DOCSLIB.ORG

Proliferation and Motility of Hepatocellular, Pancreatic and Gastric Cancer Cells Grown in a Medium Without Glucose and Arginine, but with Galactose and Ornithine

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Proliferation and Motility of Hepatocellular, Pancreatic and Gastric Cancer Cells Grown in a Medium Without Glucose and Arginine, but with Galactose and Ornithine 1276 ONCOLOGY LETTERS 13: 1276-1280, 2017 Proliferation and motility of hepatocellular, pancreatic and gastric cancer cells grown in a medium without glucose and arginine, but with galactose and ornithine MINORU TOMIZAWA1, FUMINOBU SHINOZAKI2, YASUFUMI MOTOYOSHI3, TAKAO SUGIYAMA4, SHIGENORI YAMAMOTO5 and NAOKI ISHIGE6 Departments of 1Gastroenterology, 2Radiology, 3Neurology, 4Rheumatology, 5Pediatrics and 6Neurosurgery, National Hospital Organization, Shimoshizu Hospital, Yotsukaido, Chiba 284-0003, Japan Received August 4, 2015; Accepted November 10, 2016 DOI: 10.3892/ol.2017.5568 Abstract. Human primary hepatocytes are able to survive in include hepatocellular carcinoma and cholangiocarcinoma; a medium without glucose and arginine, but supplemented the most frequent original sites of metastasis in liver cancer with galactose and ornithine (hepatocyte selection medium; are the stomach, pancreas and colon (1). Surgery is the most HSM). To address the possibility of the application of HSM effective curative treatment for primary and metastatic in cancer therapy, hepatocellular carcinoma cells, pancre- liver cancer (2,3); however, if surgery is not a viable option, atic cancer cells and gastric cancer cells were cultured in chemotherapy or molecular target therapy are considered for HSM. Cell proliferation was analyzed using an MTS assay. further treatment (4-6). The agents used in chemotherapy and Morphological changes were analyzed using hematoxylin molecular targeted therapy frequently cause hepatotoxicity, and eosin staining. Apoptosis was analyzed using a TUNEL which limits the efficacy of this treatment (7,8). Therefore, assay and cell motility was assessed with a scratch assay. the development of therapeutic approaches with a lower risk Cell proliferation was significantly suppressed in cell lines of hepatotoxicity is required. grown in HSM (P<0.01 in all the cell lines). Hematoxylin Metabolism in cancer cells is characterized by increased and eosin staining revealed pyknotic nuclei, suggesting aerobic glycolysis and lactate production, even under a suffi- that these cells had undergone apoptosis. The number of cient oxygen supply (the Warburg effect), and cancer cells TUNEL‑positive cells was significantly increased in HSM. require more glucose compared with the surrounding normal In the scratch assay, the distance between the growing edge tissues (9). This phenomenon is applied to positron emission and the scratched edge was significantly lower (P<0.01 in tomography, in which 18‑fluorodeoxyglucose, an analogue all the cell lines) in cells cultured in HSM, compared with of glucose, is taken up by cancer cells (10). Unlike glucose, those grown in Dulbecco's modified Eagle's medium or 18‑fluorodeoxyglucose is not metabolized and accumulates RPMI-1640. Therefore, the proliferation and motility of in cancer cells; therefore, a positive signal may be detected hepatocellular carcinoma cells, pancreatic cancer cells and from cancerous tissues (11). Glucose is an important source gastric cancer cells was suppressed, and these cells subse- of energy that is essential for cell survival (12,13). Galactose quently underwent apoptosis in a medium without glucose enters glycolysis as a substrate for the enzyme galactokinase and arginine, but containing galactose and ornithine. (GALK), which is expressed in the liver and kidney (14,15). Arginine is an essential amino acid produced from ornithine Introduction by ornithine carbamoyltransferase (OTC) in the urea cycle, which is exclusive to hepatocytes (16). Normal cells produce The liver is a target organ implicated in a number of primary arginine de novo, whereas cancer cells take up arginine from and metastatic