigned in the group locus, RHD and RHCE, also located in 1p36.1, are NCBI and the EBI/Sanger Institute ENSEMBL databases. separated by less than 200 kb.9 Therefore, we surmise that Gene duplication has been frequently reported in this the 1p36.2 and 1p36.3 regions, which contain a number of area of 1p36. First, Grenet et al7 registered a small region other members of the apoptotic gene family, including

Genes and Immunity DR3 gene duplication and rheumatoid arthritis K Osawa et al 441 TNFRII,10 CD30,11 OX4012 and 4-1BB13,aresubjecttoa Figure 2b. In doing this, we found that, together, PAC similar phenomenon, and that gene duplication, if present, 650H14 and BAC 58A11 contained the entire DR3 gene is not unique to the DR3 gene. sequence. While both of these clones have not been previously reported to contain the DR3 gene, the NCBI Study of artificial clones database notes that the reported sequence did not Query of the NCBI database revealed the existence of include the entire insert sequences in the BAC 58A11 seven PAC and BAC clones of human chromosome 1 sequence. We may therefore assign the DR3 gene to PAC genomic contig that encompassed D1S214 and D1S253. 650H14. We sequenced the DNA of PAC 650H14, PAC 126A5, We also found a portion of the BAC 239P22 sequence PAC 202O8 (GenBank accession no. AL031848), bacterial overlapped with PAC 126A5 (1–2000 bp). We determined artificial chromosome (BAC) clone 58A11 (GenBank through DNA sequencing that BAC 239P22 also con- accession no. AL591866), BAC 239P22 (GenBank acces- tained the complete DR3 gene sequence. It again appears sion no. AL159177), BAC 242F24 (GenBank accession no. that the previously reported sequence in the NCBI AL591163) and BAC 312B8 (GenBank accession no. database did not represent the entire insert sequence in AL590128) located between D1S253 and D1S214 in the BAC 239P22 sequence. In studying this clone, we chromosome 1p36.3 (Figure 2a). Sequencing showed that identified two loci of four-nucleotide and eight-nucleo- PAC 125A5, BAC 239P22, BAC 242F24 and BAC 312B8 tide deletions within exon 1, as well as two SNPs in exon are located in tandem, with a certain proportion of 1 and intron 6 (Figure 2b). As was the case for the overlapping sequence among them (Figure 2a). The original DR3 gene, we had difficulty in amplifying the results showed that D1S214 was contained in the BAC 78 bp region containing poly T sequences within intron 5, 312B8 clone. We next sequenced all the seven artificial possibly due to polymerase slippage. We found that BAC clones within the DR3 region and compared the results 239P22 did not overlap with BAC 58A11, because (1) to the known DR3 cDNA sequence.3 We amplified seven PAC 126A5 did not overlap with BAC 58A11, and (2) genomic fragments A, B, C, D, E, F and G as shown in another gene called FLJ10737 existed in between the PAC

a 1p 36.3 DR3 DR3

J10737 D1S214 D1S253 L duplicated duplicated MGC33488 HES2 ESPN CAMTA1 TASIRI BACH KIAA720 HKR3 F DR3 (TNFRSF25) cen ter

100kb BAC312B8 PAC126A5 PAC202O8

BAC242F24 PAC650H14

BAC239P22 BAC58A11 b B D F

A CEG ATG TGA

123 45678 910 TM DD

Exon 1 1kb

DR3 1 CGGGCCCTGCGGGCGCGGGGCTGAAGGCGGAACCACGACGGGCAGAGAGCACGGAGCCGG duplicated DR3 1 CGGGCCCT------GCGCGGGGCTGAAGGCGGAACCACGACGGGCAG------GAGCCGG

DR3 61 GAAGCCCCTGGGCGCCCGTCGGAGGGCTATGGAGCAGCGGCCGCGGGGCTGCGCGG····· duplicated DR3 49 GAAGCCCCTGGGTGCCCGTCGGAGGGCTATGGAGCAGCGGCCGCGGGGCTGCGCGG····· Intron 6

