From trees to molecules.

The invasive process of Acacia dealbata

Link at different scales

Memoria de Tesis Doctoral presentada por el Licenciado

Pablo Souza Alonso

From trees to molecules, invasive process of Acacia dealbata Link at different scales

La realización de esta tesis doctoral ha sido posible gracias a la concesión de una beca de 3er ciclo y posteriormente a un contrato predoctoral financiados por la Universidade de Vigo.

Vigo, Noviembre de 2014

Edited by Pablo Souza Alonso

Printing:

Agradecimientos

Más de 175 páginas, 60.000 palabras, 400.000 caracteres. Después de todo este trabajo, cualquiera diría que esta es la parte más fácil de escribir dentro de un proceso tan largo como es la redacción de una tesis doctoral. Error. Siendo muy fácil agradecer a la gente implicada su ayuda durante estos años, se me hace frustrante pensar que me dejo a alguien por el camino. Todos, de un modo u otro, en mayor o menor medida, me habéis marcado y tenéis vuestra parte de “culpa” en este trabajo. En un esfuerzo de memoria, intentaré en tres páginas recordaros a todos los que en algún momento os habéis cruzado en mi camino. Tengo que empezar, sin duda por mi familia. Sin vosotros no estaría aquí y no me equivoco si digo que pocos pueden estar tan agradecidos por tanto apoyo incansable, sin dudas desde el primer día. A Oli, por tu cariño, tu aliento diario, por tu confianza ciega, la tienes aún cuando a mí me falla. Esas horas interminables delante del ordenador, la paciencia durante esos fines de semana que había que subir a trabajar... Una gran parte de esta tesis es tuya. A Luís y Nuria, mis padres científicos. Ambos me disteis esa 1ª oportunidad de empezar en el mundo científico, más que un trabajo, un estilo de vida. Un estilo de vida que os hace ser diferentes. Los dos sois ejemplos a seguir dentro de este mundo y realmente os admiro. Parece que una etapa de mi vida acaba aquí pero espero, con el paso del tiempo, poder devolveros toda la confianza que depositasteis en mí desde el principio. A Paula, por tu ayuda y sinceridad. Por tu esfuerzo y constancia eres el espejo en el que la mayoría de gente de ciencia debería reflejarse. A Marga, esa sonrisa permanente para todo y con todos, junto con un saber botánico interminable, que placer trabajar a tu lado. A Carlos. Siempre echando un cable para desatascar esas situaciones imprevistas con ingenio, sonrisa y buen gusto musical. Los cafés de todos estos años no tienen precio. A Carol, mi hermana científica desde el principio. Nos tocó empezar juntos y hemos seguido caminos paralelos durante todos estos años. Gracias por todo lo que compartimos.

A esa extraña pareja, Ana y Noe, núcleo inicial del proyecto con Carpobrotus en nuestro laboratorio. Tan diferentes y ambas grandes compañeras de trabajo, tan lejos os llevó este mundillo….ojalá trabajemos de nuevo juntos en el futuro. En general, a todo el grupo de Fisio Vegetal: Pachi, Adela, Ana, Eli, Carla, Aitana, David (nuestra pandilla verdura) por su ayuda en todo momento, por tener siempre una sonrisa y ganas para solucionar los problemas; en especial a Lore, sobre todo por tu ayuda durante la estancia en Coimbra. Como no, a nuestro pequeño grupo salvaje de investigadores: Rubén, Gara, Tonio, Carol. Por todo lo compartido en estos últimos años. Valerosos supervivientes que decidieron seguir la carrera científica en el peor momento posible. Quién nos lo iba a decir. A vosotros agradeceros solo ser como sois. No hace falta decir más. A los nuevos, Ale, Marta, Yaiza, Nico, Laura, Alba y Andrea, Noe, María, Jonatan & Jonatan. Por hacer que estos últimos meses de agobio se convirtiesen en una gozada. Mucho ánimo en el camino que os queda por delante. A la gente de edafología, Luisa, Emma, Flora, Bea, Vero, Manuel, Dani. Creo que durante un tiempo, sobre todo al principio, os tocó sufrirme un poco. Gracias por vuestra paciencia y ayuda sin condiciones. A Manuel Rey y sobre todo a Óscar; sin ellos, la parte molecular hubiese sido un problema y en lugar de eso, se convirtió en un placer. También a Pablo, por esas cuantificaciones de ADN express. Al equipo al completo de Cádiz y en especial a Francisco Antonio, Chon, Paula, Rosa y Jose Luís, por hacerme sentir como uno más desde el primer día que puse un pie en vuestro laboratorio. Biólogos y químicos en ocasiones chocamos y solemos tener puntos de vista diferentes. Nunca me lo pareció. A Carlos Cavaleiro; cada visita a Coimbra es un auténtico placer. Reflejas el espíritu de colaboración entre científicos, algo esencial pero no por ello habitual, como pocas veces había visto antes. Ojalá nuestras colaboraciones se prolonguen en el tiempo. Por supuesto, no me puedo dejar por el camino a los que viniendo de fuera, algunos desde muy lejos, dejasteis un enorme poso en mí, Ifti, Hamdi, Fabri, Katya, Yusuke, Jorge. Espero que todo os vaya bien donde quiera que os lleve este mundo científico y que nos veamos pronto.

A la gente de mi promoción, que en algún momento se sentó en el zulo, banco, carballo o pecera (en función del curso al que nos refiramos y dependiendo de la época del año) por vuestra juventud infinita y por tantos y tantos análisis sesudos de los tiempos contemporáneos desde un prisma caleidoscópico, sobre todo a Luís, Anuca, Jano, Esther, Iria, Carmen, David, Águeda, Jenny, Guille, Ana, Jacobo, Toño, Dani, Olga, Agar, Manuel, Miguel, Mackay, Tomás….y muchos más, que seguro me dejo por el camino. A mis locos de la playa: Rubén, Manu, Jairo, Andrés. Conocimiento no estrictamente científico en medio salino, con miles de kilómetros y una bolsa llena de historias a nuestras espaldas…. válvula de escape para disfrutar, compartir experiencias increibles y poder seguir día a día, luchando. Al grupete de los de siempre: Héctor, Dani, Pedro, Nando, Miguel, Rafa, Esteban, Ith, Eva, María y los nuevos Eli y Norman y a los más nuevos todavía, Eric y Daryl. Prometo sentarme con vosotros un día y responder, al fín, a esa pregunta recurrente: bueno, Pablo, ¿y tu cuándo acabas de estudiar? A la Universidade de Vigo, por financiarme económicamente durante estos años. A todos vosotros, GRACIAS

Por último, me gustaría darle un pequeño espacio al investigador emigrado. No al que está pasando un período de estancia fuera, formativo e imprescindible para todos nosotros, si no a aquel que buscando establecerse y tener un futuro digno no ha tenido más remedio que emigrar ya que en este país no era valorado o incluso, directamente, excluído. Aunque no sea habitual, me gustaría también recordar, para no olvidar, a todos aquellos que en estos últimos y difíciles años se han empeñado en poner trabas al desarrollo científico, especialmente a nivel nacional, mediante reducciones de salario, falta de becas, eliminación de programas de contratación, y en general, la falta de financiación de proyectos y contratos. A aquellos que deciden no invertir en investigación y desarrollo, contrariamente a lo que hacen nuestros vecinos, olvidando que el nivel de desarrollo de una sociedad suele ir de la mano con el avance científico. A aquellos que provocando vergüenza con sus actos se llenan la boca hablando de excelencia en nuestro país y fuerzan un éxodo de investigadores

nunca antes visto, que irán con su experiencia a enriquecer y mejorar el conocimiento de nuestros pueblos vecinos. A aquellos que han dilapidado la carrera de muchos jóvenes investigadores, después de años de esfuerzo (y dinero público invertido, no nos olvidemos), bloqueando, en un momento crucial de su vida, el acceso a un puesto de trabajo digno. A aquellos que desde los medios de comunicación de masas desprestigian los logros conseguidos en las universidades y centros de investigación públicos.

Terminaré esta sección de agradecimientos haciendo mía una frase harto repetida, por desgracia, en estos tiempos:

SIN CIENCIA NO HAY FUTURO

Conviene ordenar de tal suerte las cosas, que la masa del género humano pueda comprenderlas y aplicarlas: que la ciencia deje de ser un lujo; todo al contrario, que sea la base de la vida de todos. Lo exige la justicia.

Koprotkin, A los jóvenes

La ciencia es conocimiento público, no privado

Thomas Merton

El que nos encontremos tan a gusto en plena naturaleza proviene de que ésta no tiene opinión sobre nosotros

Jordi Bigues

This PhD dissertation has originated following publications and International conference contributions

List of publications

Souza-Alonso, P., Lorenzo, P., Rubido-Bará, M., González, L., 2013. Effectiveness of management strategies in Acacia dealbata Link invasion, native vegetation and soil microbial community responses. For. Ecol. Manag. 304, 464-472. Souza-Alonso, P., Novoa, A., González, L., 2014. Soil biochemical alterations and microbial community responses under Acacia dealbata Link invasion. Soil Biol. Biochem. 79, 100-108. Souza-Alonso, P., Cavaleiro, C., González, L., 2014. Ambient has become strained. Identification of Acacia dealbata Link volatiles interfering with germination and early growth of native species. J. Chem. Ecol. 40, 1051-1061. Souza-Alonso, P., Guisande, A., González, L., 2015. Gradualism in Acacia dealbata Link invasion: impact on soil chemistry and microbial community over a chronological sequence. Soil Biol. Biochem. 80, 315-323. Souza-Alonso, P., Guisande, A., González, L., 2014. Structural changes in soil communities after triclopyr application in soils invaded by Acacia dealbata Link. Accepted for publication in Journal of Environmental Science and Health, Part B: Pesticides, Food Contaminants, and Agricultural Wastes (JESH part B). DOI 10.1080/03601234.2015.982419 Souza-Alonso, P., G. Puig, C., González, L., 2014. Antioxidant responses of Cytisus scoparius (L) Link to different extracts of the invasive Acacia dealbata Link. Currently under review in Plant Physiology and Biochemistry.

List of conferences

Souza-Alonso, P., Guisande, A., González., L., 2014. The times they are a-changin´: impact of Acacia dealbata Link on soil chemistry and microbial community over a chronological sequence. 8th International Conference on Biological Invasions: From understanding to action. Antalya, Turkey

Souza-Alonso, P., Cavaleiro, C., González., L., 2014. Volatile organic compounds (VOCs) of Acacia dealbata Link interfering with plant growth. 7th World Congress in Allelopathy. Vigo, Spain. Souza-Alonso, P., G. Puig, C., González., L., 2014. Resistance of the native shrub Cytisus scoparius (L) Link to non-polar extracts of the invasive Acacia dealbata Link. 7th World Congress in Allelopathy. Vigo, Spain. Souza-Alonso, P., Rubido-Bará, M., Lorenzo, P., González., L., 2014. Heads and tails in Acacia dealbata Link management: effectiveness of control and implications for native plants and soil microbial function. 4th International Symposium on Weeds and Invasive Plants. Montpellier, France Souza-Alonso, P., Novoa, A., González., L., 2014. Alterations in microbial community function and nutrient composition in ecosystems invaded by Acacia dealbata Link. 4th International Symposium on Weeds and Invasive Plants. Montpellier, France González., L., Lorenzo, P., Novoa, A., Souza-Alonso, P., 2013. Invasive Plants: Different But The Same. 12th EMAPi Ecology and Management of Alien Plant invasions. Pirenópolis, Brazil Fuentes-Ramírez, A., Pauchard, A., Cavieres, l.A., García, R., Aguilera-Marín, A.N., Hernández, V., Becerra, J., Lorenzo, P., Souza-Alonso, P., Rubido-Bará, M., Novoa, A., Reigosa, M.J., González, L., 2012. Colonizer potential and invasion pattern of Acacia dealbata Link in Chile and Spain. NEOBIOTA 2012, 7th European Conference on Biological Invasions. Halting Biological Invasions in Europe: from Data to Decisions. Pontevedra, Spain Souza-Alonso, P., González, L. 2012. Unfaithful lovers. Do the invaders take advantage in their introduced ranges? NEOBIOTA 2012, 7th European Conference on Biological Invasions. Halting Biological Invasions in Europe: from Data to Decisions. Pontevedra, Spain Souza-Alonso, P., Rubido-Bará, M., Lorenzo, P., González., L., 2011. Del sótano a la azotea: impacto de la invasora Acacia dealbata Link. sobre diferentes ecosistemas. XIII Congreso de la Sociedad Española de Malherbología. Tenerfie, Spain. González, L., Fernández-Fernández, N., Novoa, A., Souza-Alonso, P., 2011. La invasión invisible. Cambios en las condiciones del suelo bajo especies exóticas invasoras. XIX Reunión de la Sociedad Española de Fisiología Vegetal. Castellón, Spain. González, L., Lorenzo, P., Rubido, M., Souza-Alonso, P., Novoa, A., Fernández- Fernández, N., Fernández, R., 2011. Plant Invasion in Galicia: A problem without control. I Reunión Ibérica Sobre Plantas Invasoras. Vigo, Spain

Souza-Alonso, P., Lorenzo, P., González, L., Novoa, A., 2011. Different approaches to Acacia dealbata Link control. Effects on soil microbial biology. I Reunión Ibérica Sobre Plantas Invasoras. Vigo, Spain Souza-Alonso, P., González, L., 2011. Germination of three native species in soils invaded by Acacia dealbata Link. I Reunión Ibérica Sobre Plantas Invasoras. Vigo, Spain Souza-Alonso, P., Lorenzo, P., González, L., 2011. Altered enzymatic activity and microbial respiration in soils invaded by N-fixing Acacia dealbata Link. I Reunión Ibérica Sobre Plantas Invasoras. Vigo, Spain

Index

PART I Chapter 1. Introduction…………………………………………………………………...p. 39

PART II Chapter 2. Ambient has become strained. Identification of Acacia dealbata Link volatiles interfering with native species growth…………………………………………p. 77

Chapter 3. Antioxidant responses of Cytisus scoparius (L) Link to different extracts of the invasive Acacia dealbata Link……………………………………………..…………p. 91

PART III Chapter 4. Soil biochemical alterations and microbial community responses under Acacia dealbata Link invasion…………………………………………………………..p. 115

Chapter 5. Gradualism in Acacia dealbata Link invasion: impact on soil chemistry and microbial community over a chronological sequence………………………………...p. 129

PART IV Chapter 6. Effectiveness of management strategies in Acacia dealbata Link invasion, native vegetation and soil microbial community responses…………………………p. 141

Chapter 7. Structural changes in soil communities after triclopyr application in soils invaded by Acacia dealbata Link…………………………………………………….…p. 153

PART V Chapter 8. General discussion and future perspectives…………………………….p. 167

Foreword

Playing its cards

The plant is established. But, how can this plant survive and success? Beside other traits, allelopathy has been suggested as a powerful tool promoting Acacia dealbata Link invasion. Some approaches using leachates and macerates have been previously carried out to demonstrate the allelopathic role of chemical compounds from A. dealbata. Despite these previous efforts, there is no evidence of the use of natural concentrations of allelochemicals in A. dealbata, which is a fundamental step in the search for allelopathy. Additionally, a great body of literature has been written about the effects produced on seeds after the exposure to allelochemicals, but we do not know what happens in the target seeds after the exposure to A. dealbata chemicals. In fact, some invasive species are responsible to produce oxidative stress on target species, is A. dealbata one of them? Moreover, due to dense and heavy atmosphere inside A. dealbata canopy we also suggest the possibility that the release of volatile organic compounds (VOCs) could be negatively affecting native species development. In this work we will explore, for the first time in the Acacia genus, the potential of VOCs release as a mechanism that contribute to invasion.

Underground effects

The effects of A. dealbata on native plant diversity and aboveground communities have been previously assessed. Additionally, the impact of A. dealbata in the structure of microbial communities has been recently explored. In this work we would like to go deeper in the impact of A. dealbata, assessing structural changes in bacterial and fungal communities together with the functional effects on the underground through the measurement of soil enzymatic activities and soil basal respiration, providing a better perspective on the impact of A. dealbata in soils. Additionally, some studies indicate that time is a fundamental factor that should be taken into account since time elapsed from the appearance of the invader condtions ecosystems recovery. Despite its importance, this variable is not usually included in

plant invasions literature. Including a chronosequence of invasion (different ages, from 0 to more than 25 years of A. dealbata presence) we explore the effect of time on soil parameters and also in the structure and functionality of microbial communities. Therefore, we suggest that the degree of alteration in invaded ecosystems due to the presence of A. dealbata could be related with the age o invasion. In the other hand, due to the inherent variability and previous conditions we also hypothesize that different ecosystems could be differently affected by A. dealbata presence.

What can we do?

It is very difficult to face a work focused on an invasive plant species without including an effort to control or management. As far as we know, we carried out the first scientific approach to control A. dealbata expansion in Europe with special interest in the use of friendly management procedures. With this aim, it is interesting the measurement of the effectiveness of herbicide application but also its consequences on microorganisms and native plant species.

RESUMO

É ben sabido que unha das características das plantas é a súa condición de organismos sésiles. Dende un punto de vista individual, e a pesares de determinados movementos puntuais como os tropismos ou as nastias, unha planta permanece dende a xerminación ata a senescencia íntimamente ligada á súa contorna. Non obstante, compre desbancar o punto de vista antropocéntrico de inmediatez para visualizar dunha forma máis clara o movemento das plantas. Para iso debemos alonxar o noso foco de atención e subir da escala individual a unha escala temporal maior, a xeracional ou incluso á evolutiva. De chegares a este punto, observaremos que o movemento natural de especies vexetais é unha forza maior de cambio nos ecosistemas a través de “procesos de invasión”, dado que todas as especies que existen na actualidade ocupan un espazo determinado trala súa expansión dende outros territorios nun momento concreto da súa historia evolutiva traspasando fronteiras e barreiras naturais. Estamos a falar dun proceso, polo tanto, natural. Non obstante, a humanidade mudou dramáticamente o devenir dos acontecementos. Dun proceso lento e escalonado baseado nun conxunto de interaccións naturais pasamos, de forma evidente dende o comezo do século XIX, a unha explosión no movemento vexetal transfronterizo. Máis claramente nas derradeiras décadas, o termo “invasión biolóxica” incrementou a súa relevancia dunha maneira significativa, intimamente ligado ó progreso humano, xa que éste fai recaer a presión das invasións sobre os ecosistemas naturais elevando á dispersión de especies non nativas dunha forma nunca vista ata o de agora. Esta presión provoca que o impacto das invasión vexetais foran suxeito de aplicación de lexislación e políticas activas de xestión e mantemento. A pesares dos esforzos investidos, a estimación do impacto económico xerado polas especies vexetais invasoras é normalmente dificultoso e os programas de xestión ó longo prazo vólvense ardua tarefa polo número de etapas incluíndo aspectos medioambientais, sociais, científicos, económicos, de xestión pública que deben ser tidas en conta para desembocar en accións de xestión adecuadas. Unha pregunta que debe xurdir de forma natural ó lector de esta tese é o porqué da elección desta especie en cuestión. De feito, o Catálogo español de especies exóticas invasoras recentemente publicado (Real Decreto 630/2013) inclúe un total de 47

especies vexetais consideradas coma invasoras para o conxunto do estado. Xa que logo, ¿por qué Acacia dealbata Link? Concretamente, centramos a atención nunha das acacias máis problemáticas a nivel mundial. Debido á grande cantidade especies consideradas invasoras pertencentes ó xénero Acacia, un total de 23 a día de hoxe, non é doado escoller unha en concreto. O criterio para identificar a A. dealbata como especie altamente invasora ven derivada do feito de que esta especie foi identificada en 6 ou máis áreas polo mundo. Entre estas áreas invadidas A. dealbata aparece amplamente representada no NO peninsular, de forma máis chamativa na zona limítrofe entre as provincias de Ourense e Pontevedra, na rexión do Ribeiro. A. dealbata é unha árbore fixadora de nitróxeno nativa do sudeste australiano, máis específicamente de Nova Gales do Sur, Victoria e Tasmania. Actualmente considerada como invasora en ecosistemas de tipo mediterráneo en Europa, pero tamén noutras partes do mundo como en Sudáfrica ou Sudamérica. Dentro das áreas invadidas a nivel mundial, unha gama ampla de biomas está actualmente ameazada por A. dealbata como os hábitats de ribeira, matogueiras, fynbos, bosques esclerófilos, bosques mixtos atlánticos, pradeiras, campos agrícolas, sabanas, e plantacións arbóreas, incluíndo tamén reservas da biosfera e áreas protexidas. Antes da súa identificación como especie invasora, e polo tanto, perigosa, A. dealbata foi introducida con diversos propósitos, dependendo maiormente do país de adopción, principalmente ligado a viñedos, construción de liñas de ferrocarril, e desenvolvemento rural e restauración da terra. Unha vez tales usos deveñen integrados en como as persoas fan a súa vida, na súa cultura, e dentro de cómo se ven a sí mesmos, podemos considerar unha planta „socialmente adoptada‟ nun sentido amplo de termo. Sen ir máis lonxe, no caso de A. dealbata en Galicia alguns pobos como O Carballiño, na provincia de Ourense, veñen celebrando festas na honra desta especie dende fai case 50 anos. No SE de Francia, localidades como Mandelieu-la-Napoule ou Biot, ambos na Côte d´Azur, manteñen unha celebración de A. dealbata que persiste dende máis de 80 e 60 anos, respectivamente. Finalmente, outros sitios nos cales esta especie non é identificada como invasora como Herceg-Novi (Montenegro), tamén posuen o seu festexo na honra de A. dealbata dende 1969. De forma xeral, a pesares da ampla variación no xeito no que as sociedades e as comunidades particulares tratan a presenza de acacias, este xénero proporciona un valioso recurso de subsistencia (maiormente en países con escasos recursos) mais tamén económico. O caso de A. delabata na Francia podería ser lixeiramente diferente xa que a maiores dos propósitos mencionados anteriormente, esta especie tamén é cultivada polo seu uso na industria do perfume.

De feito, moitas variables inflúen na percepción que as persoas teñen sobre a invasión de A. dealbata. Referindose ó xenero Acacia, en xeral, Kull e colaboradores definiron as variables máis importantes que condicionan a percepción individual sobre a especie invasora. Para éstes investigadores, o nivel de desenvolvemento económico, a extensión da comercialización e a natureza da xestión (colleitas salvaxes vs. cultivos) foron as variables máis influintes. De feito, a meirande parte da poboación non ten unha percepción negativa sobre o risco e os impactos producidos por A. dealbata. Os informes negativos e a voz de alarma son fundamentalmente proporcionados por biólogos e conservacionistas. Nun estudo levado a cabo recentemente entre directores ambientais españois, revelou que as invasións biolóxicas –non exclusivamente centrado no xénero Acacia - foron percibidas soamente como unha ameaza intermedia á biodiversidade. Neste sentido, as condicións socioeconómicas poden ser un factor fortemente condicionante da percepción particular da invasión. En moitos casos, os aspectos negativos da presencia de acacias é percibido por quen non colleita os beneficios. Frecuentemente, as invasións vexetais poden levar a conflitos de interese onde a presenza de invasoras proporciona beneficios para xestores, mentres os impactos adversos asociados son padecidos por outros. Neste senso, o caso do xenero Eucalyptus en Galiza (NW España) é paradigmático; unha especie amplamente plantada que foi xestionado pero que, pola contra, a día de hoxe, segue a expandirse fora dos límites das súas plantacións. De tódolos xeitos, a preocupación sobre a problemática da invasión de A. dealbata non é nova; de feito, durante a última década, viron a luz un número extenso de publicacións referidas ao proceso invasivo desta especie. No tocante as súas características propias, aquelas que fan dela unha especie altamente perigosa, podemos destacar varias “cualidades”. Esta especie amosa unha ampla gama de características como a súa rápida dispersión, a masiva producción de sementes, a plasticidade xenética, reproducción tanto sexual como vexetativa sendo o rebrote e crecemento tras corte ou dano especialmente rápido. A maiores, dentro das numerosas habilidades que facilitan a invasión da planta, a liberación de moléculas novas no ambiente é xeralmente suxerido como un dos factores cruciais que contribúen ó éxito da invasión. As plantas invasoras a miúdo posúen moléculas que, actuando como fitotoxinas, poden interferir no funcionamento da comunidade local e proporcionar unha vantaxe competitiva fronte ás especie nativas. A influencia dunha planta nunha especie situada no seu área de influencia a través da liberación de compostos químicos é denominada, de forma xeral, como alelopatía. De feito, a presenza destas “novas armas” foi identificada como un compoñente fundamental no proceso invasivo. Os efectos producidos por estas moléculas foron detectados a

diferentes niveis de organización da planta, tanto molecular, estrutural, bioquímico, fisiolóxico e incluso ecolóxico. A tese elaborada pola doctora Paula Lorenzo (2010) na Universidade de Vigo, amais de ser pioneira no estudo de A. dealbata a nivel europeo, explorou en profundidade diversos factores, entre eles, a alelopatía como mecanismo de invasión. Con este bagaxe, e apesares dos esforzos feitos, semella que inda faltan aspectos por aclarar no proceso invasivo de A. dealbata. Polo tanto, o noso obxectivo neste traballo podería ser dividido en 3 partes centradas cada unha de elas en diferentes etapas deste proceso: A primeira parte do obxectivo será tentar poñer algo de luz nos mecanismos que inflúen no momento do establecemento de A. dealbata. A planta chega a un novo lugar e establécese. Mais, cómo pode a planta sobrevivir e ter éxito? Como xa comentamos anteriormente, xunto con outras características, a alelopatía foi suxerida como unha ferramenta que podería promover a invasión de Acacia dealbata. Aproximacións previas foron levadas a cabo mediante o uso de lixiviados e macerados para tentar demostrar a función alelopática dos seus compostos químicos. A pesares destes esforzos, ningún dos ensaios previos tivo en conta a utilización de concentracións naturais, paso fundamental na identificación da alelopatía. Existe un grande bagaxe literaria referente aos efectos que producen no interior das sementes nativas a exposición a aleloquímicos, mais no caso de A. dealbata este punto nos é descoñecido. De feito, algunhas especies invasoras son responsables de producir estrés oxidativo nas especies diana. É a A. dealbata unha delas? Por outra banda, debido á atmosfera densa e pesada dentro dos acaciais, tamén suxerimos a posibilidade de que a liberación de compostos orgánicos volátiles (VOCs, polas súas siglas en inglés volatile organic compounds) poda estar afectando de maneira negativa ás especies nativas. Nesta tese, exploraremos por primeira vez no xénero Acacia a potencialidade da liberación de compostos volátiles como posible mecanismo de invasión. Nunha segunda parte, tentaremos ir un pouco máis aló nos efectos que se producen nas comunidades do solo trala entrada de A. dealbata, explorando diferentes ecosistemas e tras diferentes períodos de invasión. Neste traballo desexaríamos ir un pouco máis alo e investigar de forma máis profunda o impacto de A. dealbata nos solos invadidos, avaliando cambios estruturais en comunidades de bacteria e hongos xunto con efectos funcionáis usando medidas de actividade enzimática e respiración basal de solo, tentando aportar unha perspectiva máis global do impacto de A. dealbata nos solos.

Complementariamente, algúns estudos indican que o tempo é un factor fundamental que debería ser tido en conta, xa que o tempo que una planta invasora permanece nun ecosistema condiciona de xeito significativo a posibilidade de recuperación dun ecosistema e o esforzo que deberá ser levado a cabo. A pesares da súa importancia, esta variable non é incluída de forma xeral nos traballos sobre plantas invasoras. Mediante o uso dunha cronosecuencia de invasión (diferentes idades de invasión, de 0 a máis de 25 anos con presenza de .A. dealbata) exploramos o efecto do tempo en na composición do solo, e tamén na estructura e funcionalidade da comunidade microbiana. Por tanto, suxerimos que o grao de alteración nos ecosistemas invadidos debido á presenza A. dealbata podería estar relacionado coa idade de invasión. Por outra banda, debido á variabilidade inherente e condicións previas nos ecosistemas tamén hipotetizamos que ecosistemas diferentes poderían ser afectados de maneira desigual pola presenza de A. dealbata. Finalmente, é imposible deixar de lado as implicacións que conleva traballar con especies invasoras. Nunha terceira parte desta tese afrontaremos a participación na xestión e control desta especie. Neste senso, ata onde chega o noso coñecemento, levamos a cabo a primeira aproximación científica ó control da expansión de A. dealbata en Europa con especial interese no desenvolvemento e aplicación de metodoloxías pouco dañinas co entorno. Co gallo de valorar este impacto, medimos a efectividade da nosa proposta en cuestión e, ó mesmo tempo, as consecuencias que conleva na flora vascular e nas comunidades microbianas. Os capítulos 2 e 3 desta tese describen mecanismos implicados no establecemento de A. dealbata. Debido á atmosfera densa baixo a cuberta vexetal hipotetizamos que os VOCS liberados polas flores, follas, follarasca ou da mezcla de todos os materiais vexetais exercen efectos inhibitorios nas plantas nativas Trifolium subterraneum, Lolium multiflorum, Medicago sativa pero tamén nas súas propias sementes. Funcionalmente, ademais da súa función interna, a liberación de VOCs é unha forma primaria de comunicación vexetal, e teñen un papel fundamental nunha ampla variedade de interaccións ecolóxicas. Como na atracción de polinizadores, directamente na defensa fronte a herbívoros e indirectamente por atraer inimigos dos herbívoros. Ademáis da función interactiva e protectora, estes metabolitos secundarios poden exercer unha influencia negativa no seu arredor. De feito, a liberación de VOCs foi recentemente indicada como mecanismo polo cal as plantas invasoras teñen éxito nos ecosistemas que invaden. Presumiblemente, estes compostos secundarios son fisiolóxicamente activos en organismos non específicos precisamente debido á súa natureza secundaria.

Atopamos que os VOCs de flores reduciron dunha forma significativa a xerminación en L multiflorum e A. dealbata; ademais, a lonxitude de raíz, a biomasa aérea e subterránea foron tamén reducidas en todas as especies estudiadas. Os VOCs de flores e da mezcla tamén aumentaron significativamente o contido de malondialdehido, indicador de dano de membrana, en T. subterraneum e L. multiflorum. Os efectos dos VOCs na actividade de enzimas antioxidantes foron variables en función da especie. Os VOCs das flores aumentaron a actividade peroxidasa e disminuiron a actividade superóxido dismutasa en T. subterraneum. Pola contra, os VOCs liberados polas follas aumentaron a actividade superóxido dismutasa en L. multiflorum. O perfil químico de VOCs elaborado mediante GC-MS revelou 27 compostos na fracción volátil de flores, 12 dos cales foron exclusivos de esta fracción. Dentro deles atopamos maioritariamente heptadecadieno, n-nonadecano, n-tricosano, e octadeceno, representando entre eles o 62% da fracción. Estos compostos evidenciaron que os VOCs liberados por A. dealbata durante a súa floración inhibiron fortemente a xerminación e o crecemento de plántula nas especies seleccionadas pero, e de forma inesperada, principalmente nas súas propias plántulas. Ata onde sabemos, esta é a primeira evidencia de fitotoxicidade e tamén autotoxicidade inducida por VOCs no xénero Acacia. Como comentabamos anteriormente, entre outras características, A. dealbata libera compostos aleloquímicos na área invadida. Ademáis algunhas plantas posúen a capacidade de provocar estrés oxidativo na flora nativa mediante a liberación de aleloquímicos. Polo tanto, este traballo foi deseñado para testar se A. dealbata pode, potencialmente, exercer estrés oxidativo na especie nativa Cytisus scoparius (L) Link. Extractos de partes aéreas, raíces e solo de A. dealbata obtidos cos solventes non polares diclorometano e acetona e baseados en concentracións naturais, foron aplicados sobre sementes de C. scoparius. Despois de dúas semanas, medimos a xerminación total, diferentes índices de xerminación, lonxitude de radículas e parte aérea, biomasa de plántula, e parámetros bioquímicos como o contido de malondialdehído, contido de H2O2, proteínas solubles e a actividade das enzimas antioxidantes superóxido dismutasa e peroxidasa. Despois da exposición ós extractos de A. dealbata, a xerminación total, os índices de xerminación e a lonxitude de radículas e hipocotilo foron lixeiramente incrementados. O contido de proteínas solubles foi significativamente aumentado para case todos os extractos de A. dealbata.

