DOCSLIB.ORG

Less Understood Issues: P21cip1 in Mitosis and Its Therapeutic Potential

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Less Understood Issues: P21cip1 in Mitosis and Its Therapeutic Potential Oncogene (2015) 34, 1758–1767 © 2015 Macmillan Publishers Limited All rights reserved 0950-9232/15 www.nature.com/onc REVIEW Less understood issues: p21Cip1 in mitosis and its therapeutic potential N-N Kreis, F Louwen and J Yuan p21Cip1 is a multifunctional protein and a key player in regulating different cellular processes. The transcription of p21 is regulated by p53-dependent and -independent pathways. The expression of p21 is increased in response to various cellular stresses to arrest the cell cycle and ensure genomic stability. p21 has been shown to be a tumor suppressor and an oncogene as well. The function of p21 in mitosis has been proposed but not systematically studied. We have recently shown that p21 binds to and inhibits the activity of Cdk1/ cyclin B1, and is important for a fine-tuned mitotic progression. Loss of p21 prolongs the duration of mitosis and results in severe mitotic defects like chromosome segregation and cytokinesis failures promoting consequently genomic instability. Moreover, p21 is dramatically stabilized in mitotic tumor cells upon treatment with mitotic agents like paclitaxel or mitotic kinase inhibitors. Increased p21 is mainly localized in the cytoplasm and associates with cell survival indicating a crucial role of p21 in susceptibility to mitotic agents in tumor cells. In this review we will briefly summarize the structure and general physiological functions as well as regulation of p21, discuss in detail its role in mitosis and its potential to serve as a therapeutic target. Oncogene (2015) 34, 1758–1767; doi:10.1038/onc.2014.133; published online 26 May 2014 INTRODUCTION arguing about the role of p21 as a classical tumor suppressor. The progression through the cell cycle is accurately regulated. This notion has been revised by a later study reporting that Loss of cell cycle control promotes tumorigenesis and is one of the p21-knockout mice were, at an average age of 16 months, hallmarks of cancer cells.1 Key regulators of the cell cycle are a susceptible to the development of spontaneous tumors like family of serine/threonine kinases: cyclin-dependent kinases (Cdk). histiocytic sarcomas, hemangiomas, B-cell lymphomas and lung The Cdks act at different stages of the cell cycle and are carcinomas as well as to severe glomerulonephritis at an average 13 responsible for the transition from one cell cycle phase to the of 9.6 months. In addition, the combined knockout of p21 Kip1 next.2,3 They are thus strictly controlled, among others, by positive and p27 in mice further increased the occurrence of 14 regulators like cyclins, which can be counteracted by negative spontaneous tumors, strongly suggestive of p21 as a tumor regulators the Cdk inhibitors (CKI).2,3 CKIs are divided into two suppressor in vivo. fi fi individual families on the basis of their structure and specificities. p21, encoded by CDKN1A, was the rst identi ed member of The first family, containing p15INK4b, p16INK4a, p18INK4c and the CKIs. It was independently isolated by several groups and p19INK4d (Inhibitors of Cdk4), binds and inhibits only Cdk4/Cdk6 named as a result of its distinct functions as a subunit of the cyclin D1 immunocomplex (p21),15,16 a wild-type p53-activated fragment complexes. The second family is comprised of Cip/Kip proteins 17 18 (Cdk-interacting protein/kinase-inhibitory protein) and character- (WAF1), a Cdk-interacting protein (Cip1), a senescent cell- derived inhibitor-1 (sdi1),19 a melanoma differentiation-associated ized by its ability to bind to a much broader range of Cdks as well 20 as cyclin subunits. This class includes p21Cip1 (hereafter referred to gene 6 (mda6) and also as Cdk2-associated protein-20 in