DR3 3121 CAGAGTAGGTGGTGTGCTGGGAATGCGAGTGGGAGAACTGGGATGGACCGAGGGGA······· duplicated DR3 3109 CAGAGTAGGTGGTGTGCTGGGAATGCGAGTGGGAGAACTGGGATGGGCCGAGGGGA ······ Figure 2 Study of artificial clones. (a) Location of original and duplicated DR3 genes, three PAC clones (650H14, 126A5, 202O8) and four BAC clones (58A11, 239P22, 242F24, 312B8) in relation to D1S214 and D1S253. Black dots represented overlapped identical genes, and a rhombus represented a newly identified duplicated DR3 gene. (b) Structure and sequence of original and duplicated DR3 genes, as sequenced from human PAC and BAC clones by using probes A–G. The primers used for amplifying the DR3 gene were: 50- TTGAAGTGGTTCTCAGGGTT-30 (forward) and 50-CTCTTGGGACAGGGCTCAAAGCT-30 (reverse) for region A; 50-CTGAAGGCGGAAC- CACGA-30 (forward) and 50-AGGCGAAAGACAGACAGGTACAG-30 (reverse) for region B; 50-GCCTGGGAGAACCACCATAATTCTG-30 (forward) and 50-CCACAGACACTATTCACTGAGC-30 (reverse) for region C; 50-GCCAGGCTGGTTTGTGGA-30 (forward) and 50- TCCATCCCAGTTCTCCCAC-30 (reverse) for region D; 50-GCTGTCTGTGGCTGGAGGC-30 (forward) and 50-TCTCACTGCTGTCAG- GAGGTGCT-30 (reverse) for region E; 50-GATTCGTACACAGGAGCTAACAGTTC-30 (forward) and 50-AGCTGTTACCCACCAACTGGAC- 30 (reverse) for region F; and 50-GTCCAGTTGGTGGGTAACAGCTGGA-30 (forward) and 50-AGCGCTTGAGCATCTCGTACTGC-30 (reverse) for region G. The PCR products were directly sequenced in an ABI 3700 sequencer (Applied Biosystems, Lincoln Centre Drive Foster City, CA, USA) using the BigDye Terminator Cycle Sequencing kit. Mutated nucleotides are underlined.

Genes and Immunity DR3 gene duplication and rheumatoid arthritis K Osawa et al 442 126A5 and BAC 239P22 clones. The reported DNA þ/þ ,mt/þ and mt/mt, respectively; where mt repre- sequence of FLJ10737 was found in tandem without sents the individuals with the haplotypes a: g.1755A4G, interruption in the PAC 126A5 and BAC 239P22 clones in b: g.2457_2470delT14, c: g.2531C4T, d: g.2678A4T and Homo sapiens chromosome 1 genomic contig (GenBank e: g.2826A4G (Figure 1a). The result showed that, while accession no. NT_028054). In addition, our DNA fiber the Rm of individuals with þ / þ (n ¼ 30) was exactly stream preparation (Fiber-FISH) showed that the PAC 0%, the Rm of those with mt/mt was 95.1% for SNPa and 126A5 signal was located exactly upstream of the 84.2% for SNPd, respectively (Figure 3a). The Rm of original PAC 650H14, in the direction of D1S214 and those with mt/ þ was 45.6724.3% (13.5–82.2%) (n ¼ 6) the centromere (Figure 1c). Together, we conclude from for the SNPa locus and 40.6716.2% (24.7–66.6%) (n ¼ 6) these findings that the DR3 gene contained in the BAC for the SNPd locus. If the gene was in single copy, the Rm 239P22 clone is a duplicate copy of the original DR3 of those with mt/ þ should be exactly 50% (Figure 3b). gene. However, as shown in Figure 3a, the Rm of those with mt/ þ was evenly distributed at 25, 50 and 75% with a focus on 50%. The results therefore support a gene Study of the ratio of mutation duplication model. The ratio of mutation (Rm), intrinsic to the DR3 gene in patients with RA,6 was measured by simultaneously amplifying normal and mutated DR3 DNA from RA Frequency of gene duplication patients whose genetic polymorphism was confirmed by Further, more than 20 metaphase chromosomes per sequencing. It can normally be expected that the Rm will person were scored using FISH and the mean allele be 0, 50 and 100% among individuals with the genotypes number observed for each individual was plotted. A

a (%) (%) 100 100 90 90 80 80 70 70 (Rm) for SNPd (Rm) for SNPa 60 60 50 50 40 mt/mt 40 mt/mt 30 mt/+ 30 mt/+ 20 +/+ 20 +/+