O aumento no nivel de H2O2 foi únicamente atopado na fracción de DCM. Non se atopou evidencia de acumulación significativa de malondialdehido en ningún dos solventes. As actividades peroxidasa e superóxido dismutasa non foron, en xeral, significativamente modificadas; de tódolos xeitos, o extracto acetónico do solo

aumentou significativamente a actividade peroxidase mentras que as flores extraídas con DCM elevaron a actividade superóxido dismutasa. Contrariamente ao que esperabamos, os extractos de A. dealbata non causaron estrés oxidativo na especie C. scoparius. Polo seu rápido crecemento e alta producción de sementes, ambas especies son pioneiras na ocupación de espazos perturbados. Polo tanto, estos resultados suxiren que para superar na competencia planta-planta, o estrés oxidativo non é unha ferramenta pola que A. dealbata afecte o crecemento temperán da especie pioneira C. scoparius. Os capítulos 4 e 5 desta tese están dedicados ós efectos de A. dealbata sobre as comunidades de solo. Máis específicamente estudiamos o impacto nos solos de bosques mixtos e matogueiras. Partimos da hipótese de que A. dealbata pode alterar a función da comunidade microbiana do solo e tamén o perfil químico do solo nos ecosistemas invadidos. A maiores, incluimos dúa datas de mostraxe en función do estadío fenolóxico da planta (vexetativo vs. reproductivo). Os parámetros químicos foron profundamente modificados no solos invadidos. Os contidos totales de C e N, P, - K, Ca, Mg, NO3 e NH4 e o P dispoñíble foron significativamente incrementados nos solos de ambos ecosistemas. As actividades microbianas do solo foron afectadas pola data de mostraxe, tratamento (invadido-non invadido) e ecosistema. As actividades enzimáticas foron principalmente alteradas durante a etapa vexetativa de A. dealbata nos bosques mixtos e durante ambos periodos nas matogueiras. Os solos invadidos por A. dealbata mostraron un aumento significativo nas actividades da fosfatasa ácida, β-glucosidasa e da N-acetil glucosaminidasa e a media xeométrica (Gmean) destas actividades. A respiración basal de solo foi significativamente reducida nos solos invadidos dos bosques mixtos. Estes resultados mostran unha alteración dos parámetros químicos do solo e a función da comunidade microbiana do solo relacionada coa presenza de A. dealbata, probablemente levando a unha aceleración na descomposición e nos índices de mineralización. Aínda así, pouco é sabido sobre o seu impacto ó longo do tempo. Polo tanto, levamos a cabo una exploración do impacto de A. dealbata nos nutrientes e na estructura e funcionamento da comunidade microbiana do solo en 4 áreas de bosque mixto invadidas no NO de España, seguindo una cronosecuencia de invasión: un mínimo de 25 anos, unha media de 15 anos, unha media de 7 anos e menos de 3 anos. O pH foi significativamente diminuído ó longo do tempo mentres que a materia orgánica aumentou significativamente. Os nutrientes do solo foron progresivamente modificados baixo A. dealbata; O contido total de C, N e P aumentou invariablemente e de forma moi significativa en relación co aumento no tempo de invasión mentres que o contido de Ca2+, *K+ e *Mg2+ mostraron tendencias irregulares durante os diferentes períodos

de invasión. Ademais, as actividades enzimáticas da fosfatasa ácida, β-glucosidasa, ureasa e N-acetil glucosaminidasa aumentaron significativamente. Tamén a respiración basal de solo aumentou relacionada coa secuencia de invasión. Mediante o uso de electroforese en xel de gradiente desnaturalizante (DGGE, polas siglas en inglés) analizamos as variacións na estrutura de comunidade bacteriana e fúnxica debido á presenza da invasora. Os resultados indicaron que a estructura de ambas comunidades foi alterada gradualmente e que o tempo e un factor de influencia na estructura das comunidades do solo. Neste estudo por primeira vez inclúense una secuencia cronolóxica para investigar o impacto gradual da invasión A. dealbata. Os nosos resultados indican que o dominio inicial de A. dealbata e o seu impacto negativo na terra e nos parámetros microbianos non son recuperados mesmo tras longos períodos despois da invasión. Os capítulos 6 e 7 abordan una experiencia de control de A. dealbata levada a cabo na rexión do Ribeiro, nos límites entre a provincia de Pontevedra e Ourense. Polo que sabemos, este traballo presenta a primeira aproximación ao control desta especie en Europa. Utilizamos aplicación directa do herbicida (triclopyr) mediante difusión sobre planta xoven e aplicación directa despois de cortar sobre planta adulta. Triclopyr é un herbicida de amplo espectro xeralmente utilizado no control de leñosas que pode exhibir efectos tóxicos para os microrganismos da terra. A pesares do seu uso extendido no control de malas herbas, non se realizaron estudos para avaliar o seu impacto en solos invadidos. Nunha primeira parte, periodicamente foron tomadas medidas biométricas sobre planta, a comunidade microbiana do solo, e tamén a riqueza e diversidade de planta nativa. Os Individuos e A. dealbata foron severamente afectado polos tratamentos, causando a morte de todos os individuos tratados. As actividades enzimáticas e a respiración basal do solo foron significativamente elevadas cando aplicamos conxuntamente o herbicida e o corte pero non cando o herbicida foi aplicado en solitario. A riqueza de especies, diversidade e cobertura foron significativamente reducidas un ano despois trala aplicación do herbicida, pero as diferenzas desapareceron na seguinte primavera. Parece, polo tanto, que as especies, a súa distribución e os grupos funcionais foron condicionados polo tratamento. Debido á efectividade dos tratamentos e a ausencia de efectos a medio prazo, a aplicación dos métodos usados neste traballo parece una opción factible para tentar reducir a presencia de A. dealbata. De tódolos xeitos, parece preciso complementar a información deste traballo con estudos a máis longo prazo, de xeito que se podan tomar decisión axeitadas, baseadas nunha maior experiencia de control.

Complementariamente, presentamos os resultados dun traballo de campo de 18 meses levado simultáneamente co ensaio de control dirixido a avaliar o impacto do triclopyr na estructura das comunidades fúnxicas e bacterianas en solos invadidos por A.dealbata mediante o uso de DGGE. Despois da que aplicación de triclopyr, o análise dos xeles suxeriu un cambio na estrutura das comunidades bacterianas mentres que a estrutura da comunidade fúnxica ficou sen alteracións. A densidade de bacteria, e os valores F:B (ratio fungo:bacteria) cambiaron ó longo do ano pero non parece que a modificación fose debida á aplicación do herbicida. Pola outra banda, a diversidade fúnxica foi aumentada 5 meses despois da aplicación do triclopyr. A riqueza e a diversidade (H´) de bacterias e fungos non foron modificados despois da aplicación de triclopyr. Como foron indicando os resultados a través destas liñas, A. dealbata é un severo modificador dos ecosistemas. Debido á magnitude do cambio que produce, recentemente recomendamos o uso do termo transformadora no canto de invasora con relación a esta especie, mais tambén referido a outras especies do mesmo xénero (A. melanoxylon, A. mearnsii ou A. longifolia). Este termo xa foi previamente descrito por Richardson e colaboradores para identificar “a aquel grupo de plantas invasoras que modifican o carácter, condición, forma ou natureza dos ecosistemas ó longo dunha área substancial relativa ó tamaño de ese mesmo ecosistema”. De tódolos xeitos, inda resta todavía moito traballo que facer en determinadas areas de coñocemento relacionadas con A. dealbata na nosa comunidade. Dende un punto de vista, teórico sería interesante profundizar máis na alteración das comunidades edáficas e ver cómo este cambio producido pola presenza de A. dealbata condiciona o ensamblaxe e desenvolvemento das comunidades formadas ”de novo”. Tamén sería interesante testar no campo o papel que poden estar xogando os volátiles liberados por A. dealbata, especialmente polas flores, como potencial característica invasora. Dende un punto de vista aplicado, a valorización dos residuos de A. dealbata ou a investigación para a utilización de material vexetal desta especie con fines non explorados ata o momento, como potenciais antioxidantes, funxicidas ou na búsqueda de herbicidas baseados en productos naturais, ou metabolitos con alto valor comercial, tamén na industria alimentaria parecen ter un futuro interesante por diante. Finalmente, tamén parece claro, e a experiencia así o indica, que os esforzos de control das especies invasoras non adoitan ser efectivos sen una estratexia a longo prazo. No caso de A. dealbata pensamos que o control debe estar ligado dunha maneira natural ó uso da terra. Para reducir os investimentos e asegurar unha recuperación da terra ó longo prazo sería moi interesante involucrar ás comunidades locales no desenvolvemento de programas de xestión.

Introduction

PART I

Introduction

Introduction

Chapter 1 Introduction

Introduction

Introduction

1. Australian acacias

1.1. Genus description– Acacia dealbata Link Belonging to the Mimosaceae/Fabaceae family, Acacia is a cosmopolitan genus containing in excess of 1350 species (Maslin, 2003) distributed in 3 subgenus named Acacia, Aculeiferum, and Phyllodineae with 161, 235 and 960 species comprised, respectively. Due to the non-monophyletic origin of their species, nomenclature of the genus is currently involved in a hard debate (Moore et al., 2011). Species of Acacia are mainly originary from Australia (practically the entire subgenus Phyllodineae) where we found around 1000 species (Maslin and Macdonald, 2004), and other parts of the world with specific climate. Within this genus approximately 25% of this species (320) are considered weeds worldwide (Sheppard et al., 2006). More precisely, 23 species are confirmed as invasive –sensu Pysek et al. (2004)- (Richardson and Rejmanek, 2011). A list of these species (recognized at 6 points or more) is collected at table 1. In general, species of the genus Acacia are trees and shrubs. Nevertheless, species considered as aggressive invaders -in which Acacia dealbata Link is included- are exclusively trees (Richardson and Rejmanek, 2011). Specific characteristics of these trees as their adaptability to many environmental conditions, easy germination and growth, good survival and rapid growth rates, wood quality and resistance and their ornamental value have been determinant to its current distribution worldwide (Maslin and Macdonald, 2004). The exceptionally high levels of intraspecific divergence and variation (Le Roux et al., 2011) together with the human selection for specific characteristics to the extensive and various usages could even potentially influence invasion success (Griffin et al., 2011). Among the invasive acacias, A. dealbata is one of the most important threats to native vegetation worldwide. This species represents a major threat to Mediterranean-type ecosystems throughout the world, such as in Southern Europe, South Africa and South America (Richardson and Rejmánek, 2011). First introduced in Europe at the end of the 18th century with ornamental purposes, it has rapidly become a major threat, especially in Mediterranean-type ecosystems, due its characteristics as a heavy seed producer and its rapid re-sprouting following cutting, fire or frost (Sheppard et al., 2006). Together with these traits, allelopathy is suggested as a powerful tool contributing to its invasive potential (Carballeira and Reigosa, 1999; Lorenzo et al., 2011). A detailed compilation of information concerning A. dealbata phenology,

Introduction reproductive biology or dispersal, together with several theories explaining its invasion have been summarized by Lorenzo (2010). Recently, the spread of A. dealbata has experienced a significant enhancement. As an example, during the decade of 1998-2008 the presence of A. dealbata in the NW of Spain increased more than a 60% growing in ten years from 40.900 occupied Ha (1998) to 66.300 (2008) (Hernández et al., 2014). Following these authors, this expansion is based on a greater increase in tree density and regeneration.

1.2. Highly invasive species We focused the attention on the most problematic Acacia species worldwide due to the vast amount of invasive species included in this genus.The criterion to identify A. dealbata, as a highly invasive species is derived to the fact that this species has been identified at 6 or more areas through the world (Richardson and Rejmanek, 2011). The concern about the problematic of A. dealbata invasion is not novel (Reigosa et al., 1984; Henderson, 1991; Carballeira and Reigosa, 1999); however, during the last decade, an extensive number of papers have been published regarding the invasive process. Within the invaded areas, a wide range of biomes are currently threatened by A. dealbata worldwide as riparian habitats (Le Maitre et al., 2002; Crous et al., 2012), shrublands (Lorenzo et al., 2010b, 2012b; Souza-Alonso et al., 2014a), fynbos (Henderson, 2007), sclerophyllous forests (Boudiaf et al., 2013), atlantic mixed forests (Souza-Alonso et al., 2014a) grasslands (Lorenzo et al., 2010b, 2012b), agricultural fields (de la Cueva, 2014), savannas (Henderson, 2007), and tree plantations (de la Cueva, 2014), including biosphere reserves and protected areas. The objective of this introductory chapter is to compile and organize recent research but also complement and extend latest discoveries related with one of the invasive acacias through the world. Topics as nutrient cycling, ecosystem services (soil quality, water and light availability), alterations in the belowground (mainly bacterial and fungal communities, but also microarthropods and seed bank composition) and aboveground (plant richness, diversity) will be deeply collected and discussed and future perspectives and directions addressed. In this chapter, I indistinctly adopt the term transformer instead of the term invasive in relation to A. dealbata. This term refers to the subset of “invasives” which changes the character, condition, form or nature of ecosystems over a substantial area relative to the extent of that ecosystem (Richardson et al., 2000). In fact, traits related with the categorization of plant species as transformers can be easily related with the entire subset of invasive acacias: the excessive users of resources, donors of limiting

Introduction resources (as N), fire promoters/suppressors, sand stabilizers, erosion promoters, colonizers of intertidal mudflats/sediment stabilizers or litter accumulators (Richardson

4 3 1 5 8 4 1 1 1 1 7 6 9 4 2 3 2 2 5 1 1 1 of 11 12 regions Number

1 1 Central America

nek (2011). In the

1 1 2 Region

Caribbean

1 1 1 1 1 1 6 South

America

1 1 1 1 1 5 islands

Atlantic in in Richardson and Rejmá

1 1 1 1 1 5 (2011) nek (rest) Africa

1 1 1 1 1 1 1 1 1 1 1 1 1 1 1

15 Africa

outhern) table Box 1 s (

1 1 1 1 1 1 6 Indian Ocean islands

2 1 1 1 1 1 1 1 1 1 1 1 1

1

Australia

ublished in Richardson and Rejmá in Richardson and ublished

1 1 1 1 1 1 1 1 8 New New Zealand

1 1 1 1 1 5 Pacific Islands

1 1 1 3

Indonesia

1 1 1 1 1 1 5 Asia

genus currently considered as invasive following

ia

1 1 1 1 1 1 6 East Middle Middle Acac

1 1 1 1 1 1 1 1 8 Europe

1 1 1 1 1 1 1 7 North

America we revised and actualized data regarding to those p to those regarding reviseddata actualized and we

table

. . Species belonging to

ii m tha

ta ricea rifolia a s ens iana

carpa a ides olia illata iae

a baileyana melanoxylon

A. auriculariformis

Table 1 present Acacia species Acacia A. A. crassi A. cyclop A. dealba A. decurr A. elata A. holose A. farnes A. iteaphylla A. implex A. longif A. mangiu A. mearns A. A. paradoxa A. podaly A. pycnan A. retino A. salicina A. salign A. strict A. vertic A. victor Species/region

Introduction

et al., 2000). Transformer species become active agents in region-forming processes instead of merely disturbing agents. In this sense, concepts as niche construction (Odling-Smee et al., 1996; Day et al., 2003) fit adequately with the transforming process that A. dealbata –and related Acacias– effectively carried out.

1.3. Current distribution Following invasive plant species databases (CABI, 2001; CEEEI, 2013; DAISIE, 2003; PHCC, 2007; FAO, 2009) and literature reviewed in this paper, we summarized recent geographical data on the spread of A. dealbata (Fig. 1). A. dealbata was considered invasive when contrastable sources were available (national and international reports, national list of invasive species or JCA papers). Despite not included as an invaded site, the presence of A. dealbata has also been indicated in the Himalayans (Bhat et al., 2012).

Fig.1. Worlwide distribution of Acacia dealbata Link. Diagonal lines identify countries where A. dealbata has been indicated as invasive species. Black areas (New South Wales, Victoria and Tasmania) indicate the native areas in Australia.

1.4. Usage and threat perception

Introduction

Through the world, A. dealbata has been introduced for many purposes, depending on the adoption country, mainly linked to vineyards, railway construction, rural development and land restoration (Sheppard et al., 2006; Kull et al., 2011). Once such uses become ingrained in how people make a living, in their culture, and in how they view themselves, one can consider a plant „adopted‟ in a broader, sociocultural sense (Kull et al., 2011). In the case of A. dealbata in Spain, some local communities (O Carballiño; Galicia, NW Spain) have been celebrating festivities in honor to A. dealbata for almost 50 years. In France, some villages as Mandelieu-la-Napoule or Biot, both in Côte d´Azur, have a celebration of A. dealbata that persists for more than 80 and 60 years, respectively. Finally, other places in which A. dealbata is not identified as invasive species as Herceg-Novi (Montenegro), have also their own A. dealbata celebration since 1969. As a general statement, and besides strong variations in the way that societies and particular communities deal with the presence of acacias, this genus provides valuable subsistence (in poor countries) but also economic resources. The case of A. dealbata in France could be slightly different since besides purposes mentioned above, A. dealbata is also cultivated for uses in perfume industry (Perriot et al., 2010; Kull et al., 2011). The following paragraphs, collected in Kull et al. (2011) allow us to understand the interaction between many variables to conform the “social imaginarium” that many acacias have worldwide:

“…the metaphor of „ecological imperialism‟, implying an epic tragedy of unidirectional conquest, control, and destruction of indigenous vegetation, is insufficient in capturing the versatile ways in which the acacias are incorporated into regional economies and identities, or how they become labeled as invading aliens and targeted for eradication. Australian acacias have been „naturalized‟ not just ecologically, but also socially through daily use in crop fields, gardens, and markets in places…” “…such direct experience and associated emotions interact with broader discourses of particular times and places – like ideas of economic advancement or national purity. The outcomes are regionally particular perceptions of introduced plants, and different receptions in different places…”

Actually, many variables influence the perception of humans about the invasion of A. dealbata. Referred to the entire genus, Kull et al. (2011) categorized the most important variables in these groups as the level of economic development, the extent of commercialization and the nature of management („wild‟ harvests vs. cultivation). In fact, a higher part of population has not a negative perception about the impact and risk of A. dealbata. Negative reports are fundamentally provided by biologists and

Introduction conservationists. Moreover, a recent study carried out within Spanish environmental managers even revealed that biological invasions –not exclusively focused on Acacia genus - were perceived only as an intermediate threat to biodiversity (Andreu et al., 2009). In this sense, socio-economic conditions can be a strong factor condition the particular perception of invasion (Kull et al., 2007, Tassin et al., 2009, Kull et al., 2011). In fact, negative aspects of the introduced acacias are perceived in some cases by those who do not reap the benefits (Kull et al., 2011). Frequently, plant invasions can lead to conflicts of interest where the presence of invaders provides benefits for stakeholders, while the associated adverse impacts are suffered by others (Van Wilgen et al., 2011). The case of Eucalyptus in Galicia (NW Spain) is paradigmatic, a widely planted species that has been largely managed (Andreu et al., 2009) and still spread from their plantation areas into surrounding communities (Calviño-Cancela and Rubido- Bará, 2013).

2. New insights in traits that promote invasion

2.1. Genetics DNA must be recognized as playing not only a qualitative role in evolution (i.e. genic), but also a quantitative one. In particular, alterations in genome size should be viewed as mutational events responsible for generating heritable phenotypic variation upon which selection can act (Gregory et al., 2001). The size of genomic pool is an important factor suggested as a trait promoting invasion (Grotkopp et al., 2004; Knight and Ackerly, 2002, Kubešová et al., 2010, Gallagher et al., 2011). In the Acacia genus, comparing abundant genome data -92 introduced acacia species belonging to subgenus Phyllodineae; 21 invasive, 71 non-invasive- through univariate analyses, no significant differences were found in genome size (Gallagher et al., 2011). Contrary to previous findings, factors usually considered as promoters of invasion as seed mass, relative growth rate or specific leaf area were not identified as invasive traits for the whole range of invasive acacias, including A. dealbata (Castro-Díez et al., 2011). Instead, these authors indicate other features as tree height or the size and precipitation in the native range. The amplitude of the native range in a species is considered an important predictor of invasiveness by the adaptation to many environmental conditions and the possibility of human contact and transportation (Goodwin et al., 1999). Intuitively, larger native range signaling us species tolerant to a wide range of environmental conditions (Gallagher et al., 2011). Nevertheless, these conclusions are generalized for the entire group of invasive

Introduction acacias, considering it a heterogeneous group, strongly created on the basis of previous works. Enhanced thermostability of photosystem II (PSII) has been suggested as a trait associated with invasiveness in arid or Mediterranean-type ecosystems in related invasive acacias (Godoy et al., 2011). Additionally, invasive species did not show this ability in their native habitats and this trait probably relies on their genetic plasticity. Consequently, physiological traits, regardless that are much poorly understood, can be as important as morphological explaining invasiveness. Despite not formerly explored in A. dealbata, this species will compete better in the hypothetic scenario of climate change, with higher temperatures and enhanced CO2 concentrations.

2.2. Human factors “Invasive acacias” is an artificially created and unrestricted group (other acacias can further become invasive) which do not implies that species share the same invasive traits but the entire group -on average- does. In addition, another key component of invasions is excluded from statistical analyses: the human factor. We also recognize that the ability of species to become invasive may be strongly linked to introduction effort and management. Castro-Díez et al. (2011) published an interesting approach also focused on the selection of potential predictors of invasiveness, comparing the characteristics of invasive and non-invasive Acacia species from the same region. To deal with the problem mentioned above –weak group construction and human influence-, these authors used logistic multiple regression applied on three categories of parameters: environmental factors (climatic affinities of acacias in their native range), life history traits (height, leaf area or length of flowering, among others) and human use. Invaders were considered using a conservative criterion –species that were considered invaders at least in two different sources- to avoid the possible inclusion of „casual species‟, diminishing eventuality. They found that most of the variation was explained by climatic variables with less contribution of life history traits. Due to the importance of high correlation of moderate temperature and water availability in their native ranges with invasive character, Acacia species evolved under conditions of relatively low climatic stress were identified. Therefore, an origin from low climatic stress areas could be a potential predictor of invasiveness. Additionally, height and resprouting ability were also indicated as predictors of invasiveness, coinciding with other authors (Gallagher et al., 2011; Gibson et al., 2011). Life history traits had an important weight on invasiveness predictor models, however, their importance were not significant when human factor was included. This fact highlights the extraordinary human influence as a vector

Introduction promoting plant invasion. Besides their individual role, this study also emphasizes the intricate relationship between intrinsic and extrinsic factors in invasive processes.

2.3 Reproductive biology While some authors found positive correlation with invasiveness (Castro-Díez et al., 2011), seed mass was also discarded as a trait promoting invasion by other authors (Gibson et al., 2011). Similarly to Gallagher et al., (2011), these authors compared characteristic traits of reproduction within the genus Acacia. In the case of A. dealbata there are no studies correlating seed mass and invasive character. Resprouting ability is generally suggested a major reproductive mechanism and a potential trait promoting invasion of A. dealbata since asexual reproduction can facilitate rapid colonization of new environments (Lorenzo et al., 2010a; Fuentes- Ramírez et al., 2011). In fact, it is confirmed that the proportion of resprouters is higher within invasive acacias (Gibson et al., 2011). In addition, these authors found that invasive acacias also reach reproductive maturity early than non-invasive acacias (< 2 years). These assays provide us with highly valuable information. However, it would be interesting to remark that interactions within traits have not been assessed. It means that traits that have not been properly considered as “invasives” could have important roles in combination with other traits. As other acacias, A. dealbata has several ways to be pollinized although pollination can be mainly considered as generalist entomophilous. Sexual reproductive process is often maximized by the synchronized opening of flowers, -widespread in acacias- both within a single tree and often within a local species‟ population (Stone et al., 2003). At the same time, within the same region, a slight delay in tree flowering within separated patches is also common (personal observation). Moreover, Acacia dealbata had the most flower heads per flowering branch and per tree, compared with other invasive Acacia species as A. longifolia, A. melanoxylon and A. saligna (Correia et al., 2014). Inflorescences of A. dealbata, often reach their climax between January-March (Lorenzo et al., 2010a); in Mediterranean-type climate regions where Australian acacias are invasive, their flowering occurs earlier than, and overlaps with, most native species whose peak of flowering take place in spring (Godoy et al., 2009) avoiding massive competition within pollinators with the consequent benefits on sexual reproduction. However, early flowering could have some disadvantages the reproductive success. The early flowering of A. dealbata (January-March) might limit the number and diversity of insects available for pollination producing pollen limitation (Correia et al., 2014).

Introduction

The role of pollinator-mediated seed production, especially by Apis mellifera, appeared to be important to the reproductive success of A. dealbata where it is introduced. Life annual cycles of honeybees are conditioned by climate and food availability and the early flowering of A. dealbata in the invaded range could be an advantage, rebooting the activity of honeybees early after winter period. Whereas bees seem to visit other acacias, as A. melanoxylon (Silva, 2012), their role as pollinator agents is doubtful since in the Atlantic coast of the Iberian Peninsula (where A. dealbata is present) palynological analysis indicate a minimal presence (≤1%) of Acacia pollen from local honeys (Aira et al., 1998; Seijo and Jato, 1998). To maximize reproductive success, different levels of selfing and elevated inbreeding have been observed in Acacia genus (Butcher et al., 1998; Coates et al., 2006). In fact, available data suggest that invasive taxa tend to have higher levels of self- compatibility, suggesting that the ability to self-fertilize may predispose Acacia species -among them A. dealbata- to invasiveness (Gibson et al., 2011). Despite being predominantly outcrosser, A. dealbata has a high capacity for autonomous self- pollination which able it to produce selfed progeny (Rodger et al., 2013, Correia et al., 2014). However, in its native range there was little evidence of elevated inbreeding influencing A. dealbata progeny (Broadhurst et al., 2008). Nevertheless, offspring of cross-pollination is more successful in all the stages than selfer (Correia et al., 2014). Summarizing, the ecological function of self-pollination and its role in plant invasiveness highly depends on the trade-off between the obvious benefits when compatible mates are absent and negative costs, as the inbreeding depression which was effectively observed. This depression was mainly characterized by reduced growth and survival of progeny among other factors. Although these depression could diminish the benefits of selfing as reproductive guarantee (Herlihy and Eckert, 2002), self- progeny still had some viability, and thus may be an option for the establishment of A.dealbata populations in the introduced ranges (Correia et al., 2014). Particularly, self- pollination could be a valuable resource to produce propagules under unusual and highly pressure circumstances (isolated areas, absence of pollinators, mate limitation, etc.). Large seeds bank that A. dealbata produces in non-native ranges are also suggested as fact promoting invasion. However, related pairs of rare and widespread Acacias have a seed production quantitatively and qualitatively similar indicating that level of seed production does not necessarily determine abundance of a species (Buist, 2003). Additionally, massive seed production and seeds accumulated in the soil bank are highly variable within transformer acacias (Table 2).

Introduction

Table 2. Seed bank comparison of the main invasive Acacias in their non-native ranges worldwide. Australia was included since several Acacias have been considered invasive also in different ranges of the native country.

Seeds produced (m2 y-1) Bank density (seeds m2) Seed viability (%) Region Chile, New Zealand, A. dealbata 2553 10000-22500 30-90 Portugal Portugal, South Africa, A. longifolia 2500-12000 2000-34000 85-99 Australia A. mearnsii - 686-38340 >83 South Africa

A. melanoxylon 740-1810 48739 70-91 South Africa-Australia

Nevertheless, there is an enormous lack of information regarding many other invaded areas through the world. Acacia seeds can be viable for long time and their germination may be stimulated by fire or derived compounds like smoke, ash or heat (Lorenzo et al., 2010c; Kulkarni et al., 2007). Since acacias largely colonize Mediterranean ecosystems, recurrent fires may promote invasion process. Moreover, in a climate change scenario with the forecast of temperature increase, more and larger wildfires should be expected (Moreno et al., 2007), and so the spread of species whose germination is increased by fire. A recent study even indicates the positive relationship between the spread of A. dealbata and fire incidence (Hernández et al., 2014). However, the prediction of its expansion entails difficulties due to strong human influence on fire patterns, which will continue to change with altered land use (Syphard et al., 2007, 2009). However, contrary to these hypotheses and based on climate/growth models, González-Muñoz et al. (2014) predicted a negative trend for A. dealbata expansion in this century.

2.4. Seed bank and dispersal Usually, alterations in belowground processes are difficult to identify as aboveground processes are more evident in plant invasion. Invasive alien plants management is an expensive and long-time inversion task, mainly when dealing with species that have very large and long-lived seed banks. One of the main characteristics of A. dealbata is related with a high impact on seed bank composition in the invaded areas with the consequent repercussion on plant diversity and the difficulties in habitat recovery after invasive management. In the case of A. dealbata, González-Muñoz et al (2012) evaluated the similarity between the floristic composition of the soil seed bank (potential vegetation) and that expressed in the established vegetation in both native

Introduction and invaded sites. They found a reduction in species richness and plant cover in invaded forests diminishing native seed bank. Additionally, A. dealbata produced a reduction in the appearance of plant species from the seed bank. In general, the presence of higher percentages of exotic species in aboveground (plant richness) and belowground (seed bank) is a consequence produced by the invasion (Marchante et al., 2011). Therefore, selective pressure on soil seed bank seems to be enhanced after the entrance of A. dealbata. In addition to their massive seed production, propagules of A. dealbata have long-lived. There are no data available concerning the maximum period of seed viability in A. dealbata; nevertheless, seeds from the Acacia genus have been found viable for surviving periods of more than 200 years (Daws et al., 2007). Indeed, germination was observed in A. dealbata seeds stored in the soil for more than 200 years (Gilbert, 1959 in Hunt et al., 2006). During their storage in soils, fire is also suggested as a promoter of A. dealbata spreading since may reduce native seed viability and stimulate germination of its own seeds. However, the promotion is probably more important in ecosystems without dominant species reliant on fire to germinate as in South African fynbos. In these ecosystems seed banks persist in the soil at lower densities after fire (Holmes, 2002) and acacias need subsequent fire cycles to outnumber and exclude native fynbos species (Le Maitre et al., 2011). In central Chile, model projections also predict the spread only in the presence of fire when combined with browsing and/or cutting (Newton et al., 2011). Based on restoration ecology precepts, the maintenance of native seed bank is fundamental to achieve successful recovery after plant invasion removal. If seed bank result damaged after plant invasion, autogenic recovery can be inhibited (Le Maitre et al., 2011). Management programs can be more effective if invaders are rapidly recognized and time elapsed between introductions and managing is reduced (Marchante et al., 2008b; Ahern et al., 2010). Seed zoochorous propagation seems to be a characteristic trend of acacias. In some invaded ranges, myrmecochory (seeds with elaiosomes) or ornithochorous dispersion (seeds with arils) of seeds has been observed in invasive acacias as A. dealbata, A. longifolia, A. melanoxylon, A. mearnsii or A. saligna (Willson and Traveset, 2000).