types of cancer. Primary liver cancer types extracellular tissues (17). Hepatocytes express GALK and OTC, and therefore, may be expected to survive in a medium lacking glucose and arginine, but supplemented with galactose and orni- thine (18,19). Our previous study developed a hepatocyte Correspondence to: Dr Minoru Tomizawa, Department of selection medium (HSM), which lacks glucose and arginine Gastroenterology, National Hospital Organization, Shimoshizu Hospital, 934-5 Shikawatashi, Yotsukaido, Chiba 284-0003, Japan but contains galactose and ornithine (20). Primary human E-mail: [email protected] hepatocytes are able to survive in HSM, and this medium purifies primary human hepatocytes from co‑culture with Key words: glucose, arginine, galactose, ornithine, galactokinase, human-induced pluripotent stem cells (21). urea cycle Therefore, the present study analyzed the suppression of the proliferation and motility of hepatocellular carcinoma cells, pancreatic cancer cells and gastric cancer cells in HSM. TOMIZAWA et al: CANCER CELLS IN HSM 1277 Materials and methods TUNEL staining. Cells were cultured in chamber slides with 5% carbon dioxide at 37˚C in a humidified chamber and apop- Cell culture. Human hepatocellular carcinoma HLF and totic cells were detected using the Wako Apoptosis In Situ PLC/PRF/5 cells, human pancreatic cancer MIA-Paca2 and Detection kit (Wako Pure Chemical Industries, Ltd.), following PANC-1 cells and human gastric cancer MKN45 and MKN74 the manufacturer's protocol. Apoptotic cells were analyzed cells were purchased from the Riken Cell Bank (Cell Engi- using a TUNEL assay, which consists of the addition of TdT to neering Division, Riken Biosource Center, Tsukuba, Japan). the 3'-terminus of apoptotically fragmented DNA, followed by HLF cells, PLC/PRF/5 cells and MIA-Paca2 cells were immunochemical detection using an anti‑fluorescein antibody cultured in Dulbecco's modified Eagle's medium (DMEM; conjugated with horseradish peroxidase and diaminobenzidine Sigma-Aldrich; Merck Millipore, Darmstadt, Germany) (DAB) as the substrate, following the manufacturer's protocol. supplemented with 10% fetal bovine serum (FBS; Thermo The stained slides were observed under x100 magnification Fisher Scientific, Inc., Waltham, MA, USA). PANC‑1, MKN45 using an AX80 microscope. and MKN74 cells were cultured in RPMI-1640 (Sigma-Aldrich; Merck Millipore) supplemented with 10% FBS. Cell lines Scratch assay. HLF, PLC/PRF/5, MIA-Paca2, PANC-1, were cultured with 5% carbon dioxide at 37˚C in a humidified MKN45 and MKN74 cells were plated on 4-well chamber chamber, and passaged twice a week. slides, and upon reaching 100% confluency, the cell monolayer was scratched with a sterile razor, incubated at 37˚C for 48 h HSM. HSM was prepared from amino acid powders, using the and stained with hematoxylin and eosin. The stained slides formulation method of Leibovitz-15 medium (Thermo Fisher were observed under x200 magnification using an AX80 Scientific, Inc.), but omitting arginine, tyrosine, glucose and microscope. The distance between the scratched and growing sodium pyruvate, and adding galactose (900 mg/l; Wako Pure edges of the cells was evaluated at five different fields. Chemical Industries, Ltd., Osaka, Japan), ornithine (1 mM; Wako Pure Chemical Industries, Ltd.), glycerol (5 mM; Wako Statistical analysis. Data were presented as the mean ± stan- Pure Chemical Industries, Ltd.) and proline (260 mM; Wako dard deviation. Cell proliferation, TUNEL assay and scratch Pure Chemical Industries, Ltd.). Proline is necessary for assay data were analyzed by one-way analysis of variance. DNA synthesis, and therefore, it was included in the medium Statistical analysis was performed using JMP 5.0J software (30 mg/l) (22). Knockout serum replacement (KSR; Thermo (SAS Institute, Inc., Cary, NC, USA). P<0.05 was considered Fisher Scientific, Inc.) was used at a final concentration of 10% to indicate a statistically significant difference. in place of FBS in order to establish defined xeno‑free condi- tions in HSM. Results Cell proliferation