Flexibility of the Yeast A2 Repressor Enables It to Occupy the Ends of Its Operator, Leaving the Center Free

Downloaded from genesdev.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press Flexibility of the yeast a2 repressor enables it to occupy the ends of its operator, leaving the center free Robert T. Sauer,* Dana L. Smith, and Alexander D. Johnson Departments of Microbiology and Biochemistry/Biophysics, University of California, San Francisco, California 94143 USA The yeast a2 protein, the product of the MATal gene, is a regulator of yeast cell type; it turns off transcription of the a-specific genes by binding to an operator located upstream of each gene. In this paper we describe the domain structure, subunit organization, and some unusual features of the way this protein contacts its operator. We show that the protein is folded into two domains. The carboxy-terminal domain binds specifically to the operator; the amino-terminal domain contains dimerization contacts. The a2 dimer differs from those of the phage repressors in that it is flexible and therefore is able to bind tightly to differently spaced operator half-sites. In the natural operator, the centers of the operator half-sites are two and one-half turns of DNA apart, exposing them on opposite sides of the DNA helix. We show that the design of a2 allows a dimer to reach across its operator such that it occupies the two half-sites but leaves the middle of the operator available to other proteins. [Key Words: DNA-protein interaction; repressor; gene expression; homeo domain] Received March 29, 1988; revised version accepted May 13, 1988. The yeast a2 protein is related by sequence (and presum of 24,000, its amino-terminal sequence is Met-Asn-Lys- ably structure) and by function (the determination of Ile..., and the purified protein exhibits the expected cell type) to a large group of proteins that contain the amino acid composition (see Methods). The presence of so-called homeo domain (for review, see Gehring 1987). the amino-terminal Met is consistent with the fact that These proteins are all thought to act, at least in part, by the E. coli methionine aminopeptidase fails to cleave be binding to specific DNA sequences and modulating the fore an asparagine (see Flinta et al. 1986; Ben-Bassat and expression of nearby target genes (see e.g., Laughon and Bauer 1987). We do not yet know whether the amino-ter Scott 1984; Desplan et al. 1985). For the case of a2, we minal methionine is present in al produced from yeast, know that this protein recognizes an operator located but the protein produced in E. coh comigrates with al upstream of each of its target genes (the a-specific genes) from yeast on SDS gels (A. Vershon, unpubl.). This sug and that it turns off transcription of these genes by gests that no drastic modifications of al occur in yeast. binding to these operators (see Fig. 1; Johnson and Hers- kowitz 1985). In this paper we utilize al purified to homogeneity Domain structure of the a2 protein from an overproducing strain of Escherichia coh to de Cleavage of the purified al protein with chymotrypsin termine the domain structure, subunit arrangement, and generates two major fragments. As shown in Figure 2B, fimctional organization of al. We show that the design the yield of these fragments remains relatively constant of al and its operator allows access of proteins to the between 10 and 640 min of digestion. This resistance to center of the operator even when al is bound. further proteolysis indicates that these fragments are folded stably and correspond to structural domains of Results al. The chymotryptic fragments of al were purified, and their amino-terminal sequences and amino acid compo Overexpression and purification of the a2 protein sitions were determined (see Methods). This analysis As described in Methods, the al protein was overex- showed that the larger fragment consists of amino acids pressed in E. coli and purified to apparent homogeneity. 1-102 and the smaller fragment consists of amino acids An SDS gel profile of the purified protein is shown in 132-210 of al (210 residues total). We will refer to these Figure 2, lane 1. As predicted from the DNA sequence fragments as the amino-terminal and carboxy-terminal (Astell et al. 1981), al has a monomer molecular weight fragments, respectively. (Close inspection of Fig. 2 re veals a minor digestion product that migrates just ahead of the carboxy-terminal fragment; this minor product Ôn sabbatical leave from the Department of Biology, Massachusetts In stitute of Technology, Cambridge, Massachusetts 02139 USA appears at early times of digestion but disappears at late GENES & DEVELOPMENT 2:807-816 © 1988 by Cold Spring Harbor Laboratory ISSN 0890-9369/88 $1.00 807 Downloaded from genesdev.