2.5. Symbiotic partners Several studies have been carried out in the latest years to elucidate the relationship between A. dealbata and soil microbial communities. By far, the largest symbiotic bacteria isolated from A. dealbata nodules in Portugal belonged to Bradyrhizobium

Introduction

(Rodríguez-Echeverría et al., 2011), mainly B. japonicum but one isolate was related to B. elkanii and other to B. canariense. Additionally, also Rhizobium tropici was related with nodules of A. dealbata (Lafay and Burdon, 2001). Comparing with invaded ranges, these authors found higher phylogenetic diversity in the isolates from Australia. In fact, compared with other invasive species as A. longifolia or A. melanoxylon, nodules from A. dealbata presented higher variation in rhizobial DNA (Lafay and Burdon, 2001). Acacias have a certain degree of promiscuity and can associate with more than one symbiotic partner; however, there are no clear differences on the symbiotic promiscuity of invasive and non-invasive species (Rodríguez-Echeverría et al., 2011). These results suggest that symbiotic promiscuity is not important for the invasive success of A. dealbata, at least in Portugal. However, further research including other invaded regions where A. dealbata is present is necessary since only information from a few ranges as South Africa (Rhizobium leguminosarum, Rhizobium spp., Mesorhizobium spp., as new symbionts in Joubert, 2003), Portugal (Rodríguez-Echeverría et al., 2011) or Brazil (Lammel et al., 2013) is available. Despite the evidence provided by Rodríguez-Echeverría et al., (2011), some doubts arise from these results. Authors predicted that the progression of invasion would be faster for promiscuous species because the invasion of high-specificity legumes would be limited by the build-up and dispersion of compatible rhizobia populations. In our region (NW Iberian Peninsula), several species belonging to Acacia genus mainly A. longifolia, A. melanoxylon, A. mearnsii and A. dealbata are present. Contrary to this prediction, evidence indicates that A. dealbata –despite its low symbiotic promiscuity is, apparently, the most aggressive invader. Assuming that is a highly difficult task, in our opinion, the key point would be to address the relative weight of promiscuity vs non-promiscuity on total plant performance. Nevertheless, symbiotic promiscuity is merely another factor that contributes to invasion success. I.e., compared to other invasive acacias in Portugal, A. dealbata had significantly higher success in biological reproduction (Correia et al., 2014) Another interesting factor is the possibility that exotic symbiotic bacteria might have been co-introduced with the invasive Acacia species, as in the case of A. longifolia in Portugal, facilitating its establishment and spread (Rodríguez-Echeverría, 2010). Analyses of the nifD and nodA genes indicated that Bradyrhizobium isolated from nodules of A. longifolia were related to Australian rather than European bacteria. In the case of A. dealbata, no studies are available indicating the possible co-introduction of symbiotic bacteria that could be helping the success of this species. Interestingly, the role of other symbiotic partners, the ectomycorrhizal fungi (EMF) could also be related with successful introductions. The co-introduction of other specific

Introduction symbionts, the ectomycorrhizal fungi (EMF) is also essential for the establishment of i.e. the exotic Pinaceae species in the Southern Hemisphere (Nuñez et al., 2009), of Eucalyptus spp. in the Northern Hemisphere (Díez, 2005) and even the Australian Acacia holosericea and A. mangium in Africa (Duponnois et al., 2007). Recent studies indicated that A. mearnsii significantly altered structure and composition of EMF (Boudiaf et al., 2013). It would be interesting to note if alterations produced by A. mearnsii directly benefits this species. Therefore, the study of the relationship between A. dealbata and EMF could be interesting to elucidate the role of symbionts in the invasive process. The introduction of microbial symbionts that could help the spread of an invasive species implies that acacias or other plants that are not currently considered as threats could become potential invasives after the introduction of native symbionts.

2.6. Allelopathy Allelopathy, as defined by Rice (1984) was also early suggested in the case of A. dealbata as a useful trait promoting invasion. In this way, Reigosa et al. (1984) were the first suggesting this possibility. These authors indicate the presence of phenolic compounds within several chemical groups that could be involved in the observed results. Since this time, many works has been published concerning the effects of allelochemicals of A. dealbata on model, agricultural and native species (Carballeira and Reigosa, 1999; Lorenzo et al., 2008; Souza-Alonso et al., 2014b), soil microbial function and structure (Lorenzo et al., 2010b; Lorenzo et al., 2013). After their initial interesting results, Reigosa et al., (1999) collected rainfall, stemflow and surface percolates and applied on Lactuca sativa L. Percolates showed the highest inhibitory effect. Probably, the passing through the soil litter increased the concentration of chemical with negative consequences on L. sativa germination and growth. Applied in unknown concentrations, rainfall leachates and macerates of A. dealbata reduced germination of agricultural (Zea mays L.) and understory species, also affecting photosynthesis and net respiration rate (Lorenzo et al., 2008). Applied during larger periods natural leachates but mainly macerates of A. dealbata enhanced respiration rate and net photosynthesis, mainly during flowering period (Lorenzo et al., 2011). Altered physiological parameters in understory related an unrelated plant species indicates that suggested allelopathy -working alone- is not a factor of exclusion of native species in A. dealbata canopy. In both studies, the inhibitoriest results were found in aqueous macerates (24h) which maximize the presence of dissolved allelochemicals with possible inhibitory function. However, this fact do not implies that these molecules are being released in natural conditions also avoiding the intermediary

Introduction role of soil microbial communities as detoxifiers or merely modifiers of plant released allelochemicals (Zhu et al., 2011). Therefore, these results suggested a probable phytotoxic consequence rather than allelochemical effect. Seed germination of several species -native and model species- showed species dependent effects, mainly reduced effects, after the contact with A. dealbata soil extracts and canopy leachates collected at different periods of the year (Lorenzo et al., 2010c). Nonetheless, an expected result arises from this work: canopy leachate and soil extract produced an increase in the elongation of A. dealbata radicles suggesting auto-stimulation. Stimulation of A. dealbata seeds is a relevant fact with possible important ecological consequences. On the opposite, inhibitory effects of A. dealbata leachates in the growth of its own seeds were also found (Lorenzo and Rodríguez- Echevarría, 2012). Released in the edge of invasion, chemical compounds in leachates should favor germination and early growth of new individuals, which do not effectively, occurs. Contradictory results produce skepticism to assume the possibility that leachates worked as “invasion supporters”. The effect of allelopathy was also studied on soil microbial communities. Leachates from A. dealbata increased the consumption of carbohydrates and amino acids and decreased the consumption of carboxylic acids of the microbial community activity in soils from pine and mixed forests (Lorenzo et al., 2013). They also found that leachates reduced richness and diversity of bacteria in soils from pine forest without consequences in microbial community structure. Nevertheless, modifications observed in the functional diversity might be transitional since structural changes were not observed. Chemical compounds, seasonally produced and concentrated in flowers, are then available for soil microorganisms providing different C sources. Changes in the source of C could lead to a punctual rise of specialized groups but permanent changes cannot be assured. On the contrary, this could be an initial point of selective pressure to exclude non-specialized groups but more time would be necessary to see structural changes in bacterial and fungal communities (Lorenzo et al., 2013), mainly in fungal communities, as they conform more stable communities. The possible role of allelopathic compounds in native ecosystems was also tested on the infectivity of the essential arbuscular mycorrhizal fungi (AMF) (Lorenzo et al., 2013). Invasive plants can have impacts in the density and composition of these communities, modifying the diversity of AMF that colonizes the roots of native plants (Hawkes et al., 2006). However, and contrary to expected, leachates from flowers of A. dealbata did not reduce AMF colonization, independently of soil provenance, in Plantago lanceolata (Lorenzo et al., 2013). It is stated that plant-AMF relationships can be used as promoters of invasion since they can be used as “superhighways” to carry

Introduction allelochemicals from the donor plant to its targets (Barto et al., 2012). However, allelochemicals from flowers avoid the internal way and reaching soil microbes directly, through gravity. Complementary, recent results could indicate that contrary to other related species, as A. melanoxylon (Renuka et al., 2012), A. dealbata showed relatively low dependence on AMF (Crisostomo et al., 2012). Hence, from a pragmatic perspective, AMF infection is “useless” in communities dominated by A. dealbata. Nevertheless, we should not avoid that in this case, sampling had limited extension and the dependence on AMF could be variable, conditioned by the environment. Nevertheless, within the many invasive traits owned by A. dealbata, allelopathy is merely another one that can be influencing AMF communities. Besides the relative low benefits that A. dealbata extracts from AMF, a recent study indicate that AMF communities on shrublands invaded by A. dealbata are suffering structural changes (Guisande et al., under review) with possible consequences on root colonization, native plant development and even community assemblage. Therefore, benefits of A. dealbata could be not by direct association but, on the contrary, indirectly, through the reduction of AMF availability for native plant species. However, further research will be necessary to identify the magnitude of change (a wide range of ecosystems, longer periods of time).

3. Effects on ecosystems

The term “impact” has a wide definition and the impacts of exotics can be measured at different scales; in the case of invasive acacias, general impacts have been widely reviewed (to read a good summary of the impact of acacias abroad see Le Maitre et al., 2011). They collected the effects produced after the entrance of acacias at different scales in biophysical (mainly above- and below-ground communities, microclimates, soil moisture regimes and soil nutrient levels) and ecosystem services impacts (mainly soil formation, water flow and nutrient cycling, wood or fiber production and recreation or educational opportunities to sustain human well-being). Obviously, invasion of acacias presents differences across different geographical regions. Even the invasion of A. dealbata present differences with other Acacias. Currently, many information is available on the effects produced by A. dealbata on soil biogeochemistry (Lorenzo et al., 2010, Castro-Díez et al., 2012; Souza-Alonso et al., 2014a), microbial communities (Lorenzo et al., 2010, Crisostomo et al., 2012, Lorenzo and Rodríguez-Echevarría, 2012), soil functionality, plant aboveground (Fuentes- Ramírez et al., 2011) and belowground diversity (González-Muñoz et al., 2012).

Introduction

3.1. Aboveground effects 3.1.1. Structural changes In a rapid observation, the intricate maze conformed by A. dealbata individuals produced alterations that can be immediately identified. Apparently, the quantity of light reaching the soil is reduced under A. dealbata canopy. These conditions lead to an alteration in the establishment of native plants leading to a lower survivor of light- demanding native forest species vs shade-tolerant in invaded stands in Chile (Fuentes- Ramírez et al., 2011). Light reduction was initially suggested by Lorenzo (2010) -as irradiance reaching the soil-, however its influence was not statistically verified. Light across the canopy -through hemispherical photographs- was then evaluated by González-Muñoz et al., (2012), together with other factors as the impacts of A. dealbata on soil properties, composition of the soil seed bank and the established vegetation. Surprisingly, there was no evidence of light reduction under A. dealbata canopy compared to native forests. This fact can be explained by the relative thickness of the oak forests. Devious branches and leaves on the native tree form a dense stand that reduces direct light impact, as in the case of A. dealbata. However, it would be interesting to extend the analyses of light availability to a wide invaded ecosystems (grasslands, wetlands, shrublands, riparian forests), providing us with a reasonable picture of light distribution between invaded and non-invaded areas among different ecosystems.

3.1.2. Biodiversity Negative impacts on native vegetation by A. dealbata invasions are well documented (Fuentes-Ramírez et al., 2010; Lorenzo et al., 2012). Outside its native range, the presence of A. dealbata entails severe consequences in the aboveground diversity. In the study carried out by Fuentes Ramírez et al (2010), the presence of A. dealbata reduced plant species richness at community level, even facilitating the entrance of introduced flora in low-density stands. Similar results were also found in other fairly distanced area, also invaded by A. dealbata (Lorenzo et al., 2012). In NW Spain, these authors found a reduction of native species in different ecosystems but also a substitution of native species for others in the invaded areas. Besides the demonstrated reduction in biodiversity outside its native range it is interesting to note some aspects: in their native range, A. dealbata is successful pioneer merely in the early stages of development, disappearing later during succession. It could be because A. dealbata is not adapted to low-light sub-canopy environments, at least in their native areas (Hunt et al., 2006). Nevertheless, A. dealbata shows high survival within native

Introduction forest and in open areas in Chile where it can endure long periods of drought and shade under canopies of native trees (Fuentes-Ramírez et al., 2011)

3.2. Belowground effects 3.2.1. Physicochemical composition and nutrient cycling As occurred in the aboveground, the immediate perception of A. dealbata invasion indicates substantial changes in the structure of the soil surface. From our perspective, changes produced by the presence of acacias fit adequately with the concept of niche construction (Odling-Smee et al., 1996; Day et al., 2003). For example, A. dealbata creates a root net in the upper soil layers, due to its extensive creeping rhizomatous root system (Fuentes-Ramírez et al., 2011). Water availability is a limiting factor in Mediterranean-type ecosystems, where the variability and unpredictability of precipitation impose strong constraints on plant growth and could represent an important evolutionary pressure (Joffre et al., 1999). Le Maitre et al. (2011) compared the impacts of 3 acacias (A. dealbata, A. saligna and A. longifolia) in different parts of the world (Chile, South Africa and Portugal, respectively). After many comparisons, they found that soil moisture levels decreased following A. dealbata invasions whereas other acacias increase soil moisture. Across their range of introduction, A. dealbata and other congeners are suggested as water consuming species and their presence could lead to severe consequences on the hydrological balances of invaded areas. From a pragmatic perspective, the highly use of water can be seen as a fast growing strategy. However, instead of an individual trait, it can be seen as a community strategy –due to their ability to sprout promoting the collective rather than individual plants in the long term (Werner et al., 2010). Due to their water uses, the presence of A. dealbata and A. melanoxylon in South Africa collected a high part of the estimated reduction of mean annual runoff by 7% (Le Maitre et al., 2000). Analyses of root exudates and soil composition in related species, as A. longifolia, indicated higher concentration on long chain alkanes that can induce water repellency (Ens et al., 2009). The release of these compounds reducing de facto water availability for native seedlings growing in the upper layers of soil in the vicinity of the acacia, might be relevant in areas with water limitation, as Mediterranean-type ecosystems. There is a relative consensus in the fact that plant exotics usually enhance N content of invaded soils, affecting nutrient cycling (Ehrenfeld 2003; Vilá et al., 2011). However, many invasive plants are also N-fixers, so this fact could be masking the reality. In a recent study, Castro Díez et al. (2014) using a meta-analyses indicated that exotics influence N pools, even excluding N-fixers from the analyses. They found that

Introduction functional distance between dominant species or climate are more important factors conditioning N pools.

Figure 2. Pictures representing evident structural changes produced by surface roots in A. dealbata. In the left we can see the dominance of A. dealbata roots in the invaded ecosystem. In the right, picture shows the thickness of surface root net. Massive root growth in the first 20 cm of soil creates a new layer with altered structural conditions for native plant development.

In general, litter from exotics tends to decompose different than native litter. As far as we know, contradictory results are found in the case of A. dealbata. Leaves from A. dealbata raised a relatively fast C mineralization from the litter, releasing 27–35% of the initial C content during 5 months of decomposition (de Neergaard et al., 2005). In spite of high N content and correspondingly low C:N ratios, data on soil mineral N show that all litter immobilized N for the duration of the incubation. On the contrary, simulating field conditions in the laboratory, some authors indicated that the exotic litter of A. dealbata tended to decomposed less than the litter of P. pinaster and the native Q. robur (Castro-Díez et al., 2012). In soils from mixed forest (Q. robur, P. pinaster) pH remained similar below A. dealbata litter and, surprisingly, no changes in organic - matter, N content, or NO3 were collected. On the contrary, ammonium constantly increased in comparison with native litter. The increase of ammonium below A. dealbata indicates high N mineralization activity, according with the decline of soil organic matter. In these simulated approach, mineralization was co-dominated by ammonification and nitrification processes.

3.2.2. Soil legacy After the entrance in the new ecosystem, plant performance produce soil changes that can be measured at many levels altering the net effect of soil on the growth of

Introduction competiting species but also on its own growth (Ehrenfeld et al. 2003, 2010; Bever et al. 2010). Impacts produced by A. dealbata in soils are difficult to evaluate. In fact, could be easy to measure changes in C, N, pH, conductivity, structure or any other essential aspect related with soil matrix. Nevertheless, the degree of alteration and the efforts required to return to pre-invasion conditions are hardly evaluable. Due to its complexity and intricate relationships that are embraced in its matrix, soil is the most vulnerable factor and, probably, the key point in the invasive process. As stated above, A. dealbata seems to modify soil characteristics for its own benefit (Lorenzo and Rodríguez-Echeverría, 2012; Rodríguez-Echevarría et al., 2013) which could entail several consequences. In one hand, this factor promotes its expansion, since growth of its own seedlings could be favored, a positive feed-back. In a recent assay, Rodríguez-Echevarría et al., (2013) found that the effect of soil origin was differential depending on the age of A. dealbata plants. Seedlings (1 month aged) grown on A. dealbata soils did not experience any changes, but on the contrary, saplings (3 months aged) grew taller and produced more biomass than saplings grew on non-invaded soils. In addition, nodulation (biomass of nodules/biomass plant) was extremely enhanced in invaded soils. However, Rodríguez-Echeverría et al. (2013) indicate that other aspects, but not soil characteristics are responsible for the success in the invaded soils since nutrient content was higher in the native than in the invaded soil. These authors suggest the possibility of a change in soil microorganisms responsible for this positive feed-back. Invaded soils exerted positive effects on the germination of its own seeds while, at the same time, they increased the mortality of seedlings of P. pinaster is increased. Again, changes in soil microbiota seemed to be responsible for the net effects collected.

3.2.3. Soil Microorganisms In the previous section (2.5 symbiotic partners) we mainly collected information regarding A. dealbata – microbial relationships. Here, we aim to collect recent results focused on the impacts produced by A. dealbata on soil microorganisms. There is no extensive information; however, scientific concern has been recently increased as a consequence of the negative impacts collected in invaded areas. As a legume, A. dealbata is highly reliant on the symbiotic associations with compatible microbes. Effective nodulation and the presence of compatible symbionts seem to be crucial for its development. Lorenzo and Rodríguez-Echeverría (2012) indicated that plants growing in soils previously invaded presented higher nodules biomass and consequently higher growth rates. Nevertheless, in the opposite, investigating the net effect of soil biota on the growth and biomass of seedlings, Lorenzo and Rodríguez-

Introduction

Echevarría (2012) found that seedlings grown in the absence of soil native microbes (sterilized soil) had higher biomass than those grown in soils with native communities. Moreover, we recently found that A. dealbata grows comparatively better than native species without forming nodules during the first 12 weeks of development (Souza- Alonso et al., unpublished results). Lorenzo et al., (2010) conducted an assay to investigate the effect of A. dealbata in the structure and diversity of belowground biotic community. In general, the structure of soil bacteria was very heterogeneous and independent of invasion status. They found that the structure of soil fungal communities was more affected by invasion in pine forest and shrublands than in grasslands (Lorenzo et al., 2010). On the contrary, richness and diversity of fungal species were significantly higher in native area than in invaded and transition areas of grasslands. As in the case of bacterial communities, the effect of A. dealbata on soil fungal communities was ecosystem-dependent. The increase of nutrient pools and decomposition rates in invaded areas might have a detrimental effect on soil fungal community, which is usually associated with lower decomposition rates. As was stated above, other important group the arbuscular mycorrhizal fungi (AMF) seemed to be unaffected by A. dealbata leachates (Lorenzo et al., 2013). Moreover, Crisóstomo et al., (2012) indicated that A. dealbata has low dependence on AMF. However, current studies indicate that, despite the apparent non- dependence, the presence of A. dealbata entails structural consequence in AMF communities of invaded soils (Guisande et al., unpublished results).

3.2.4. Mesofauna Intimate relationships between native plants and microbes may be disrupted after invasion of acacias and their impacts have been profusely studied. On the other hand, plant-animal relationships can also be altered; however, in spite of their interest, less information is available concerning other important groups implicated on decomposition processes as nematodes, arthropods or annelids. Coetzee et al. (2007) found a significant reduction in arthropods (Coleoptera) richness and abundance in grasslands invaded by A. dealbata compared to non-invaded stands. In addition, these authors also found a reduction in the average of body size where A. dealbata was present. On the other hand, changes in litter composition due to A. dealbata invasion provide terrestrial isopods with impoverished nutrient sources, producing a reduction in individual growth, even compared with other invasive species (Sousa et al., 1998). Dominant components of the arthropod macrodecomposers, this fact might have important consequences on nutrient availability since they are beneficial because of their role in enhancing nutrient cycling, by comminution of

Introduction organic debris and transporting it to moister microsites in the soil (Paoletti and Hassall, 1999). Additionally, they also transport propagules of bacteria, fungi and vesicular arbuscular mycorrhiza through soils (Rabatin and Stinner, 1988). In addition, plant-animal relationships within the ecosystem can be altered. An interesting approach has been recently provided by Eichhorn et al. (2011). They investigated whether damaged A. dealbata trees and seedlings could attract local ants to defend the plant through extra-floral nectaries (EFN) after herbivores attack in Portugal. Results from this study suggest that the production of EFN is proportional to damage produced and damaged trees were visited by ants with the aim of removing nectar. Damaged seedlings were visited by local and invasive ants, alternatively. Interestingly, damaged trees were only visited by the invader Linepithema humile, an invasive ant originary from Argentina. Native and invasive ants are known to compete for access to nectar resources (Oliver et al., 2008); therefore, the presence of A. dealbata could exert positive feedback with the invasive ant L. humile. However, Eichhorn et al., (2011) also suggested that the L. humile do not actively harvest nectar and theirs visits to EFN are rare and so, this could not be considered an ant-plant mutualism. In fact, they stated the successful of A. dealbata invasion is due to the avoidance of local herbivores rather than beneficial mutualisms.

4. Control and management

4.1. Recent advances Among the different methodologies employed, mechanical control is the most valued and frequently used strategy to cope with plant invasions in Spain (Andreu et al., 2009). Records on plant invasions cost management are poor and few data available indicate that the total actual expenditure (largely underestimated) amounted to 50 million (€), only in the period 2000-2010 (Andreu et al., 2009). Management efforts invested in the control of Acacia merely reach 0.20% of total investment (90.000€) and there is no available data of the investment in A. dealbata management. Nevertheless, efforts to control will be theoretically improved during the next decade since A. dealbata has been confirmed by government authorities as a pest (BOE, 2013). Many attempts have been carried out to manage Acacia invasions worldwide but there is no extensive literature in the case of A. dealbata (Campbell and Kluge, 1999). Nowadays, potential biocontrol agents are being identified, as a recently discovered gall midge (Kolesik and Adair, 2012). The main body of research in the A. dealbata management has its origins in South Africa. This country was the first to implement management policies to control the spreading of A. dealbata.

Introduction

4.2. Biological control Invasive acacias have been managed in the last decades using biological control. In South Africa, where the timber is economically important, biological control programs have targeted pod formation and seed production with gall wasps, weevils and a gall forming rust fungus from Australia (Dennill and Donnelly, 1991; Dennill et al., 1999; Impson et al., 2008; Impson et al., 2013). Despite biocontrol implementations in the 90´s and recent findings on promising agents (Kolesik and Adair, 2012), there is no introduced agent that produced significant effects in A. dealbata control (Moran et al., 2013). The potential ecological effects of introduced biological control agents are not addressed and unexpected results as ecological replacement, compensatory responses or food-web interactions are sometimes collected (Pearson and Callaway, 2003). Despite their positive results, there are many examples on biological control literature concerning undesirable effects and biocontrol agents of acacias are not exceptional (Seymour and Veldtman, 2010; Veldtman et al., 2011). Usually, species closely related to the targeted plant are more susceptible to be attacked than distantly related species (Pemberton et al., 2000). Therefore, the use of biological control agents in Europe or North America should have presumably low ecological risk as there are no native acacias in these continents.

4.3. Restoration and prevention Theory predicts that management programs are more effective if invaders are rapidly recognized and time elapsed between introductions and managing is short as possible (Marchante et al., 2008b, Ahern et al., 2010). The future of restoration after A. dealbata removal is clearly uncertain because of deeply changes in soil conditions. Firstly, by the concept of restoration itself that implies the return to the preceding ecosystem conditions. As we referenced through this introductory chapter, the transforming character of A. dealbata (niche construction) of the invaded ecosystem suggest that return to preexisting condition is virtually impossible due to intricate relationships between the triangle formed by soil matrix-belowground communities-aboveground communities. In our opinion, concepts as recovery are more adequate dealing with the problematic of A. dealbata. Removal without adequate management planning can be lead to exposure of the infertile subsoil, restricting colonization of indigenous species, in particular grasses that could aid in stabilizing the soil (de Neergaard et al., 2005). An interesting approach could be the simultaneous introduction of native species with high water use. It was

Introduction found that A. dealbata is highly efficient as a pioneer species but has a limited temporal niche (Hunt et al., 2006). In long-term competition with a highly water-demanding species, A. dealbata could be out-competed. As stated before, the massive production of long-viable seeds is a critical factor in the invasive process of A. dealbata and entails serious difficulties to develop management actions and restoration programs. In cases where native seed bank is exhausted or reaches critical values due to the massive presence of its seeds, the inclusion of native propagules in restoration programs could be required to achieve similar preexisting conditions in the seed ecosystem structure in a medium term. In some particular habitats, as headwater rivers or even watercourses, indigenous tree regeneration is very low and not disturbance-triggered which will likely result in slow recovery without additional intervention (Galatowitsch and Richardson, 2005).

5. Future research and perspectives

Invasive plants have been recently identified as potential sources for natural compounds, moreover plants with suggested allelopathic activity. In fact, natural chemicals and organic mulches obtained from suggested allelopathic plants can be used as friendly herbicides or pesticides to control weeds or plagues in crops (Narwal, 2010). In order to valorize post-management plant residues of A. dealbata, it could be interesting to develop prospection in the search for metabolites with highly commercial value in agricultural or food industry as antioxidants, antifungals, antimicrobials or natural herbicides to take the opportunity offered by the presence of the invader. Chemically, the phenolic, flavonoid and alkaloid contents of the ethanol, methanol, acetone and hydroalcoholic crude extracts of A. dealbata and A. melanoxylon were recently studied (Duarte et al., 2012). Among them, A. melanoxylon presented more flavonoids and alkaloids content. In this assay, both species showed stronger antioxidant activity –mainly A. dealbata– tested using the DPPH scavenging assay and the β-carotene bleaching test. The valorization of residues of A. dealbata is also an interesting focus of research. In this sense, the economic cost of the removal of invaded patches can also be balanced by economic profit from this wood. The high polysaccharide content of A. dealbata makes it as valuable resource for biorefineries providing a way of upgrading underutilized renewable feedstocks. At this date, efforts are being done to maximize the energy obtained by its wood, in the form of solvent pretreatments and enzymatic hydrolysis (Yañez et al., 2009, 2013). In this sense, the inclusion of sophisticated techniques as nuclear magnetic resonance (13c-NMR), have potential applications in

Introduction optimizing extraction processes, identification of tannin sources, and characterization of tannin content (Reid et al., 2013). The bioconversion of hardwood into bioethanol is also a valuable resource. However lignin has to be disrupted. Novel processes, as the use of combined bio-organosolv process (fungal pretreatment combined with organosolv delignification) are being developed to improving the results obtained by a single organosolv delignification in A. dealbata (Muñoz et al., 2007). Despite its low quality to ameliorate soil conditions, A. dealbata material can be also employed as a protector layer to reduce soil erosion or to avoid soil moisture depletion. Although results of nutrient release and composition of decomposing material in A. melanoxylon and A. dealbata are not astonishing (de Neergaard et al., 2005), effortless access to plant material source and the possibility of saving money after management practices, suggest it as an interesting use as green manure. In fact, larger management proposals are probably unsustainable in a long term whether they are entirely dependent on external funding (de Neergaard et al., 2005). In this sense, it was suggested that composting plant residues of A. dealbata with sewage sludge also improve soil biochemical and chemical properties (Tejada et al., 2014). Complementary, in order to valorize post-management plant residues of A. dealbata, it could be interesting to develop prospection in the search for metabolites with highly commercial value in agricultural or food industry for already known uses in other related acacias, such tannins in A. mearnsii (Griffin et al., 2011), but also for novel- interesting purposes such as phytoextracting species in the remediation of heavy metal-contaminated biosolids (Mok et al 2013), new bio-sorbents and coagulants for water and sewage treatment (Beltrán-Heredia et al., 2010; Kumari et al., 2012; Soares et al., 2012; Mangrich et al 2014), a source for biocomposts production (Brito et al., 2013) or even for medical and health purposes (Olajuyigbe and Afolayan, 2012; Shen et al., 2010; Tabuti et al., 2010; Payne et al., 2013; Ogawa et al., 2013; Sowndhararajan et al., 2013). Surprisingly and contrary to common sense, today some authors even recommend plantations of acacias omitting empirical evidence. These authors handle theoretic arguments as the selection of fast growing and high biomass producing tree species and the “amelioration” of soil chemical properties, completely avoiding the negative consequences produced by these species (Mekonnen at al., 2006). History repeats once again.

Introduction

Summarizing, many questions related to the invasion of A. dealbata have been answered in the last years. Nevertheless, at the same time -as a science matter- other questions arise and some aspects remain unexplored. We have seen that extracts from A. dealbata produced several effects on seeds and seedlings of native plants, but, what about natural concentrations in the field? What are the main physiological effects produced by these compounds? We already know that A. dealbata can induce changes at soil microbial structure but what happens with soil function? In the other hand, we still have several doubts about the effect produced across the time in the function and structure of soil microbial communities. Additionally, the continuous sampling and time expended below its canopy lead us to include in this PhD a new hypothesis that could contribute to the expansion of A. dealbata. We investigated the role of volatile organic compounds (VOCs) released by A. dealbata as a possible mechanism promoting its invasiveness. Moreover, we realize that there is an enormous challenge in front of us related with A. dealbata control. Here, we present the first scientific effort in Europe to manage areas invaded with A. dealbata. Additionally, we are also interested in the ecological consequences derived from the use of synthetic herbicides in plant and soil communities.

In the following pages we try to address these questions.

References

Ahern, R.G., Landis, D.A., Reznicek, A.A., Schemske, D.W., 2010. Spread of exotic plants in the landscape: the role of time, growth habit, and history of invasiveness. Biol. Invasions. 12, 3157-3169. Aira, M.J., Horn, H., Seijo, M.C., 1998. Palynological analysis of honeys from Portugal. J.Apic. Res. 37, 247-254. Andreu, J., Vila, M., Hulme, P.E., 2009. An assessment of stakeholder perceptions and management of noxious alien plants in Spain. Environ. Manag. 43, 1244-1255. Barto, E.K., Weidenhamer, J.D., Cipollini, D., Rillig, M.C., 2012. Fungal superhighways: do common mycorrhizal networks enhance below ground communication? Trends Plant Sci. 17, 633-637. Bhat, J.A., Kumar, M., Negi, A.K., Todaria, N.P., 2012. Acacia dealbata Link (silver wattle), an invasive species growing in high altitudes of the Himalaya. Current Sci, 103, 130.

Introduction

Beltrán-Heredia, J., Sánchez-Martín, J., Gómez-Muñoz, M.C., 2010. New coagulant agents from tannin extracts: Preliminary optimisation studies. Chem. Eng. J. 162, 1019-1025. Bever, J.D., Dickie, I.A., Facelli, E., Facelli, J.M., Klironomos, J., Moora, M., Zobel, M., 2010. Rooting theories of plant community ecology in microbial interactions. Trends Ecol. Evol. 25, 468-478. Boudiaf, I., Baudoin, E., Sanguin, H., Beddiar, A., Thioulouse, J., Galiana, A., Duponnois, R., 2013. The exotic legume tree species Acacia mearnsii alters microbial soil functionalities and the early development of a native tree species Quercus suber in North Africa. Soil Biol. Biochem. 65, 172-179. Brito, L.M., Saldanha, J., Mourão, I., Nestler, H., 2013. Composting of Acacia longifolia and Acacia melanoxylon invasive species. Acta Hortic. 1013, 211-216. Broadhurst, L.M., Young, A.G., Forrester, R., 2008. Genetic and demographic responses of fragmented Acacia dealbata (Mimosaceae) populations in southeastern Australia. Biol. Conserv. 141, 2843-2856. Buist, M.L., 2003. Comparative ecology and conservation biology of two critically endangered acacias (Acacia lobulata and A. sciophanes) and two common, widespread relatives (Acacia verricula and A. anfractuosa) from the south-west of Western Australia. PhD thesis, The University of Western Australia. Butcher, P.A., Moran, G.F., Perkins, H.D., 1998. RFLP diversity in the nuclear genome of Acacia mangium Heredity, 81, 205-213. CABI, invasive species compendium (2001) http://www.cabi.org/isc/?compid=5&dsid= 2207&loadmodule=datasheet&page=481&site=144#. Campbell, P.L., Kluge, R.L., 1999. Development of integrated control strategies for wattle. 1. Utilization of wattle, control of stumps and rehabilitation with pastures. S. Afr. J. Plant Soil. 16, 24-30. Calviño-Cancela, M., Rubido-Bará, M., 2013. Invasive potential of Eucalyptus globulus: Seed dispersal, seedling recruitment and survival in habitats surrounding plantations. Forest Ecol. Manag. 305, 129-137. Carballeira, A., Reigosa, M.J., 1999. Effects of natural leachates of Acacia dealbata Link in Galicia (NW Spain). Bot. Bull. Acad. Sinica 40, 87-92. Castro-Díez, P., Godoy, O., Saldaña, A., Richardson, D.M., 2011. Predicting invasiveness of Australian acacias on the basis of their native climatic affinities, life-history traits and human use. Divers. Distrib. 17, 934-945. Castro-Díez, P., Fierro-Brunnenmeister, N., González-Muñoz, N., Gallardo, A., 2012. Effects of exotic and native tree leaf litter on soil properties of two contrasting sites in the Iberian Peninsula. Plant Soil. 350; 179-191. Castro‐Díez, P., Godoy, O., Alonso, A., Gallardo, A., Saldaña, A., 2014.. What explains variation in the impacts of exotic plant invasions on the nitrogen cycle? A meta‐analysis. Ecol. Let. 17, 1-12.