analysis. HLF, PLC/PRF/5, MIA-Paca2, To examine the effect of culture in HSM on cell proliferation, PANC-1, MKN45 and MKN74 cells were trypsinized, an MTS assay was performed following three days of culture harvested and seeded onto 96‑well flat‑bottomed plates at a in DMEM, RPMI-1640 or HSM (Fig. 1). Proliferation of HLF, density of 1,000 cells/well, then incubated at 37˚C for 24 h PLC/PRF/5, MIA-Paca2, PANC-1, MKN45 and MKN74 cells in DMEM or RPMI-1640 supplemented with 10% FBS. cultured in HSM decreased to 23.4±5.9, 15.7±7.0, 24.0±10.4, Subsequent to changing the medium to HSM, the cells were 19.0±10.3, 25.3±9.3 and 34.7±13.2%, respectively. The results cultured at 37˚C for a further 72 h, and subjected to an MTS revealed that cell proliferation was significantly suppressed in assay (Promega Corporation, Madison, WI, USA), according HSM for all cell lines (P<0.01). to the manufacturer's protocol. MTS is reduced by the cells To observe morphological changes, hematoxylin and eosin into a colored formazan product that reduces the absorbance staining was performed following two days of culture in HSM at 490 nm; the absorbance at 490 nm was evaluated using an (Fig. 2). HLF cells (Fig. 2A), PLC/PRF/5 cells (Fig. 2B), iMark Microplate Absorbance Reader (Bio-Rad Laboratories, MIA-Paca2 cells (Fig. 2C), PANC-1 cells (Fig. 2D), MKN45 Inc., Hercules, CA, USA). cells (Fig. 2E) and MKN74 cells (Fig. 2F) all exhibited pyknotic nuclei, suggesting that the cells had undergone apoptosis. Hematoxylin and eosin staining. HLF, PLC/PRF/5, To further examine whether HSM-induced apoptosis MIA-Paca2, PANC-1, MKN45 and MKN74 cells were had occurred, a TUNEL assay was performed (Fig. 3). cultured in chamber slides (Matsunami, Kishiwada, Japan) in TUNEL-positive cells were observed in all cell lines (Fig. 3A). a 5% CO2 atmosphere at 37˚C in a humidified chamber, and The percentage of apoptotic cells in HLF, PLC/PRF/5, subjected to hematoxylin and eosin staining (Muto Glass, MIA-Paca2, MKN45 and MKN74 cells cultured in DMEM or Tokyo, Japan). The cells were fixed in 10% formalin at room RPMI-1640 was 0.1±0.0, 0.2±0.0, 1.1±0.0, 1.3±0.0, 10.9±2.1 temperature for 10 min. The cells were stained with hema- and 0.1±0.0%, respectively. The percentage of cells in HLF, toxylin, and incubated at room temperature for 4 min.
Load more

Recommended publications
  • Molecular Characterization of Galactokinase Deficiency In
    J Hum Genet (1999) 44:377–382 © Jpn Soc Hum Genet and Springer-Verlag 1999377 ORIGINAL ARTICLE Minoru Asada · Yoshiyuki Okano · Takuji Imamura Itsujin Suyama · Yutaka Hase · Gen Isshiki Molecular characterization of galactokinase deficiency in Japanese patients Received: May 19, 1999 / Accepted: August 21, 1999 Abstract Galactokinase (GALK) deficiency is an autoso- Key words Galactosemia · Galactokinase (GALK) · Muta- mal recessive disorder, which causes cataract formation in tion · Genotype · Phenotype children not maintained on a lactose-free diet. We charac- terized the human GALK gene by screening a Japanese genomic DNA phage library, and found that several nucle- otides in the 59-untranslated region and introns 1, 2, and 5 in Introduction our GALK genomic analysis differed from published data. A 20-bp tandem repeat was found in three places in intron Galactokinase (GALK: McKUSICK 230200) is the first 5, which were considered insertion sequences. We identified enzyme in the Leloir pathway of galactose metabolism; it five novel mutations in seven unrelated Japanese patients catalyzes the phosphorylation of galactose to galactose- with GALK deficiency. There were three missense muta- 1-phosphate. GALK deficiency, first described in 1965 tions and two deletions. All three missense mutations (Gitzelmann 1965), is an autosomal recessive genetic disor- (R256W, T344M, and G349S) occurred at CpG dinucle- der with an incidence of 1/1,000,000 in Japan (Aoki and otides, and the T344M and G349S mutations occurred in Wada 1988) on newborn mass screening and an incidence of the conserved region. The three missense mutations led to a 1/1,000,000 in Caucasians (Segal and Berry 1995).