Ratio of mutation 10 Ratio of mutation 10

-5 -4 -3 -2 -1 0 1 2 3 4 5 -5 -4 -3 -2 -1 0 1 2 3 4 5 ∆ Ct ∆ Ct

b Duplicated gene model

+/+

mt/+ × × × × × × 25%50% 75%

mt/mt Rm × × %: × × × mutation 100% no mutation

Figure 3 Quantitative PCR study of the ratio of mutation (Rm). (a) The Rm for SNPa (left) and SNPd (right) locus of DR3 gene6 in the individuals with genotypes þ / þ (open circle) (n ¼ 30), mt/ þ (closed circle) (n ¼ 6) and mt/mt closed (square). To determine the ratio of mutation (Rm) for the DR3 gene, we measured the allele frequencies for each of the target genes using the methods as described by Germer et al.18 The Rm was calculated by using DCt of quantitative PCR. The quantitative PCR reactions used either a normal (Reaction I) or a mutated forward primer (Reaction II, 30-portion of sense primer specific for disease-associated SNP) in conjunction with a common reverse primer and SYBR Green PCR Master Mix reagent containing uracil-N-glycosylase (UNG). A standard curve was constructed by amplifying in an ABI PRISM 7700 (Applied Biosystems) 0:100, 20:80, 25:75, 33:66, 50:50, 66:33, 75:25, 80:20 and 100:0 mixtures of normal vs mutated DR3 exons 4–7 that had been subcloned into the pT7Blue vector (Novagen). The PCR thermal cycling conditions were as follows: a pre-run of 501C for 2 min and 951C for 12 min, followed by 45 cycles at 951C for 20 s and 581C for 20 s, and a final incubation at 721C for 20 min. When the ratio of mixed plasmids (simulating a range of Rm) was plotted on the y-axis and DCt was plotted on the x-axis, a standard S-shaped curve was obtained. The ratio of mutation (Rm) was expressed as Rm ¼ exp(DCt)/(1 þ exp(DCt)), where DCt ¼ (Ct of Reaction I)À(Ct of Reaction II). Genomic DNA was then quantified accordingly. The primers were: 50-CAGGTTCCCGCAGAGA-30 (forward; normal) or 50-CAGGTTCCCG- CAGAGG-30 (forward; mutated), and 50-CCACGACAGCTAGGAATTACGT-30 (reverse) for SNPa; 50-GCCAAGATGGTCTTGATCA-30 (forward; normal) or 50-TAGCCAAGATGGTCTTGATCT-30 (forward; mutated), and 50-GCACCTAGAACAGTGTGTAGAACATAGCA-30 (reverse) for SNPd (Figure 1a). (b) Distribution of Rm among individuals fitted a duplicated gene model.

Genes and Immunity DR3 gene duplication and rheumatoid arthritis K Osawa et al 443 Table 1 Frequency of DR3 gene duplication

N With gene duplication Without gene duplication w2 OR (95% CI)

Healthy individuals 28 11 (0.39) 17 (0.61) P ¼ 0.01 5.56 (1.60–19.4) Rheumatoid patients 23 18 (0.78) 5 (0.22)

N, number of individuals studied. Parenthesis, proportion. OR, odds ratio. Metaphase chromosome spreads were prepared and processed for FISH. The patients with RA fulfilling the diagnostic criteria of the American College of Rheumatology and their pedigrees19 or geographically and ethnically similar healthy individuals living in the same distinct, Hyogo prefecture, Japan, were compared, under the written consent based on certification of the ethical board of Kobe University Graduate School of Medicine. Healthy individuals, n ¼ 28 (14 males; 14 females), and rheumatoid patients, n ¼ 23 (four males; 19 females).

