DOCSLIB.ORG

Nuclear Ribosomal DNA Evidence for a Western North American Origin of Hawaiian and South American Species of Sanicula (Apiaceae)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Nuclear Ribosomal DNA Evidence for a Western North American Origin of Hawaiian and South American Species of Sanicula (Apiaceae) Proc. Natl. Acad. Sci. USA Vol. 95, pp. 235–240, January 1998 Evolution Nuclear ribosomal DNA evidence for a western North American origin of Hawaiian and South American species of Sanicula (Apiaceae) PABLO VARGAS†,BRUCE G. BALDWIN‡, AND LINCOLN CONSTANCE Jepson Herbarium and Department of Integrative Biology, University of California, Berkeley, CA 94720-2465 Communicated by Peter H. Raven, Missouri Botanical Garden, St. Louis, MO, November 7, 1997 (received for review July 17, 1997) ABSTRACT Results from phylogenetic analysis of nu- Raillardiopsis) ancestry of the Hawaiian silversword alliance clear rDNA internal transcribed spacer (ITS) sequences from (Argyroxiphium, Dubautia, Wilkesia) provides one unequivocal a worldwide sample of Sanicula indicate that Hawaiian example of such dispersal in the sunflower family (4–6). In this sanicles (Sanicula sect. Sandwicenses) constitute a monophy- paper, we provide phylogenetic evidence from nuclear ribo- letic group that descended from a western North American somal DNA internal transcribed spacer (ITS) sequences for ancestor in Sanicula sect. Sanicoria, a paraphyletic assemblage another example of angiosperm dispersal from the Pacific of mostly Californian species. A monophyletic group compris- coast of temperate western North America to the Hawaiian ing representatives of all 15 species of S. sect. Sanicoria and the Islands involving Sanicula (Apiaceae). In addition, we show three sampled species of S. sect. Sandwicenses was resolved in evidence for two amphitropical dispersals of sanicles from all maximally parsimonious trees, rooted with sequences from temperate western North America to southern South America. species of Astrantia and Eryngium. All sequences sampled from eastern North American, European, and Asian species of MATERIALS AND METHODS Sanicula fell outside the ITS clade comprising S. sect. Sani- coria and S. sect. Sandwicenses. A lineage comprising the We examined DNAs from one to six populations of 23 species Hawaiian taxa and three species endemic to coastal or near- representing all 15 taxa in the western American Sanicula sect. coastal habitats in western North America (Sanicula arcto- Sanicoria, three of four species in the Hawaiian Sanicula sect. poides, Sanicula arguta, and Sanicula laciniata) is diagnosed by Sandwicenses (Sanicula kauaiensis may be extinct), two of six nucleotide substitutions and a 24-bp deletion in ITS2. The species from the Asian Sanicula sect. Pseudopetagnia, and hooked fruits in Sanicula lead us to conclude that the ancestor three of 13 species from the cosmopolitan Sanicula sect. of Hawaiian sanicles arrived from North America by external Sanicla (for taxonomy of Sanicula see refs. 7–10). The only bird dispersal; similar transport has been hypothesized for the section not examined was the Asian Sanicula sect. Tubercula- North American tarweed ancestor of the Hawaiian silversword tae, comprising three species (unavailable to us) regarded by alliance (Asteraceae). Two additional long-distance dispersal Shan and Constance (7) as having ‘‘diverged least from the events involving members of S. sect. Sanicoria can be con- assumed progenitors...ofthegenus.’’ Sampling encompassed cluded from the ITS phylogeny: dispersal of Sanicula crassi- the main continental distribution of the genus (Asia, Europe, caulis and Sanicula graveolens from western North America to North America, and South America) and included a Malaysian southern South America. sample of the only species known from Africa. Populations were sampled widely across the distribution of species repre- The volcanic history, extreme geographic isolation, and dis- sented by multiple DNAs (Table 1). Three species outside harmonic biota of the Hawaiian archipelago demonstrate that Sanicula in subfamily Saniculoideae (Astrantia major, Eryn- terrestrial life in the islands must have arrived by long-distance gium cervantesii, and Eryngium mexicanum) were chosen as dispersal (1). Among plants, the approximately 966 species of outgroups based on morphological and molecular evidence of indigenous Hawaiian angiosperms (89% endemic) have been close relationship to the ingroup (see ref. 11). estimated to stem from 272 to 282 natural introductions to the Total DNAs were extracted from pooled fresh leaf tissue of islands (2). On the basis of comparative floristics, Fosberg (3) 5–10 individuals per population or from dried leaf fragments hypothesized that most natural introductions of Hawaiian of herbarium specimens by using a modification of the hexa- flowering plants were from southeast Asian source areas. decyltrimethylammonium bromide (CTAB) method in Doyle and Doyle (12), with two ethanol precipitations. The 18S–26S Directionality of prevailing air currents, occurrence of inter- nuclear rDNA ITS region (ITS1, 5.8S subunit, and ITS2) was mediary ‘‘stepping-stone’’ islands, and climatic similarities PCR-amplified by using c28kj (59-TTGGACGGAATTTAC- between the Hawaiian archipelago and tropical areas to the CGCCCG-39, designed by K. W. Cullings, San Francisco State west and southwest of the islands accord with Fosberg’s University) and LEU1 (59-GTCCACTGAACCTTATCATT- estimate. TAG-39, designed by L. E. Urbatsch, Louisiana State Univer- A minority (about 18%) of ancestral Hawaiian plant colo- sity) for most samples. The internal primers ITS2, ITS3, ITS4, nists are thought to have dispersed from the Americas (3), and ITS5 (13) were used for sequencing reactions and for PCR despite unfavorable prevailing winds and water currents. Plant dispersal across the unbroken 3,900-km oceanic barrier be- tween temperate western North America and the Hawaiian Abbreviations: ITS, internal transcribed spacer of 18S–26S nuclear Islands appears to have been exceedingly rare. Molecular ribosomal DNA; Ma, million years ago. y Data deposition: The sequences reported in this paper have been phylogenetic evidence of a California tarweed (Madia deposited in the GenBank database (accession nos. AF031960– AF032016). † The publication costs of this article were defrayed in part by page charge Permanent address: Real Jardı´n Bota´nico, Plaza de Murillo, 2, 28014-Madrid, Spain. payment. This article must therefore be hereby marked ‘‘advertisement’’ in ‡To whom reprint requests should be addressed at: Jepson Herbarium accordance with 18 U.S.C. §1734 solely to indicate this fact. and Dept. of Integrative Biology, 1001 Valley Life Sciences Building, © 1998 by The National Academy of Sciences 0027-8424y98y95235-6$2.00y0 no. 2465, University of California, Berkeley, CA 94720-2465. e-mail: PNAS is available online at http:yywww.pnas.org. [email protected]. 235 Downloaded by guest on September 25, 2021 236 Evolution: Vargas et al. Proc. Natl. Acad. Sci. USA 95 (1998) Table 1. Matrix of informative nucleotide sites and insertionsydeletions (indels) from the nuclear rDNA ITS region in Sanicula and outgroups 1111111111111111111111111111 1123344555555566666777788899990011122222233333456667778888 57824727123578912579567804734893726901235901459353464781346 1 TAGGCCCCCGACATCGGGCCCCACACGGCTCGGACTCAACGGACCTCGCATGCAATCTG 2 TAGGCCACCGACGTCGGGCCCCACCTGGCTCGGCCTCAACGGCACTCGCATGCAATTTG 3 TTAGCCACGGACATTGGTCCCCCAGAGGCGCGGCTTCRATTACCACCGCATGTCACTGC 4 TTAGACACCGACGTCGGGCCCCGTTTGATCGGGCTCCGCTACAATTTATATGCCATCCT 5 TTAGACACCGACGTCGGGCTCCGTT-GACCGGGTTCCGCTACAATTTGTATGCTATCCT 6 TTAGACACCGACGTCGGGCCCTGTTCGACCGGGCTCCGCTACAACTTGTATGCCATCCT 