    [Show full text]
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
    [Show full text]
  • Hereditary Galactokinase Deficiency J
    Arch Dis Child: first published as 10.1136/adc.46.248.465 on 1 August 1971. Downloaded from Alrchives of Disease in Childhood, 1971, 46, 465. Hereditary Galactokinase Deficiency J. G. H. COOK, N. A. DON, and TREVOR P. MANN From the Royal Alexandra Hospital for Sick Children, Brighton, Sussex Cook, J. G. H., Don, N. A., and Mann, T. P. (1971). Archives of Disease in Childhood, 46, 465. Hereditary galactokinase deficiency. A baby with galactokinase deficiency, a recessive inborn error of galactose metabolism, is des- cribed. The case is exceptional in that there was no evidence of gypsy blood in the family concerned. The investigation of neonatal hyperbilirubinaemia led to the discovery of galactosuria. As noted by others, the paucity of presenting features makes early diagnosis difficult, and detection by biochemical screening seems desirable. Cataract formation, of early onset, appears to be the only severe persisting complication and may be due to the biosynthesis and accumulation of galactitol in the lens. Ophthalmic surgeons need to be aware of this enzyme defect, because with early diagnosis and dietary treatment these lens changes should be reversible. Galactokinase catalyses the conversion of galac- and galactose diabetes had been made in this tose to galactose-l-phosphate, the first of three patient (Fanconi, 1933). In adulthood he was steps in the pathway by which galactose is converted found to have glycosuria as well as galactosuria, and copyright. to glucose (Fig.). an unexpectedly high level of urinary galactitol was detected. He was of average intelligence, and his handicaps, apart from poor vision, appeared to be (1) Galactose Gackinase Galactose-I-phosphate due to neurofibromatosis.
    [Show full text]
  • Induction of Uridyl Transferase Mrna-And Dependency on GAL4 Gene Function (In Vitro Translation/Immunoprecipitation/GAL Gene Cluster/Positive Regulation) JAMES E
    Proc. Nati. Acad. Sci. USA Vol. 75, No. 6, pp. 2878-2882, June 1978 Genetics Regulation of the galactose pathway in Saccharomyces cerevisiae: Induction of uridyl transferase mRNA-and dependency on GAL4 gene function (in vitro translation/immunoprecipitation/GAL gene cluster/positive regulation) JAMES E. HOPPER*, JAMES R. BROACHt, AND LUCY B. ROWE* * Rosenstiel Basic Medical Sciences Research Center, Brandeis University, Waltham, Massachusetts 02154; and t Cold Spring Harbor Laboratory, Cold Spring Harbor, New York 11724 Communicated by Norman H. Giles, April 10,1978 ABSTRACT In Saccharomyces cerevisiae, utilization of Genetic control of the inducible galactose pathway enzymes galactose requires four inducible enzyme activities. Three of involves the four structural genes GALI, GAL10, GAL7, and these activities (galactose-l-phosphate uridyl transferase, EC genes, GAL4, GAL81 (c), GAL80 2.7.7.10; uridine diphosphogalactose 4-epimerase, EC 5.1.3.2; GAL2 and four regulatory and galactokinase, EC 2.7.1.6) are specified by three tightly (i), and GALS.* Mutations in GALl, GAL10, GAL7, and GAL2 linked genes (GAL7, GALlO, and GALI, respectively) on chro- affect the individual appearance of galactokinase, epimerase, mosome II, whereas the fourth, galactose transport, is specified transferase, and galactose transport activities, respectively (6). by a gene (GALS) located on chromosome XIL Although classic Mutations defining the GALl, GAL10, and GAL7 genes have genetic analysis has revealed both positive and negative regu- invariably been recessive, and they map in three tightly linked latory genes that coordinately affect the appearance of ail four complementation groups near the centromere of chromosome enzyme activities, neither the basic events leading to the ap- pearance of enzyme activities nor the roles of the regulatory II (6, 9, 10).