mouse fi 21 22 fl as p21), p27Kip1 and p57Kip2, who are evolutionally highly broblasts (CAP20). The numerous names of p21 re ect its conserved and are mostly able to substitute each other.4–6 p21 complexity and manifold capabilities, correlate with an increasing and p57Kip2 are uniquely expressed in mammals, whereas p27Kip1 appreciation of its importance in a wide variety of cellular is conserved throughout different species. It is found in budding processes. yeast (Sic1), fission yeast (Rum1), Drosophila (Dacapo) and Xenopus (Xic1).7 CKIs have been thoroughly investigated in vivo: mice lacking STRUCTURE OF P21 functional CKIs reveal a broad spectrum of phenotypes.8 Interest- In free solution, p21 is an intrinsically unstructured protein with ingly, p57Kip2 is the only member required for embryonic 15–20% of secondary structure and a lack of tertiary structure.23–25 development. About 90% of the p57Kip2-knockout mice were Conformational analysis suggests that posttranslational modifica- embryonic or neonatal lethal.9 Of the INK4 inhibitors, only tions of p21 like phosphorylation may alter its folding, subcellular p16INK4a-knockout mice showed an increased incidence of localization and mediate different binding partners, referred to as spontaneous and carcinogen-induced tumor development.10,11 a ‘folding-on-binding mechanism’.24 Through its ‘binding promis- However, p21-knockout mice remained tumor-free upon 7 months cuity’ and diversity,23,26 p21 is able to bind to different Cdks that with a defective G1 checkpoint in mouse embryonic fibroblasts,12 have a sequence homology of 57–83% as well as to varying cyclins Department of Gynecology and Obstetrics, J.W. Goethe-University, Frankfurt, Germany. Correspondence: Dr N-N Kreis or Dr J Yuan, Department of Gynecology and Obstetrics, J.W. Goethe-University, Theodor-Stern-Kai 7, D-60590 Frankfurt, Germany. E-mail: [email protected] or [email protected] Received 13 March 2014; revised 16 April 2014; accepted 16 April 2014; published online 26 May 2014 p21 in mitosis N-N Kreis et al 1759 with a homology of 25–42%.24 With its Cdk binding domain (K proliferating cell nuclear antigen (PCNA), leading to an inhibition 27 29,32 site, amino acids 53–58) and the 310 helix, p21 binds to the Cdks, of the DNA synthesis. A second weaker cyclin binding domain whereby the residue Tyr-77 (Y77) of p21 blocks the ATP binding exists at the C-terminus (Cy2),27 overlapping with the PCNA pocket of the Cdks.28,29 The structural adaptability of p21 is binding region (Figure 1). There are also two nuclear export mediated through a stretchable linker helix domain at the signals,33 a nuclear localization signal34 and different degradation N-terminus between the conserved cyclin binding domain (Cy1) motifs like D-box and F-box in p21. In addition, the binding and the K site. The dynamic linker helix domain is required to fit of different proteins like calmodulin causes its nuclear the spectrum of distances between the distinct Cdk/cyclin translocation.35,36 Furthermore, p21 is acetylated at its N-terminus complexes.30,31 The N-terminus of p21 is important for the and is hence not a substrate for N-ubiquitylation.37 The association with the Cdks as well as the cyclin subunits. By modification of p21 impacts its structure and further influences contrast, the C-terminus of p21 mediates the binding to its function. Figure 1. Illustration of the p21 structure. The LH-domain (linker helix) and the 310 helix with amino acid Y77 (Tyr-77) are indicated. For references see main text. Cy1 and Cy2, cyclin binding domains; F-box and D-box, destruction motifs; K, Cdk binding domain; NES, nuclear export signal; NLS, nuclear localization signal; PCNA, proliferating cell nuclear antigen; S2-ACE, acetylation of Ser-2. Table 1. Phosphorylation sites of p21 Amino acid Kinase Function Ref Thr-57 Cdk2/cyclin A Critical residue for the interaction with