7 TTAGATACCGACGTCGGGCCCCATTCGATCAGGCTCCGCTACAATTTGTATGCCATCCT 8 TTAGACACCGATGTCGTGCCCCGTTCGACCGGGCTCCGCTACAATTTGTATGCTATCCT 9 ATAGAAATCGACGTCGGGTTCCGTGCGATCGGGATCCGCTACAATTTATATGCCATCCT 10 ATAGAAATCGACGTCGGGTTCCGTGCGATCGGGATCCGCTACAATTTATATGCCATCCT 11 ATAGAAATCGACGTCGGGTTCCGTGCAATCGGGATCCGCTACAATTTATATGCCATCCT 12 TTAGAAATCAACGTCTGGTCCTGTTCAACCGGGCTCCGCTACAATTTATATGCCATCCT 13 TTAGAGGCCGACGTCGGGTCCCGTTCAACCGGA--CCGCTACAATTTATATGCCATCCT 14 TAAGAA-CCGACGCAGTGTCTCGTTCGACCGGGCTCTTCTACAATTTGTTTTCCATTCT 15 TTAGAAATCGACGTCGGGTCCCGTTCGACCGGGCTCCGCTACAATTTATATGCCATCCT 16 TTAAAATCCGACGTCGGGTCCTGTTCGACCGGCCTCCGCTACAATTTATACGCCACCCT 17 TTAAAATCCGACGTCGGGTCCTGTTCGACCGGCCTCCGCTACAATTTATACGCCACCCT 18 TTAAAATCCGACGTCGGGTCCTGTTCGACCGGCCTCCGCTACAATTTATACGCCACCCT 19 TTAAAATCCGACGTCGGGTCCTGTTCGACCGGCCTCCGCTACAATTTATACGCCACCCT 20 TAAGAGATCGACGTAGTGTCCCGTTCGACCGAGCTCTGCTACAATTCGTTTTTCATT-T 21 TTAGAGACGCCCGTCGTGTCCTGTTCGATCGGTTTCCGCTACAACATGTTTGCTGTACT 22 TTAGAGACGCCCGTCGTGTCCTGTTCGACCGGTTTCCGCTACAACATGTTTGCTGTACT 23 TTAGAGACGCCCGTCATGTCCTGTTTGATCGGTCTCCGCTACAACATGTTTGCTGTACT 24 TAAGAAACCAACGTAGTTTCCCGTTCGACCGGGCTCTGCTACCATTTGTTTTCCATTCT 25 TTAGAGGCCGACGTCGGGTCCYGTACGACCGGGCTCCGCTACAATTTATATGCCATCCT 26 TAAGAA-CCGACGCAGTGTCTCGTTCGACCGGGCTCTTCTACAATTTGTTTTCCATTCT 27 TTAGAGACGCCTGTCATGTCCTGTTCGACCGGTCTCCGCTACAACATGTTTGCTGTACT 28 TTAGAGACGCCCGTCATGTCCTGTTCGACCGGTCTCCGCTACAACATGTTTGTTGTACT 29 TTAGAGACGCCCGTCATGTCCTGTTTGACCGGTCTCCGCT-CAACATGTTTGCTGTACT 30 TAAGAAACCGACATAGTGTCCCGTTCGACCGAACTCTGCTACAATTCGTTTTTCATTCT 31 TAAGAAACCGAMGTAGTGTCCYGTTCGACCGGGCTCTTCTACAATTTGTTTTTCATTCT 22223333333444444444444444444444444444444444444444455555555 00024689999000111111222222233333345566666677788889900134555 25609283789479146789012567801236950303678902306788949265237 1 TCGGGGGGCGC-CCCACTCCTGGTGGTCGTCACGAGGCCGCAGGCCCGCACGTCGGCGC 2 TCGGGGGGCGCCCCCACTCCTTGTGCTCGTCATGAGGCCGCGGGCCCGCACGTCGGCGC 3 CTGGGCGGCGCAACTTTCCACTTGGCTTGCGCGGTGGATGCATGCCAGCACGTCGAC-- 4 TCGGGGGGCGC-ACTATCCTTCCGACTCGCATTGAGGTTGTGGATCAACGTTTTGGCGC 5 CTGGGGGGCGC-ACCATCCTTGCGATTCGCATGGAGGCTGTGGATCAACGTTTCGGCGC 6 CCGGGGGGCGC-ACCATCCTCAGGACTCGCATGGAGGCTGTGGATCAACGTTTCGACGC 7 CCAGAGGGCGC-ACCTTCCTTACGATTCGCATGGAGGCTGTGGATCAACGTTTCGGTGT
Load more

Recommended publications
  • Sanicula Bipinnatifida
    Sanicula bipinnatifida English name Purple Sanicle Scientific name Sanicula bipinnatifida Family Apiaceae (Carrot) Other scientific names none Risk status BC: imperilled (S2); red-listed; Conservation Framework Highest Priority – 2 (Goal 3, Maintain BC diversity) Canada: National General Status – at risk (2010); COSEWIC – Threatened (2001) Global: secure (G5) Elsewhere: California, Oregon and Washington – reported (SNR) Range/Known distribution Populations of Purple Sanicle have a N narrow range in Canada, occurring only on southeastern Vancouver CAMPBELL Island and the Gulf Islands. Globally, RIVER the species range extends along the COMOX west coast of North America from VANCOUVER VANCOUVER ISLAND PORT northern Baja California through ALBERNI Oregon, and then sporadically in DUNCAN Washington and British Columbia. There are 18 existing populations VICTORIA and 6 extirpated or unconfirmed sites, ranging from Duncan south to Victoria, with populations on Galiano Island and Saturna Island. NANAIMO The Canadian populations and GALIANO those in nearby Washington State ISLAND are disjunct by about 100 km from the main population. Population DUNCAN sizes range from a single plant to over eleven hundred individuals. N VICTORIA Distribution of Sanicula bipinnatifida l Recently confirmed sites l Extirpated or historical sites Species at Risk in Garry Oak and Associated Ecosystems in British Columbia Sanicula bipinnatifida Field description This distinctly purple-flowered short-lived perennial herb grows 10- 60cm tall from a vertical taproot. The erect stem is stout and branched with leaves at the base and on the lower stem. Leaves are 4-13 cm long, toothed, and range from simple to pinnately divided (leaves arranged on either side of the main leaf axis, like a feather) once or twice with the leaflets opposite each other.