Introduction

CEEEI, 2013. Catálogo Español de Especies Exóticas Invasoras. Ministerio De Agricultura, Alimentación Y Medio Ambiente / Spanish Catalogue of Invasive Exotic Species. Spanish Ministery of Agriculture, Food and Environment. Coates, D.J., Tischler, G., McComb, J.A., 2006. Genetic variation and the mating system in the rare Acacia sciophanes compared with its common sister species Acacia anfractuosa (Mimosaceae). Conserv. Genet. 7, 931-944. Coetzee, B.W.T., Van Rensburg, B.J., Robertson, M.P., 2007. Invasion of grasslands by silver wattle, Acacia dealbata (Mimosaceae), alters beetle (Coleoptera) assemblage structure. Afr. Entomol. 15, 328-339. Correia, M., Castro, S., Ferrero, V., Crisóstomo, J.A., Rodríguez‐Echeverría, S., 2014. Reproductive biology and success of invasive Australian acacias in Portugal. Bot. J. Linnean Soc. 174, 574-588. Crisostomo, J.A., 2012. Belowground mutualisms and plant genetic diversity; insights into the invasion process of Acacia dealbata and Acacia saligna. PhD dissertation. University of Coimbra Crous, C.J., Jacobs, S.M., Esler, K.J., 2012a. Drought-tolerance of an invasive alien tree, Acacia mearnsii and two native competitors in fynbos riparian ecotones. Biol. Invasions. 14, 619-631. de la Cueva, A.V., 2014. Case studies of the expansion of Acacia dealbata in the valley of the river Miño (Galicia, Spain). Forest Syst. 23, 3-14. DAISIE database. Delivering Alien Invasive Species Inventories for Europe (2003). http://www.europe-aliens.org/speciesFactsheet.do?speciesId=12749# Daws, M.I., Davies, J., Vaes, E., van Gelder, R., Pritchard, H.W., 2007. Two-hundred-year seed survival of Leucospermum and two other woody species from the Cape Floristic region, South Africa.Seed Sci. Res.17, 73-80. Day, R.L., Laland, K.N., Odling-Smee, F.J., 2003. Rethinking adaptation: the niche-construction perspective. Perspect. Biol. Med. 46, 80-95. de Neergaard, A., Saarnak, C., Hill, T., Khanyile, M., Berzosa, A.M., Birch-Thomsen, T., 2005. Australian wattle species in the Drakensberg region of South Africa - An invasive alien or a natural resource?.Agric. Syst. 85, 216-233. Dennill, G.B., Donnelly, D., 1991. Biological control of Acacia longifolia and related weed species (Fabaceae) in South Africa. Agr Ecosyst Environ. 37, 115-135. Dennill, G.B., Donnelly, D., Stewart, K., Impson, F.A.C., 1999. Insect agents used for the biological control of Australian Acacia species and Paraserianthes lophantha (Willd.) Nielsen (Fabaceae) in South Africa. Afr. Entom. Memoir 1, 45-54. Díez, J., 2005. Invasion biology of Australian ectomycorrhizal fungi introduced with eucalypt plantations into the Iberian Peninsula. Biol. Invasions. 7, 3-15. Duarte, A.P., Luís, Â., Gil, N, Amaral, M.E., 2012. Antioxidant activities of extract from Acacia melanoxylon, Acacia dealbata, Olea europaea and alkaloids estimation.Int. J. Pharm. Sci. 4, 225-231.

Introduction

Duponnois, R., Plenchette, C., Prin, Y., Ducousso, M., Kisa, M., Ba, A. Galiana, A., 2007. Use of mycorrhizal inoculation to improve reafforestation process with Australian Acacia in Sahelian ecozones. Ecol. Engin. 29, 105-112. FAO. Food and Agriculture Organization of the United Nations. Invasive and introduced species. Country species list. http://www.fao.org/forestry/27179/en/ago/ Ehrenfeld, J.G., 2003. Effects of exotic plant invasions on soil nutrient cyling processes. Ecosystems. 6, 503-523. Ehrenfeld, J.G., 2010. Ecosystem consequences of biological invasions. Annu. Rev. Ecol. Evol. S. 41, 59-80. Eichhorn, M.P., Ratliffe, L.C., Pollard, K.M., 2011. Attraction of ants by an invasive Acacia. Insect Conserv.Diver. 4, 235-238. Ens, E.J., Bremner, J.B., French, K., Korth, J., 2009. Identification of volatile compounds released by roots of an invasive plant, bitou bush (Chrysanthemoides monilifera spp. rotundata), and their inhibition of native seedling growth. Biol. Invasions. 11, 275-287. Fuentes-Ramírez, A., Pauchard, A., Marticorena, A., Sánchez, P., 2010. Relationship between the invasion of Acacia dealbata Link (Fabaceae: Mimosoideae) and plant species richness in south-central Chile. Gayana – Botanica. 67, 188-97. Fuentes-Ramírez, A., Pauchard, A., Cavieres, L.A. García, R.A., 2011. Survival and growth of Acacia dealbata vs. native trees across an invasion front in south-central Chile. Forest Ecol. Manag. 261, 1003-1009. Galatowitsch, S., Richardson, D.M., 2005. Riparian scrub recovery after clearing of invasive alien trees in headwater streams of the Western Cape, South Africa. Biol. Conserv. 122, 509-521. Gallagher, R.V., Leishman, M.R., Miller, J.T., Hui, C., Richardson, D.M., Suda, J., Trávníček, P., 2011. Invasiveness in introduced Australian acacias: the role of species traits and genome size. Divers Distrib. 17, 884-897. Gibson, M.R., Richardson, D.M., Marchante, E., Marchante, H., Rodger, J.G., Stone, G.N., Wilson, J.R., 2011. Reproductive biology of Australian acacias: important mediator of invasiveness?. Divers Distrib. 17, 911-933. Gilbert, J.M., 1959. Forest succession in the Florentine Valley, Tasmania Paper Proc. R. Soc. Tas., 93, 129-151. Godoy, O., Richardson, D.M., Valladares, F., Castro-Díez, P., 2009. Flowering phenology of invasive alien plant species compared with native species in three Mediterranean-type ecosystems. Ann. Bot. 103, 485-494. Godoy, O., de Lemos-Filho, J.P., Valladares, F., 2011. Invasive species can handle higher leaf temperature under water stress than Mediterranean natives. Environ Exp Bot. 71, 207-214. Goodwin, B.J., McAllister, A.J. Fahrig, L., 1999. Predicting invasiveness of plant species based on biological information. Conserv. Biol. 13, 422-426.

Introduction

González-Muñoz, N., Costa-Tenorio, M., Espigares, T., 2012. Invasion of alien Acacia dealbata on Spanish Quercus robur forests: Impact on soils and vegetation.Forest Ecol. Manag. 269, 214-221. González-Muñoz, N., Linares, J.C., Castro-Díez, P., Sass-Klaassen, U., 2014. Predicting climate change impacts on native and invasive tree species using radial growth and twenty- first century climate scenarios. Eur J. Forest Res. 1-14. Gregory, T.R., 2001. Coincidence, coevolution, or causation? DNA content, cell size, and the C- value enigma. Biol. Rev. 76, 65-101. Griffin, A.R., Midgley, S.J., Bush, D., Cunningham, P.J., Rinaudo, A.T., 2011. Global uses of Australian acacias - Recent trends and future prospects. Divers. Distrib. 17, 837-847 Grotkopp, E., Rejmánek, M., Sanderson, M.J. Rost, T.L., 2004. Evolution of genome size in pines (Pinus) and its lifehistory correlates: supertree analyses. Evolution. 58, 1705-1729. Hawkes, C.V., Belnap, J., D‟Antonio, C., Firestone, M.K., 2006. Arbuscular mycorrhizal assemblages in native plant roots change in the presence of invasive exotic grasses. Plant Soil. 281, 369-380. Henderson, L.,1991. Invasive alien woody plants of the Orange Free State. Bothalia. 21, 73-89 Henderson, L., 2007. Invasive, naturalized and casual alien plants in southern Africa: a summary based on the Southern African Plant Invaders Atlas (SAPIA). Bothalia. 37, 215. Herlihy, C.R., Eckert, C.G., 2002. Genetic cost of reproductive assurance in a self-fertilizing plant. Nature. 416, 320-323. Hernández, L., Martínez-Fernández, J., Cañellas, I., de la Cueva, A.V., 2014. Assessing spatio- temporal rates, patterns and determinants of biological invasions in forest ecosystems. The case of Acacia species in NW Spain. For. Ecol.Manage. 329, 206-213. Holmes, P.M., 2002. Depth distribution and composition of seed-banks in alien-invaded and uninvaded fynbos vegetation. Austral Ecol. 27, 110-120. Hunt, M.A., Battaglia, M., Davidson, N.J., Unwin, G.L., 2006. Competition between plantation Eucalyptus nitens and Acacia dealbata weeds in northeastern Tasmania. Forest Ecol Manag. 233, 260-274. Impson, F.A.C., Kleinjan, C.A., Hoffmann, J.H., Post, J.A., 2008. Dasineura rubiformis (Diptera: Cecidomyiidae), a new biological control agent for Acacia mearnsii in South Africa. S. Afr. J. Sci. 104, 247-249. Impson, F.A., Post, J.A., Hoffmann, J.H., 2013. Impact of the flower-galling midge Dasineura rubiformis Kolesik, on the growth of its host plant, Acacia mearnsii De Wild, in South Africa. S. Afr. J. Bot. 87, 118-121. Joffre, R., Rambal, S., Damesin, C., 1999. Functional attributes in Mediterranean-type ecosystems. In: Pugnaire, F.I., Valladares, F., (eds). Handbook of Functional Plant Ecology. New York: Marcel Dekker. Joubert, C. (2003) Rhizobia Associated with Australian Acacia species (Acacia mearnsii, Acacia dealbata and Acacia decurrens) in South Africa as Determined by Sodium Dodecyl-Sulphate Polyacrylamide Gel Electrophoresis. Msc Thesis. University of Pretoria, Pretoria

Introduction

Knight, C.A. Ackerly, D.D., 2002. Variation in nuclear DNA content across environmental gradients: a quantile regression analysis. Ecol Lett. 5, 66-76. Kolesik, P., Adair, R.J., 2012. A new genus of gall midge (Diptera: Cecidomyiidae) from Australian Acacia. Aust. J. Entomol. 51, 97-103. Kubešová, M. Moravcová, L., Suda, J., Jarošík, V., Pyšek, P., 2010. Naturalized plants have smaller genomes than their non-invading relatives: a flow cytometric analysis of the Czech alien flora. Preslia. 82, 81-96. Kulkarni, M.G., Sparg, S.G., Van Staden, J., 2007. Germination and post-germination response of Acacia seeds to smoke-water and butenolide, a smoke-derived compound. J. Arid Environ. 69, 177-187. Kull, C.A., Tassin, J. Rangan, H., 2007. Multifunctional, scrubby, and invasive forests? Wattles in the highlands of Madagascar. Mt. Res. Dv. 27, 224-231. Kull, C.A., Shackleton, C.M., Cunningham, P.J., Ducatillon, C., Dufour‐Dror, J.M., Esler, K.J., Zylstra, M.J., 2011. Adoption, use and perception of Australian acacias around the world. Divers Distrib. 17, 822-836. Kumari, A.A., Ravindhranath, K., 2012. Extraction of aluminium (III) ions from polluted waters using bio-sorbents derived from Acacia melanoxylon and Eichhornia crassipes plants. J. Chem. Pharm. Res. 4, 2836-2849. Lafay, B. Burdon, J.J., 2001. Small-subunit rRNA genotyping of rhizobia nodulating Australian Acacia spp. Appl. Environ. Microb. 67, 396-402. Lammel, D.R., Cruz, L.M., Carrer, H., Cardoso, E.J., 2013. Diversity and symbiotic effectiveness of beta-rhizobia isolated from sub-tropical legumes of a Brazilian Araucaria Forest. World J.Microb. Biot. 29, 2335-2342. Le Maitre, D.C., Versfeld, D.B., Chapman, R.A., 2000. Impact of invading alien plants on surface water resources in South Africa: A preliminary assessment. http://hdl.handle.net/10204/2121 Le Maitre, D.C., Gaertner, M., Marchante, E., Ens, E.J., Holmes, P.M., Pauchard, A., Richardson, D.M., 2011. Impacts of invasive Australian acacias: implications for management and restoration. Divers. Distrib. 17, 1015-1029. Le Roux, J.J., Brown, G.K., Byrne, M., Ndlovu, J., Richardson, D.M., Thompson, G.D., Wilson, J.R., 2011. Phylogeographic consequences of different introduction histories of invasive Australian Acacia species and Paraserianthes lophantha (Fabaceae) in South Africa. Divers. Distrib. 17, 861-871. Lorenzo, P., Pazos-Malvido, E., González, L., Reigosa, M.J., 2008. Allelopathic interference of invasive Acacia dealbata: physiological effects. Allelopathy J. 22, 453-462. Lorenzo, P., Gonzalez, L. Reigosa, M.J., 2010a. The genus Acacia as invader: the characteristic case of Acacia dealbata Link in Europe. Ann. For. Sci. 67, 1-11. Lorenzo, P., Rodríguez-Echeverría, S., González, L., Freitas, H. 2010b. Effect of invasive Acacia dealbata Link on soil microorganisms as determined by PCR-DGGE. Appl Soil Ecol. 44, 245-251.

Introduction

Lorenzo, P., Pazos-Malvido, E., Reigosa, M.J., González, L., 2010c. Differential responses to allelopathic compounds released by the invasive Acacia dealbata Link (Mimosaceae) indicate stimulation of its own seed. Aust J. Bot. 58, 546-553. Lorenzo, P., Palomera-Pérez, A., Reigosa, M.J., González, L., 2011. Allelopathic interference of invasive Acacia dealbata Link on the physiological parameters of native understory species. Plant Ecol. 212, 403-412. Lorenzo, P., Rodríguez-Echeverría, S., 2012. Influence of soil microorganisms, allelopathy and soil origin on the establishment of the invasive Acacia dealbata. Plant Ecol. Divers. 5, 67-73. Lorenzo, P., Pazos-Malvido, E., Rubido-Bará, M., Reigosa, M. J., González, L., 2012. Invasion by the leguminous tree Acacia dealbata (Mimosaceae) reduces the native understorey plant species in different communities. Aust J. Bot. 60, 669-675. Lorenzo, P., Pereira, C.S., Rodríguez-Echeverría, S., 2013. Differential impact on soil microbes of allelopathic compounds released by the invasive Acacia dealbata Link. Soil Biol. Biochem.57, 156-163. Mangrich, A.S., Doumer, M.E., Mallmannn, A.S., Wolf, C.R., 2014. Química Verde no Tratamento de Águas: Uso de Coagulante Derivado de Tanino de Acacia mearnsii. Revista Virtual de Química. 6, 2-15 Marchante, E., Kjøller, A., Struwe, S., Freitas, H., 2008a. Invasive Acacia longifolia induce changes in the microbial catabolic diversity of sand dunes. Soil Biol. Biochem. 40, 2563- 2568.

Marchante, E., Kjøller, A., Struwe, S., Freitas, H., 2008b. Soil recovery after removal of the N2- fixing invasive Acacia longifolia: consequences for ecosystem restoration. Biol. Invasions 11, 813-823. Marchante, H., Freitas, H., Hoffmann, J.H., 2010. Seed ecology of an invasive alien species, Acacia longifolia (Fabaceae), in Portuguese dune ecosystems. Am. J. Bot. 97, 1780-1790. Marchante, H., Freitas, H., Hoffmann, J.H., 2011. The potential role of seed banks in the recovery of dune ecosystems after removal of invasive plant species. Appl. Veg. Sci. 14, 107-119. Maslin, B.R., Miller, J.T., Seigler, D.S., 2003. Overview of the generic status of Acacia (Leguminosae: Mimosoideae). Aust. Syst. Bot. 16, 1-18. Maslin, R., McDonald, M.W., 2004. Acacia Search. Evaluation of Acacia as a woody crop option for southern Australia, RIRDC. Union Offset Printers, Canberra, Australia. May, B.M., Attiwill, P.M., 2003. Nitrogen-fixation by Acacia dealbata and changes in soil properties 5 years after mechanical disturbance or slash-burning following timber harvest. Forest Ecol. Manag. 181, 339-355. Mekonnen, K., Yohannes, T., Glatzel, G., Amha, Y., 2006. Performance of eight tree species in the highland Vertisols of central Ethiopia: growth, foliage nutrient concentration and effect on soil chemical properties. New For. 32, 285-298.

Introduction

Mok, H.F., Majumder, R., Laidlaw, W.S., Gregory, D., Baker, A.J., Arndt, S.K., 2013. Native Australian species are effective in extracting multiple heavy metals from biosolids. Int J Phytoremediat. 15, 615-632. Moore, G., Smith, G.F., Figueiredo, E., Demissew, S., Lewis, G., Schrire, B., Rico, L., van Wyk, A.E., 2011. Acacia, the 2011 Nomenclature Section in Melbourne, and beyond. Taxon 59, 1188-1195. Moran, V.C., Hoffmann, J.H., Zimmermann, H.G., 2013. 100 years of biological control of invasive alien plants in South Africa: History, practice and achievements. S. Afr. J. Sci. 109, 1-6. Muñoz, C., Mendonça, R., Baeza, J., Berlin, A., Saddler, J., Freer, J., 2007. Bioethanol production from bio‐organosolv pulps of Pinus radiata and Acacia dealbata. J. Chem. Technol. Biot. 82, 767-774. Narwal, S.S., 2010. Allelopathy in ecological sustainable organic agriculture. Allelopathy J. 25, 51-72. Newton, A.C., Echeverría, C., Cantarello, E., Bolados, G., 2011. Projecting impacts of human disturbances to inform conservation planning and management in a dryland forest landscape. Biol. Conserv. 144, 1949-1960. Nuñez, M.A., Horton, T.R. Simberloff, D., 2009. Lack of belowground mutualisms hinders Pinaceae invasions. Ecology. 90, 2352-2359. Odling-Smee, F.J., Laland, K.N., Feldman, M.W., 1996. Niche construction. Am Nat. 641-648. Ogawa, S., Matsumae, T., Kataoka, T., Yazaki, Y., Yamaguchi, H., 2013. Effect of acacia polyphenol on glucose homeostasis in subjects with impaired glucose tolerance: A randomized multicenter feeding trial. Exp Therap. Med. 5, 1566-1572. Olajuyigbe, O.O., Afolayan, A.J., 2012. In vitro antibacterial and time-kill assessment of crude methanolic stem bark extract of Acacia mearnsii De Wild against bacteria in shigellosis. Molecules. 17, 2103-2118. Oliver, T.H., Pettitt, T., Leather, S.R., Cook, J.M., 2008. Numerical abundance of invasive ants and monopolisation of exudate-producing resources - a chicken and egg situation. Ins. Conserv. Divers. 1, 208-214. Palni Hills Conservation Council (PHCC) (2007) 22nd Annual report, 2006–2007. PHCC, Kodaikanal. Paoletti, M.G., Hassall, M., 1999. Woodlice (Isopoda: Oniscidea): their potential for assessing sustainability and use as bioindicators. Agric. Ecosyst. Environ. 74, 157-165. Payne, S.E., Kotze, A.C., Durmic, Z., Vercoe, P.E., 2013. Australian plants show anthelmintic activity toward equine cyathostomins in vitro. Vet. Parasitol. 196, 153-160. Pearson, D.E., Callaway, R.M., 2003. Indirect effects of host-specific biological control agents.Trends Ecol. Evol. 18, 456-61. Pemberton, R.W., 2000. Predictable risk to native plants in weed biological control. Oecologia. 125:489-94.

Introduction

Perriot, R., Breme, K., Meierhenrich, U.J., Carenini, E., Ferrando, G., Baldovini, N., 2010. Chemical composition of French mimosa absolute oil. J. Agr. Food Chem. 58, 1844-1849. Pyšek, P., Richardson, D.M., Rejmánek, M., Webster, G.L., Williamson, M., Kirschner, J., 2004. Alien plants in checklists and floras: towards better communication between taxonomists and ecologists. Taxon. 53, 131-143. Rabatin, S.C., Stinner, B.R., 1988. Indirect effects of interactions between VAM fungi and soil- inhabiting invertebrates on plant processes. Agric. Ecosyst. Environ. 24, 135-146. Reid, D.G., Bonnet, S.L., Kemp, G., van der Westhuizen, J.H., 2013. Analysis of commercial proanthocyanidins. Part 4: Solid state 13C NMR as a tool for in situ analysis of proanthocyanidin tannins, in heartwood and bark of quebracho and acacia, and related species.Phytochemistry. 94, 243-248. Reigosa, M.J., Casal, J.F., Carballeira, A., 1984. Efectos alelopáticos de Acacia dealbata Link durante su floración (in Spanish). Studia Oecologica. 5, 135-150. Renuka, G., Rao, M.S., Kumar, V.P., Ramesh, M., Reddy, S.R., 2012. Arbuscular Mycorrhizal Dependency of Acacia melanoxylon R. Br. Proc. Nat Acad Sci. India Section B: Biol. Sci. 82, 441-446. Rice, E.L., 1984. Allelopathy. Academic press. Richardson, D.M., Pyšek, P., Rejmánek, M., Barbour, M.G., Panetta, F.D., West, C.J., 2000. Naturalization and invasion of alien plants: concepts and definitions. Divers. Distrib. 6, 93- 107. Richardson, D.M., Rejmánek, M., 2011. Trees and shrubs as invasive alien species–a global review. Divers. Distrib. 17, 788-809. Richardson, D.M., Carruthers, J., Hui, C., Impson, F.A., Miller, J.T., Robertson, M.P., Wilson, J.R., 2011. Human‐mediated introductions of Australian acacias–a global experiment in biogeography. Divers. Distrib. 17, 771-787. Rodger, J.G., Johnson, S.D., 2013. Self-pollination and inbreeding depression in Acacia dealbata: Can selfing promote invasion in trees? S. Afr. J. Bot. 88, 252-259. Rodríguez‐Echeverría, S., 2010. Rhizobial hitchhikers from Down Under: invasional meltdown in a plant–bacteria mutualism?.J. Biogeogr. 37, 1611-1622. Rodríguez‐Echeverría, S., Le Roux, J.J., Crisóstomo, J.A., Ndlovu, J., 2011. Jack‐of‐all‐trades and master of many? How does associated rhizobial diversity influence the colonization success of Australian Acacia species?. Divers. Distrib. 17, 946-957. Sánchez‐Martín, J., Beltrán‐Heredia, J., Rodríguez‐Sánchez, M.T., 2012. Removal of Erioglaucine (Acid Blue 9) with a new coagulant agent from Acacia mearnsii tannin extract. Color. Tech. 128, 15-20. Seijo, M.C., Jato, M.V., 1998. Palynological characterization of honeys from Galicia (Northwest Spain). Grana. 37, 285-292. Seymour, C.L., Veldtman, R., 2010. Ecological role of control agent, and not just host‐specificity, determine risks of biological control. Austral Ecol. 35, 704-711.

Introduction

Shen, X., Wang, Y., Wang, F., 2010. Characterisation and biological activities of proanthocyanidins from the barks of Pinus massonian and Acacia mearnsii. Nat. Prod. Res. 24, 590-598. Sheppard, A.W., Shaw, R.H., Sforza, R., 2006. Top 20 environmental weeds for classical biological control in Europe: A review of opportunities, regulations and other barriers to adoption. Weed Res. 46, 93-117. Silva, P.M., 2012. Invasão de Ecossistemas por Acacia longifolia – Caracterização da entomofauna associada e identificação de potenciais polinizadores. Master‟s Thesis, Faculty of Science and Tecnology, New University of Lisbon, Lisbon. Soares, P.R., Duarte, F.T., Freitas, O.M., Delerue-Matos, C., Figueiredo, S.A., Boaventura, R.A., 2012. Evaluating the efficiency of a vegetal coagulant in the treatment of industrial effluents. Fresen. Environ. Bull. 21, 2413-2418. Sousa, J.P., Vingada, J.V., Loureiro, S., Da Gama, M.M., Soares, A.M.V.M., 1998. Effects of introduced exotic tree species on growth, consumption and assimilation rates of the soil detritivore Porcellio dilatatus (Crustacea: Isopoda). Appl. Soil Ecol. 9, 399-403. Souza-Alonso, P., Novoa, A., González, L., 2014a. Soil biochemical alterations and microbial community responses under Acacia dealbata Link invasion. Soil Biol. Biochem. 79, 100-108. Souza-Alonso, P., Cavaleiro, C., González, L., 2014b. Ambient has Become Strained. Identification of Acacia dealbata Link volatiles interfering with germination and early growth of native species. J. Chem. Ecol. 40, 1051-1061. Sowndhararajan, K., Joseph, J.M., Manian, S., 2013. Antioxidant and Free Radical Scavenging Activities of Indian Acacias: Acacia leucophloea (Roxb.) Willd., Acacia ferruginea Dc., Acacia dealbata Link. and Acacia pennata (L.) Willd. Int. J. Food Prop. 16, 1717-1729. Stone, G.N., Raine, N.E., Prescott, M. Willmer, P.G., 2003. Pollination ecology of acacias (Fabaceae, Mimosoideae). Aust. System. Bot. 16, 103-118. Syphard, A.D., Radeloff, V.C., Keeley, J.E., Hawbaker, T.J., Clayton, M.K., Stewart, S. I., Hammer, R.B., 2007. Human influence on California fire regimes. Ecol. Appl. 17, 1388-1402. Syphard, A.D., Radeloff, V.C., Hawbaker, T.J., Stewart, S.I., 2009. Conservation threats due to human-caused increases in fire frequency in mediterranean-climate ecosystems. Conserv. Biol. 23, 758-769. Tabuti, J.R., Kukunda, C.B., Waako, P.J., 2010. Medicinal plants used by traditional medicine practitioners in the treatment of tuberculosis and related ailments in Uganda. J. Ethnopharmacol. 127, 130-136. Tassin, J., Rakotomanana, R., Kull, C., 2009. Gestion paysanne de l‟invasion de Acacia dealbata a` Madagascar. Bois et Forêts des Tropiques. 300, 3-14. Tejada, M., Gómez, I., Fernández-Boy, E., Díaz, M.J., 2014. Effects of sewage sludge / Acacia dealbata composts on soil biochemical and chemical properties. Commun. Soil Sci. Plant . 45, 570-580. van Wilgen, B.W., Dyer, C., Hoffmann, J.H., Ivey, P., Le Maitre, D.C., Richardson, D.M., Rouget, M., Wannenburgh, A., Wilson, J.R.U., 2011. National-scale strategic approaches for

Introduction

managing introduced plants: insights from Australian acacias in South Africa. Divers. Distrib. 17, 1060-1075. Veldtman, R., Lado, T.F., Botes, A., Procheş, Ş., Timm, A.E., Geertsema, H., Chown, S.L., 2011. Creating novel food webs on introduced Australian acacias: indirect effects of galling biological control agents. Divers. Distrib. 17, 958-967. Vilá, M., Espinar, J.L., Hejda, M., Hulme, P.E., Jarosik, V., Maron, J.L. et al., 2011. Ecological impacts of invasive alien plants: a metaanalysis of their effects on species, communities and ecosystems. Ecol. Lett. 14, 702-708. Werner, C., Zumkier, U., Beyschlag, W., Máguas, C., 2010. High competitiveness of a resource demanding invasive acacia under low resource supply. Plant Ecol. 206, 83-96. Willson, M.F., Traveset, A., 2000. The ecology of seed dispersal. In: Seeds: the ecology of regeneration in plant communities, Vol 2. pp. 85-124. Yáñez, R., Romaní, A., Garrote, G., Alonso, J. L., Parajó, J.C., 2009. Experimental evaluation of alkaline treatment as a method for enhancing the enzymatic digestibility of autohydrolysed Acacia dealbata. J. Chem. Technol. Biot. 84, 1070-1077. Yáñez, R., Gómez, B., Martínez, M., Gullón, B., Alonso, J.L., 2013. Valorization of an invasive woody species, Acacia dealbata, by means of Ionic liquid pretreatment and enzymatic hydrolysis. J. Chem. Technol. Biot. Zhu, X., Zhang, J., Ma, K., 2011. Soil biota reduce allelopathic effects of the invasive Eupatorium adenophorum. PLoS ONE 6, e25393.

Introduction

Chapter 2 Ambient has become strained

PART II Playing its cards

Chapter 2 Ambient has become strained

Chapter 2 Ambient has become strained

Chapter 2. Ambient has become strained. Identification of Acacia dealbata Link volatiles interfering with native species growth

Souza-Alonso, P., Cavaleiro, C., González, L., 2014. Ambient has become strained. Identification of Acacia dealbata Link volatiles interfering with germination and early growth of native species. J. Chem. Ecol. 40, 1051-1061.