cyclin B1, promoting the Cdk1/cyclin B1 activity in G2/M 39 ERK2 In vitro phosphorylation site, cytoplasmic translocation of p21, simultaneous phosphorylation of Thr-57 and 44 Ser-130 leads to degradation of p21 GSK3β In vitro phosphorylation site, destabilization of p21 in endothelial cells 80 JNK1/p38α In vitro phosphorylation site, increased p21 stability mediated through Mst-1/2 after disruption of actin 75,76 cytoskeleton Ser-98 ASK1 Binding to and inhibition of ASK1 51 JNK1 In vitro phosphorylation site, abolished interaction of ASK1 and p21 after JNK1 inhibitor treatment 51 Ser-114 GSK3β UV-induced ATR-activation and p21 degradation (CRL4Cdt2), PCNA-dependent 62,81 Ser-130 Cdk2/cyclin E Decreased p21 stability via ubiquitin-dependent degradation (SCFSkp2), phosphorylation of Ser-130 stimulates 60 the ligation of p21 to ubiquitin Cdk6/cyclin K Essential for the cyclin K-mediated release of a p21-imposed G1 arrest, phosphorylatable form unable to 40 associate with Cdk2 in vivo ERK2 In vitro phosphorylation site, cytoplasmic translocation of p21, simultaneous phosphorylation of Thr-57 and Ser- 44 130 leads to degradation of p21 JNK1/p38α Increase in p21 stability in response to TGF-β 75 Thr-145 Akt1/PKB Cytoplasmic translocation of p21 in HER2/neu expressing cells, prevents binding to PCNA and decreases binding 41,45 of Cdk2/4 in endothelial cells DAPK3/ZIP Increased p21 stability, identified by phage-peptide display 77 Pim-1 Increased p21 stability, nuclear localization of p21 in H1299 lung cancer cells, inhibition of PCNA binding 46,49 Pim-2 Increased p21 stability in the nucleus, inhibition of cell proliferation in HCT116 cells at G1/S phase 42 PKA In vitro phosphorylation, inhibition of PCNA binding in Sf9 cells 50 Ser-146 Akt1/PKB Increased p21 stability, protection of glioblastoma cell lines from taxol-induced apoptosis, promotion of cell 79 survival Lats2 Cytoplasmic degradation of p21 in response to UV irradiation and promotion of apoptosis
Load more

Recommended publications
  • Outlier Kinase Expression by RNA Sequencing As Targets for Precision Therapy
    Published OnlineFirst February 5, 2013; DOI: 10.1158/2159-8290.CD-12-0336 RESEARCH ARTICLE Outlier Kinase Expression by RNA Sequencing as Targets for Precision Therapy Vishal Kothari 1 , Iris Wei 2 , Sunita Shankar 1 , 3 , Shanker Kalyana-Sundaram 1 , 3 , 8 , Lidong Wang 2 , Linda W. Ma 1 , Pankaj Vats 1 , Catherine S. Grasso 1 , Dan R. Robinson 1 , 3 , Yi-Mi Wu 1 , 3 , Xuhong Cao 7 , Diane M. Simeone 2 , 4 , 5 , Arul M. Chinnaiyan 1 , 3 , 4 , 6 , 7 , and Chandan Kumar-Sinha 1 , 3 ABSTRACT Protein kinases represent the most effective class of therapeutic targets in cancer; therefore, determination of kinase aberrations is a major focus of cancer genomic studies. Here, we analyzed transcriptome sequencing data from a compendium of 482 cancer and benign samples from 25 different tissue types, and defi ned distinct “outlier kinases” in individual breast and pancreatic cancer samples, based on highest levels of absolute and differential expression. Frequent outlier kinases in breast cancer included therapeutic targets like ERBB2 and FGFR4 , distinct from MET , AKT2 , and PLK2 in pancreatic cancer. Outlier kinases imparted sample-specifi c depend- encies in various cell lines, as tested by siRNA knockdown and/or pharmacologic inhibition. Outlier expression of polo-like kinases was observed in a subset of KRAS -dependent pancreatic cancer cell lines, and conferred increased sensitivity to the pan-PLK inhibitor BI-6727. Our results suggest that outlier kinases represent effective precision therapeutic targets that are readily identifi able through RNA sequencing of tumors. SIGNIFICANCE: Various breast and pancreatic cancer cell lines display sensitivity to knockdown or pharmacologic inhibition of sample-specifi c outlier kinases identifi ed by high-throughput transcrip- tome sequencing.