    [Show full text]
  • Seed Ecology Iii
    SEED ECOLOGY III The Third International Society for Seed Science Meeting on Seeds and the Environment “Seeds and Change” Conference Proceedings June 20 to June 24, 2010 Salt Lake City, Utah, USA Editors: R. Pendleton, S. Meyer, B. Schultz Proceedings of the Seed Ecology III Conference Preface Extended abstracts included in this proceedings will be made available online. Enquiries and requests for hardcopies of this volume should be sent to: Dr. Rosemary Pendleton USFS Rocky Mountain Research Station Albuquerque Forestry Sciences Laboratory 333 Broadway SE Suite 115 Albuquerque, New Mexico, USA 87102-3497 The extended abstracts in this proceedings were edited for clarity. Seed Ecology III logo designed by Bitsy Schultz. i June 2010, Salt Lake City, Utah Proceedings of the Seed Ecology III Conference Table of Contents Germination Ecology of Dry Sandy Grassland Species along a pH-Gradient Simulated by Different Aluminium Concentrations.....................................................................................................................1 M Abedi, M Bartelheimer, Ralph Krall and Peter Poschlod Induction and Release of Secondary Dormancy under Field Conditions in Bromus tectorum.......................2 PS Allen, SE Meyer, and K Foote Seedling Production for Purposes of Biodiversity Restoration in the Brazilian Cerrado Region Can Be Greatly Enhanced by Seed Pretreatments Derived from Seed Technology......................................................4 S Anese, GCM Soares, ACB Matos, DAB Pinto, EAA da Silva, and HWM Hilhorst
    [Show full text]
  • Vascular Plants at Fort Ross State Historic Park
    19005 Coast Highway One, Jenner, CA 95450 ■ 707.847.3437 ■ [email protected] ■ www.fortross.org Title: Vascular Plants at Fort Ross State Historic Park Author(s): Dorothy Scherer Published by: California Native Plant Society i Source: Fort Ross Conservancy Library URL: www.fortross.org Fort Ross Conservancy (FRC) asks that you acknowledge FRC as the source of the content; if you use material from FRC online, we request that you link directly to the URL provided. If you use the content offline, we ask that you credit the source as follows: “Courtesy of Fort Ross Conservancy, www.fortross.org.” Fort Ross Conservancy, a 501(c)(3) and California State Park cooperating association, connects people to the history and beauty of Fort Ross and Salt Point State Parks. © Fort Ross Conservancy, 19005 Coast Highway One, Jenner, CA 95450, 707-847-3437 .~ ) VASCULAR PLANTS of FORT ROSS STATE HISTORIC PARK SONOMA COUNTY A PLANT COMMUNITIES PROJECT DOROTHY KING YOUNG CHAPTER CALIFORNIA NATIVE PLANT SOCIETY DOROTHY SCHERER, CHAIRPERSON DECEMBER 30, 1999 ) Vascular Plants of Fort Ross State Historic Park August 18, 2000 Family Botanical Name Common Name Plant Habitat Listed/ Community Comments Ferns & Fern Allies: Azollaceae/Mosquito Fern Azo/la filiculoides Mosquito Fern wp Blechnaceae/Deer Fern Blechnum spicant Deer Fern RV mp,sp Woodwardia fimbriata Giant Chain Fern RV wp Oennstaedtiaceae/Bracken Fern Pleridium aquilinum var. pubescens Bracken, Brake CG,CC,CF mh T Oryopteridaceae/Wood Fern Athyrium filix-femina var. cyclosorum Western lady Fern RV sp,wp Dryopteris arguta Coastal Wood Fern OS op,st Dryopteris expansa Spreading Wood Fern RV sp,wp Polystichum munitum Western Sword Fern CF mh,mp Equisetaceae/Horsetail Equisetum arvense Common Horsetail RV ds,mp Equisetum hyemale ssp.affine Common Scouring Rush RV mp,sg Equisetum laevigatum Smooth Scouring Rush mp,sg Equisetum telmateia ssp.
    [Show full text]