    [Show full text]
  • Supplementary Materials
    Supplementary Materials Figure S1. Differentially abundant spots between the mid-log phase cells grown on xylan or xylose. Red and blue circles denote spots with increased and decreased abundance respectively in the xylan growth condition. The identities of the circled spots are summarized in Table 3. Figure S2. Differentially abundant spots between the stationary phase cells grown on xylan or xylose. Red and blue circles denote spots with increased and decreased abundance respectively in the xylan growth condition. The identities of the circled spots are summarized in Table 4. S2 Table S1. Summary of the non-polysaccharide degrading proteins identified in the B. proteoclasticus cytosol by 2DE/MALDI-TOF. Protein Locus Location Score pI kDa Pep. Cov. Amino Acid Biosynthesis Acetylornithine aminotransferase, ArgD Bpr_I1809 C 1.7 × 10−4 5.1 43.9 11 34% Aspartate/tyrosine/aromatic aminotransferase Bpr_I2631 C 3.0 × 10−14 4.7 43.8 15 46% Aspartate-semialdehyde dehydrogenase, Asd Bpr_I1664 C 7.6 × 10−18 5.5 40.1 17 50% Branched-chain amino acid aminotransferase, IlvE Bpr_I1650 C 2.4 × 10−12 5.2 39.2 13 32% Cysteine synthase, CysK Bpr_I1089 C 1.9 × 10−13 5.0 32.3 18 72% Diaminopimelate dehydrogenase Bpr_I0298 C 9.6 × 10−16 5.6 35.8 16 49% Dihydrodipicolinate reductase, DapB Bpr_I2453 C 2.7 × 10−6 4.9 27.0 9 46% Glu/Leu/Phe/Val dehydrogenase Bpr_I2129 C 1.2 × 10−30 5.4 48.6 31 64% Imidazole glycerol phosphate synthase Bpr_I1240 C 8.0 × 10−3 4.7 22.5 8 44% glutamine amidotransferase subunit Ketol-acid reductoisomerase, IlvC Bpr_I1657 C 3.8 × 10−16
    [Show full text]
  • Biochemistry Entry of Fructose and Galactose
    Paper : 04 Metabolism of carbohydrates Module : 06 Entry of Fructose and Galactose Dr. Vijaya Khader Dr. MC Varadaraj Principal Investigator Dr.S.K.Khare,Professor IIT Delhi. Paper Coordinator Dr. Ramesh Kothari,Professor UGC-CAS Department of Biosciences Saurashtra University, Rajkot-5, Gujarat-INDIA Dr. S. P. Singh, Professor Content Reviewer UGC-CAS Department of Biosciences Saurashtra University, Rajkot-5, Gujarat-INDIA Dr. Charmy Kothari, Assistant Professor Content Writer Department of Biotechnology Christ College, Affiliated to Saurashtra University, Rajkot-5, Gujarat-INDIA 1 Metabolism of Carbohydrates Biochemistry Entry of Fructose and Galactose Description of Module Subject Name Biochemistry Paper Name 04 Metabolism of Carbohydrates Module Name/Title 06 Entry of Fructose and Galactose 2 Metabolism of Carbohydrates Biochemistry Entry of Fructose and Galactose METABOLISM OF FRUCTOSE Objectives 1. To study the major pathway of fructose metabolism 2. To study specialized pathways of fructose metabolism 3. To study metabolism of galactose 4. To study disorders of galactose metabolism 3 Metabolism of Carbohydrates Biochemistry Entry of Fructose and Galactose Introduction Sucrose disaccharide contains glucose and fructose as monomers. Sucrose can be utilized as a major source of energy. Sucrose includes sugar beets, sugar cane, sorghum, maple sugar pineapple, ripe fruits and honey Corn syrup is recognized as high fructose corn syrup which gives the impression that it is very rich in fructose content but the difference between the fructose content in sucrose and high fructose corn syrup is only 5-10%. HFCS is rich in fructose because the sucrose extracted from the corn syrup is treated with the enzyme that converts some glucose in fructose which makes it more sweet.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Review Galactokinase: Structure, Function and Role in Type II