    [Show full text]
  • PARSANA-DISSERTATION-2020.Pdf
    DECIPHERING TRANSCRIPTIONAL PATTERNS OF GENE REGULATION: A COMPUTATIONAL APPROACH by Princy Parsana A dissertation submitted to The Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy Baltimore, Maryland July, 2020 © 2020 Princy Parsana All rights reserved Abstract With rapid advancements in sequencing technology, we now have the ability to sequence the entire human genome, and to quantify expression of tens of thousands of genes from hundreds of individuals. This provides an extraordinary opportunity to learn phenotype relevant genomic patterns that can improve our understanding of molecular and cellular processes underlying a trait. The high dimensional nature of genomic data presents a range of computational and statistical challenges. This dissertation presents a compilation of projects that were driven by the motivation to efficiently capture gene regulatory patterns in the human transcriptome, while addressing statistical and computational challenges that accompany this data. We attempt to address two major difficulties in this domain: a) artifacts and noise in transcriptomic data, andb) limited statistical power. First, we present our work on investigating the effect of artifactual variation in gene expression data and its impact on trans-eQTL discovery. Here we performed an in-depth analysis of diverse pre-recorded covariates and latent confounders to understand their contribution to heterogeneity in gene expression measurements. Next, we discovered 673 trans-eQTLs across 16 human tissues using v6 data from the Genotype Tissue Expression (GTEx) project. Finally, we characterized two trait-associated trans-eQTLs; one in Skeletal Muscle and another in Thyroid. Second, we present a principal component based residualization method to correct gene expression measurements prior to reconstruction of co-expression networks.
    [Show full text]
  • Par6c Is at the Mother Centriole and Controls Centrosomal Protein
    860 Research Article Par6c is at the mother centriole and controls centrosomal protein composition through a Par6a-dependent pathway Vale´rian Dormoy, Kati Tormanen and Christine Su¨ tterlin* Department of Developmental and Cell Biology, University of California, Irvine, Irvine, CA 92697-2300, USA *Author for correspondence ([email protected]) Accepted 3 December 2012 Journal of Cell Science 126, 860–870 ß 2013. Published by The Company of Biologists Ltd doi: 10.1242/jcs.121186 Summary The centrosome contains two centrioles that differ in age, protein composition and function. This non-membrane bound organelle is known to regulate microtubule organization in dividing cells and ciliogenesis in quiescent cells. These specific roles depend on protein appendages at the older, or mother, centriole. In this study, we identified the polarity protein partitioning defective 6 homolog gamma (Par6c) as a novel component of the mother centriole. This specific localization required the Par6c C-terminus, but was independent of intact microtubules, the dynein/dynactin complex and the components of the PAR polarity complex. Par6c depletion resulted in altered centrosomal protein composition, with the loss of a large number of proteins, including Par6a and p150Glued, from the centrosome. As a consequence, there were defects in ciliogenesis, microtubule organization and centrosome reorientation during migration. Par6c interacted with Par3 and aPKC, but these proteins were not required for the regulation of centrosomal protein composition. Par6c also associated with Par6a, which controls protein recruitment to the centrosome through p150Glued. Our study is the first to identify Par6c as a component of the mother centriole and to report a role of a mother centriole protein in the regulation of centrosomal protein composition.
    [Show full text]
  • The Number of Genes
    Table S1. The numbers of KD genes in each KD time The number The number The number The number Cell lines of genes of genes of genes of genes (96h) (120h) (144h) PC3 3980 3822 128 1725 A549 3724 3724 0 0 MCF7 3688 3471 0 1837 HT29 3665 3665 0 0 A375 3826 3826 0 0 HA1E 3801 3801 0 0 VCAP 4134 34 4121 0 HCC515 3522 3522 0 0 Table S2. The predicted results in the PC3 cell line on the LINCS II data id target rank A07563059 ADRB2 48 A12896037 ADRA2C 91 A13021932 YES1 77 PPM1B;PPP1CC;PPP2CA; A13254067 584;1326;297;171;3335 PTPN1;PPP2R5A A16347691 GMNN 2219 PIK3CB;MTOR;PIK3CA;PIK A28467416 18;10;9;13;8 3CG;PIK3CD A28545468 EHMT2;MAOB 14;67 A29520968 HSPB1 1770 A48881734 EZH2 1596 A52922642 CACNA1C 201 A64553394 ADRB2 155 A65730376 DOT1L 3764 A82035391 JUN 378 A82156122 