Chapter 2 Ambient has become strained

Author's personal copy

JChemEcol DOI 10.1007/s10886-014-0498-x

Ambient has Become Strained. Identification of Acacia dealbata Link Volatiles Interfering with Germination and Early Growth of Native Species

Pablo Souza-Alonso & Luís González & Carlos Cavaleiro

Received: 23 April 2014 /Revised: 12 June 2014 /Accepted: 9 September 2014 # Springer Science+Business Media New York 2014

Abstract Acacia dealbata Link is a widespread invader in Keywords Volatile organic compounds (VOCs) . Plant Mediterranean type ecosystems, and traits promoting its inva- invasion . Phytotoxicity . Germination . Oxidative stress . siveness are currently under investigation. Due to the dense Early growth atmosphere below its canopy, we hypothesized that volatile organic compounds (VOCs) released from flowers, leaves, Abbreviations litter, or a mixture of treatments exert inhibitory effects on VOCs Volatile organic compounds the natives Trifolium subterraneum, Lolium multiflorum, Gt Total germination Medicago sativa, and also on its own seeds. We reported that MDA Malodialdehyde VOCs from flowers significantly reduced germination in POX Peroxidase L. multiflorum and A. dealbata; moreover, root length, stem SOD Superoxide dismutase length, aboveground and belowground biomass were also GC Gas chromatography reduced in all species studied. Volatile organic compounds GC/MS Gas chromatography/mass spectrometry from flowers and the mixture also increased significantly NBT Nitroblue tetrazolium malondialdehyde content in T. subterraneum and EDTA Ethylenediaminetetraacetic acid L. multiflorum. The effects of VOCs on antioxidant enzymatic TBA Thiobarbituric acid activities were species dependent. Flowers enhanced peroxi- dase but decreased superoxide dismutase activity in T. subterraneum. In contrast, VOCs released from leaves increased the activity of superoxide dismutase in Introduction L. multiflorum. GC/MS analyses revealed 27 VOCs in the volatile fraction from flowers, 12 of which were exclusive to Volatile organic compounds (VOCs) are typical lipophilic mol- this fraction. Within them, heptadecadiene, n-nonadecane, n- ecules from secondary plant metabolism. They are derived tricosane, and octadecene represent 62 % of the fraction. We mainly from isoprenoid pathways and with low molecular present evidence that the VOCs released from A. dealbata masses (under 300 Da). Lipophilic VOCs can cross membranes flowers strongly inhibited germination and seedling growth of freely and evaporate into the atmosphere when there are no selected species, and mainly on its own seedlings. As far as we barriers to diffusion (Pichersky et al. 2006). Structurally, VOCs know, this is the first evidence of phytotoxicity induced by generally can be assigned to the following classes: terpenoids, VOCs in invasive species belonging to the Acacia genus. fatty acid derivatives including lipoxygenase pathway prod-

ucts, benzenoids and phenylpropanoids, C5-branched com- pounds, and various nitrogen and sulfur containing compounds P. Souza-Alonso (*) : L. González Plant Biology and Soil Science Department, University of Vigo, (Dudareva et al. 2004). 36310 Vigo, Spain Functionally, besides their internal role, the release of e-mail: [email protected] VOCs is a primary form of plant communication, and they are involved in a variety of ecological interactions. Volatile C. Cavaleiro Faculty of Pharmacy/CEF and CNC, University of Coimbra, organic compounds have clear participation in important Azinhaga de Santa Comba, 3000-548 Coimbra, Portugal plant-plant ecological interactions (Runyon et al. 2006). This Author's personal copy

JChemEcol includes: serving to attract and guide pollinators (Reinhard membrane undergo peroxidation, malondialdehyde et al. 2004), working as mediators of direct herbivore (MDA) is accumulated. Its concentration is routinely defenses by exerting an immediate negative impact on used as an index of lipid peroxidation under stress herbivores (Kessler and Baldwin 2001), and serving as conditions (Lin and Kao 2000). an indirect defense by attracting enemies of the herbi- Acacia Dealbata Link is a N2-fixing tree native to vores (Arimura et al. 2005). VOCs are released into the Australia. First introduced in Europe at the end of the environment mainly through four ecological processes: 18th century for ornamental purposes, it has rapidly volatilization, leaching, plant residue decomposition in become a major threat, especially in Mediterranean- soil, and root exudation (Chou 1999). Regardless of the type ecosystems, due its characteristics as a heavy seed release mode, the qualitative and quantitative emission producer and its rapid re-sprouting following cutting, of VOCs depends on other factors, such as the pheno- fire or frost (Sheppard et al. 2006). Acacia dealbata typical stage (Kotze et al. 2010). In addition to the inter- drastically reduces species richness and diversity under active and protective role, these secondary metabolites its canopy (González-Muñoz et al. 2012; Lorenzo et al. can exert a negative influence on their surrounding envi- 2012a). Several features have been postulated to explain ronment (Barney et al. 2005). In fact, the release of VOCs its success, and among them, allelopathic potential has has been postulated as a mechanism by which invasive been postulated as a major trait contributing to its plants are successful in the invaded ranges (Barney et al. invasiveness (Casal et al. 1985; Carballeira and 2005; Inderjit et al. 2011; Zhang et al. 2012a). Reigosa, 1999). The allelochemicals of A. dealbata are Presumably, the compounds are physiologically active in currently considered as invasive weapons, disturbing nonconspecific organisms precisely because of their sec- soil and plant communities at a physiological and func- ondary nature (Berenbaum 1995). Outside the native tional level (Lorenzo et al. 2011, 2013). However, the range, some of these compounds can act as mystery by which A. dealbata and other exotic invasive allelochemicals, favoring the success of exotic plants species have become overwhelmingly dominant in in- (Inderjit et al. 2011). The inhibitory effects of VOCs on vaded communities from originally being minor compo- seed germination and early growth in the surrounding nents of their native communities remains unclear environment has been demonstrated (Muller 1966; (Callaway and Maron 2006). Thelen et al. 2005) after plant damage (Karban 2007), In their native range, A. dealbata trees appear as but also when the plant producing VOCs is not an inva- separated individuals. However, outside its native range, siveplant(Zhangetal.2012b). However, the physiolog- A. dealbata patches form intricate mazes during the first ical mechanisms responsible for the inhibition are still steps of invasion, increasing the density of individuals/ unknown. m2, and virtually establishing monocultures. The vast Biotic and abiotic stress factors are well-known for concentration of A. dealbata individuals creates an at- inducing the production of reactive oxygen species mosphere rich in VOCs inside its canopy. The intense - (ROS). The production of ROS, as O2 or H2O2,and aroma, mainly during the flowering period, is pro- related oxidative stress in general, can be directly or nounced, and flowers currently are used in 80 perfumes indirectly produced by the action of phytotoxins (Heiser with a worldwide production estimated at five tons/year et al. 1998). Reactive oxygen species are highly reac- (Perriot et al. 2010). Due to its relative importance in tive, and in the absence of any protective mechanism this industry, an exploratory approach describing the they can seriously disrupt normal metabolism through essential oil composition of its flowers was previously oxidative damage to lipids, protein, and nucleic acids carried out by Perriot et al. (2010), using n-hexane as (Melonietal.2003). Mechanisms to avoid the effects of the extractant solvent. ROS include the presence of the antioxidant enzymatic The effects of A. dealbata VOCs on the surrounding envi- system. Antioxidant enzymes such as superoxide dis- ronment have not been studied. The role of A. dealbata vol- mutase (SOD) and peroxidase (POX) are involved di- atiles as a potential invasive characteristic is possible and still rectly in detoxification (Bailly 2004). Superoxide dis- unknown. The unusual and penetrating smell within the can- mutase is the first line of defense since it is a major opy of A. dealbata led us to hypothesize that volatile com- - scavenger of O2 , and its enzymatic action results in the pounds released by A. dealbata plants or its litter might - formation of H2O2.AfterO2 removal, POX catalyzes directly affect germination and the early growth of native the transformation from H2O2 to H2O and its activity species. To identify the impact of A. dealbata VOCs we tested has been suggested as being an indicator of allelopathic the volatile effect on native plant development. We recorded stress level (Ding et al. 2008; Singh et al. 2006). seed germination and seedling growth parameters such as root Membrane stability also is severely altered in the pres- and stem growth, aboveground and belowground biomass, ence of ROS. When polyunsaturated fatty acids in the together with oxidative stress parameters such as antioxidant Author's personal copy

JChemEcol enzymatic activities and malondialdehyde (MDA) content in Gas Chromatography/Mass Spectrometry GC/MS analysis three native plants and in A. dealbata. In the same period, we was carried out in an Hewlett-Packard 6890 gas chromato- carried out the extraction of VOCs from different parts graph fitted with a HP1 fused silica column (polydimethylsi- of the plant and identified volatile compounds using GC loxane 30 m×0.25 mm i.d., film thickness 0.25 μm), and GC/MS. interfaced with an Hewlett-Packard Mass Selective Detector 5973 (Agilent Technologies) operated by HP Enhanced ChemStation software, version A.03.00.GC with parameters Methods and Materials as described above; interface temperature: 250 °C, MS source temperature: 230 °C, MS quadrupole temperature: 150 °C, Material Collection and Extract Preparation In January ionization energy: 70 eV, ionization current: 60 μA, scan 2013, during the peak of the flowering period, Acacia range: 35–350 units, scans s-1:4.51. dealbata flowers, leaves, and litter were collected at three different invaded areas, distanced more than 100 m apart Identification of Volatile Compounds from A. dealbata The and located 70 m (±5 m) above sea level in Ribadelouro identity of the compounds was achieved from their retention (42.1035449 N, -8.66097524 W; Pontevedra province), NW indices on both SPB-1 and SupelcoWax-10 columns and from Spain. Completely developed flowers were selected carefully their mass spectra. Retention indices, calculated by linear from at least 25 A. dealbata trees at each invaded area. interpolation relative to retention times of C8-C22 n-alkanes, Flowers from the different areas were pooled and immediately were compared with those of reference compounds included enclosed in plastic bags to minimize VOCs loss. in our laboratory database or tentatively from literature data Simultaneously, leaves and small branches from 25 individ- (Acree and Arn 2004; Adams 2007;El-Sayed2012;Linstrom uals also were collected and cut into small pieces (1–5cm)to and Mallard 2003). The acquired mass spectra was compared facilitate VOCs liberation, and were immediately put into with corresponding data of commercial standards from a lab- plastic bags. One dm2 of soil litter was collected below 25 made library, from the Wiley Mass Spectral Database mature plants in each area and immediately put into plastic (McLafferty 2009), or from literature data (Adams 2007; bags. Fresh material was taken immediately to the laboratory Joulain and Koning 1998). A relative amount of individual for further processing. components was calculated based on GC peak areas without Once in the laboratory and during the following 24 h, plant FID response factor correction. The relative percentage of material was separated into two portions. A small portion was components which co-elute on an apolar column was calcu- used in VOCs bioassays. A large portion of flowers, leaves, lated on a polar column. and litter of A. dealbata were submitted to continuous and simultaneous water distillation and extraction with n-pentane, Volatile Compounds Bioassay Simultaneously to identifying for 4 h, using a Likens-Nickerson apparatus (Marsili 2001). volatile compounds, bioassays preventing physical contact This procedure yielded sufficient quantities of volatile isolates between the plant material and seeds of the target species were to use in chemical analyses. Analysis of the flowers, leaves, performed, similarly to those described in Barney et al. and litter volatiles were carried out by a combination of gas (2005). Plant material was introduced into hermetic glass chromatography (GC) and gas chromatography/mass spec- chambers (1 dm3) allowing the VOCs to flow inside and make troscopy (GC/MS). contact with seeds. Fresh flowers, leaves, litter, and the com- bination of flowers x leaves x litter (hereafter mix) were Gas Chromatography Analytical GC was carried out in an arranged achieving a total of 4 treatments. Glass chambers Hewlett-Packard 6890 (Agilent Technologies, Palo Alto, CA, were arranged in a completely randomized design, with three USA) gas chromatograph with an HP GC ChemStation Rev. replicates, and the same number of chambers was used as A.05.04 data handling system equipped with a single injector control (see below). and two flame ionization detection (FID) system. A graphpak The seeds of four species were included in the assay; the divider (Agilent Technologies, part no. 5021-7148) was used three native plants Lolium multiflorum L., Trifolium for simultaneous sampling to 2 Supelco fused silica capillary subterraneum L. var trikkala, and Medicago sativa L., and columns (Supelco, Bellefonte, PA, USA) with different sta- also seeds of A. dealbata after the auto-stimulation suggested tionary phases: SPB-1 (polydimethylsiloxane 30 m×0.20 mm by Lorenzo et al. (2010). Native seeds were purchased from i.d., film thickness 0.20 μm), and SupelcoWax-10 Zulueta Corporation and A. dealbata seeds were collected in (polyethyleneglycol 30 m×0.20 mm i.d., film thickness Mos (Galicia, NW Spain) during the summer of 2012. Prior to 0.20 μm). Oven temperature program: 70–220 °C the assay, seeds were sterilized in sodium hypochlorite (1 %) (3 °C min-1), 220 °C (15 min), injector temperature: 250 °C, and then profusely rinsed for 1 min in distilled water. After carrier gas: helium, adjusted to a linear velocity of 30 cm s-1, sterilization, 25 seeds per chamber of each species were splitting ratio 1:40; detectors temperature: 250 °C. spread over 2 Whatmann Ner 1 filter papers, and 8 ml of Author's personal copy

JChemEcol

distilled water were added to maintain moisture. Immediately inacoldmortarwithN2. The powdered material was homog- after seed placement, 15 g of each plant material were trapped enized in 3 ml of 50 mM HEPES-KOH buffer (7.8) with in a sterile cotton gauze swab (1 mm mesh size) at the top of 0.1 mM EDTA. Samples were centrifuged at 15000 g for hermetic glass chambers. The mix treatment was created by 15 min at 4 °C. The supernatant was used to determine both pooling 15 g of proportionate mixture (1:1:1) of flowers, POX and SOD activities. leaves, and litter. In the control chambers, nets were filled Peroxidase (POX) activity was measured by monitor- with plastic straw pieces, instead of A. dealbata material. After ing the increase in absorbance at 470 nm for 7 min in the inclusion of the net with each individual treatment, the 50 mM phosphate buffer (pH 5.5) containing 1 mM tops of the glass chambers were sealed with silicone and guaiacol and 0.5 mM H2O2. One unit of POX activity hermetically closed, to avoid VOCs loss. The glass chambers was defined as the amount of enzyme that caused an were arranged randomly in a growth chamber and maintained increase in absorbance of 0.01 per min (Upadhyaya at 24/18 °C and 16/8 h L/D conditions until the end of the et al. 1985). At the same time, SOD activity was assay. Germination was checked daily. Seeds were considered measured by the nitroblue tetrazolium reaction (NBT), germinated after radicle protrusion (1 mm). in accordance with the method of Beauchamp and After 10 d for L. multiflorum and T. subterraneum and Fridovich (1971). Supernatant was added to the reaction 14 days for M. sativa and A. dealbata, total germination mixture (1:4 v/v) in 50 mM HEPES-KOH buffer (7.8)

(Gt), germination indices as the speed of germination (S), containing 0.1 mM EDTA, 50 mM Na2CO3,12mML- accumulated speed of germination (AS), and coefficient of methionine, and 75 μM NBT (nitro blue tetrazolium). the rate of germination (CRG) were measured as described in The resulting mixture was placed under three 15 W Hussain et al. (2008). The length of hypocotyls (in fluorescent lamps (Hitachi F15T8/D, 700 lumens) and T. subterraneum, M. sativa,andA. dealbata) and the length left for acclimatization. After 3 min, the reaction began of the first foliage leaf in L. multiflorum were measured. To with the addition of 2 μM riboflavin (500 μl), and the facilitate description of results, hereafter hypocotyl and foliage mixture was placed again under the lights. After lengths arereferred to as stem length. Additionally, radicle 10 min, the samples were placed in darkness in order lengths, aboveground, belowground, and total seedling bio- to end the reaction. A complete reaction mixture with- mass, together with the antioxidant stress enzymes superoxide out enzyme (no sample), which gave the maximal color, dismutase (SOD) and peroxidase (POX), and the served as a control. A non-irradiated complete reaction malondialdehyde (MDA) content also were measured. mixture served as a blank. The reduction of the NBT Recognition of natural concentrations is a fundamental step was measured at 560 nm, and the enzyme unit was in allelopathy bioassays, however, the estimation of realistic determined with the values of the NBT inhibition per- concentrations in the case of VOCs entails several difficulties. centage using the equation: For this reason, the weight of plant material included in the ÂÃÀÁ treatments was selected, as much as possible, according to a INBT ¼ AbssampleÀAbscontrol =Abscontrol  100 reproduction of natural conditions. During the time of the assay, the fresh weight of a typical inflorescence of Where Abssample and Abscontrol are the absorbance values in A. dealbata was between 5 and 20 g, a normal branch (30– presence and absence of enzyme, respectively. The values of 40 cm) of between 10 and 20 g, and a small square of POX and SOD activity were given in relation to the dry A. dealbata litter (1 dm2) presented variable weights between weight of the sample. 10 and 25 g. For further biochemical analyses, only L. multiflorum and Malondialdehyde Content Lipid peroxidation was deter- T. subterraneum seedlings were included, as these species mined by estimating the malondialdehyde (MDA) con- were unique in providing enough plant material to adequately tent using the method of Hodges et al. (1999). Seedling replicate measurements of antioxidant enzymatic activities material (0.2 g) was ground in a cold mortar with N2, and MDA content. homogenized in 3 ml 80 % EtOH, and centrifuged at 3000 g for 10 min at 4 °C. To 1 ml aliquot of the supernatant we added 1 ml of either: (i)—thiobarbituric Biochemical Measurements acid (TBA solution), comprised of 20 % TCA (w/v) and 0.01 % butylated hydroxitoluene or (ii)+TBA solution Antioxidant Enzymatic Activities Superoxide dismutase and containing the above plus 0.65 % TBA. The samples POX activities were spectrophotometrically measured. After thenweremixedvigorouslyandheatedat95°Cfor harvesting, seedling tissues were frozen immediately (-80 °C) 25 min. They were cooled rapidly in an ice bath direct- until activities were measured. For both enzymes, samples ly afterwards. After cooling and centrifugation at 3000 g were prepared identically by grinding fresh material (0.2 g) for 10 min, the absorbance of the supernatant was read Author's personal copy

JChemEcol at 440, 532, and 600 nm. Malondialdehyde equivalents treatment (95 %), and also in the litter and mix (93 and 81 %, were calculated as follows: respectively). Parallel to Gt results, flowers in L. multiflorum and flowers, leaves, and mix in A. dealbata significantly A ¼ ½ŠðÞÀAbs þ ÀAbs þ ðÞAbs − ÀAbs − 532 TBA" 600 TBA 532 TBA 600 TBA reduced S and AS indices. In addition, litter also reduced S

B ¼ ðÞÂAbs440þTBAÀAbs600þTBA 0:0571 and AS in T. subterraneum. CRG results were variable among the different plant species. MDAequivalentsðÞ¼ nmol=mL ðÞÂA−B=157000 106 Seedling development was severely affected by the pres- ence of volatiles from A. dealbata (Fig. 2). Acacia dealbata seeds seemed to be the most affected by the presence of Statistical Analyses The results of total germination, germi- VOCs. In fact, we found that flowers, leaves, and mix nation indices, radicles and stem length, aboveground and completely inhibited radicle and stem elongation. belowground biomass, POX, SOD, and MDA levels were Consequently, there was no biomass of stems and radicles in subjected to a two-way analysis of variance (ANOVA) in A. dealbata seedlings. The remaining species also were se- order to examine the between-subject effects of independent verely affected by treatments, particularly by VOCs released variables (species and treatment). One-way ANOVAwas ap- from A. dealbata flowers. Flowers had significantly decreased plied to identify the effects of treatments on each independent radicle and stem length in T. subterraneum (85 and 31 %, variable, and significant differences were inferred from a respectively) and M. sativa (90 and 53 %, respectively). probability level of 0.05 %. Multiple comparisons of means Radicles and stem biomass also were drastically decreased were carried out using the Tukey test as the post-hoc test. All in both T. subterraneum (86 and 30 %, respectively) and in data were previously subjected to the Kolmogorov–Smirnov M. sativa (89 and 42 %, respectively). Although not statistically (K-S) test for normality and Levene’stesttocheck analyzed, we also observed an inhibition of secondary root homocedasticity in the variances. Correlation level between formation and a reduction in the presence of root hairs in measured variables was assessed using the Pearson’scorrela- T. subterraneum. Furthermore, seedlings affected by volatiles tion coefficient. All statistical analyses were carried out using from the mix treatment had noticeable root tip oxidation. the SPSS v.19 (Chicago, Illinois) software for Windows. Flowers completely inhibited radicle and stem growth in L. multiflorum seedlings (100 %). In this case, the above- ground and belowground biomasses also were drastically reduced (100 %). Results In the mix, where flowers were present, a reduction also was causedinthegrowthofradiclewithareductioninbiomass.The Bioassay Results Germination, morphological, and oxidative decrease in root length was highly significant for L. multiflorum stress parameters measured in the assay significantly varied (57 %), T. subterraneum (73 %), and M. sativa (74 %). The for the independent variables (species, treatments) and some diminution in radicle biomass also was significant for the three of them in their mutual interactions (Table 1). In addition, species (in the same order, 71, 47, and 90 %). The mix treatment almost all studied parameters were severely affected by VOCs reduced the length of stems in L. multiflorum (45 %) similarly released from the different treatments. reducing stem biomass (42 %). The mix treatment also decreased

Total germination (Gt) was significantly reduced in the stem biomass in M. sativa (37 %). L. multiflorum and A. dealbata seeds (Fig. 1). In The release of volatiles from leaves produced remarkable

L. multiflorum, VOCs from flowers drastically reduced Gt results. After the exposure to A. dealbata leaves, the growth of with respect to the control (74 %). Furthermore, total germi- radicles did not decrease significantly; however, the biomass of nation of A. dealbata also was severely reduced in the flower roots was reduced in L. multiflorum (56 %), T. subterraneum

Table 1 F – statistics of two-way ANOVA of the effects of the indepen- germination, biometrical and biochemical variables. Asterisks represent dent variables species (T. subterraneum and L. multiflorum)andtreat- significant differences at level: *P≤0.05, **P≤0.01 and ***P≤0.001 ments (flowers, leaves, litter and mix), and their interactions on

Germination Radicle length Stem length Radicle biomass Stem biomass Lipid peroxidation POX activity SOD activity

df F df F df F df F df F df F df F df F

Species 1 38.9*** 1 20.3*** 1 814.4*** 1 213.8*** 1 656.5*** 1 2.4 1 28.8*** 1 0.7 Treatment 4 1.6 4 15.9*** 4 12.54*** 4 72.8*** 4 16.6*** 4 16.9*** 4 2.7** 4 7.7 Species x treatment 3 1.4 3 5.8* 3 17.7*** 3 1.9 3 0.7 3 0.4 3 3.9* 3 2.2 Author's personal copy

JChemEcol

Fig. 1 Mean of a) total Control Flowers Leaves Litter Mix germination (Gt), b) speed of a) b) germination (S), c)speedof 100 15 a accumulated germination (AS), a a 80 aba 12 a and d) coefficient of the rate of ab ab a b germination (CRG) for the 60 9 different species after the S a a a exposure to VOCs from Acacia (%)Gt 40 b 6 a a a dealbata. Bars represent standard b b 20 bc 3 b b error (SE). Asterisks represent c b significant differences between 0 0 treatments in one-way ANOVA, c) d) with Tukey used as the post-hoc 50 a a 20 a a a a test (*** P≤0.001; ** P≤0.01; b b b 40 abb 16 a a a b * P≤0.05) b a a a a 30 12 a a a

AS a 20 a a CRG 8 b 10 b 4 b b 0 0 Lolium Trifolium Medicago Acacia Lolium Trifolium Medicago Acacia

(20 %), and M. sativa (67 %). Finally, under the exposure to exposure to single flowers (205 %) or in combination with the VOCs released from litter, species showed irregular responses. mix(150%)(Fig.3). The mix treatment also produced a signif- Stem biomass was significantly increased in L. multiflorum icant increase in the MDA content in L. multiflorum (144 %). (53 %) while radicle biomass was reduced (24 %). In Antioxidant enzymatic activities showed variable re- M. sativa, a rise in aerial biomass was also found (77 %), sponses. The activity of POX in T. subterraneum seedlings without significant alterations in stem length. At the same time, was significantly increased in flowers (38 %) and litter (57 %). the litter increased the length of radicles in T. subterraneum Flower treatment reduced the activity of SOD in (35 %) and decreased the length of the stems (21 %), without T. subterraneum (46 %) and leaf treatment slightly increased effects on biomass. SOD activity in L. multiflorum (12 %).

Antioxidant System Responses VOCs released from flowers Identification of VOCs Volatile isolates from different completely inhibited the growth of A. dealbata and A. dealbata materials were analyzed by GC and GC/MS. L. multiflorum, so it was unfeasible to carry out biochemical Flower, leaf and litter isolates had different compositions, both measurements on these seedlings. Malondialdehyde content in qualitatively and quantitatively (Table 2). Volatile isolates of T. subterraneum seedlings was enhanced dramatically after the A. dealbata had a total of 67 different compounds, 27 of them

Fig. 2 Percentage (%) with Flowers Leaves Litter Mix respecttothecontrolofa)radicle length, b)stemlength,c)radicle 150 50 biomass, and, d) stem biomass of a) b) 100 25 the different species after the 0 50 ** exposure to VOCs from Acacia -25 dealbata. Asterisks represent 0 * length (%) -50 ** significant differences between -50 *** -75 ** treatments in one-way ANOVA, ** -100 *** * lengthStem (%) *** * -100 with Tukey as the post-hoc test Radicle *** *** *** *** *** -150 *** -125 *** (*** P≤0.001; ** P≤0.01; *** * P≤0.05)

50 c)150 d) 25 100 (%) ** 0 ** 50 -25 * * 0 -50 biomass biomass *** -50 -75 *** ** ** * * * *** ** -100 -100 *** *** *** Stem *** *** *** *** *** *** Radicle biomass Radicle biomass (%) -125 *** -150 ***

Lolium Trifolium Medicago Acacia Lolium Trifolium Medicago Acacia Author's personal copy

JChemEcol

Fig. 3 Mean of a)MDA Control Flowers Leaves Litter Mix equivalents, b) SOD activity, c) b) POX activity for Trifolium a) 1 - 750 100 subterraneum and Lolium 1 * multiflorum after the exposure to - *** VOCs from Acacia dealbata. 75 Bars represent standard error 500 * ** (SE). Asterisks represent ** 50 significant differences between dry weight) 250 treatments in one-way ANOVA, fresh weight) 25 with Tukey as the post-hoc test (*** P≤0.001; ** P≤0.01; activity(EU · g SOD

MDA equivalentsMDA (µmol ·g 0 0 * P≤0.05) T. subterraneum L. multiflorum T. subterraneum L. multiflorum c) 200 -1 ** 160 *

120

80 dry weight) 40 POXactivity (EU · g 0 T. subterraneum L. multiflorum were found in flowers, 41 in the leaves, and 31 in the litter. the action of VOCs released from flowers has been identified These compounds represent, respectively, 90.1, 81, and previously in other species, such as in Antirrhinum majus 87.2 % of the whole composition of the isolates. (Horiuchi et al. 2007). The release of VOCs with phytotoxic From the entire set of VOCs identified, 9 were common to effects related to invasive processes takes place in multiple the three isolates. Flowers had lower VOCs diversity. In fact, a ways; including the foliar tissues (Eom et al. 2006), roots (Ens high proportion of the flower isolate (62 %) is represented by et al. 2009), or even the litter (Inderjit et al. 2011). four compounds: heptadecadiene (22.9 %), n-nonadecane Our results suggest that the emission of VOCs from flowers (18.9 %), n-tricosane (10.9 %), and octadecene (9.3 %). could have important ecological consequences on plant Regardless of the low diversity, twelve compounds were growth under A. dealbata canopies, and also on their own found exclusively in the isolate from flowers: hexadecene, development. Recently, the soils invaded by A. dealbata were n-hexadecane, heptadecene, hexadecenal, n-octadecane, reported to have positive effects on germination of octadecene, octadecenal, n-eicosane, kaurene, manool, n- A. dealbata, while increasing mortality of other plant species docosane, and n-tetracosane, representing 20 % of the isolate. (Rodríguez-Echeverría et al. 2013). Additionally, changes in Leaves had the highest diversity of compounds; however, phytochemistry produced by A. dealbata are probably respon- phytol represented almost half of the sample composition sible for the variable effect on its own seeds and seedlings (44.3 %), and the remaining components were present at under laboratory conditions (Lorenzo and Rodríguez- lower proportions (<7 %). Twenty-two compounds were ex- Echeverría 2012; Rodríguez-Echeverría et al 2013). Lorenzo clusively found in the isolate from leaves. In the litter isolate, et al. (2010) even referred to auto-stimulation of A. dealbata compounds with the highest proportion were heptadecadiene seeds after the exposure to its own leachates. In contrast, our (16.1 %), globulol (12.3 %), n-nonadecane (7.4 %), and results suggest exactly the opposite. Seed germination and the aromadendrene (6.8 %). Additionally, ten compounds were development of young seedlings of A. dealbata in invaded found exclusively in the litter (Table 2). areas seem to be severely influenced by the liberation of VOCs. Ecologically, this fact may have profound implica- tions. Under A. dealbata, the vast majority of new individuals are asexually produced and our results indicate that the release Discussion of VOCs from flowers could be favoring this recruitment. Along with the severe reduction on seedling growth pa- Different plant materials were assayed from Acacia dealbata. rameters, VOCs from A. dealbata also affected oxidative Among them, VOCs from flowers produced the strongest stress parameters. VOCs released from A. dealbata materials interference on the growth of the target species. Even though modified the activity of antioxidant enzymes in the target there is little literature, inhibition of growth parameters due to species. Increased levels of H2O2 and proline, together with Author's personal copy

JChemEcol

Table 2 Volatile compounds identified in the isolates from Acacia dealbata flowers leaves and litter

RI * RIb Compound Flowers % Leaves % Litter % Id. method n.d. n.d. Hexanal - 1.1 - MS n.d. n.d. Heptanal - - 0.1 MS 800 800 Octane - 1.2 - MS / RI n.d. n.d. E-2-Hexenal - 0.2 - MS n.d. n.d. 3-Hexen-1-ol - 0.8 - MS n.d. n.d. Hexanol - 0.9 - MS n.d. n.d. Heptanal - 1.2 - MS / RI 900 900 Nonane - 0.2 - MS / RI 929 1030 α-Pinene - 5.3 0.5 MS / RI 946 n.d. Heptanol - 1.0 - MS 968 1118 β-Pinene - 1.4 - MS / RI 977 n.d. Octanal - 0.4 - MS / RI 996 1171 α-Phellandrene - 0.2 - MS / RI 1004 n.d. Benzyl alcohol - 0.2 - MS / RI 1007 n.d. Phenylacetaldehyde - 0.6 - MS / RI 1018 1215 1.8-Cineole - 0.5 5.0 MS / RI 1029 n.d. 2-Octenal - 0.9 - MS 1055 n.d. 1-Octanol 0.5 0.4 0.6 MS / RI 1081 1392 Nonanal 2.5 6.8 2.5 MS / RI 1119 1647 E-Pinocarveol - - 1.3 MS / RI 1124 1648 Z-Verbenol - 0.2 - MS / RI 1133 1563 Pinocarvone - 0.2 0.7 MS / RI 1144 1695 Borneol - - 0.8 MS / RI 1553 n.d. Nonanol - 0.2 - MS 1168 1692 α-Terpineol - - 0.8 MS / RI 1183 1494 Decanal - 1.9 0.9 MS 1235 n.d. 2-Decenal * - 0.4 - MS 1286 n.d. Undecanal 0.3 - 1.1 MS 1386 n.d. E-α-Damascone - 0.3 - MS / RI 1386 n.d. 2-Undecanone - - 0.7 MS 1406 1592 E-Caryophyllene 0.2 0.5 0.6 MS / RI 1426 1600 Aromadendrene - 0.3 6.8 MS / RI 1446 1636 allo-Aromadendrene - - 0.8 MS / RI 1463 1702 Germacrene D 0.6 0.3 1.0 MS / RI 1481 1684 Ledene - - 1.3 MS / RI 1488 n.d. Tridecanal - 0.2 - MS 1500 1500 Pentadecane 0.7 0.2 - MS / RI 1505 1751 δ-Cadinene 0.2 - 0.8 MS / RI 1560 2063 Globulol - 0.4 12.3 MS / RI 1576 n.d. Hexadecene 0.8 - - MS 1600 1600 Hexadecane 0.3 - - MS / RI 1673 n.d. 8-Heptadecene - 0.7 - MS 1677 1719 Heptadecadiene * 22.9 - 16.1 MS 1688 n.d. Heptadecene * 0.9 - - MS 1698 n.d. Pentadecanal 1.1 0.3 1.3 MS 1700 1700 n-Heptadecane 5.6 0.2 3.2 MS / RI 1770 n.d. Hexadecenal * 1.2 - - MS 1795 n.d. Hexadecanal - 0.2 1.0 MS 1800 1800 Octadecane 0.7 - - MS / RI Author's personal copy

JChemEcol

Table 2 (continued)