result was obtained if 460% of the score value fell into a death domain and activates apoptosis and NF-kB. Curr Biol either the duplicated or no duplicated category. The 1996; 6: 1669–1676. frequency of DR3 gene duplication using this method 5 Shiozawa S, Hayashi S, Tsukamoto Y et al. Identification of the was 78% (18/23) in patients with RA and 39% (11/28) in gene loci that predispose to rheumatoid arthritis. Int Immunol healthy individuals (P ¼ 0.01, odds ratio 5.56) (Table 1). 1998; 10: 1891–1895. The finding may be in line with Ohno’s proposal that 6 Shiozawa S, Hashiramoto A, Kawasaki H et al. Evidence for gene duplication can be a prerequisite for evolution.14 We functional variation of the death receptor 3 (DR3) gene that inhibits apoptosis and predisposes to progressive joint found that disease-associated DR3 haplotype containing destruction in ‘rheumatoid arthritis. submitted for publica- four SNPs and one 14 nucleotide deletion within exon 5 tion. and intron 5 was significantly concentrated in a popula- 7 Grenet J, Valentine V, Kitson J, Li H, Farrow SN, Kidd VJ. tion of Japanese familial patients with RA as compared Duplication of the DR3 gene on human chromosome 1p36 with healthy control (Po0.0006),6 which may imply that, and its deletion in human neuroblastoma. Genomics 1998; 49: while the vast majority of gene duplicates are silenced 385–393. within a few million years of evolution, gene duplication 8 Gururajan R, Lahti JM, Grenet J et al. Duplication of a genomic also has the potential to generate substantial molecular region containing the Cdc2L1-2 and MMP21-22 genes on substrate for the origin of evolutional novelties.15 human chromosome 1p36.3 and their linkage to D1Z2. Genome Res 1998; 8: 929–939. 9 Suto Y, Ishikawa Y, Hyodo H, Uchikawa M, Juji T. Gene organization and rearrangements at the human Rhesus blood Acknowledgements group locus revealed by fiber-FISH analysis. Hum Genet 2000; 106: 164–171. We thank Professor J Inazawa and Dr F Saito-Ohara at 10 Kemper O, Derre´ J, Cherif D, Engelmann H, Wallach D, Berger the Tokyo medical and dental University for their R. The gene for the type II (p75) tumor necrosis factor receptor technical advise on FISH and Fiber-FISH, and Drs (TNF-RII) is localized on band 1p36.2-p36.3. Hum Genet 1991; Y Konishi, H Kawasaki, Y Miura, K Komai and 87: 623–624. K Murayama at Kobe University for useful advice. We 11 Fonatsch C, Latza U, Du¨rkop H, Rieder H, Stein H. Assign- also thank Dr M Lamphier for critical reading of the ment of the human CD30 (Ki-1) gene to 1p36. Genomics 1992; manuscript. This study is expected to be a doctoral thesis 14: 825–826. 12 Latza U, Du¨ rkop H, Schnittger S et al. The human OX40 of KO. This investigation was supported in part by a homolog: cDNA structure, expression and chromosomal Grand-in-Aid for Scientific Research of the Ministry of assignment of the ACT35 antigen. Eur J Immunol 1994; 24: Education, Culture, Sports, Science and Technology of 677–683. Japan, Nos. 14657117 to KO and 13204059 to SS. This 13 Schwarz H, Arden K, Lotz M. CD137, a member of the tumor research was also supported by a grant for 21st Century necrosis factor receptor family, is located on chromosome COE Program, ‘Center of Excellence for Signal Transduc- 1p36, in a cluster of related genes, and colocalizes with several tion disease: Diabetes Mellitus as Model’ from the malignancies. Biochem Biophys Res Commun 1997; 235: 699–703. Ministry of Education, Culture, Sports, Science and 14 Ohno S. Evolution by Gene Duplication. Springer-Verlag: Berlin, Technology of Japan to SS. 1970. 15 Lynch M, Conery JS. The evolutionary fate and consequences of duplicate genes. Science 2000; 290: 1151–1155. 16 Parra I, Windle B. High resolution visual mapping of stretched References DNA by fluorescent hybridization. Nat Genet 1993; 5: 17–21. 1 Locksley RM, Killeen N, Lenardo MJ. The TNF and TNF 17 Fidlerova´ H, Senger G, Kost M, Sanseau P, Sheer D. Two receptor superfamilies: integrating mammalian biology. Cell simple procedures for releasing chromatin from routinely 2001; 104: 487–501. fixed cells for fluorescence in situ hybridization. Cytogenet Cell 2 Kitson J, Raven T, Jiang YP et al. A death-domain-containing Genet 1994; 65: 203–205. receptor that mediates apoptosis. Nature 1996; 384: 372–375. 18 Germer S, Holland MJ, Higuchi R. High-throughput SNP 3 Chinnaiyan AM, O’Rourke K, Yu GL et al. Signal transduction allele-frequency determination in pooled DNA samples by by DR3, a death domain-containing receptor related to TNFR- kinetic PCR. Genome Res 2000; 10: 258–266. 1 and CD95. Science 1996; 274: 990–992. 19 Arnett FC, Edworthy SM, Bloch DA et al. The American 4 Marsters SA, Sheridan JP, Donahue CJ et al. Apo-3, a new rheumatism association 1987 revised criteria for the classifica- member of the tumor necrosis factor receptor family, contains tion of rheumatoid arthritis. Arthritis Rheum 1988; 31: 315–324.

Genes and Immunity