DPP4 771 HRH1;HTR2C;CHRM3;CH A82772293 2756;2354;2808;2367 RM1 A86248581 CDA 1785 A92800748 TEK 459 A93093700 LMNA 1399 K00152668 RARB 105 K01577834 ADORA2A 525 K01674964 HRH1;BLM 31;1314 K02314383 AR 132 K03194791 PDE4D 30 K03390685 MAP2K1 77 K06762493 GMNN;APEX1 1523;2360 K07106112 ERBB4;ERBB2;EGFR 497;60;23 K07310275 AKT1;MTOR;PIK3CA 13;12;1 K07753030 RGS4;BLM 3736;3080 K08109215 BRD2;BRD3;BRD4 1413;2786;3 K08248804 XIAP 88 K08586861 TBXA2R;MBNL1 297;3428 K08832567 GMNN;CA12 2544;50 LMNA;NFKB1;APEX1;EH K08976401 1322;341;3206;123 MT2 K09372874 IMPDH2 232 K09711437 PLA2G2A 59 K10859802 GPR119 214 K11267252 RET;ALK 395;760 K12609457 LMNA 907 K13094524 BRD4 7 K13662825 CDK4;CDK9;CDK5;CDK1 34;58;13;18 K14704277 LMNA;BLM 1697;1238 K14870255 AXL 1696 K15170068 MAN2B1 1756 K15179879
    [Show full text]
  • Centriole Overduplication Is the Predominant Mechanism Leading to Centrosome Amplification in Melanoma
    Published OnlineFirst January 12, 2018; DOI: 10.1158/1541-7786.MCR-17-0197 Oncogenes and Tumor Suppressors Molecular Cancer Research Centriole Overduplication is the Predominant Mechanism Leading to Centrosome Amplification in Melanoma Ryan A. Denu1,2, Maria Shabbir3, Minakshi Nihal3, Chandra K. Singh3, B. Jack Longley3,4,5, Mark E. Burkard2,4, and Nihal Ahmad3,4,5 Abstract Centrosome amplification (CA) is common in cancer and can evaluated. PLK4 is significantly overexpressed in melanoma com- arise by centriole overduplication or by cell doubling events, pared with benign nevi and in a panel of human melanoma cell including the failure of cell division and cell–cell fusion. To assess lines (A375, Hs294T, G361, WM35, WM115, 451Lu, and SK-MEL- the relative contributions of these two mechanisms, the number of 28) compared with normal human melanocytes. Interestingly, centrosomes with mature/mother centrioles was examined by although PLK4 expression did not correlate with CA in most cases, immunofluorescence in a tissue microarray of human melanomas treatment of melanoma cells with a selective small-molecule PLK4 and benign nevi (n ¼ 79 and 17, respectively). The centrosomal inhibitor (centrinone B) significantly decreased cell proliferation. protein 170 (CEP170) was used to identify centrosomes with The antiproliferative effects of centrinone B were also accompa- mature centrioles; this is expected to be present in most centro- nied by induction of apoptosis. somes with cell doubling, but on fewer centrosomes with over- duplication. Using this method, it was determined that the major- Implications: This study demonstrates that centriole overdupli- ity of CA in melanoma can be attributed to centriole overduplica- cation is the predominant mechanism leading to centrosome tion rather than cell doubling events.
    [Show full text]
  • Characterization of NIP2/Centrobin, a Novel Substrate of Nek2, and Its Potential Role in Microtubule Stabilization
    2106 Research Article Characterization of NIP2/centrobin, a novel substrate of Nek2, and its potential role in microtubule stabilization Yeontae Jeong, Jungmin Lee, Kyeongmi Kim, Jae Cheal Yoo and Kunsoo Rhee* Department of Biological Sciences and Research Center for Functional Cellulomics, Seoul National University, Seoul 151-742, Korea *Author for correspondence (e-mail: [email protected]) Accepted 11 April 2007 Journal of Cell Science 120, 2106-2116 Published by The Company of Biologists 2007 doi:10.1242/jcs.03458 Summary Nek2 is a mitotic kinase whose activity varies during the associated with microtubules. Knockdown of NIP2 showed cell cycle. It is well known that Nek2 is involved in significant reduction of microtubule organizing activity, centrosome splitting, and a number of studies have cell shrinkage, defects in spindle assembly and abnormal indicated that Nek2 is crucial for maintaining the integrity nuclear morphology. Based on our results, we propose that of centrosomal structure and microtubule nucleation NIP2 has a role in stabilizing the microtubule structure. activity. In the present study, we report that NIP2, Phosphorylation may be crucial for mobilization of the previously identified as centrobin, is a novel substrate of protein to a new microtubule and stabilizing it. Nek2. NIP2 was daughter-centriole-specific, but was also found in association with a stable microtubule network of cytoplasm. Ectopic NIP2 formed aggregates but was Key words: NIP2, Centrobin, Nek2, Centrosome, Mitosis, dissolved by Nek2 into small pieces and eventually Microtubule Introduction through the phosphorylation-induced displacement of C-Nap1 Phosphorylation is one of major control mechanisms used from the centriolar ends (reviewed in Fry, 2002).