  • Circumscription and Phylogeny of Apiaceae Subfamily Saniculoideae Based on Chloroplast DNA Sequences
    ARTICLE IN PRESS Molecular Phylogenetics and Evolution xxx (2007) xxx–xxx www.elsevier.com/locate/ympev Circumscription and phylogeny of Apiaceae subfamily Saniculoideae based on chloroplast DNA sequences Carolina I. Calviño a,b,¤, Stephen R. Downie a a Department of Plant Biology, University of Illinois at Urbana-Champaign, Urbana, IL 61801-3707, USA b Instituto de Botánica Darwinion, Buenos Aires, Argentina Received 14 July 2006; revised 3 January 2007; accepted 4 January 2007 Abstract An estimate of phylogenetic relationships within Apiaceae subfamily Saniculoideae was inferred using data from the chloroplast DNA trnQ-trnK 5Ј-exon region to clarify the circumscription of the subfamily and to assess the monophyly of its constituent genera. Ninety- one accessions representing 14 genera and 82 species of Apiaceae were examined, including the genera Steganotaenia, Polemanniopsis, and Lichtensteinia which have been traditionally treated in subfamily Apioideae but determined in recent studies to be more closely related to or included within subfamily Saniculoideae. The trnQ-trnK 5Ј-exon region includes two intergenic spacers heretofore underutilized in molecular systematic studies and the rps16 intron. Analyses of these loci permitted an assessment of the relative utility of these noncoding regions (including the use of indel characters) for phylogenetic study at diVerent hierarchical levels. The use of indels in phylogenetic anal- yses of both combined and partitioned data sets improves resolution of relationships, increases bootstrap support values, and decreases levels of overall homoplasy. Intergeneric relationships derived from maximum parsimony, Bayesian, and maximum likelihood analyses, as well as from maximum parsimony analysis of indel data alone, are fully resolved and consistent with one another and generally very well supported.
    [Show full text]
  • Checklist of the Vascular Plants of Redwood National Park
    Humboldt State University Digital Commons @ Humboldt State University Botanical Studies Open Educational Resources and Data 9-17-2018 Checklist of the Vascular Plants of Redwood National Park James P. Smith Jr Humboldt State University, [email protected] Follow this and additional works at: https://digitalcommons.humboldt.edu/botany_jps Part of the Botany Commons Recommended Citation Smith, James P. Jr, "Checklist of the Vascular Plants of Redwood National Park" (2018). Botanical Studies. 85. https://digitalcommons.humboldt.edu/botany_jps/85 This Flora of Northwest California-Checklists of Local Sites is brought to you for free and open access by the Open Educational Resources and Data at Digital Commons @ Humboldt State University. It has been accepted for inclusion in Botanical Studies by an authorized administrator of Digital Commons @ Humboldt State University. For more information, please contact [email protected]. A CHECKLIST OF THE VASCULAR PLANTS OF THE REDWOOD NATIONAL & STATE PARKS James P. Smith, Jr. Professor Emeritus of Botany Department of Biological Sciences Humboldt State Univerity Arcata, California 14 September 2018 The Redwood National and State Parks are located in Del Norte and Humboldt counties in coastal northwestern California. The national park was F E R N S established in 1968. In 1994, a cooperative agreement with the California Department of Parks and Recreation added Del Norte Coast, Prairie Creek, Athyriaceae – Lady Fern Family and Jedediah Smith Redwoods state parks to form a single administrative Athyrium filix-femina var. cyclosporum • northwestern lady fern unit. Together they comprise about 133,000 acres (540 km2), including 37 miles of coast line. Almost half of the remaining old growth redwood forests Blechnaceae – Deer Fern Family are protected in these four parks.