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press Sauer et al. Figure 1. Control of the a-specific genes by al. {Top) al turns off transcription of the five known a-specific genes by binding to an operator located upstream of each gene; for the cases of the STE6, BARl, and STE2 genes, the binding has been demonstrated biochemically (Johnson and Hers- kowitz 1985; L. Evnin and A. Johnson, unpubl.). Interaction of al with the MFal and MFa2 se quences has been inferred on the basis of strong sequence conservation. The numbers beneath each operator refer to the approximate distance from the center of the operator to the start of the structural gene. {Bottom] The sequences of the five operators. The sixth line shows a rough con -245 MFa2 sensus sequence. The seventh and eighth lines indicate that the operator contains two different axes of approximate twofold symmetry; the two STE6 CATGTAATTACCTAATAGGGAAA TTTACACGCT axes are offset by 1/2 bp. Taken from Johnson BARl CATGTAATTACCGAAAAAGGAAA TTACATGGCG and Herskowitz (1985), this figure includes se STE2 CATGTACTTACCCAATTAGGAAA TTTACATGGT quence information from the following sources: MFa1 TGTGTAATTACCCAAAAAGGAAA TTTACATGTT STE6 (Wilson and Herskowitz 1986) BARl MFa2 CATGTATTTACCTATTCGGGAAA TTTACATGAC (Kronstad et al. 1987), STE2 (Burkholder and CATGTAATTACC-AATAAGGAAA TTTACATG-T Hartwell 1985; Miller et al. 1985), MFal and AATT-CC- - A|T- -GG-AAT T MFa2 (Brake et al. 1985). CATGTAA- T--C \ G--A -TTACATG times. We also purified this fragment and determined its omeric comes from sedimentation equilibrium experi amino-terminal sequence and composition; it consists ments performed by Bill Werner and Howârd of amino acids 132-205. Because of lov^ yields, this frag Schachman at University of California, Berkeley. They ment was not studied further.) observed that, at equilibrium, the reduced al was dis- Subunit structure of the intact a2 protein B 1 2 3 4 5 6 7 8 9 10 11 Purified al exists as a covalently linked dimer, with the linkage occurring through disulfide bonds between amino-terminal domains. This conclusion is based on the observation that the apparent size of al on SDS gels doubles if the protein is not treated with reducing agents prior to electrophoresis. Lane 1 of Figure 2A shows that when al was denatured by heating in SDS and 2-mercaptoethanol, it migrated with the expected molecular weight of 24,000. Lane 2 of Figure 2A shows that when the 2-mercaptoethanol was omitted from the sample buffer, the purified protein migrated with an apparent molecular weight of approximately 45,000. Next, we used gel filtration chromatography and sedi mentation velocity centrifugation experiments to ex amine the apparent molecular weight of reduced and disulfide-linked al under native conditions. These results Figure 2. SDS-gel profiles of intact al and chymotryptic frag are shown in Figures 3 and 4. Reduced al migrates ments of al.{A) Disulfide-linked and reduced al. (Lane 1] Puri through the sizing column with an apparent molecular fied al electrophoresed through a 12% acrylamide gel, ac weight of 35,000 and sediments through a sucrose gra cording to Laemrrdi (1970). 2-Mercaptoethanol was included in dient with an apparent molecular weight of 17,000. the sample buffer, and the sample was heated at 90°C for 2 min These values can be compared to the expected molecular prior to electrophoresis. (Lane 2) An aliquot from the same batch of al treated in the same way, except that the 2-mercap weight of an al monomer, 24,000. The simplest inter toethanol was omitted from the sample buffer. (B) Generation pretation of these data is that reduced al is a monomer of chymotryptic fragments of al. (Lane 1] Purified al; (lane 2) with a somewhat elongated shape. A molecule of this blank; (lane 3-11] purified al after treatment with chymo- type would migrate faster than expected through a sizing trypsin (E : S = 1 : 6000) for 2.5, 5, 10, 20, 40, 80, 160, 320, and column and slower than expected through a sucrose gra 640 min, respectively. All samples were heated in 2-mercap dient. Further evidence that reduced al is, in fact, mon- toethanol prior to electrophoresis through a 12% SDS gel. 808 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press Yeast al repressor Superose-12 Column \d. n ~/^^ 1 y^^ Alpha2 (S-S) >/°BSA 11 -1 s y/^ Oval yÂlpha2 (SH) 10- Figure 3. Mobilities of reduced and disulfide-linked al Mb on a superose-12 gel filtration column. The molecular weights of the standards are IgG (158,000), BSA /^ Cyc (68,000), ovalbumin (43,000), myoglobin (17,000) and cytochrome c (12,000). The relative mobility of IgG was 9 - 1 r 1 1 —1 1 1 1 1 1 1 1 • set at 1.0, and that of myoglobin was set at 0.

Load more