    [Show full text]
  • S41467-019-10037-Y.Pdf
    ARTICLE https://doi.org/10.1038/s41467-019-10037-y OPEN Feedback inhibition of cAMP effector signaling by a chaperone-assisted ubiquitin system Laura Rinaldi1, Rossella Delle Donne1, Bruno Catalanotti 2, Omar Torres-Quesada3, Florian Enzler3, Federica Moraca 4, Robert Nisticò5, Francesco Chiuso1, Sonia Piccinin5, Verena Bachmann3, Herbert H Lindner6, Corrado Garbi1, Antonella Scorziello7, Nicola Antonino Russo8, Matthis Synofzik9, Ulrich Stelzl 10, Lucio Annunziato11, Eduard Stefan 3 & Antonio Feliciello1 1234567890():,; Activation of G-protein coupled receptors elevates cAMP levels promoting dissociation of protein kinase A (PKA) holoenzymes and release of catalytic subunits (PKAc). This results in PKAc-mediated phosphorylation of compartmentalized substrates that control central aspects of cell physiology. The mechanism of PKAc activation and signaling have been largely characterized. However, the modes of PKAc inactivation by regulated proteolysis were unknown. Here, we identify a regulatory mechanism that precisely tunes PKAc stability and downstream signaling. Following agonist stimulation, the recruitment of the chaperone- bound E3 ligase CHIP promotes ubiquitylation and proteolysis of PKAc, thus attenuating cAMP signaling. Genetic inactivation of CHIP or pharmacological inhibition of HSP70 enhances PKAc signaling and sustains hippocampal long-term potentiation. Interestingly, primary fibroblasts from autosomal recessive spinocerebellar ataxia 16 (SCAR16) patients carrying germline inactivating mutations of CHIP show a dramatic dysregulation of PKA signaling. This suggests the existence of a negative feedback mechanism for restricting hormonally controlled PKA activities. 1 Department of Molecular Medicine and Medical Biotechnologies, University Federico II, 80131 Naples, Italy. 2 Department of Pharmacy, University Federico II, 80131 Naples, Italy. 3 Institute of Biochemistry and Center for Molecular Biosciences, University of Innsbruck, A-6020 Innsbruck, Austria.
    [Show full text]
  • Novel Functions of Death-Associated Protein Kinases Through Mitogen-Activated Protein Kinase-Related Signals
    International Journal of Molecular Sciences Article Novel Functions of Death-Associated Protein Kinases through Mitogen-Activated Protein Kinase-Related Signals Mohamed Elbadawy 1,2,† , Tatsuya Usui 1,*,†, Hideyuki Yamawaki 3 and Kazuaki Sasaki 1 1 Laboratory of Veterinary Pharmacology, Department of Veterinary Medicine, Faculty of Agriculture, Tokyo University of Agriculture and Technology, 3-5-8 Saiwai-cho, Fuchu, Tokyo 183-8509, Japan; [email protected] (M.E.); [email protected] (K.S.) 2 Department of Pharmacology, Faculty of Veterinary Medicine, Benha University, Moshtohor, Elqaliobiya, Toukh 13736, Egypt 3 Laboratory of Veterinary Pharmacology, School of Veterinary Medicine, Kitasato University, Towada, Aomori 034-8628, Japan; [email protected] * Correspondence: [email protected]; Tel./Fax: +81-42-367-5769 † These authors contributed equally to this work. Received: 13 September 2018; Accepted: 1 October 2018; Published: 4 October 2018 Abstract: Death associated protein kinase (DAPK) is a calcium/calmodulin-regulated serine/threonine kinase; its main function is to regulate cell death. DAPK family proteins consist of DAPK1, DAPK2, DAPK3, DAPK-related apoptosis-inducing protein kinases (DRAK)-1 and DRAK-2. In this review, we discuss the roles and regulatory mechanisms of DAPK family members and their relevance to diseases. Furthermore, a special focus is given to several reports describing cross-talks between DAPKs and mitogen-activated protein kinases (MAPK) family members in various pathologies. We also discuss small molecule inhibitors of DAPKs and their potential as therapeutic targets against human diseases. Keywords: MAPK; DAPK; ERK; p38; JNK 1. Introduction: DAPKs, MAPKs Death-associated protein kinase (DAPK) family proteins are closely related, Ca2+/calmodulin (CaM)-regulated serine/threonine kinases, whose members not only possess significant homology in their catalytic domains but also share cell death-associated functions [1,2].