    [Show full text]
  • EV Fr YOI4,NO2 ,/ / Wtnrer 1Se1 1!Ews[Etter The,Vlonld.No' 9.'L Q'tlue 9Lcnt Soci,St
    --.--t-, l@lseya uniflora eI\EV fr YOI4,NO2 ,/ / wtNrER 1se1 1!ews[etter the,Vlonld.no' 9.'l q'tlue 9Lcnt Soci,st SULPHUR CINQUEFOIL - AN INTHODUCED WEED TO EQUAL KNAPWEED AND SPURGE BY 2A2O? - Peter M Rice Suffur cinquetoil (Potentillarecfa L.) is native to Eurasia, management of this plant. Werner and Soule (1972) have an origin similar to spotted knapweed and leafy spurge. compiled most of the scattered information on sulfur Sulfur cinquefoil had become a well established weed by cinquefoil, but most of these observations were made the 1950s in eastern Canada, the northeast United States under the moist climatic conditions of eastern North and the Great Lakes region, and scanered populations America. had been recorded in southern British Columbia. The first confirmed Montana collections in the herbaria at Montana A rough description of the niche of this plant can be state university and the university of Montana were made composed from the published information and casual in 1962 (Missoula County) and 1965 (Lake County). A observations made in Montana Sulfur cinquefoil can recent re-examination of the collection of cinquefoils at the establish in open grasslands, shrubby areas and forest University of Montana herbarium resulted in designating an margins, but not under dense forest canopies. Roadsides, unidentified specimen collected in 1956 as a sulfur waste places and abandoned fields are particularly cinquefoil. This panicular plant was collected in a field susceptible. lt is most successful on coarse-textured soils adiacent to the Missoula Counry Fairgrounds, a typical and dry sites at low and mid elevations, and moderately locale for a possible first state record of an introduced moist sites at low elevations.
    [Show full text]
  • Rinconada Checklist-02Jun19
    Checklist1 of Vascular Flora of Rinconada Mine and Rinconada Trail San Luis Obispo County, California (2 June 2019) David J. Keil Robert F. Hoover Herbarium Biological Sciences Department California Polytechnic State University San Luis Obispo, California Scientific Name Common Name Family Rare n ❀ Achyrachaena mollis blow wives ASTERACEAE o n ❀ Acmispon americanus var. americanus Spanish-clover FABACEAE o n Acmispon brachycarpus shortpod deervetch FABACEAE v n ❀ Acmispon glaber var. glaber common deerweed FABACEAE o n Acmispon parviflorus miniature deervetch FABACEAE o n ❀ Acmispon strigosus strigose deer-vetch FABACEAE o 1 Please notify the author of additions or corrections to this list ([email protected]). ❀ — See Wildflowers of San Luis Obispo, California, second edition (2018) for photograph. Most are illustrated in the first edition as well; old names for some species in square brackets. n — California native i — exotic species, introduced to California, naturalized or waif. v — documented by one or more specimens (Consortium of California Herbaria record; specimen in OBI; or collection that has not yet been accessioned) o — observed during field surveys; no voucher specimen known Rare—California Rare Plant Rank Scientific Name Common Name Family Rare n Acmispon wrangelianus California deervetch FABACEAE v n ❀ Acourtia microcephala sacapelote ASTERACEAE o n ❀ Adelinia grandis Pacific hound's tongue BORAGINACEAE v n ❀ Adenostoma fasciculatum var. chamise ROSACEAE o fasciculatum n Adiantum jordanii California maidenhair fern PTERIDACEAE o n Agastache urticifolia nettle-leaved horsemint LAMIACEAE v n ❀ Agoseris grandiflora var. grandiflora large-flowered mountain-dandelion ASTERACEAE v n Agoseris heterophylla var. cryptopleura annual mountain-dandelion ASTERACEAE v n Agoseris heterophylla var. heterophylla annual mountain-dandelion ASTERACEAE o i Aira caryophyllea silver hairgrass POACEAE o n Allium fimbriatum var.