RI * RIb Compound Flowers % Leaves % Litter % Id. method

1826 n.d. Hexahydrofarnesyl acetone 0.8 0.2 2.0 MS / RI 1868 n.d. Heptadecenal * - 0.1 4.2 MS 1873 n.d. Heptadecanal - - 3.3 MS 1878 n.d. Octadecene * 9.3 - - MS 1882 n.d. 2-Heptadecanone - 3.2 - MS 1905 1901 n-Nonadecane 18.9 0.3 7.4 MS / RI 1961 n.d. Palmitic acid 0.5 2.5 - MS 1975 n.d. Octadecenal * 2.7 - - MS 1998 2019 n-Eicosane 1.9 - - MS / RI 2007 n.d. Kaurene * 0.8 - - MS 2017 n.d. Abietatriene - - 0.6 MS / RI 2024 n.d. Manool 0.2 - - MS / RI 2052 n.d. Abietadiene - - 1.3 MS / RI 2099 2093 n-Heneicosane 4.2 - 1.8 MS / RI 2109 n.d. Phytol - 44.3 - MS / RI 2198 2193 n-Docosane 0.3 - - MS / RI 2301 2296 n-Tricosane 10.9 0.5 5.0 MS / RI 2398 2392 n-Tetracosane 1.1 - - MS / RI Aliphatic compounds 88.1 68.1 52.6 Monoterpene hydrocarbons 6.9 0.5 Oxygen containing monoterpenes 1.0 8.6 Sesquiterpene hydrocarbons 1.0 1.0 11.3 Oxygen containing sesquiterpenes 0.4 12.3 Diterpenes 1.9 Other compounds 1.0 3.6 Total identified 90.1 81 87.2

RIa retention indice on a SPB-1 column, RIb retention indice on a supelcowax 10 column, MS mass spectroscopy (GC-MS), n.d not determined. *Correct isomer not identified a generalized rise in antioxidant enzymatic activities also have kaurene diterpenoids are compounds with diverse biological been reported after the exposure to VOCs from the invasive activities. In fact, allelopathic effects of senescent needles of Ageratina adenophora (Zhang et al. 2012c). Besides the Araucaria angustifolia were related to the presence of ent- alteration in antioxidant enzymatic activities, the increased kaurene (Braine et al. 2011). Another ent-kaurene diterpenoid, levels of MDA in seedlings after the exposure to VOCs from leukamenin E, previously has been shown to have phytotoxic A. dealbata flowers suggest the occurrence of lipid membrane effects on root growth and root hair development of lettuce damage (Zhang et al. 2012c). seedlings (Ding et al. 2008). The isolate of volatiles from Differences between treatments in germination, early leaves had a high proportion of phytol, which at high quanti- growth, and oxidative stress may be related to the differential ties previously has shown insecticidal activity (Cruz-Estrada composition and proportions of the cocktail of VOCs in each et al. 2013). It also contained representative quantities of α- plant material and to the target plant. The high proportions of pinene (5.3 %), which inhibited root growth and caused heptadecadiene, n-nonadecane, octadecene, and n-tricosane in oxidative damage in root tissue through the enhanced gener- the essential oils from flowers could be responsible for the ation of ROS (Singh et al. 2006). To assess the independent inhibitory responses. However, identifying single phytotoxic effect of the major compounds and to identify key compounds activity of the known compounds can be difficult (Barney responsible for the inhibitory effects of VOCs from flowers, et al. 2005). The elevated percentage of aliphatic compounds further research, including dose–response curves for each in the isolates from flowers in comparison to the leaves and compound, would be necessary. litter may contribute to the inhibition shown (Ghayal et al. Summarizing knowledge from recent works, a trade-off 2011). In addition, a small percentage of the volatile isolate between soil changes, microbial relationships, and phyto- was kaurene (0.8 %) (correct isomer not identified), and ent- chemistry seem to be influencing the germination of all Author's personal copy

JChemEcol species in the novel conditions established by the invader. Carballeira A, Reigosa MJ (1999) Effects of natural leachates of Acacia – However, the relative importance of each variable in the dealbata link in Galicia (NW Spain). Bot Bull Acad Sinica 40:87 92 invasive process remains partially unexplored and requires Casal JF, Reigosa MJ, Carballeira A (1985) Allelopathic potential of further research under field conditions. Complementary to Acacia dealbata Link. | [Potentiel allelopathique de Acacia dealbata the effects on seeds and early growth, it also would be desir- Link]. Rev Écol Biol Sol 22:1–12 able to investigate the physiological effects of VOCs emitted Chou CH (1999) Roles of allelopathy in plant biodiversity and sustain- able agriculture. Crit Rev Plant Sci 18:609–636 during the flowering period on mature plant species living Cruz-Estrada A, Gamboa-Angulo M, Borges-Argáez R, Ruiz-Sánchez E under the A. dealbata canopy. Therefore, the autotoxic and (2013) Insecticidal effects of plant extracts on immature whitefly phytotoxic effects of VOCs from A. dealbata seem clear but Bemisia tabaci genn. (Hemiptera: Aleyroideae). Electron J more information is required to prove that the composition of Biotechno 16 (1) – Ding L, Qi L, Jing H, Li J, Wang W, Wang T (2008) Phytotoxic effects of surrounding species in the field natives but also their own leukamenin E (an ent-kaurene diterpenoid) on root growth and root seedlings – is influenced by A. dealbata through the release of hair development in Lactuca sativa L. seedlings. J Chem Ecol 34: VOCs. 1492–1500 In summary, in this study, the VOCs released from Dudareva N, Pichersky E, Gershenzon J (2004) Biochemistry of plant volatiles. Plant Physiol 135:1893–1902 A. dealbata material, mainly from flowers, caused a reduction El-Sayed AM (2012) The pherobase: database of pheromones and of total germination. Seedling growth parameters were severe- semiochemicals ly reduced for all species included in the assay, and mainly on Ens EJ, Bremner JB, French K, Korth J (2009) Identification of volatile A. dealbata seedlings. In addition, oxidative stress and mem- compounds released by roots of an invasive plant, bitou bush (Chrysanthemoides monilifera spp. rotundata), and their inhibition brane damage is suggested as due to the increase in POX of native seedling growth. Biol Invasions 11:275–287 activity and MDA content in T. subterraneum and Eom SH, Yang HS, Weston LA (2006) An evaluation of the allelopathic L. multiflorum. Some of the volatiles released from flowers potential of selected perennial groundcovers: foliar volatiles of have known phytotoxic effects, and this coupled with the catmint (Nepeta×faassenii) inhibit seedling growth. J Chem Ecol 32:1835–1848 germination and early growth results strengthens the hypoth- Ghayal NA, Dhumal KN, Deshpande NR, Ruikar AD, Phalgune UD esis that VOCs from A. dealbata may be influencing the (2011) Phytotoxic effects of leaf leachates of an invasive weed germination and seedling growth of their own seeds and Cassia uniflora and characterization of its allelochemical. Res J – native species in natural conditions. This appears to be the Pharm Biol Chem Sci 2:524 534 González-Muñoz N, Costa-Tenorio M, Espigares T (2012) Invasion of first evidence of the phytotoxic effects of VOCs released from alien Acacia dealbata on Spanish Quercus robur forests: impact on A. dealbata flowers. soils and vegetation. Forest Ecol Manag 269:214–221 Heiser I, Oßwald W, Elstner EF (1998) The formation of reactive oxygen species by fungal and bacterial phytotoxins. Plant Physiol Bioch 36: 703–713 Hodges DM, Delong JM, Forney CF, Prange RK (1999) Improving the thiobarbituric acid-reactive-substances assay for estimating lipid References peroxidation in plant tissues containing anthocyanin and other in- terfering compounds. Planta 207:604–611 Horiuchi JI, Badri DV, Kimball BA, Negre F, Dudareva N, Paschke MW, Acree T, Arn H (2004) Gas chromatography-olfactometry (GCO) of Vivanco JM (2007) The floral volatile, methyl benzoate, from natural products. In: Flavornet and human odor space, Sponsored snapdragon (Antirrhinum majus) triggers phytotoxic effects in by DATU Inc., http://www.fla vornet.org Arabidopsis thaliana.Planta226:1–10 Adams RP (2007) Identification of essential oil components by gas Hussain MI, Gonzalez-Rodriguez L, Reigosa MJ (2008) Germination and chromatography/mass spectrometry, 4th edn. Allured Publishing growth response of four plant species to different allelochemicals Corporation, Carol Stream and herbicides. Allelopathy J 22:101–110 Arimura GI, Kost C, Boland W (2005) Herbivore-induced, indirect plant Inderjit EH, Crocoll C, Bajpai D, Kaur R, Feng Y-L, Silva C, Treviño defences. BBA Mol Cell Biol L 1734:91–111 Carreón J, Valiente-Banuet A, Gershezon J, Callaway RM (2011) Bailly C (2004) Active oxygen species and antioxidants in seed biology. Volatile chemicals from leaf litter are associated with invasiveness of Seed Sci Res 14:93–107 a neotropical weed in Asia. Ecology 92:316–324 Barney JN, Hay AG, Weston LA (2005) Isolation and characterization of Joulain D, Koning WA (1998) The atlas of spectral data of sesquiterpene allelopathic volatiles from mugwort (Artemisia vulgaris). J Chem hydrocarbon. B. Verlag, Hamburg Ecol 31:247–265 Karban R (2007) Experimental clipping of sagebrush inhibits seed ger- Beauchamp CO, Fridovich I (1971) Superoxide dismutase: improved mination of neighbours. Ecol Lett 10:791–797 assays and an assay applicable to acrylamide gels. Anal Biochem Kessler A, Baldwin IT (2001) Defensive function of herbivore- 44:276–287 induced plant volatile emissions in nature. Science 291:2141– Berenbaum MR (1995) The chemistry of defence: the theory and prac- 2144 tice. Proc Natl Acad Sci U S A 92:2–8 Kotze MJ, Jürgens A, Johnson SD, Hoffmann JH (2010) Volatiles asso- Braine JW, Curcio GR, Wachowicz CM, Hansel FA (2011) Allelopathic ciated with different flower stages and leaves of Acacia cyclops and effects of Araucaria angustifolia needle extracts in the growth of their potential role as host attractants for Dasineura dielsi (Diptera: Lactuca sativa seeds. J For Res 17:440–445 Cecidomyiidae). S Afr J Bot 76:701–709 Callaway RM, Maron JL (2006) What have exotic plant invasions taught Lin CC, Kao CH (2000) Effect of NaCl stress on H2O2 metabolism in rice us over the past 20 years? Trends Ecol Evol 21:369–374 leaves. Plant Growth Regul 30:151–155 Author's personal copy

JChemEcol

Linstrom PJ, Mallard WG (2003) NIST chemistry webbook, NIST stan- Pichersky E, Noel JP, Dudareva N (2006) Biosynthesis of plant volatiles: dard reference database number 69. National Institute of Standards nature’s diversity and ingenuity. Science 311:808–811 and Technology, Gaithersburg, 20899 Reinhard J, Srivivasan MV, Zhang S (2004) Olfaction: scent-triggered Lorenzo P, Rodríguez-Echeverría S (2012) Influence of soil microorgan- navigation in honeybees. Nature 427:411–411 isms, allelopathy and soil origin on the establishment of the invasive Rodríguez-Echeverría S, Afonso C, Correia M, Lorenzo P, Roiloa SR Acacia dealbata. Plant Ecol Divers 5:67–73 (2013) The effect of soil legacy on competition and invasion by Lorenzo P, Pazos-Malvido E, Reigosa MJ, González L (2010) Acacia dealbata link. Plant Ecol 214:1139–1146 Differential responses to allelopathic compounds released by the Runyon JB, Mescher MC, De Moraes CM (2006) Volatile chemical cues invasive Acacia dealbata Link (Mimosaceae) indicate stimulation of guide host location and host selection by parasitic plants. Science its own seed. Aust J Bot 58:546–553 313:1964–1967 Lorenzo P, Palomera-Pérez A, Reigosa MJ, González L (2011) Sheppard AW, Shaw RH, Sforza R (2006) Top 20 environmental Allelopathic interference of invasive Acacia dealbata Link on the weeds for classical biological control in Europe: a review of physiological parameters of native understory species. Plant Ecol opportunities, regulations and other barriers to adoption. 212:403–412 Weed Res 46:93–117 Lorenzo P, Pazos-Malvido E, Rubido-Bará M, Reigosa MJ, González L Singh HP, Batish DR, Kaur S, Arora K, Kohli RK (2006) α-Pinene (2012) Invasion by the leguminous tree Acacia dealbata inhibits growth and induces oxidative stress in roots. Ann Bot 98: (Mimosaceae) reduces the native understorey plant species in dif- 1261–1269 ferent communities. Aust J Bot 60:669–675 Thelen GC, Vivanco JM, Newingham B, Good W, Bais HP, Landres P, Lorenzo P, Pereira CS, Rodríguez-Echeverría S (2013) Differential im- Caesar A, Callaway RM (2005) Insect herbivory stimulates allelo- pact on soil microbes of allelopathic compounds released by the pathic exudation by an invasive plant and the suppression of natives. invasive Acacia dealbata Link. Soil Biol Biochem 57:156–163 Ecol Lett 8:209–217 Marsili R (2001) Flavor, fragrance, and odor analysis, vol. 115. CRC Press Upadhyaya A, Sankhla D, Davis TD, Sankhla N, Smith BN (1985) Effect Maslin B (2001) Introduction to acacia. In: Orchard AE, Wilson AJ (eds) of paclobutrazol on the activities of some enzymes of activated Flora de Australia, mimosaceae, acacia part 1, vol 11A. ABRS, oxygen metabolism and lipid peroxidation in senescing soybean Canberra/CSIRO Publishing, Melbourne, pp 3–13 leaves. J Plant Physiol 121:453–461 Mclafferty H (2009) Wiley registry of mass spectral data 9th/NIST 08. Zhang F, Guo J, Chen F, Liu W, Wan F (2012a) Identification of volatile Mass spectral library compounds released by leaves of the invasive plant croftonweed Meloni DA, Olive MA, Martinaze CA, Cambaia J (2003) Photosynthesis (Ageratina adenophora, Compositae), and their inhibition of rice and activity of superoxide dismutase, peroxidase and glutathione seedling growth. Weed Sci 60:205–211 reductase in cotton under salt stress. Environ Exp Bot 49:69–76 Zhang RM, Zuo ZJ, Gao PJ, Hou P, Wen GS, Gao Y (2012b) Allelopathic Muller CH (1966) The role of chemical inhibition (allelopathy) in vege- effects of VOCs of Artemisia frigida Willd. on the regeneration of tational composition. Bull Torrey Bot Club 93:32–351 pasture grasses in Inner Mongolia. J Arid Environ 87:212–218 Perriot R, Breme K, Meierhenrich UJ, Carenini E, Ferrando G, Baldovini Zhang F, Chen F, Liu W, Guo J, Wan F (2012c) ρ-Cymene inhibits N (2010) Chemical composition of French mimosa absolute oil. J growth and induces oxidative stress in rice seedling plants. Weed Agric Food Chem 58:1844–1849 Sci 60:564–570 Chapter 2 Ambient has become strained

Chapter 3 Antioxidant responses

Chapter 3. Antioxidant responses of Cytisus scoparius (L) Link to different extracts of the invasive Acacia dealbata Link

Souza-Alonso, P., G. Puig, C., González, L., 2014. Antioxidant responses of Cytisus scoparius (L) Link to different extracts of the invasive Acacia dealbata Link. Currently under review in Plant Physiology and Biochemistry.

Chapter 3 Antioxidant responses

Chapter 3 Antioxidant responses

1. Introduction

Plants have developed large coevolved relationships with their neighbors and have different communicative ways to relate with their surrounding environment, which includes not only other plants but also soil microbial and invertebrate communities (Bais et al., 2004). Interference in the functioning of the system, the “how it works”, takes place when an exotic plant species enters in a new habitat (Lorenzo, 2010). Within numerous traits that promote plant invasion, the presence of novel molecules in the environment is often suggested as one of the most important factors contributing to invasion success (Lorenzo et al., 2011; Novoa et al., 2013). Invasive plants often hold novel molecules that, acting as phytotoxins, can disturb local function and provide advantages in competition with native species (Callaway and Aschehoug, 2000; Bais et al., 2003). Indeed, the presence of these “novel weapons” has been identified as a major component in the invasiveness process (Kim and Lee, 2010; Inderjit et al., 2011). The effects produced by these novel molecules have been detected at molecular, structural, biochemical, physiological and ecological levels of plant organization (Gniazdowska and Bogatek, 2005). Within the wide range of effects induced by allelochemicals, production of reactive oxygen substances (ROS) and related oxidative stress in general have been proposed as key mechanisms in the action of phytotoxins (Weir et al., 2004). Reactive oxygen - - species such as superoxide (O2 ), hydrogen peroxide (H2O2) and hydroxyl radicals (OH ) are produced during response to allelopathic stress (Singh et al., 2006; Ding et al., 2007; Mutlu et al., 2011). The presence of these compounds in the intracellular matrix can affect lipid peroxidation, protein metabolism, membrane permeability, can even damage DNA, and can finally lead to programmed cell death when ROS achieve critical levels (Ding et al., 2007). To scavenge the toxic effects of ROS, plants have developed a complex antioxidant defense system including the accumulation of antioxidant compounds, such as proline, ascorbate, malonate, ascorbic acid, glutathione, tocopherols and carotenoids (Lee et al., 2001) but also through the presence of enzymatic antioxidant systems (Atici and Nalbantoğlu, 2003; Kang et al., 2003). Antioxidant enzymes are essential components in the scavenging system of ROS and reduce their harmful effects. The principal enzymes involved in the defense are superoxide dismutases (SOD) and peroxidases (Bailly, 2004). Superoxide dismutase (SOD) is the first line of defense, since it is a major scavenger of O2- and its enzymatic action results in the formation of H2O2. Once its action has been carried out, H2O2 is metabolized to H2O by peroxidase (POX) and

Chapter 3 Antioxidant responses catalase (CAT) (Willekens et al., 1997), so these enzymes provide tolerance to plants against biotic and abiotic stresses. Besides the role as a sensitive indicator of environmental stress, POX activity level in plants has also been suggested as a marker of allelopathic stress (Singh et al., 2006; Ding et al., 2007). A better understanding of the effects produced by allelochemicals can be achieved through the measurement of common physiological processes such as germination, seedling or radicle growth (Lorenzo et al., 2008; 2011; Hussain et al., 2011) in combination with the quantification of seed oxidative stress (Singh et al., 2006; Ding et al., 2007; Mutlu et al., 2011). As a general statement, allelochemicals are secondary metabolites, which, once released into the environment, reach another plant through soil solution (González, 2004). Therefore, the best evidence for allelopathy should include knowledge of natural concentrations and rates of allelochemicals in the soil solution, so it is essential to carefully match the natural concentrations of allelochemicals (Inderjit and Callaway, 2003). The quantification of soil extract concentrations in allelopathy bioassays provides a useful tool in distinguishing between allelopathic or phytotoxic effects caused by the novel molecules introduced into the ecosystem. However, in the search for allelopathic relationships, the natural concentration of allelochemicals in invaded soils has rarely been quantified in bioassays (Ens et al., 2009; Cantor et al., 2011). Acacia is one the main invasive genus and includes some of the most important plant invaders globally (Richardson and Rejmánek, 2011; Richardson et al., 2011). Within the Acacia genus, one of the main aggressive species is Acacia dealbata Link. Invasive traits that characterize this species are widely described in Lorenzo et al. (2010a). Together with fast growth, massive seed production and active re-growth after fire, frost and cutting, allelopathy is suggested as a powerful tool contributing to its invasive potential (Carballeira and Reigosa, 1999; Lorenzo et al., 2011). To our knowledge, a broad range of effects have been collected in A. dealbata invasions; including the reduction on plant diversity (Fuentes-Ramírez et al., 2010; Lorenzo et al., 2012), modification of soil nutrients (Lorenzo et al., 2010b) and the alteration of decomposition processes (Castro-Díez et al., 2012), together with seed bank alteration (González- Muñoz et al., 2012), modifications in microbial community structure (Lorenzo et al., 2010b) and function (Lorenzo et al., 2013; Souza-Alonso et al., unpublished data). Additionally, the production and release of allelochemicals has been suggested as a trait promoting the invasiveness of A. dealbata (Carballeira and Reigosa, 1999; Lorenzo et al., 2008; 2011; 2013). However, the mechanisms by which these chemicals produce damages on target plants remain unexplored. Moreover, no studies concerning the possible oxidative damage caused by A. dealbata on native species have been carried out. Previous findings indicated to us that the non-polar extracts of

Chapter 3 Antioxidant responses

A. dealbata were the most phytotoxic fraction applied at natural concentrations on L. sativa (Souza-Alonso, unpublished results). As a consequence, the presented study was designed to test the effects of non-polar fractions of A. dealbata soil, roots and flowers on a native shrub; Cytisus scoparius L. Native to Western Europe, this leguminous shrub is also an aggressive invader worldwide (Cronk and Fuller, 1995; Isaacson, 2000). In this region, both A. dealbata and C. scoparius are successful pioneer species after disturbances such as land abandonment, fire or highway construction (personal observation). Therefore, we are interested in the effect produced by A. dealbata chemistry on a species that occupies similar ecological niches and thus, obtained results will be more ecologically relevant. We hypothesize that A. dealbata should cause a decrease on germination and oxidative damage during the initial growth of C. scoparius seeds. This fact could contribute to success at early stages of plant competition. To test our hypothesis we measured different physiological, biometrical and biochemical parameters such as total germination and germination indices, radicle and hypocotyl length, seedling fresh and dry weights, lipid peroxidation, H2O2 level, soluble protein content and the antioxidant enzymes peroxidase (POX, EC 1.11.1.7) and superoxide dismutase (SOD, EC 1.15.1.1).

2. Material and methods

2.1. Site location and sampling In March 2012, soil and plant material were collected in an invaded area of the O Ribeiro Region (latitude, 42° 18′ 18″ N, longitude 8° 10′ 18″ W, Galicia, NW Spain). The sampling date was chosen according to the peak of the flowering period of A. dealbata (Lorenzo et al., 2010a). This period is suggested as the most allelopathic period of A. dealbata (Carballeira and Reigosa, 1999). In this area, three different shrublands, which are heavily invaded by Acacia dealbata, were selected. These invaded patches were separated by at least 100 m and were mainly dominated by Ulex europaeus L., Pterospartum tridentatum L., Calluna vulgaris (L.) Hull, Erica umbellata Loefl. ex L. and Erica cinerea (L.), with the presence of the genuses Cistus and Cytisus. At each invaded shrubland, three different A. dealbata materials were collected to prepare the extracts: soil, roots and flowers. In each patch, soil underneath of at least 10 mature A. dealbata plants and within 15 cm around live roots (maximum 20 cm in depth) was collected using a hand shovel. Live roots (0.2-1 cm diameter) from 10 mature A. dealbata plants were identified within the first 30 cm from plant origin and collected. Flowers from apical inflorescences of at least 10 mature plants were also

Chapter 3 Antioxidant responses collected and pooled. Soil, roots and flowers from the three invaded areas were pooled apart in plastic bags, and carried to the laboratory for further processing.

2.2. Extraction procedure Once in the laboratory, fresh material was processed as follows: soil was sieved through a 2 mm mesh, then homogenized and directly used in the extraction procedure. Soil adhered to the roots was carefully removed and then roots were chopped into small pieces (<1cm). Flowers were also detached from the inflorescence. The extraction procedure was carried out following Ens et al. (2009), with slight modifications. Soil (500 g), A. dealbata roots (250 g), and flowers (250 g) were included in the process. The weight of soil and plant material was selected according to an ecologic and equitable criterion. We include, approximately, the weight that can be influencing a small number of seeds in the field; i.e. the amount of included soil comprises 1 dm3, a volume in which we can find several seeds. Each natural material was independently placed in a 2L Erlenmeyer flask where dichloromethane (DCM) and acetone were sequentially added by increasing polarity (DCM

Chapter 3 Antioxidant responses

3000 ppm (w/w weight of dry residue/weight of original material used). Maximum weights of dry residues (3000 ppm) were selected as reference values since our objective is to evaluate potential effects of A. dealbata. Further interpretation of the results obtained was carried out by categorizing the single or combined effects of soil, roots and flowers of the same extract in order to distinguish between allelopathic or phytotoxic effects (Ens et al., 2009). To provide evidence for allelopathy, significant effects of soil extracts on C. scoparius must be accompanied with significant results produced by the same extracts from roots or flowers. In the cases in which significant effects were exclusively collected in the extracts from roots or flowers but without significance in the equivalent extract from soil these results will be referred as phytotoxic. If significant alterations on C. scoparius seeds were exclusively produced by soil extracts, the effects will be classified as indirect soil effects.

2.3. Bioassay design Prior to the application in the bioassay, pH of each solution was recorded with the use of pH meter (MicropH 2000, Crisom). Both DCM and acetone dry extracts were previously dissolved in DCM to achieve a concentration of 3000 ppm (parts of extract/million parts of solvent). Five replicates for each treatment were prepared in plastic dishes (3.5 cm diameter) fitted with filter paper. DCM and acetone extracts from soil, roots and flowers were applied, allowing the organic solvent to evaporate for at least 30 min in a fume hood chamber. Ten seeds of C. scoparius equally distanced were placed in each replicate and 0.7 ml of distilled water was added. Plates were sealed with parafilm to prevent evaporation and placed in a growth chamber at 20 ± 1°C in darkness conditions. Control plates using distilled water instead of A. dealbata extracts were adequately prepared. Additionally, another 5 replicates with distilled water in which DCM had previously been applied and evaporated were also established to test whether DCM presence had a masking effect on germination and seedling growth (Ens et al. 2009). C. scoparius seeds were acquired in Herbiseed and maintained at 4°C before the start of the assay. Seeds were sterilized in a sodium hypochlorite solution (1%) for 5 min and then profusely rinsed in distilled water.

2.4. Germination and biometric measurements: Germination was recorded daily and after 15 days, total germination (Gt), hypocotyl and radicle length, fresh and dry weights were monitored. These parameters are accepted as indirect measurements of other physiological processes affected by chemical interaction (Macías et al., 2000). Seeds were considered germinated only

Chapter 3 Antioxidant responses after the radicle had protruded beyond the seed coat by at least 1 mm. As described in Hussain et al. (2008), three germination indices were also calculated because of their common use in germination studies: speed of germination (S), speed of accumulated germination (AS) and coefficient of the rate of germination (CRG). For dry weight estimation, seedlings were placed in an oven at 70 °C for 72 h. Biochemical analyses: we arranged a number of plates in excess to test the effects of A. dealbata extracts on oxidative stress parameters of C. scoparius. Seeds were disposed as described above for biometric measurements. Four replicates were established for each biochemical parameter and extract tested. After 5 days of incubation, hydrogen peroxide (H2O2) levels, lipid peroxidation, soluble protein determination and antioxidant enzymatic activities were measured.

The hydrogen peroxide (H2O2) content was measured as described in Aroca et al. (2003). The level of lipid peroxidation was determined by estimating the malondialdehyde (MDA) content using the method of Hodges et al. (1999). The protein content of the extracts was determined according to Bradford (1976), using bovine serum albumin (BSA) as a standard reference. Superoxide dismutase (SOD) and peroxidase (POX) samples were identically prepared. Fresh material (0.2 g) was ground with the use of liquid N2 in a mortar and pestle. Powdered material was homogenized in 3 ml 50 mM HEPES-KOH buffer (pH 7.8) with 0.1 mM EDTA. Samples were then centrifuged at 15000 g for 15 min at 4 °C. The supernatant was used to determine both POX and SOD activities and it was stored at -80 °C until analysis. POX activity was measured by monitoring the increase in absorbance at 470 nm for 7 min in 50 mM phosphate buffer (pH 5.5) containing 1 mM guaiacol and 0.5 mM H2O2. One unit of POX activity was defined as the amount of enzyme that caused an increase in absorbance of 0.01 per minute (Upadhyaya et al., 1985). SOD activity was estimated by recording the decrease in absorbance of nitro blue tetrazolium (NBT) by the enzyme, according to the method of Beauchamp and Fridovich (1971) modified by Sanchez-Moreiras (2004). The values of POX and SOD activity are given in relation to the dry weight of the sample.

2.5. Statistical analyses The collected data was statistically analyzed using the Student t-test and significant differences were inferred from 0.05% probability level. Prior to statistical analyses, data normality and the homogeneity of variances were checked by Kolmogorov-Smirnov test (K-S test) and Levene´s test, respectively. Pearson‟s correlation was carried out to assess the linear relationship between measured variables. All tests were performed using SPSS v19.0 Software (SPSS Inc., Chicago, IL, USA).

Chapter 3 Antioxidant responses

3. Results pH was significantly reduced in all extracts assayed compared with control, mainly in the DCM fraction where pH values of soil, root and flower extracts were reduced in more than one unit (Table 1). The decrease in pH even suffered a severe drop of 2 units (from 6.16 to 4.15) in the flower extract (see also Table 1).

Table 1. The pH values Solvent Extract pH (mean ± SE, n=3) of A. Distilled water 6.16 ± 0.032 dealbata extracts with control values (distilled Soil 5.10 ± 0.043*** water). Asterisk means DCM Roots 4.95 ± 0.034***

a significant difference Flowers 4.15 ± 0.037***

according to the Soil 5.44 ± 0.035*** Student‟s t test (* Acetone Roots 5.34 ± 0.032*** P≤0.05, ** P≤0.01 and *** P≤0.001). Flowers 5.92 ± 0.055***

Germination and biometric measurements: After 15 days, contrasting effects were collected in Gt (Fig. 1). Soil DCM extract caused a significant rise in Gt (+41%; P≤0.001) whereas acetone roots extract produced a significant reduction (-35%; P≤0.001). As in Gt, soil DCM extracts were the most active promoting the increase in S (129%; P≤0.01) and AS (304%; P≤0.001) with acetone soil extract also increasing S (80%; P≤0.01) and AS (164%; P≤0.001) in a significant way. No significant alterations were recorded in CRG.

60 ***** 40 DCM Soil Acetone Soil

20 Acetone Roots

(%) DCM Roots

t 0 G DCM Flowers Acetone Flowers -20 -40 *****

150 ** 400 *** 120 320

* ***

90 240 AS S *** 60 160 30 80 0 0

Chapter 3 Antioxidant responses

Figure 1. Total germination (Gt) and germination indices S, and AS after the exposure to DCM and acetone extracts. Results are represented in percentage (%) with respect to

the control. Positive results indicate stimulation whereas negative results indicate inhibition. Asterisks indicate significant differences according to the Student‟s t test for independent two samples (* P≤0.05, ** P≤0.01 and *** P≤0.001).

DCM and acetone extracts invariably increased radical and hypocotyl length of treated seeds (Fig. 2). Radicles of C. scoparius were generally enhanced in a rank between 25-90%; however, the significant increase was uniquely related to the DCM fraction, particularly to the soil and roots extracts. The lengths of hypocotyls were generally enhanced (between 10-60%), however the soil DCM fraction uniquely produced significant effects (P≤0.01). Seedling biomass and the ratio FW/DW (fresh weight/dry weight) showed irregular trends but in neither case seedling biomass was significantly affected after the exposure to A. dealbata extracts

100 ** ) 80 a) % b) DCM Soil

(%) 80 * 60 DCM Roots *

60 length( DCM Flowers

ength l 40 40 Acetone Soil Acetone Roots 20 20 Radicle Radicle Acetone Flowers 0 Hypocotile 0

Figure 2. Radicle length (a) and hypocotyl length (b) of C. scoparius seedlings after the exposure to DCM and acetone extracts. Results are represented in percentage (%) with respect to the control. Positive results indicate stimulation whereas negative results indicate inhibition. Asterisks indicate significant differences according to the Student‟s t test for independent two samples (* P≤0.05, ** P≤0.01 and *** P≤0.001).

Biochemical analyses: After 5 days, soluble protein content in C. scoparius seeds was considerably enhanced (Fig. 3). DCM and acetone extracts significantly increased protein levels by more than 40%, reaching almost 60% in soil (57%; P≤ 0.001) and roots (56%; P≤ 0.001) acetone extracts. Hydrogen peroxide was significantly enhanced in DCM extracts of soil and roots, whereas acetone extracts showed no significant effects on H2O2 content. Malonaldehyde values were generally diminished but not in a significant manner, with the exception of the decrease produced by acetone soil extracts (70%; P≤0.05).