    [Show full text]
  • Suppl. Table 1
    Suppl. Table 1. SiRNA library used for centriole overduplication screen. Entrez Gene Id NCBI gene symbol siRNA Target Sequence 1070 CETN3 TTGCGACGTGTTGCTAGAGAA 1070 CETN3 AAGCAATAGATTATCATGAAT 55722 CEP72 AGAGCTATGTATGATAATTAA 55722 CEP72 CTGGATGATTTGAGACAACAT 80071 CCDC15 ACCGAGTAAATCAACAAATTA 80071 CCDC15 CAGCAGAGTTCAGAAAGTAAA 9702 CEP57 TAGACTTATCTTTGAAGATAA 9702 CEP57 TAGAGAAACAATTGAATATAA 282809 WDR51B AAGGACTAATTTAAATTACTA 282809 WDR51B AAGATCCTGGATACAAATTAA 55142 CEP27 CAGCAGATCACAAATATTCAA 55142 CEP27 AAGCTGTTTATCACAGATATA 85378 TUBGCP6 ACGAGACTACTTCCTTAACAA 85378 TUBGCP6 CACCCACGGACACGTATCCAA 54930 C14orf94 CAGCGGCTGCTTGTAACTGAA 54930 C14orf94 AAGGGAGTGTGGAAATGCTTA 5048 PAFAH1B1 CCCGGTAATATCACTCGTTAA 5048 PAFAH1B1 CTCATAGATATTGAACAATAA 2802 GOLGA3 CTGGCCGATTACAGAACTGAA 2802 GOLGA3 CAGAGTTACTTCAGTGCATAA 9662 CEP135 AAGAATTTCATTCTCACTTAA 9662 CEP135 CAGCAGAAAGAGATAAACTAA 153241 CCDC100 ATGCAAGAAGATATATTTGAA 153241 CCDC100 CTGCGGTAATTTCCAGTTCTA 80184 CEP290 CCGGAAGAAATGAAGAATTAA 80184 CEP290 AAGGAAATCAATAAACTTGAA 22852 ANKRD26 CAGAAGTATGTTGATCCTTTA 22852 ANKRD26 ATGGATGATGTTGATGACTTA 10540 DCTN2 CACCAGCTATATGAAACTATA 10540 DCTN2 AACGAGATTGCCAAGCATAAA 25886 WDR51A AAGTGATGGTTTGGAAGAGTA 25886 WDR51A CCAGTGATGACAAGACTGTTA 55835 CENPJ CTCAAGTTAAACATAAGTCAA 55835 CENPJ CACAGTCAGATAAATCTGAAA 84902 CCDC123 AAGGATGGAGTGCTTAATAAA 84902 CCDC123 ACCCTGGTTGTTGGATATAAA 79598 LRRIQ2 CACAAGAGAATTCTAAATTAA 79598 LRRIQ2 AAGGATAATATCGTTTAACAA 51143 DYNC1LI1 TTGGATTTGTCTATACATATA 51143 DYNC1LI1 TAGACTTAGTATATAAATACA 2302 FOXJ1 CAGGACAGACAGACTAATGTA
    [Show full text]
  • Gene Expression Microarray Analysis of the Sciatic Nerve of Mice with Diabetic Neuropathy
    INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE 35: 333-339, 2015 Gene expression microarray analysis of the sciatic nerve of mice with diabetic neuropathy LEI ZHANG1, SHEN QU2, AIBIN LIANG3, HONG JIANG4 and HAO WANG1 1Department of Special Needs Medical Branch, Shanghai Tongji Hospital, School of Medicine, Tongji University, Shanghai 200065; 2Department of Endocrinology, Shanghai Tenth People's Hospital, School of Medicine, Tongji University, Shanghai 200072; Departments of 3Hematology and 4Radiology, Shanghai Tongji Hospital, School of Medicine, Tongji University, Shanghai 200065, P.R. China Received March 20, 2014; Accepted October 7, 2014 DOI: 10.3892/ijmm.2014.2011 Abstract. The present study aimed to explore novel target protein 170 kDa (Cep170)] were found to be co-regulated genes that regulate the development of diabetic neuropathy by both STZ and Rosi, the protein structure of which was (DN) by analyzing gene expression profiles in the sciatic nerve predicted and certain binding activity to Rosi was docked. Our of infected mice. The GSE11343 microarray dataset, which was study demonstrates that the Marcks, Glipr2 and Cep170 genes downloaded from Gene Expression Omnibus, included data may be underlying drug targets in the treatment of DN. on 4 control samples and 5 samples from mice with diabetes induced by streptozotocin (STZ), 5 samples from normal mice Introduction treated with rosiglitazone (Rosi) and 5 samples from mice with diabetes induced by STZ and treated with Rosi. Differentially Diabetic neuropathy (DN), a frequent chronic complica- expressed genes (DEGs) between the different groups were tion of diabetes (type I and II) (in approximately 60 to 75% identified using the substitution augmentation modification of cases) (1), is a major cause of morbidity and mortality, redefinition (SAMR) model.