    [Show full text]
  • Tidal Marsh Recovery Plan Habitat Creation Or Enhancement Project Within 5 Miles of OAK
    U.S. Fish & Wildlife Service Recovery Plan for Tidal Marsh Ecosystems of Northern and Central California California clapper rail Suaeda californica Cirsium hydrophilum Chloropyron molle Salt marsh harvest mouse (Rallus longirostris (California sea-blite) var. hydrophilum ssp. molle (Reithrodontomys obsoletus) (Suisun thistle) (soft bird’s-beak) raviventris) Volume II Appendices Tidal marsh at China Camp State Park. VII. APPENDICES Appendix A Species referred to in this recovery plan……………....…………………….3 Appendix B Recovery Priority Ranking System for Endangered and Threatened Species..........................................................................................................11 Appendix C Species of Concern or Regional Conservation Significance in Tidal Marsh Ecosystems of Northern and Central California….......................................13 Appendix D Agencies, organizations, and websites involved with tidal marsh Recovery.................................................................................................... 189 Appendix E Environmental contaminants in San Francisco Bay...................................193 Appendix F Population Persistence Modeling for Recovery Plan for Tidal Marsh Ecosystems of Northern and Central California with Intial Application to California clapper rail …............................................................................209 Appendix G Glossary……………......................................................................………229 Appendix H Summary of Major Public Comments and Service
    [Show full text]
  • Plant List for Web Page
    Stanford Working Plant List 1/15/08 Common name Botanical name Family origin big-leaf maple Acer macrophyllum Aceraceae native box elder Acer negundo var. californicum Aceraceae native common water plantain Alisma plantago-aquatica Alismataceae native upright burhead Echinodorus berteroi Alismataceae native prostrate amaranth Amaranthus blitoides Amaranthaceae native California amaranth Amaranthus californicus Amaranthaceae native Powell's amaranth Amaranthus powellii Amaranthaceae native western poison oak Toxicodendron diversilobum Anacardiaceae native wood angelica Angelica tomentosa Apiaceae native wild celery Apiastrum angustifolium Apiaceae native cutleaf water parsnip Berula erecta Apiaceae native bowlesia Bowlesia incana Apiaceae native rattlesnake weed Daucus pusillus Apiaceae native Jepson's eryngo Eryngium aristulatum var. aristulatum Apiaceae native coyote thistle Eryngium vaseyi Apiaceae native cow parsnip Heracleum lanatum Apiaceae native floating marsh pennywort Hydrocotyle ranunculoides Apiaceae native caraway-leaved lomatium Lomatium caruifolium var. caruifolium Apiaceae native woolly-fruited lomatium Lomatium dasycarpum dasycarpum Apiaceae native large-fruited lomatium Lomatium macrocarpum Apiaceae native common lomatium Lomatium utriculatum Apiaceae native Pacific oenanthe Oenanthe sarmentosa Apiaceae native 1 Stanford Working Plant List 1/15/08 wood sweet cicely Osmorhiza berteroi Apiaceae native mountain sweet cicely Osmorhiza chilensis Apiaceae native Gairdner's yampah (List 4) Perideridia gairdneri gairdneri Apiaceae
    [Show full text]
  • Fort Ord Natural Reserve Plant List
    UCSC Fort Ord Natural Reserve Plants Below is the most recently updated plant list for UCSC Fort Ord Natural Reserve. * non-native taxon ? presence in question Listed Species Information: CNPS Listed - as designated by the California Rare Plant Ranks (formerly known as CNPS Lists). More information at http://www.cnps.org/cnps/rareplants/ranking.php Cal IPC Listed - an inventory that categorizes exotic and invasive plants as High, Moderate, or Limited, reflecting the level of each species' negative ecological impact in California. More information at http://www.cal-ipc.org More information about Federal and State threatened and endangered species listings can be found at https://www.fws.gov/endangered/ (US) and http://www.dfg.ca.gov/wildlife/nongame/ t_e_spp/ (CA). FAMILY NAME SCIENTIFIC NAME COMMON NAME LISTED Ferns AZOLLACEAE - Mosquito Fern