    CMLS, Cell. Mol. Life Sci. 61 (2004) 2471–2484 1420-682X/04/202471-14 DOI 10.1007/s00018-004-4160-6 CMLS Cellular and Molecular Life Sciences © Birkhäuser Verlag, Basel, 2004 Review Galactokinase: structure, function and role in type II galactosemia H. M. Holden a,*, J. B. Thoden a, D. J. Timson b and R. J. Reece c,* a Department of Biochemistry, University of Wisconsin, Madison, Wisconsin 53706 (USA), Fax: +1 608 262 1319, e-mail: [email protected] b School of Biology and Biochemistry, Queen’s University Belfast, Medical Biology Centre, 97 Lisburn Road, Belfast BT9 7BL, (United Kingdom) c School of Biological Sciences, The University of Manchester, The Michael Smith Building, Oxford Road, Manchester M13 9PT, (United Kingdom), Fax: +44 161 275 5317, e-mail: [email protected] Received 13 April 2004; accepted 7 June 2004 Abstract. The conversion of beta-D-galactose to glucose unnatural sugar 1-phosphates. Additionally, galactoki- 1-phosphate is accomplished by the action of four en- nase-like molecules have been shown to act as sensors for zymes that constitute the Leloir pathway. Galactokinase the intracellular concentration of galactose and, under catalyzes the second step in this pathway, namely the con- suitable conditions, to function as transcriptional regula- version of alpha-D-galactose to galactose 1-phosphate. tors. This review focuses on the recent X-ray crystallo- The enzyme has attracted significant research attention graphic analyses of galactokinase and places the molecu- because of its important metabolic role, the fact that de- lar architecture of this protein in context with the exten- fects in the human enzyme can result in the diseased state sive biochemical data that have accumulated over the last referred to as galactosemia, and most recently for its uti- 40 years regarding this fascinating small molecule ki- lization via ‘directed evolution’ to create new natural and nase.
    [Show full text]
  • Metabolism of Sugars: a Window to the Regulation of Glucose and Lipid Homeostasis by Splanchnic Organs
    Clinical Nutrition 40 (2021) 1691e1698 Contents lists available at ScienceDirect Clinical Nutrition journal homepage: http://www.elsevier.com/locate/clnu Narrative Review Metabolism of sugars: A window to the regulation of glucose and lipid homeostasis by splanchnic organs Luc Tappy Faculty of Biology and Medicine, University of Lausanne, Switzerland, Ch. d’Au Bosson 7, CH-1053 Cugy, Switzerland article info summary Article history: Background &aims: Dietary sugars are absorbed in the hepatic portal circulation as glucose, fructose, or Received 14 September 2020 galactose. The gut and liver are required to process fructose and galactose into glucose, lactate, and fatty Accepted 16 December 2020 acids. A high sugar intake may favor the development of cardio-metabolic diseases by inducing Insulin resistance and increased concentrations of triglyceride-rich lipoproteins. Keywords: Methods: A narrative review of the literature regarding the metabolic effects of fructose-containing Fructose sugars. Gluconeogenesis Results: Sugars' metabolic effects differ from those of starch mainly due to the fructose component of de novo lipogenesis Intrahepatic fat concentration sucrose. Fructose is metabolized in a set of fructolytic cells, which comprise small bowel enterocytes, Enterocyte hepatocytes, and kidney proximal tubule cells. Compared to glucose, fructose is readily metabolized in an Hepatocyte insulin-independent way, even in subjects with diabetes mellitus, and produces minor increases in glycemia. It can be efficiently used for energy production, including during exercise. Unlike commonly thought, fructose when ingested in small amounts is mainly metabolized to glucose and organic acids in the gut, and this organ may thus shield the liver from potentially deleterious effects. Conclusions: The metabolic functions of splanchnic organs must be performed with homeostatic con- straints to avoid exaggerated blood glucose and lipid concentrations, and thus to prevent cellular damages leading to non-communicable diseases.