Chapter 3 Antioxidant responses

30 40

1 -

DW ) DW *** ***

1 25 - *** *** ***

g 30 mol x g x mol

20 μ (

mgx ( 15 20

) DW 10 content 10 * 5 equivalents

Protein 0 MDA 0

12

DW ) DW ***

1 Control - *** 9

xg DCM Soil

mol mol DCM Roots

μ ( 6 Control DCM Flowers DCM Soil AcetoneSoil 3 content DCM Roots

2 AcetoneRoots O 2 DCM Flowers AcetoneFlowers H 0 AcetoneSoil AcetoneRoots Figure 3. Total protein content (a), hydrogen peroxideAcetone levelsFlowers (b), and malondialdehyde (MDA) levels (c) after the exposure to DCM and acetone extracts. Asterisks significant differences according to the Student‟s t test for independent two samples (* P≤0.05, **

P≤0.01 and *** P≤0.001).

Antioxidant enzymatic activities of C. scoparius seeds showed variable results after the exposure to A. dealbata extracts (Fig. 4). Acetone soil extracts enhanced POX values by almost reaching double control values (91%; P≤0.05), whereas the remaining extracts did not produce a significant effect on POX activity. Superoxide dismutase activity was generally enhanced under DCM fractions, significantly in the flowers extract (26%; P≤0.05), whereas acetone fractions showed variable trend. A general absence or weak significant correlations were found between physiological and biochemical parameters (Table 2). Nevertheless, as expected, Gt and germination indices were highly significantly correlated. Results related to germination and biometric measurements are mostly included in indirect soil effects since soil extracts have shown the highest activity (Table 3). However, results collected in biochemical parameters are mainly included in the allelopathic effects, given the fact that significant alterations produced by the soil extracts were also collected after the application of roots, flowers or both extracts. In none of the measured parameters, both biometrical and biochemical, were significant differences between water and DCM controls shown (data not shown).

Chapter 3 Antioxidant responses

1

1

0.05 0.05

.32 .05 .22 .07 .23 .29 .15 .20 .14 .22 .06 .0 0 0 0 0 SOD - - 0 0 - 0 0 0 - 0 0 0

accumulated accumulated 1 0.20 0.17 0.09 0.04 0.19 0.09 0.32 POX - - - - 0.42* 0.05 0.13 - 0.08 - -

.

1 0.03 0.09 0.25 0.21 0.28 0.03 0.22 0.18 0.09 0.13

, speed of

Lipid P Lipid ------

, , fresh weight/dry weight; AS

2 1 O 2

FW/DW 0.33 0.01 H - 0.34 0.25 0.26 0.11 0.46* 0.37 - 0.12

1 0.06 0.13

Prot. 0.15 - 0.08 0.09 - 0.36 0.06 0.04

1 0.16 0.14 0.07 0.08 0.26

FW/DW - - - - - 0.25 0.54**

, , hypocotyl length; , , speed of germination;

S

. L. .

1 Hyp. Hyp. L. 0.51* 0.07 Hyp - - 0.28 0.33 0.32 0.43*

1

, superoxidedismutase 0.31

L. Rad. - 0.32 0.33 0.34 0.01 SOD

total total germination;

t

1

, , radicles length; G 0.22 CRG - 0.34 0.43* 0.49**

Rad. Rad. L

, , peroxidase; 1 AS

0.15

- 0.86** 0.99** POX

1 S

0.01 0.92**

t

1 G 0.02

1

peroxidation; , lipid pH

)

LipidP.

coefficient of the rate of germination;

dry weight dry

1 -

g sons´ sons´ bivariate correlations between measured variables. Asteriskmeans significant correlation: * significant correlationat

CRG dry weight) dry dry weight) dry

1 1 - - dry dry weight) dry weight) dry

mol· (mm)

1 Pear 1

-

-

µ

(

(mm)

.

(mg·g

(mol·g , , content; protein

(U·g (U·g

2

(%)

O

t 2

pH G S AS CRG L. Rad. L. Hypoc. FW/DW Prot. H P Lipid POX SOD

Table 2. level; ** significant correlation at 0.01 germination; level. Abbreviations: Prot.

Chapter 3 Antioxidant responses

A.

- - - - - P A I.A I.A I.A I.A Effect

between

Flowers 0.839 0.388 0.192 0.284 0.110 0.686 0.272 0.000*** 0.105 0.862 0.598 0.191

allelopathy; I.A=indirect

, speed of accumulated

, fresh weight/dry weight; AS

Acetone

Roots 0.041* 0.884 0.174 0.982 0.112 0.563 0.435 0.000*** 0.598 0.971 0.194 0.861 FW/DW

Soil 0.855 0.048* 0.000*** 0.550 0.139 0.385 0.366 0.000*** 0.144 0.023* 0.001** 0.408

ocotyl ocotyl length;

, speed of germination;

, hyp S

- - - - P A A A A I.A I.A I.A Effect Hyp. L.

dismutasesuperoxide ,

Flowers 0.717 0.109 0.001** 0.772 0.210 0.221 0.312 0.091 0.310 0.089 0.108 0.035*

SOD total total germination;

t

G

, radicles length;

DCM Rad. L Roots 0.949 0.630 0.292 0.329 0.017* 0.181 0.826 0.000*** 0.003** 0.972 0.396 0.071

peroxidase; ,

POX

Soil 0.037* 0.009** 0.000*** 0.328 0.012* 0.046* 0.845 0.000*** 0.002** 0.204 0.486 0.446

= = no effect. Abbreviations: -

, lipid peroxidation; peroxidation; lipid ,

LipidP.

dry weight ) weight dry

1

-

coefficient coefficient of the rate of germination;

dry weight) dry

1 - dry weight) dry mol· g

CRG 1 µ - ( dry dry weight) dry weight) dry

(mm) 1 1

(mg·g -

- extracts extracts and distilled water controls according to the Student’s t test; *P≤0.05; **P≤0.01; ***P≤0.001. A=

(mm)

. Combined effect of extracts on measured variables following Ens et al. (2009). Asterisks represent significant differences

(mol·g (U·g (U·g

, protein content; content; protein , 2 (%)

O

ble 3 t 2

G S AS CRG L. Rad. L. Hypoc. FW/DW Proteins H Perox. Lip. POX SOD

Ta dealbata allelopathy; P=phytotoxic effect, germination; Prot.

Chapter 3 Antioxidant responses

Control 2000 * 100 *

DCM Soil DW)

DW) 80

1 1 - 1 DCM Roots

- 1500

60 DCM Flowers (EU x g (EUx (EU xg (EU 1000 Acetone Soil 40

AcetoneRoots activity activity 500 20 Acetone Flowers

POX SOD 0 0

Control 2000 * 100 *

DCM Soil DW) DW) 80

1 - 1 DCM Roots - 1500 Figure 4. Peroxidase (POX) (a) and Superoxide Dismutase

(SOD) (b) activities after60 the exposure to DCM and acetone DCM Flowers (EU x g (EUx (EU xg (EU 1000 extracts. Asterisks indicate significant differences according to Acetone Soil the Student‟s t test for independent40 two samples (* P≤0.05, **

AcetoneRoots activity activity 500 P≤0.01 and *** P≤0.001). 20 Acetone Flowers

POX SOD 0 0

4. Discussion

The influence of pH in bioassays is critical because inadequate pH can provoke abiotic stress in terrestrial plants (Pedrol et al., 2006). In our assay, the reduction in values of pH, due to the drawing of organic acids, together with the variable set of chemical compounds after extraction, was according to data previously found (pH ≈ 4-6) in A. dealbata branches and canopy leachates (Lorenzo et al., 2011). Despite the variability found in pH values between control and DCM and acetone extracts, pH by itself did not seem to be responsible for the differences in biometrical and biochemical parameters. In fact, pH was invariably and significantly reduced for all DCM and acetone extracts, however the effects produced by these extracts were highly variable. Moreover, correlation results do not suggest a linking effect between pH and physiological and biochemical parameters. In contrast, chemical composition of the extracts seems to be responsible for the alteration in physiological and biochemical parameters. Recent studies indicated the presence of negative effects in germination and physiological parameters under the exposure to leachates of A. dealbata and related species, such as A. melanoxylon (Lorenzo et al., 2008; 2011; Hussain et al., 2011). In our assay, extracts applied at concentrations, as we found in invaded soils, have followed different trends. Usually, bioassays to elucidate the fate of allelochemicals include susceptible species as target species as L. sativa or A. thaliana (Carballeira and Reigosa, 1999; Lorenzo et al., 2008; Hussain et al., 2011; Kato-Noguchi et al.,

Chapter 3 Antioxidant responses

2014), so a hard coat seed such as C. scoparius probably presents less sensitivity to A. dealbata allelochemicals. In addition, sensitivity to allelochemicals is highly variable since plant responses are generally species and concentration dependent (Norsworthy, 2003; Singh et al., 2006; Hussain et al., 2008). In addition, allelochemicals reach target plants through soil solution (González, 2004), but the presence of a hard coat in C. scoparius, as in other legumes, probably offers a protective layer which reduces the absorption of allelochemicals due its key role in water uptake (Gresta et al., 2011). Not only the hard coat but the antioxidant capacity of C. scoparius due to phenolic content can be protecting seeds from the oxidative damage (Ângelo et al., 2009). The inclusion of a strong competitor of A. dealbata during early stages of land disturbances that is also putatively allelopathic (Grove et al., 2012) and occupies similar ecological niches provide more realistic information regarding the effect of invasive-native plant chemical interaction. Nevertheless, further research including a broad range of plant species should be interesting to discriminate between sensitive and non-sensitive species. The increase in germination parameters, mainly Gt, S and AS was especially evident in the soil DCM extracts. Besides the enhancement of Gt, results from S and AS indicated acceleration in the germinative process. S index was a useful tool, better revealing what occurred during the germination process than Gt, and perhaps more accurate than AS and CRG (Chiapusio et al., 1997). In fact, S index is more sensitive as an indicator of allelopathic effects (Ahmed and Wardle, 1994). In our case, S and AS provided parallel information about how germination is affected by A. dealbata extracts. Due to the severe increase in both indices, mainly in soil extracts, a probable effect of indirect allelopathy could be suggested. Soil extracts increased the number of germinated seeds but also the period in which the germination process took place. As a consequence of oxidative stress, malondialdehyde is produced when polyunsaturated fatty acids in the membrane undergo peroxidation, and its concentration is routinely used as an index of lipid peroxidation under stress conditions (Katsuhara et al., 2005). Consequently, low levels of MDA compared with controls can be an indicator related to an absence of membrane damage. Antioxidant enzymatic activity was not according to H2O2 levels. A general enhancement in SOD activity is the - initial defense against O2 , and its transformation entails an enhancement in H2O2. Therefore, we expected to find higher activity of SOD particularly in the DCM fraction, but correlation was clearly absent. When H2O2 is accumulated, POX metabolizes it into

H2O to avoid cell damage; however, POX levels were not correlated with H2O2. In fact, POX activity uniquely suggests a possible effect of oxidative stress in soil acetone extracts. The general absence of differences in POX levels compared to controls,

Chapter 3 Antioxidant responses

despite the increased level of H2O2 in DCM treatments, gave evidence that oxidative stress was not generally noticeable in C. scoparius seeds due to the application of A. dealbata extracts. The increase in soluble protein content suggests a probable enhancement in protein metabolism; hypothetically, C. scoparius seeds are investing in radicle and hypocotyl elongation instead in reducing oxidative stress level. In general, protein metabolism is negatively influenced after the exposure to allelochemicals (Einhellig, 1996; Baziramakenga et al., 1997; Singh et al., 2009); however, it was found that at certain levels, some allelochemicals stimulate protein synthesis (Inderjit and Nayyar, 2002; Terzi et al., 2003; Al Sherif and Gharieb, 2011; Shahbazi et al., 2011). Nevertheless, the increased soluble protein content produced by A. dealbata extracts was not reflected on seedlings biomass. Extracts of A. dealbata seemed to exert differential effects depending on the original plant material and solvent polarity. Through the inclusion of different solvents during the extractive process, the nature of compounds obtained is highly variable between extracts due to their range of polarities (Ens et al., 2009). Therefore, the variability reflected in the results can be related to the expected differential composition of extracts. As a result of their wide origin, most of the compounds suggested as allelochemicals are characterized as multisite active compounds that may interfere with various physiological processes of a target plant and their activity cannot be explained by just a single mode of action (Gniazdowska and Bogatek, 2005). This differential mode of action is clearly reflected in the multiple effects recorded on C. scoparius seeds after exposure to A. dealbata extracts (Table 3). Soil, roots and flowers either dissolved in DCM or in acetone seem to present different composition or proportions of allelochemicals since the effects collected showed high variability with signicant effects. Nevertheless, the key role of soil extracts is strongly suggested since physiological and biochemical changes (classified as phytotoxic, allelopathic or indirectly allelopathic) collected in our assay were mainly produced by soil extracts. The extensive root system of A. dealbata could be a driving force in the soil effects collected in our assay. Due to its extensiveness, A. dealbata roots occupy a huge soil space, both superficial and in depth and has previously been suggested as an inhibitor of new plant establishment (González-Muñoz et al., 2012). Furthermore, the root system of A. dealbata is in constant development and dead root material is directly incorporated into the organic soil matter. As a result, the A. dealbata root system creates an environment in which root degradation products, the natural release and accumulation of exudates and their alteration through biotic or abiotic processes, might be responsible for the soil effect obtained in our assay. The identification of indirect soil

Chapter 3 Antioxidant responses chemical effects are one of the advantages of comparing both soil and plant based extracts (Ens et al., 2009). Allelochemical toxicity is a multi-factorial process since it greatly depends on concentration, flux rates, age and the physiological stage of the plant, climate, season and environmental conditions (Gniazdowska and Bogatek, 2005). Additionally, soil microbial communities play an important role in plant-plant chemical interaction intensifying or weakening the allelopathic effect (Cipollini et al., 2012). In this case, we have not checked flux rates but the use of soil reference values ensure that the effects found in our assay are at real concentrations in a specific period of time. Here, the stimulation found could be explained by a well-known phenomenon: the hormetic response, described as biphasic dose-response relationships exhibiting low- dose stimulation and a high-dose inhibition (Calabrese and Baldwin, 2002). Biological activity of all compounds is strictly guided by their concentrations and, as a consequence, allelochemicals that exert negative effects at higher doses can produce positive responses at lower doses. Moreover, the range of stimulation found in our case is generally in accordance to the main accepted range suggested by the hormetic stimulatory response. In general, this range does not exceed twofold of the control with maximum responses 30-60% greater than controls (Calabrese and Baldwin, 2002). As a consequence, countered effects between our results and previous studies on physiological parameters using A. dealbata extracts and macerates (Lorenzo et al., 2008; 2011) could be due to the uncertain position that the concentration of compounds in DCM and acetone extracts occupies in the dose-response curve of A. dealbata allelochemicals. Additionally, it should be desirable to obtain a profile of chemical compounds released by A. dealbata that could be responsible for the effects collected; however, this quantification exceeds the objectives of this work. Even though the potential positive effects are held by the hormetic response, an early germination caused by chemical compounds in soil extracts could be ecologically harmful for native seeds. The flowering period is suggested as the most allelopathic period in A. dealbata phenology but it takes place between January and March at this latitude (Lorenzo et al., 2010a). Consequently, the flowering period assures the occurrence of chemicals with potential phytotoxic activity in soils under A. dealbata canopy. Allelopathic compounds could promote an early germination of surrounding species before environmental conditions are suitable to successful establishment. Harsh conditions may produce harmful effects on native seedlings when developed early, reducing competition and favoring A. dealbata success.

5. Conclusions

Chapter 3 Antioxidant responses

Contrary to our expectations based on previous results, the findings obtained suggest a slight stimulatory effect of A. dealbata extracts on physiological and biochemical parameters of C. scoparius. Soil extracted with DCM but also with acetone, appeared to be the most bioactive fraction. The use of plant extracts close to natural concentrations seems to be responsible for this apparent contradiction. Biochemical parameters indicated higher metabolic activity but low malondialdehyde content and the non-correlated levels in POX and SOD led us to think that chemicals from A. dealbata triggered slight oxidative stress in C. scoparius. Therefore, the reduction of biodiversity found under A. dealbata canopy seems to be unrelated with chemical compounds released by A. dealbata plant and soil.

Acknowledgements

We would like to thank the Xunta de Galicia for its financial support through the PGIDIT05RAG31001PR project.

References

Ahmed, M., Wardle, D.A., 1994. Allelopathic potential of vegetative and flowering ragwort (Senecio jacobaea L.) plants against associated pasture species. Plant Soil. 164:61-8. Al Sherif, E.A., Gharieb, H.R., 2011. Allelochemical effect of Trianthema portulacastrum L. on Amaranthus viridis L. supports the ecological importance of allelopathy. Afr. J. Agr. Res. 6, 6690-6697. Ângelo, L., Cristina, G., Ana, P.D., 2009. Antioxidant activity of extracts of Portuguese shrubs: Pterospartum tridentatum, Cytisus scoparius and Erica spp. J. Med. Plants Res. 3, 886-893. Aroca, R., Irigoyen, J.J., Sánchez-Díaz, M., 2003. Drought enhances maize chilling tolerance. II. Photosynthetic traits and protective mechanisms against oxidative stress. Physiol. Plantarum. 117, 540-549. Atici, Ö., Nalbantoğlu, B. 2003. Antifreeze proteins in higher plants. Phytochemistry. 64, 1187- 1196. Bailly, C., 2004. Active oxygen species and antioxidants in seed biology. Seed Sci. Res. 14, 93- 107. Bais, H.P., Vepachedu, R., Gilroy, S., Callaway, R.M., Vivanco, J.M., 2003. Allelopathy and exotic plant invasion: From molecules and genes to species interactions. Science. 301, 1377- 1380.

Chapter 3 Antioxidant responses

Bais, H.P., Park, S.W., Weir, T.L., Callaway, R.M., Vivanco, J.M., 2004. How plants communicate using the underground information superhighway. Trends Plant Sci. 9, 26-32. Baziramakenga, R., Leroux, G.D., Simard, R.R., Nadeau, P., 1997. Allelopathic effects of phenolic acids on nucleic acid and protein levels in soybean seedlings. Can. J. Bot. 75, 445- 450. Beauchamp, C., Fridovich, I., 1971. Superoxide dismutase: improved assays and an assay applicable to acrylamide gels. Anal Biochem. 44, 276-287. Bradford, M., 1976. A Rapid and Sensitive Method for the Quantitation of Microgram Quantities of Protein Utilizing the Principle of Protein-Dye Binding. Anal. Biochem. 72, 248-254. Calabrese, E.J., Baldwin, L.A., 2002. Defining hormesis. Human Exp. Toxic. 21, 91–97. Callaway, R.M., Aschehoug, E.T., 2000. Invasive plants versus their new and old neighbors: A mechanism for exotic invasion. Science. 290, 521-523. Cantor, A., Hale, A., Aaron, J., Traw, M.B., Kalisz, S., 2011. Low allelochemical concentrations detected in garlic mustard-invaded forest soils inhibit fungal growth and AMF spore germination. Biol. Invasions 13, 3015-3025. Carballeira, A., Reigosa, M.J., 1999. Effects of natural leachates of Acacia dealbata Link in Galicia (NW Spain). Bot Bull Acad Sinica. 40, 87-92. Castro-Díez, P., Fierro-Brunnenmeister, N., González-Muñoz, N., Gallardo, A., 2012. Effects of exotic and native tree leaf litter on soil properties of two contrasting sites in the Iberian Peninsula. Plant Soil. 350, 179-1991. Chiapusio, G., Sánchez, A.M., Reigosa, M.J., González, L., Pellissier, F., 1997. Do germination indices adequately reflect allelochemical effects on the germination process? J. Chem. Ecol. 23, 2445-2453. Cipollini, D., Rigsby, C.M., Barto, E.K., 2012. Microbes as targets and mediators of allelopathy in plants. J. Chem. Ecol. 38,714-727. Cronk, Q.C.B., Fuller, J.L., 1995. Plant invaders. Chapman & Hall, London. Ding, J., Sun, Y., Xiao, C.L., Shi, K., Zhou, Y.H., Yu, J.Q., 2007. Physiological basis of different allelopathic reactions of cucumber and figleaf gourd plants to cinnamic acid. J. Exp. Bot. 58, 3765-3773. Einhellig, F.A., 1996. Mechanism of action of allelochemicals in allelopathy. Agron. J. 88, 886- 893. Ens, E.J., French, K., Bremner, J.B., 2009. Evidence for allelopathy as a mechanism of community composition change by an invasive exotic shrub, Chrysanthemoides monilifera spp. Rotundata. Plant Soil. 316, 125-137. Fuentes-Ramírez, A., Pauchard, A., Marticorena, A., Sánchez, P., 2010. Relationship between the invasion of Acacia dealbata Link (Fabaceae: Mimosoideae) and plant species richness in south-central Chile. Gayana – Botanica. 67, 188-97. Gniazdowska, A., Bogatek, R., 2005. Allelopathic interaction between plants: Multi site action of allelochemicals. Acta Physiol. Plant. 27, 395-408.

Chapter 3 Antioxidant responses

González, L., 2004 Relaciones alelopáticas. In: Reigosa MJ, Pedrol N, Sanchez A (eds). La ecofisiología vegetal. Una ciencia de síntesis. Thomson, Madrid González-Muñoz, N., Costa-Tenorio, M., Espigares, T., 2012. Invasion of alien Acacia dealbata on Spanish Quercus robur forests: Impact on soils and vegetation. Forest Ecol Manag. 269, 214-221. Gresta, F., Avola, G., Onofri, A., Anastasi, U., Cristaudo, A., 2011. When does hard coat impose dormancy in legume seeds? Lotus and Scorpiurus case study. Crop Sci. 51, 1739-1747. Grove, S., Haubensak, K.A., Parker, I.M., 2012. Direct and indirect effects of allelopathy in the soil legacy of an exotic plant invasion. Plant Ecol 213, 1869-1882. Hodges, D.M., DeLong, J.M., Forney, C.F., Prange, R.K., 1999. Improving the thiobarbituric acid-reactive-substances assay for estimating lipid peroxidation in plant tissues containing anthocyanin and other interfering compounds. Planta. 207, 604-611. Hussain, M.I., Gonzalez-Rodriguez, L., Reigosa, M.J., 2008. Germination and growth response of four plant species to different allelochemicals and herbicides. Allelopathy J. 22,101-110. Hussain, M.I., González, L., Souto, C., Reigosa, M.J., 2011. Ecophysiological responses of three native herbs to phytotoxic potential of invasive Acacia melanoxylon R. Br. Agroforest Syst. 83,149-166. Inderjit, Nayyar, H., 2002. Shift in allelochemical functioning with selected abiotic stress factors. In: Inderjit, Mallik, AU (eds) Chemical Ecology of Plants: Allelopathy in Aquatic and Terrestrial Ecosystems, Birkhauser-Verlag. Inderjit, Callaway, R.M., 2003. Experimental designs for the study of allelopathy. Plant Soil. 256, 1–11. Inderjit, Evans, H., Crocoll, C., Bajpai, D., Kaur, R., Feng, Y-L., et al. 2011. Volatile chemicals from leaf litter are associated with invasiveness of a neotropical weed in Asia. Ecology 92,316- 324. Isaacson, D.L., 2000. Impacts of broom (Cytisus scoparius) in western North America. Plant Prot. Q. 15, 145–148.

Kang, G., Wang, C., Sun, G., Wang, Z., 2003. Salicylic acid changes activities of H2O2 metabolizing enzymes and increases the chilling tolerance of banana seedlings. Environ. Exp. Bot. 50, 9-15. Kato-Noguchi, H., Kobayashi, A., Ohno, O., Kimura, F., Fujii, Y., Suenaga, K., 2014 Phytotoxic substances with allelopathic activity may be central to the strong invasive potential of Brachiaria brizantha. J. Plant Physiol. 171, 525-530. Katsuhara, M., Otsuka, T., Ezaki, B., 2005. Salt stress-induced lipid peroxidation is reduced by glutathione S-transferase, but this reduction of lipid peroxides is not enough for a recovery of root growth in Arabidopsis. Plant Sci. 169,369-373. Kim, Y.O., Lee, E.J., 2010. Comparison of phenolic compounds and the effects of invasive and native species in East Asia: Support for the novel weapons hypothesis. Ecol. Res. 26, 87-94. Lee, D.H., Kim, Y.S., Lee, C.B., 2001. The inductive responses of the antioxidant enzymes by salt stress in the rice (Oryza sativa L.). Plant Physiol. 158, 735-747.

Chapter 3 Antioxidant responses

Lorenzo, P., Pazos-Malvido, E., González, L., Reigosa, M.J., 2008. Allelopathic interference of invasive Acacia dealbata: Physiological effects. Allelopathy J. 22, 452-461. Lorenzo, P. 2010. Invasion of Acacia dealbata Link: new perspectives on allelopathic process. European PhD Thesis. University of Vigo. Lorenzo, P., González, L., Reigosa, M.J., 2010a. The genus Acacia as invader: The characteristic case of Acacia dealbata Link in Europe. Ann. For. Sci. 67, 1-11. Lorenzo, P., Rodríguez-Echeverría, S., González, L., Freitas, H., 2010b. Effect of invasive Acacia dealbata Link on soil microorganisms as determined by PCR-DGGE. Appl. Soil Ecol. 44, 245-251. Lorenzo P, Palomera-Pérez A, Reigosa MJ, González L. Allelopathic interference of invasive Acacia dealbata Link on the physiological parameters of native understory species. Plant Ecol 2011;212:403–12. Lorenzo, P., Pazos-Malvido, E., Rubido-Bará, M., Reigosa, M.J., González, L., 2012. Invasion by the leguminous tree Acacia dealbata (Mimosaceae) reduces the native understorey plant species in different communities. Aust. J. Bot. 60, 669-675. Lorenzo, P., Pereira, C.S., Rodríguez-Echeverría, S., 2013. Differential impact on soil microbes of allelopathic compounds released by the invasive Acacia dealbata Link. Soil Biol. Biochem. 57, 156-163. Macías, F.A., Castellano, D., Molinillo, J.M.G., 2000. Search for a Standard Phytotoxic Bioassay for Allelochemicals. Selection of Standard Target Species. J. Agric. Food Chem. 48, 2512- 2521. Mutlu, S., Atici, Ö., Esim, N., Mete, E., 2011. Essential oils of catmint (Nepeta meyeri Benth.) induce oxidative stress in early seedlings of various weed species. Acta Physiol. Plant. 33, 943-951. Norsworthy, J.K., 2003. Allelopathic potential of wild radish (Raphanus raphanistrum). Weed Tech. 17, 307-313 Novoa, A., González, L., Moravcova, L., Pysek, P., 2012. Effects of soil characteristics, allelopathy and frugivory on establishment of the invasive plant Carpobrotus edulis and a co- occuring native, Malcolmia littorea. PLoS ONE 7, e53166. Pedrol, N., González, L., Reigosa, M.J., 2006. Allelopathy and abiotic stress. In: Reigosa, M.J., Pedrol, N., González, L. (eds). Allelopathy: a physiological process with ecological implications. Springer, The Netherlands. Richardson, D.M., Rejmánek, M., 2011. Trees and shrubs as invasive species - a global review. Divers. Distrib. 17, 788-809. Sanchez Moreiras, A., 2004. Whole plant stress response after BOA exposition. European PhD Thesis. University of Vigo. Shahbazi, A., Lotfi, M., Mostafavi, K., Asadian, G., Heidarian, A.R., 2011. Effect of Persian galbanum (Ferula gummosa L.) extract on seed germination and growth of some weeds. Afr. J. Agr. Res. 6, 5106-5111.

Chapter 3 Antioxidant responses

Singh, H.P., Batish, D.R., Kaur, S., Arora, K., Kohli, R.K., 2006. α-Pinene inhibits growth and induces oxidative stress in roots. Ann. Bot. 98, 1261-1269. Singh, A., Singh, D., Singh, N.B., 2009. Allelochemical stress produced by aqueous leachate of Nicotiana plumbaginifolia Viv. Plant Growth Regul. 58, 163-171. Terzi, I., Kocaçaliskan, I., Benlioglu, O., Solak, K.. 2003. Effects of juglone on growth Cucumber seedlings with respect to physiological and anatomical parameters. Acta Physiol. Plant. 25, 353-356. Upadhyaya, A., Sankhla, D., Davis, T.D., Sankhla, N., Smith, B.N., 1985. Effect of paclobutrazol on the activities of some enzymes of activated oxygen metabolism and lipid peroxidation in senescing soybean leaves. J. Plant. Physiol. 121, 453-461. Weir, T.L., Park, S.W., Vivanco, J.M., 2004. Biochemical and physiological mechanisms mediated by allelochemicals. Curr. Opin. Plant Biol. 7, 472-479. Willekens, H., Chamnongpol, S., Davey, M., Schraudner, M., Langebartels, C., Van Montagu,

M., et al. Catalase is a sink for H2O2 and is indispensable for stress defense in C3 plants. Embo. J. 16, 4806-4816.

Chapter 4 Soil and microbial alterations under A. dealbata

PART III Underground Effects

Chapter 4 Soil and microbial alterations under A. dealbata

Chapter 4 Soil and microbial alterations under A. dealbata

Chapter 4. Soil biochemical alterations and microbial community responses under Acacia dealbata Link invasion

Souza-Alonso, P., Novoa, A., González, L., 2014. Soil biochemical alterations and microbial community responses under Acacia dealbata Link invasion. Soil Biol. Biochem. 79, 100-108.

Chapter 4 Soil and microbial alterations under A. dealbata

Soil Biology & Biochemistry 79 (2014) 100e108

Contents lists available at ScienceDirect

Soil Biology & Biochemistry

journal homepage: www.elsevier.com/locate/soilbio

Soil biochemical alterations and microbial community responses under Acacia dealbata Link invasion

* Pablo Souza-Alonso a, , Ana Novoa a, b, Luís Gonzalez a a Department of Plant Biology and Soil Science, University of Vigo, 36310 Vigo, Spain b Centre for Invasion Biology, Department of Botany and Zoology, Stellenbosch University, Matieland 7602, South Africa article info abstract

Article history: A critical outcome of the invasive processes of exotic plants is the impact on soil microbial communities Received 30 September 2013 and chemical parameters. We studied the impact of Acacia dealbata on soils of mixed forests and Received in revised form shrublands. We hypothesized that A. dealbata can alter soil microbial community function and soil 2 September 2014 chemical profile in invaded ecosystems. Two sampling dates were selected depending on the pheno- Accepted 7 September 2014 logical stage of A. dealbata (vegetative vs. reproductive). Available online 19 September 2014 Soil chemical parameters were deeply modified in the invaded sites. Total C and N, P, K, Ca, Mg, NO3 þ and NH content and available P, were significantly higher in invaded soils of both mixed forests and Keywords: 4 Plant invasion shrublands. Soil microbial community activities were affected by the sampling date, soil type and Mixed forest ecosystem. Enzymatic activities mainly varied in soils collected during the vegetative stage of A. dealbata Shrubland in mixed forests and during both vegetative and reproductive stages in shrublands. Soils invaded by Soil chemistry A. dealbata showed increased acid phosphatase, b-glucosidase and N-acetyl glucosaminidase activities Microbial community function and the geometrical mean of these activities. Soil basal respiration was significantly reduced in invaded Enzymatic activities patches of mixed forests. Our results showed an alteration of soil chemistry and microbial community function related to A. dealbata presence, probably leading to acceleration in the decomposition and mineralization rates. © 2014 Elsevier Ltd. All rights reserved.