    [Show full text]
  • WO 2016/081450 Al 26 May 2016 (26.05.2016) W P O P C T
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2016/081450 Al 26 May 2016 (26.05.2016) W P O P C T (51) International Patent Classification: (81) Designated States (unless otherwise indicated, for every G01N33/574 (2006.01) kind of national protection available): AE, AG, AL, AM, AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, (21) International Application Number: BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, PCT/US20 15/06 1073 DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, (22) International Filing Date: HN, HR, HU, ID, IL, IN, IR, IS, JP, KE, KG, KN, KP, KR, 17 November 2015 (17.1 1.2015) KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, (25) Filing Language: English PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, SC, (26) Publication Language: English SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (30) Priority Data: 62/08 1,445 18 November 2014 (18. 11.2014) US (84) Designated States (unless otherwise indicated, for every kind of regional protection available): ARIPO (BW, GH, (71) Applicant: BLUEPRINT MEDICINES CORPORA¬ GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, TION [US/US]; 215 First Street, Cambridge, MA 02142 TZ, UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, (US).
    [Show full text]
  • Novel Methylation Patterns Predict Outcome in Uveal Melanoma
    Article Novel Methylation Patterns Predict Outcome in Uveal Melanoma Sarah Tadhg Ferrier 1 and Julia Valdemarin Burnier 1,2,3,* 1 Cancer Research Program, Research Institute of the McGill University Health Centre, Montreal, QC, Canada, H4A 3J1; [email protected] 2 Experimental Pathology Unit, Department of Pathology, McGill University; Montreal, QC, Canada, H3A 0G4 3 Department of Oncology, McGill University; Montreal, QC, Canada, H3A 0G4 * Correspondence: [email protected] Table S1. Differentially methylated genes in the Pathways in Cancer KEGG pathway with a log FC ≥ 1.5. Average Average Log Fold Change Differentially Adjusted P Beta Beta ID Gene Name Species (High vs Low Methylated Probes Value Value, Value, Risk) Low High ABL proto-oncogene 1, non- ABL1 Homo sapiens cg13440206, −1.85238 1.39E−06 0.576589 0.259088 receptor tyrosine kinase(ABL1) cg02915920 −1.84042 8.03E−06 0.482846 0.192714 cg21195763 1.685721 3.13E−19 0.573548 0.83358 ADCY2 adenylate cyclase 2(ADCY2) Homo sapiens cg14116052 2.454448 4.3E−24 0.513149 0.885217 ADCY6 adenylate cyclase 6(ADCY6) Homo sapiens cg25196508 3.480923 2.9E−25 0.188362 0.792499 AKT serine/threonine kinase AKT1 Homo sapiens cg14116052 2.454448 4.3E−24 0.513149 0.885217 1(AKT1) bone morphogenetic protein BMP4 Homo sapiens cg08046044 1.527233 3.98E−06 0.049923 0.209543 4(BMP4) cg01873886 1.789942 2.55E−05 0.026254 0.1723 Life 2020, 10, x; doi: FOR PEER REVIEW www.mdpi.com/journal/life Life 2020, 10, x FOR PEER REVIEW 2 of 22 cyclin dependent kinase inhibitor CDKN1B Homo sapiens cg06197769
    [Show full text]