    [Show full text]
  • Fructose & Galactose Metabolism
    Fructose & Galactose Metabolism Dr. Nesrin Mwafi Biochemistry & Molecular Biology Department Faculty of Medicine, Mutah University Other substrates enter Glycolysis Glucose Mannose hexokinase Galactose Gal-1P G1P G6P Mannose-6p Hexokinase (extrahepatic tissues) Fructose F6P FBP in liver in Glyceraldehyde F1P DHAP G3P glycerol Glycerol Glycerol-3-P kinase Fructose Sources • Dietary Sources of Fructose: 1. Sucrose (table sugar) consists of glucose and fructose 2. Free fructose: fruits (fruit sugar), honey, vegetables 3. Sweetener: High Fructose Corn Syrup (HFCS) Fructose Absorption • Free fructose is absorbed from intestinal lumen through GLUT5 found at the apical membrane of the intestinal absorptive cells (enterocytes) • Fructose then crosses to blood capillaries through GLUT2 at the basolateral membrane • Fructose absorption and entrance into cells is insulin independent • Glucose and Galactose are absorbed via SGLT1 at the apical end and then through GLUT2 at the basolateral membrane. Fructose Metabolic Pathways • Fructose can be metabolized by one of two metabolic pathways: 1. Major Pathway (called Fructose-1-phosphate) in Liver 2. Minor Pathway in other tissues (Extrahepatic cells like kidney and testis) the fructose is phosphorylated by hexokinase and the generated fructose-6-phosphate directly joins the glycolysis Fructose Metabolism in Liver • Fructose-1-phosphate (F-1-P) pathway (Fructolysis) consists of 3 steps: 1. Phosphorylation of fructose by the hepatic enzyme fructokinase to generate fructose-1-phosphate. This step is important to trap fructose inside hepatocytes and to destabilize fructose (an activation step) 2. The cleavage of F-1-P by aldolase b (also known as F-1-P Aldolase) to produce dihydroxyacetone phosphate (DHAP) and glyceraldehyde (DHAP) Fructose Metabolism in Liver Glycerol dehydrogenase Glycerol ATP ATP Triose phosphate ADP Glycerol isomerase kinase ADP Dehydrogenase Glycerol-3- phosphate Triglycerides Fructose Metabolism in Liver 3.
    [Show full text]
  • A Review of Isozymes in Cancer1
    Cancer Research VOLUME31 NOVEMBER 1971 NUMBER11 [CANCER RESEARCH 31, 1523-1542, November 1971] A Review of Isozymes in Cancer1 Wayne E. Criss Department of Obstetrics and Gynecology, University of Florida College of Medicine, Gainesville, Florida 32601 TABLE OF CONTENTS postulated role for that particular isozymic system in cellular metabolism. Summary 1523 Introduction 1523 Normal enzyme differentiation 1523 INTRODUCTION Tumor enzyme differentiation 1524 Isozymes 1524 Normal Enzyme Differentiation DNA polymerase 1524 Enzyme differentiation is the process whereby, during the Hexokinase 1525 Fructose 1,6-diphosphatase 1525 development of an organ in an animal, the organ acquires the quantitative and qualitative adult enzyme patterns (122). Key Aldolase 1526 pathway enzymes in several metabolic processes have been Pyruvate kinase 1527 found to undergo enzymatic differentiation. The enzymes Láclatedehydrogenase 1527 Isocitrate dehydrogenase 1527 involved in nitrogen metabolism, and also in urea cycle Malate dehydrogenase 1528 metabolism (180), are tyrosine aminotransferase (123, 151, Glycerol phosphate dehydrogenase 1529 330, 410), tryptophan pyrrolase (261), serine dehydratase Glutaminase 1529 (123, 410), histidine ammonia lyase (11), and aspartate Aspartate aminotransferase 1530 aminotransferase (337, 388). The enzymes involved in nucleic Adenylate kinase 1531 acid metabolism are DNA polymerase (156, 277) and RNase (52). In glycolysis the enzymes are hexokinase-glucokinase Carbamyl phosphate synthetase 1531 Lactose synthetase 1533 (98, 389), galactokinase 30, aldolase (267, 315), pyruvate Discussion 1533 kinase (73, 386), and lactate dehydrogenase (67, 69). In References 1533 mitochondrial oxidation they are NADH oxidase, succinic oxidase, a-glycero-P oxidase, ATPase, cytochrome oxidase, and flavin content (84, 296). In glycogen metabolism the SUMMARY enzymes involved are UDPG pyrophosphorylase and UDPG glucosyltransferase (19).