American water fern, mosquito fern, Family Azolla filiculoides ? Mosquito fern, Pacific mosquitofern DENNSTAEDTIACEAE - Bracken Hairy brackenfern, Western bracken Family Pteridium aquilinum var. pubescens fern DRYOPTERIDACEAE - Shield or California wood fern, Coastal wood wood fern family Dryopteris arguta fern, Shield fern Common horsetail rush, Common horsetail, field horsetail, Field EQUISETACEAE - Horsetail Family Equisetum arvense horsetail Equisetum telmateia ssp. braunii Giant horse tail, Giant horsetail Pentagramma triangularis ssp. PTERIDACEAE - Brake Family triangularis Gold back fern Gymnosperms CUPRESSACEAE - Cypress Family Hesperocyparis macrocarpa Monterey cypress CNPS - 1B.2, Cal IPC
    [Show full text]
  • 2004 Vegetation Classification and Mapping of Peoria Wildlife Area
    Vegetation classification and mapping of Peoria Wildlife Area, South of New Melones Lake, Tuolumne County, California By Julie M. Evens, Sau San, and Jeanne Taylor Of California Native Plant Society 2707 K Street, Suite 1 Sacramento, CA 95816 In Collaboration with John Menke Of Aerial Information Systems 112 First Street Redlands, CA 92373 November 2004 Table of Contents Introduction.................................................................................................................................................... 1 Vegetation Classification Methods................................................................................................................ 1 Study Area ................................................................................................................................................. 1 Figure 1. Survey area including Peoria Wildlife Area and Table Mountain .................................................. 2 Sampling ................................................................................................................................................ 3 Figure 2. Locations of the field surveys. ....................................................................................................... 4 Existing Literature Review ......................................................................................................................... 5 Cluster Analyses for Vegetation Classification .........................................................................................
    [Show full text]
  • Flora of the Carolinas, Virginia, and Georgia, Working Draft of 17 March 2004 -- BIBLIOGRAPHY
    Flora of the Carolinas, Virginia, and Georgia, Working Draft of 17 March 2004 -- BIBLIOGRAPHY BIBLIOGRAPHY Ackerfield, J., and J. Wen. 2002. A morphometric analysis of Hedera L. (the ivy genus, Araliaceae) and its taxonomic implications. Adansonia 24: 197-212. Adams, P. 1961. Observations on the Sagittaria subulata complex. Rhodora 63: 247-265. Adams, R.M. II, and W.J. Dress. 1982. Nodding Lilium species of eastern North America (Liliaceae). Baileya 21: 165-188. Adams, R.P. 1986. Geographic variation in Juniperus silicicola and J. virginiana of the Southeastern United States: multivariant analyses of morphology and terpenoids. Taxon 35: 31-75. ------. 1995. Revisionary study of Caribbean species of Juniperus (Cupressaceae). Phytologia 78: 134-150. ------, and T. Demeke. 1993. Systematic relationships in Juniperus based on random amplified polymorphic DNAs (RAPDs). Taxon 42: 553-571. Adams, W.P. 1957. A revision of the genus Ascyrum (Hypericaceae). Rhodora 59: 73-95. ------. 1962. Studies in the Guttiferae. I. A synopsis of Hypericum section Myriandra. Contr. Gray Herbarium Harv. 182: 1-51. ------, and N.K.B. Robson. 1961. A re-evaluation of the generic status of Ascyrum and Crookea (Guttiferae). Rhodora 63: 10-16. Adams, W.P. 1973. Clusiaceae of the southeastern United States. J. Elisha Mitchell Sci. Soc. 89: 62-71. Adler, L. 1999. Polygonum perfoliatum (mile-a-minute weed). Chinquapin 7: 4. Aedo, C., J.J. Aldasoro, and C. Navarro. 1998. Taxonomic revision of Geranium sections Batrachioidea and Divaricata (Geraniaceae). Ann. Missouri Bot. Gard. 85: 594-630. Affolter, J.M. 1985. A monograph of the genus Lilaeopsis (Umbelliferae). Systematic Bot. Monographs 6. Ahles, H.E., and A.E.
    [Show full text]