    [Show full text]
  • O O2 Enzymes Available from Sigma Enzymes Available from Sigma
    COO 2.7.1.15 Ribokinase OXIDOREDUCTASES CONH2 COO 2.7.1.16 Ribulokinase 1.1.1.1 Alcohol dehydrogenase BLOOD GROUP + O O + O O 1.1.1.3 Homoserine dehydrogenase HYALURONIC ACID DERMATAN ALGINATES O-ANTIGENS STARCH GLYCOGEN CH COO N COO 2.7.1.17 Xylulokinase P GLYCOPROTEINS SUBSTANCES 2 OH N + COO 1.1.1.8 Glycerol-3-phosphate dehydrogenase Ribose -O - P - O - P - O- Adenosine(P) Ribose - O - P - O - P - O -Adenosine NICOTINATE 2.7.1.19 Phosphoribulokinase GANGLIOSIDES PEPTIDO- CH OH CH OH N 1 + COO 1.1.1.9 D-Xylulose reductase 2 2 NH .2.1 2.7.1.24 Dephospho-CoA kinase O CHITIN CHONDROITIN PECTIN INULIN CELLULOSE O O NH O O O O Ribose- P 2.4 N N RP 1.1.1.10 l-Xylulose reductase MUCINS GLYCAN 6.3.5.1 2.7.7.18 2.7.1.25 Adenylylsulfate kinase CH2OH HO Indoleacetate Indoxyl + 1.1.1.14 l-Iditol dehydrogenase L O O O Desamino-NAD Nicotinate- Quinolinate- A 2.7.1.28 Triokinase O O 1.1.1.132 HO (Auxin) NAD(P) 6.3.1.5 2.4.2.19 1.1.1.19 Glucuronate reductase CHOH - 2.4.1.68 CH3 OH OH OH nucleotide 2.7.1.30 Glycerol kinase Y - COO nucleotide 2.7.1.31 Glycerate kinase 1.1.1.21 Aldehyde reductase AcNH CHOH COO 6.3.2.7-10 2.4.1.69 O 1.2.3.7 2.4.2.19 R OPPT OH OH + 1.1.1.22 UDPglucose dehydrogenase 2.4.99.7 HO O OPPU HO 2.7.1.32 Choline kinase S CH2OH 6.3.2.13 OH OPPU CH HO CH2CH(NH3)COO HO CH CH NH HO CH2CH2NHCOCH3 CH O CH CH NHCOCH COO 1.1.1.23 Histidinol dehydrogenase OPC 2.4.1.17 3 2.4.1.29 CH CHO 2 2 2 3 2 2 3 O 2.7.1.33 Pantothenate kinase CH3CH NHAC OH OH OH LACTOSE 2 COO 1.1.1.25 Shikimate dehydrogenase A HO HO OPPG CH OH 2.7.1.34 Pantetheine kinase UDP- TDP-Rhamnose 2 NH NH NH NH N M 2.7.1.36 Mevalonate kinase 1.1.1.27 Lactate dehydrogenase HO COO- GDP- 2.4.1.21 O NH NH 4.1.1.28 2.3.1.5 2.1.1.4 1.1.1.29 Glycerate dehydrogenase C UDP-N-Ac-Muramate Iduronate OH 2.4.1.1 2.4.1.11 HO 5-Hydroxy- 5-Hydroxytryptamine N-Acetyl-serotonin N-Acetyl-5-O-methyl-serotonin Quinolinate 2.7.1.39 Homoserine kinase Mannuronate CH3 etc.
    [Show full text]