1. Introduction (Ehrenfeld, 2003; Liao and Boutton, 2008). Invasive plants also alter soil microbial composition, as they harbor different root-associated Natural species movements are a major force for bringing about microbial communities (Kourtev et al., 2002). New plantemicrobe ecosystem changes through “invasion” processes, since all species associations, together with the alteration on litter input, influence have spread into new territories at some point in their evolutionary the microbial community structure, which is strongly related to history (Sax et al., 2005) and overcome natural barriers (Lorenzo plant growth and vice versa (Bever, 2003). and Gonzalez, 2010). However, humans have changed all this. In Soil microbial communities release extracellular enzymes that the last decades, the term “biological invasion” has become allow them to access energy and nutrients present in complex increasingly relevant, directly related to the progression of hu- substrates, catalyzing the initial step of decomposition and nutrient mankind, which heightens invasive pressure on natural ecosystems mineralization (Allison and Vitousek, 2005). Moreover, decompo- and leads to the dispersion of non-native species at unprecedented sition rates should in principle be correlated with the activity of the rates (Ricciardi, 2007). enzymes responsible for degradation (Sinsabaugh, 1994). The Once the invader has settled, many effects have been collected functional capacity of these microbial communities varies among with variable magnitudes and directions (Weidenhamer and soils dominated by different plant species (Waldrop et al., 2000). Callaway, 2010; Vila et al., 2011). One of the main characteristics Nevertheless, there is a feedback between plant and microbial affected by the presence of non-native plants is the flux of litter, communities as the current vegetation is reflected in the range of mainly due to large amount of organic material deposition enzymatic activities of the soil microbial community (Kourtev et al., 2002). Therefore, microbial enzymes are fundamental components for the functionality of soil ecosystems. In fact, enzymatic activities * Corresponding author. Tel.: þ34 986 812 594; fax: þ34 986 812 556. can be used as a direct expression of the microbial community's E-mail address: [email protected] (P. Souza-Alonso). metabolic requirements and available nutrients, and provide a http://dx.doi.org/10.1016/j.soilbio.2014.09.008 0038-0717/© 2014 Elsevier Ltd. All rights reserved. P. Souza-Alonso et al. / Soil Biology & Biochemistry 79 (2014) 100e108 101 more comprehensive understanding of the key processes linking unedo L. in the warmest areas. Shrublands are mainly composed of microbial populations and nutrient dynamics (Sinsabaugh and Ulex europaeus L., Pterospartum tridentatum L., Erica umbellata Loefl. Moorhead, 1994). Due to their fast response to environmental Ex L., Erica cinerea L. and the scarce presence of the genuses Cistus condition changes and disturbances, enzymatic activities have been sp. and Cytisus sp. A total of six independent ecosystems were widely used as sensitive indicators of alterations in soil microbial chosen 100 m apart from each other. In each ecosystem (mixed function during invasive processes (Nannipieri et al., 1990; Allison forest or shrubland), we clearly differentiated two statuses: an et al., 2006; Joanisse et al., 2007) or litter decomposition (Waring, invaded patch, entirely occupied by A. dealbata more than 10 years 2013). old, and a non-invaded patch with native vegetation. Each sam- pling plot occupied an approximate area of 100 m2 (10 10 m). 1.1. Genus Acacia and Acacia dealbata Non-invaded plots were located contiguous to A. dealbata plots, within the first 5 m without A. dealbata presence. Invaded and non- Among invasive plants, Acacia is probably one of the most invaded plots had similar characteristics before A. dealbata problematic genuses outside its range of distribution; 23 species of invasion. acacias are currently defined as invasive plants (Richardson and Rejmanek, 2011). Acacia dealbata Link is an N-fixing tree native to 2.2. Soil sampling and chemical analyses Australia, widespread in New South Wales, Victoria and Tasmania (May and Attiwill, 2003) and currently considered as an invader in Soil collection was conducted in December 2010 (vegetative European Mediterranean-type ecosystems (Marchante et al., 2008; stage of A. dealbata) and March 2011 (reproductive stage of A. Celesti-Grapow et al., 2010; INPN, 2011; MARM, 2011), but also in dealbata). Soil for chemical analyses was collected in December other parts of the world such as South Africa (Richardson and 2010. A total of 10 samples (minimum, 1 m apart) of the topsoil Rejmanek, 2011) and South America (Fuentes-Ramírez et al., (0e20 cm) were randomly collected after litter removal in each 2010). A. dealbata shows a wide range of invasive traits such as invaded and non-invaded plot of each mixed forest and shrubland. rapid dispersal, fast sprouting, sexual and vegetative reproduction Soil samples were stored in polyethylene bags at 4 C(±2 C) in a or genetic plasticity (Alpert et al., 2000; Lorenzo et al., 2010a). The portable fridge and immediately taken to the laboratory. Soil presence of allelopathic compounds has also been suggested as a samples from the same origin were pooled to form a composite tool contributing to its spread, unbalancing competition with sample. Once in the laboratory, a part of each soil type was air dried native species mainly during the flowering period (Carballeira and at room temperature (72 h), passed through a 2 mm sieve and Reigosa, 1999; Lorenzo et al., 2011). Nevertheless, allelopathic subsequently used for chemical analyses. The other part was freshly compounds have been reported to exert a variable influence on sieved and kept at 4 C and used for biochemical analyses within microbial communities (Lorenzo et al., 2013a, b). A. dealbata is a 24 h after soil collection. good target species to explore alterations in soil microbial com- Soil pH was determined in a soil solution rate of 1:2.5 soil munity function because the wide range of effects resulting from its weight/water volume ratio in a Crison digital pH meter (Guitian- presence include alteration of soil elements as C, N or P (Lorenzo Ojea and Carballas, 1976). Total C and N content were estimated et al., 2010b), decomposition processes (Castro-Díez et al., 2012) after combustion at 1200 C of 0.1 g of soil samples using an LECO and microbial community structure (Lorenzo et al., 2010b). CNS-2000. Inorganic carbon was similarly determined after To our knowledge, only one study has been recently conducted removing organic matter (OM) by combustion at 550 C of 0.3 g of to assess the effects of A. dealbata on the soil microbial function of soil samples for 24 h. Inorganic carbon of all samples was <0.05%, so non-specific microbial groups (Lorenzo et al., 2013a). Therefore, the total carbon was considered as organic carbon. Total phosphorus, present study aims to determine the impact of A. dealbata invasion potassium, calcium and magnesium were extracted using on microbial activities. We are submitting a case of discussion of HCLeHNO3 after combustion (3 h, 550 C), followed by quantifi- one of the most problematic plant invaders in Europe from a new cation in the extract by inductively coupled plasma optical emission perspective: the assessment of microbial enzymatic activities and spectrometry (ICP-OES) in a Perkin Elmer Optima 4300 DV instru- soil basal respiration in invaded and non-invaded soils of mixed ment. Available phosphorus was extracted according to Jakmunee forests and shrublands. Additionally, measurements were taken at and Junsomboon (2009) and colorimetrically determined by the two different periods to evaluate the influence of the phenological Bray-Kurtz I method (Bray and Kurtz, 1945). Ammonia, NO3 and stage of A. dealbata. NO2 were analyzed according to Kempers (1974). For each soil parameter, five subsamples from each composite sample were 2. Methods taken for the analyses.

2.1. Site description and experimental design 2.3. Microbial community activity analyses

The study was conducted in an area in the region of O Ribeiro, in Two different measurements of the microbial community NW Spain (42180 1800N, 8 100 1800 W). Soils from this area are function were estimated: soil enzymatic activities (hereafter EAs) classified as umbrisols (Soil Atlas of Europe, 2005). This area is and soil basal respiration (SBR). All measurements were taken on characterized by a Mediterranean sub humid climate with Atlantic two sampling dates according to different phenological stages of trend, with mean annual temperature range values from 6.7 Cto A. dealbata. To allow the comparison of results, sampling dates with 18.0 C. The underlying material consisted of granite and granodi- similar atmospheric conditions were selected (e.g. temperature, orite rocks. Soils are typically acidic with sandy texture and contain rainfall). a high content of organic matter and low levels of nutrients. These Three enzymes directly involved in carbon (C), nitrogen (N) and soils are generally classified as umbrisols (European Commision, phosphorus (P) cycling were selected. We measured the C-degrad- 2005). ing enzyme, b-glucosidase (E.C. 3.2.1.21, hereafter BG), which acts in Two different ecosystems were clearly distinguished in the the decomposition of cellulose and other carbohydrate polymers; studied area: forest and shrubland. Selected forests are mainly the N-liberating enzyme N-acetyl-glucosaminidase (E.C. 3.2.1.50, dominated by Pinus pinaster Ait., forming mixed compositions with NAGase), implicated in chitin degradation; and acid phosphatase Quercus robur L., accompanied by Quercus suber L. and Arbutus (E.C. 3.1.3.2, AP), an enzyme involved in the release of P from organic 102 P. Souza-Alonso et al. / Soil Biology & Biochemistry 79 (2014) 100e108 matter. Due to their extensive presence in soils and key role in relationship between soil chemical and microbial parameters. decomposition process, these enzymes have previously been used to Correlation matrix was further analyzed through principal characterize the effects of plant invasions (Allison et al., 2006; Li component analysis (PCA) to represent the relationship of micro- et al., 2006; Joanisse et al., 2007). Using absorption spectropho- bial activity parameters (Soil basal respiration, EAs and GMea) tometry techniques after soil incubation with a specific substrate, between the invaded and non-invaded patches. All tests were enzymatic activity was quantified according to Allison and Vitousek performed using SPSS v19.0 Software (SPSS Inc., Chicago, IL, USA). (2005) as the amount of p-nitrophenol (PNP) produced. Under lab- oratory conditions, each sample was replicated four times and 3. Results averaged. The results of the activities were expressed as mmol p- 1 1 nitrophenol g dry soil h . For each sample, the geometric mean 3.1. Soil chemical analyses (GMea) of the assayed EAs was also calculated [GMea ¼ (AP 1/3 BG NAG) ]. This algorithm has previously been used to assess the Significant differences were found in the soil chemistry among effects of grazing (Prieto et al., 2011) or the recovery of polluted soils invaded and non-invaded soils in both shrubland and mixed forest (Hinojosa et al., 2004). Here, we used this algorithm to assess the (Table 1). All chemical parameters experienced a general general change in the global enzymatic activities of soils invaded enhancement under A. dealbata invasion with the exception of C:N with A. dealbata. ratio and pH values. Total C content was significantly higher in soils Soil basal respiration measurements were made in situ in invaded by A. dealbata, >45% in mixed forests (p < 0.001) and December 2010 (vegetative period) and March 2011 (reproductive >500% in shrublands (p < 0.001). Total N was also significantly period). Measurements were carried out as described in Pedrol higher in invaded soils. Nitrogen content in the invaded soils from et al. (2010), using a soil respiration chamber (Li-COR 6000-09) mixed forests duplicated N values in non-invaded soils (p < 0.001). connected to an infrared gas analyzer (Li-COR 6200). Six points Moreover, total N of invaded shrublands reached more than seven were randomly located in invaded and non-invaded patches of each times N values in the non-invaded soils (p < 0.001). In both mixed ecosystem. To take measurements, the litter layer was removed and forests and shrublands, changes in N where A. dealbata was present the soil surface was covered with a sheet paper for 20 min to avoid þ entailed a significant enhancement in NO2 ,NO3 ,NH4 contents, and fl direct light in uence and to stabilize soil conditions. During soil N:P (using total p values) ratio, and decreased the C:N ratio respiration measurements we recorded soil relative humidity, air (Table 1). Available (Pa) and total P, Ca, and Mg were also signifi- temperature, soil temperature and CO2 concentration. cantly higher in invaded soils of mixed forests (26%, 19%, 43% and 44%, respectively), and shrublands (21%, 152%, 690% and 766%, 2.4. Statistical analyses respectively). Additionally, the overall variation found in soil chemistry between non-invaded and invaded soils presented Enzymatic activities and GMea results were subjected to a remarkable differences. Changes in the soil chemistry of shrubland three-way analysis of variance (3-way ANOVA) in order to examine were more noticeable than those in the forest: 333% of variation the single and combined effects of the independent variables of the from native values, compared to around 90% in the forest. model (phenological stage, ecosystem and soil type). Data Pearson's correlation results for the pH, the main soil chemical normality and the homogeneity of variances were checked by elements (C, N and P), and microbial variables (EAs and SBR), KolmogoroveSmirnov test and Levene's test, respectively. If seemed to be similar for the invaded and non-invaded soils normality assumptions were satisfied, differences in the enzymatic (Table 2). The pH was negatively correlated with N and C. However, activities and soil basal respiration between invaded and non- in invaded soils, P was also found to be positively correlated with C invaded patches were evaluated by t-test. and N, and negatively with pH, whereas no correlations were found Soil basal respiration values obtained in the field were previ- in non-invaded soils. ously subjected to ANCOVA, using the measured ambient condi- tions (soil relative humidity, air temperature, soil temperature and 3.2. Soil microbial activities CO2 concentration) as covariables. Hence, soil respiration data were transformed according to significant variables and then submitted EAs responded differently to independent variables (Table 3); to ANOVA. Pearson's correlation was carried out to assess the linear the phenological stage, soil type and ecosystem significantly

Table 1 Mean (±SE) of soil chemical parameters in mixed forests and shrublands in December 2010. Asterisks represent significant differences between invaded and non-invaded zones t-test:* p < 0.05,**p < 0.01,*** p < 0.001.

Variables Mixed forests Shrublands

Non-invaded Invaded Non-invaded Invaded

pH 3.98 (±0.02) 4.07 (±0.02)** 5.33 (±0.01) 4.5 (±0.01)*** C (g/Kg) 187.63 (±2.72) 274.8 (±10.85)*** 30.97 (±0.09) 194.1 (±0.1)*** N (g/Kg) 7.03 (±0.18) 15.71 (±0.91)*** 1.58 (±0.01) 11.89 (±0.01)*** P (mg/kg) 371.58 (±9.53) 468.35 (±11.24)** 330.5 (±0.41) 400.5 (±0.42)***

Pavailable 73.83 (±1.77) 88.14 (±0.91)*** 27.58 (±0.03) 69.46 (±0.04)*** (mg/Kg) Ca (g/kg) 3.74 (±0.22) 5.35 (±0.06)*** 1.36 (±0.01) 10.76 (±0.004)*** K (g/kg) 3.63 (±0.57) 3.08 (±0.02) 1.3 (±0.003) 3.51 (±0.002)*** Mg (g/kg) 3.32 (±0.19) 4.8 (±0.07)*** 0.45 (±0.002) 3.9 (±0.035)*** NO2 (mg/kg) 0.21 (±0.01) 0.48 (±0.02)*** 0.57 (±0.001) 0.55 (±0.016) NO3 (mg/kg) 7.22 (±0.32) 46.94 (±4.75)*** 20.53 (±0.46) 74.15 (±0.28)*** þ NH4 (mg/kg) 27.23 (±0.81) 62.67 (±1.03)*** 15.78 (±0.15) 70.38 (±0.05)*** C:N 26.87 (±0.31) 18.28 (±0.34)*** 19.72 (±0.06) 16.33 (±0.01)*** N:P 19.17 (±0.88) 32.54 (±1.15)*** 4.77 (±0.01) 29.75 (±0.02)*** C:P 504.95 (±1.98) 586.74 (±3.01)** 93.70 (±0.14) 484.65 (±0.3)*** P. Souza-Alonso et al. / Soil Biology & Biochemistry 79 (2014) 100e108 103

Table 2 Bivariate correlations (Pearson correlation) between soil microbial parameters (italics) and main soil chemical parameters.** indicate significant correlation at 0.01 level;* indicates significant correlation at 0.05 level; n.s. ¼ no significant correlation. SBR ¼ soil basal respiration, AP ¼ acid phosphatase, BG ¼ b-glucosidase, NAGase ¼ N-acetyl- glucosaminidase.

SBR AP BG NAGase pH N C P

Non-invaded soils SBR 1.00 n.s. 0.64* n.s. 0.98** 0.98** 0.99** n.s. AP 1.00 0.72** 0.94** n.s. n.s. n.s. n.s. BG 1.00 0.66* 0.81** 0.69* 0.78* n.s. NAGase 1.00 n.s. n.s. n.s. n.s. pH 1.00 0.97** 0.99** n.s. N 1.00 0.99** n.s. C 1.00 n.s. P 1.00 Invaded SBR 1.00 n.s. 0.89* n.s. 0.97** n.s. 0.75* 0.72* soils AP 1.00 n.s. 0.92** n.s. 0.92** 0.84** 0.86** BG 1.00 n.s. 0.93** n.s. n.s. n.s. NAGase 1.00 n.s. 0.87** 0.81** 0.83** pH 1.00 0.72* 0.85** 0.80** N 1.00 0.98** 0.95** C 1.00 0.96** P 1.00

influenced AP and NAGase activities, whereas BG activity was not according to these variables and submitted to ANOVA. Soil basal affected by the phenological stage, and GMea values seemed to be respiration was significantly lower in invaded soils of mixed forests independent of the studied ecosystem. Enzymatic activities and in the vegetative period (Fig. 2). Mixed forests had the highest GMea were heavily increased in the presence of A. dealbata to a respiration values in the vegetative period of A. dealbata, whereas different degree (Fig. 1). Initially, native shrubland presented lower shrublands had the lowest values for the same period, indepen- EAs in comparison to the native forest (see also Fig. 1). In the dently of soil type (Fig. 2). In addition, respiration values were shrubland, enzymatic activities were mainly increased in both the significantly altered between phenological stages, decreasing in the reproductive and vegetative stages whereas the enhancement in forests but increasing in the shrublands. the forest was related to the vegetative period (AP>46%, p < 0.01; Principal component analysis of the soil community function GMea>150%, p < 0.01). The rise in EAs in soils with A. dealbata data for the two ecosystems revealed that 91.4% of the variation of presence was particularly noticeable in the shrubland in both pe- the soil microbial activity (EAs and SBR) could be explained by the riods, vegetative (BG>83%, p < 0.000; NAGase>200%, p < 0.000) first (PC1, 70.4% of the total variance) and second (PC2, 20.5% of the and reproductive (AP>575%, p < 0.000; BG>230%, p < 0.000; total variance) components (Fig. 3). Eigenvalues over 1 were NAGase>109%, p < 0.05). At the same time, significant differences in selected and a Varimax rotation was performed. It is shown that the all EAs were found between different phenological stages in the enzymatic activities (AP, BG and NAGase, from invaded or non- shrubland in both invaded and non invaded patches (see also invaded patches) were closely located along the PC2, while they Fig. 1). On the contrary, activities remained unchanged between were more distanced from each other along the PC1. GMea of the vegetative and reproductive stages in the mixed forests. enzymatic activities was negatively related with PC2, but did not Pearson's correlation indicates that the activity of BG was pos- clearly separate invaded from native patches. On the contrary, SBR itive and significantly correlated with pH values, but negatively was clearly differentiated, also negatively located on the PC2 (SBR with C and N in non-invaded soils of the ecosystems (Table 2). In from invaded patches) or highly located along the PC1 (SBR from invaded soils, BG was positively correlated with pH. However, native patches). negative correlations were found between AP and NAGase with C, N, and P (Table 2). In addition, individual bivariate correlations 4. Discussion (enzymeeenzyme) were higher in non-invaded soils than in soils with A. dealbata presence (Table 2). Results from this study clearly indicated that the exotic plant ANCOVA results indicated that air temperature (p < 0.05) and A. dealbata can alter important functions of the soil microbial soil temperature (p < 0.01) significantly influenced soil respiration community. The change in functions of the microbial community (data not shown). Therefore, respiration data were transformed was accompanied by changes in soil elements in the upper layer; þ mainly total C, total N and NO2 ,NO3 and NH4 and total and Table 3 available P. Like other species within the Acacia genus, A. dealbata Effects of the independent variables of the model (3-way ANOVA) including dramatically alters soil composition and nutrient release (Stock phenological stage (DecembereMarch), ecosystem (mixed forest-shrubland), soil et al., 1995; Lorenzo et al., 2010b), and slightly enhances decom- type (invaded-non invaded), and their interactions on soil enzymatic activities and position rates (Castro-Díez et al., 2012). The increment in the N GMea;*p < 0.05;**p < 0.01;***p < 0.001. AP ¼ acid phosphatase; BG ¼ b-glucosidase; þ NAGase ¼ N-acetyl-glucosaminidase; GMea ¼ geometric mean of enzymatic content and N compounds (NO2 ,NO3 and NH4 ) in soils invaded by activities A. dealbata may be related to the N2-fixing condition of this species (Sheppard et al., 2006; Lorenzo et al., 2010a). Subsequently, these AP BG NAGase GMea changes might be responsible for the reduced C:N ratio found in Phenological stage 0.000*** 0.628 0.002** 0.001** invaded soils, probably supported by an acceleration in decompo- Soil Type 0.000*** 0.000*** 0.000*** 0.000*** Ecosystem 0.044* 0.005** 0.001** 0.541 sition processes (Taylor et al., 1989; Augusto et al., 2002). In fact, Ps x ST 0.008** 0.386 0.209 0.010* Castro-Díez et al. (2012) indicated an increase in N mineralization Ps x E 0.004* 0.579 0.003** 0.057 in soils under A. dealbata mainly due to the high increase of ST x E 0.000*** 0.178 0.115 0.078 ammonium and nitrate. In our case, it is not the increase but the Ps x ST x E 0.000*** 0.229 0.696 0.015** significant differences in ammonium and nitrate content between 104 P. Souza-Alonso et al. / Soil Biology & Biochemistry 79 (2014) 100e108

Fig. 1. Soil enzymatic activities and GMea in the mixed forests and shrublands in the different phenological stages: vegetative ( , December 2010) and reproductive period ( , March 2011). Asterisks represent significant differences with the non-invaded patches in t-test: *p < 0.05, **p < 0.01, ***p < 0.001. Lower case/capital letters indicate differences between phenological stages. Vertical lines indicate standard error. Note the different scale for the activities.

invaded and non-invaded soils. At the same time, ammonification acidification seems to be dependent on the original soil conditions and nitrification processes, (suggested by the larger amounts of as no differences in soil pH were collected after simulating þ NH4 and NO3 in invaded soils) also found for other acacias A. dealbata litter deposition in laboratory (Castro-Díez et al., 2012). (Ehrenfeld, 2003) could underlie changes in N compounds. The massive C and N soil input seems to be a determining factor As it was found with other acacias and N2-fixers (Zou et al., affecting soil composition and could play a key role in the invasion of 1995), phosphorus was altered under the A. dealbata canopy. A. dealbata. High percentage of variation in the average of soil Moreover, it was negatively correlated with enzymatic activity but chemical values found in shrublands (333%) might be favored by the positively correlated with the main soil parameters. The correlation initially poor values in these ecosystems compared to the original with C and N suggests that A. dealbata is the main source of P, values in mixed forests. As stated by Dassonville et al. (2008), large whereas in native ecosystems soil P probably derives from multiple positive impacts (higher topsoil nutrient concentrations in patches sources. This fact could be also indicated by the negative correlation where A. dealbata was present) were initially most often found in in invaded soils between P and pH. C and N are negatively related to sites with small pools of nutrients in the topsoil. In addition, another pH, a common fact as they represent a substantial amount of the likely explanation for the remarkable differences between invaded soil organic matter and the enhancement in organic matter content and non-invaded soils in shrublands could be the enhanced amount is usually accompanied by soil acidification in invasive processes of of organic matter (total C) in the litter due to the change in the Acacias (Ehrenfeld et al., 2003; Lorenzo et al., 2010b). Nevertheless, dominant eAcacia vs shrubse life form (Alpert et al., 2000). P. Souza-Alonso et al. / Soil Biology & Biochemistry 79 (2014) 100e108 105

Fig. 2. Soil basal respiration (SBR) in the different phenological stages: vegetative ( , December 2010) and reproductive period ( , March 2011), for the different ecosystems. Asterisks represent significant differences with non-invaded zones in t-test: *p < 0.05; **p < 0.01, ***p < 0.001. Lower case/capital letters indicate differences between phenological stages. Vertical lines indicate standard error.

Change in functional type might also explain the enhancement produced by the invader entailed higher nutrient availability (with in macronutrients in invaded soils. Calcium content (values in the exception of K in mixed forests) in the upper layers of invaded invaded shrubland were 10-fold non-invaded values) displays soils, linking nutrient content with litter produced by A. dealbata. some of the largest variation in foliar concentrations and consistent Moreover, the extended and aggressive root system of A. dealbata differences among plant functional types (Thompson et al., 1997). (Fuentes-Ramírez et al., 2011) can be also accelerating weathering These macronutrients play a key role since deficiencies in these since plant roots take advantage of existing pores and fractures in cations can often be a limiting factor of tree growth (Augusto et al., bedrock to advance physical weathering (Roering et al., 2010; 2002). Rock-derived nutrients as K, Ca or Mg, are made available Brantley et al., 2011). Another plausible explanation is that foliage mainly through the geochemical processes of mineral weathering of hardwood species usually has higher concentrations of N, K, Ca (Schlesinger, 1997). In our case, the trend of increased content of K, and Mg than coniferous species (Augusto et al., 2002). A. dealbata is Ca and Mg in soils with A. dealbata presence is in accordance with not a real hardwood species (acacia has persistent evergreen the highest rates of organic matter entering the ecosystem. In the phyllodes); however, the high amount of litter (dead branches, case of soils invaded by A. dealbata, high increase in organic matter leaves, superficial roots) produced can be responsible for the in- can be positively influencing nutrients retention (da Silva et al., crease obtained. 2014) and vice versa (Sollins et al., 1996). The enhancement The shift in organic matter inputs, C or N, may also be related to changes of function in the soil microbial community (Allison and Vitousek, 2005; Wallenius et al., 2011; Esch et al., 2013). Previous works have shown that A. dealbata modifies soil chemistry and changes soil functional diversity of bacteria in mixed pine forests (Lorenzo et al., 2013a). Our results suggest that this invader mainly increased microbial activity associated with C and P cycles. In addition, the general increase of the measured enzymatic activities and GMea in the invaded soils indicated an enhancement in nutrient cycling in soils under A. dealbata canopy, due to the consistent trend of increased activities across the invaded patches. The alteration found in the N:P ratio contribute to the effective modification of microbial community function, since on a medium or large scale this ratio was established as a crucial factor control- ling microbial functional diversity, with a similar importance to water availability (Liu et al., 2010). In line with Fanelli et al. (2008), differences found in the N:P ratio in our study can be interpreted as a high severity of disturbance caused by A. dealbata. Nevertheless, we do not avoid the fact that enzymatic measurements carried out in this assay only reflect a small, but important, part of the general picture of the microbial community activity. These three enzymes provide us with valuable information of C, N and P cycles; however, complementary information would be very interesting in order to Fig. 3. Ordination biplot (PC1 vs. PC2) of principal component analyses (PCA) for both strongly support changes, and on the other hand, intricate micro- invaded and non-invaded ecosystems based on soil microbial parameters: Soil basal bial community function. Additionally, biological interpretation of D þ ▫ ◊ respiration ( ), GMea ( ) AP activity (O), NAG activity ( ), and BG activity ( ). Empty the enzymatic results is certainly complex as AP, BG and NAGase symbols (D) represent non-invaded zones; filled symbols (:) represent invaded zones. Data in parentheses indicate the percentage of total variation accounted for were differently affected by independent variables (phenological each principal component axis. stage, soil type and ecosystem) and their interactions. 106 P. Souza-Alonso et al. / Soil Biology & Biochemistry 79 (2014) 100e108

The reduction in C:N ratio seems to be related to the age of in- enzymes work. The relationships between EAs and C, N and P were vasion in A. dealbata (Souza-Alonso et al., unpublished data). The reversed in soils invaded by A. dealbata. Activities of AP and NAG are initial pH values found in mixed forests and shrublands (z5e4) uncorrelated with C, N and P in non-invaded patches, but these could favor fungal dominance (Bååth E. and Anderson, 2003; De activities were negatively related in the invaded soils. We suggest Vries et al., 2006) as well as a C:N ratio z15 does (Strickland and that the presence of the invader could also modify patterns of Rousk, 2010). However, under A. dealbata canopy maximum pH enzymatic activity. Furthermore, weak or negative relationships values barely reached 4.5 units. At these pH values and below this between C, N and P with enzymatic activities suggests that other threshold, Rousk et al. (2009) found an inhibition of microbial factors, such as an interaction with soil particles (Geisseler and variables. In fact, some authors have recently found a reduction in Horwath, 2009), can be influencing enzymatic activity in non- soil bacterial richness and diversity in the laboratory under invaded soils. AP and NAG activities seem to be dependent on A. dealbata influence (Lorenzo et al., 2013a). Therefore, in this work chemical composition in the invaded soils. On the contrary, an fungal community could be exerting a key role under A. dealbata opposite trend might be suggested for BG activity. This change in canopy. function can be associated with the change in microbial composi- NAGase activities, important for N-transformations in acidic tion, since bacteria and fungi are the main source of extracellular soils (Parham and Deng, 2000), have a wide origin and this enzyme soil enzymes but the structure of soil community can be modified is expressed by a diverse group of fungi (Miller et al., 1998). Low pH under A. dealbata invasion (Lorenzo et al., 2010b). However, despite favors soil conditions for fungal development, so an increase in the general modification in enzymatic activities, the ordination plot NAGase activity would be expected. Indeed, in shrublands, where from PCA did not clearly differentiate invaded and native zones the variation of pH range was higher, significant differences in because of their enzymatic functionality. NAGase activity were found, whereas the variation for the forests Soil basal respiration data are not in line with the general was not significant. Moreover, some authors have previously found trend; whereby the presence of exotic species generally en- an alteration in the structure of fungal community in soils from hances respiration rates (Metcalfe et al., 2011). Results of EAs and A. dealbata stands (Lorenzo et al., 2010b) and even beneath other GMea suggested a partial increase in the microbial activity in the acacias (Remigi et al., 2008). However, the change towards fungal invaded soils, and so an enhancement in SBR would be expected. activity predominance is carefully suggested due to a relevant fact. Nevertheless, contrary to the EAs and the GMea results, respi- N levels and NAGase activity are both enhanced in soils invaded by ration rates were higher in non-invaded soils of mixed forests or A. dealbata, but NAGase activities are generally inversely propor- not affected in soils of shrublands. Indeed, a trend of increased tional to N availability (Sinsabaugh et al., 1993). This circumstance SBR has recently been found in soils invaded on a new and long- is also extensive to the AP activities. Generally, increased AP activity time basis by A. dealbata (Souza-Alonso et al., unpublished data). is a response to low environmental P availability (Sinsabaugh et al., Soil respiration is positively correlated with soil organic matter 1993). Allison and Vitousek (2005) could provide us with a plau- content. However, in this case we can argue that despite the sible explanation for the enhanced activities in NAG and AP. They enhancement of measured microbial activities, a reduction in suggested an “apparent limitation” in P to explain the rise in the unexplored activities or the effect of other environmental vari- activity of AP. In soils invaded by A. dealbata, the increase in N:P and ables can be unbalancing microbial activity in the mixed forest, C:P ratio would be an indication to invest in P acquisition, with the as inferred by the reduction in SBR. In addition, it is possible that resulting enhancement in AP activity. In addition, AP is known to measured activities may not be entirely illustrative of the entire increase with organic P (Redel et al., 2008) and the high correlation microbial community and thus some differences may have found between C and P in soils invaded by A. dealbata suggest an remained unnoticed. Nevertheless, contrary to the EAs and the enhancement in organic P, bound to the organic matter. Therefore, GMea, PCA analysis clearly separate respiration values from organic P could be responsible for the increase in AP activity and, in invaded and non-invaded patches, implying that respiratory turn, AP activity may enhance mineralization rates of organic P. At metabolism of the invaded and non-invaded communities per- the same time, the activity of this enzyme can be used as predictor formed differently. of mass loss (Waring, 2013), therefore it provides us with infor- Due to the influence of independent factors (phenological stage, mation about the state of decomposition processes. soil type and ecosystem) on microbial parameters, we can suggest The large amount of organic matter in A. dealbata litter entering that the phenological stage of A. dealbata and ecosystem selected the system (reflected in the C content) is probably more important exerted variable influence on EAs and SBR. On the contrary, the than mineral N availability in determining enzyme production presence of the invader in the shrublands invariably altered the (Allison et al., 2006), mainly in the upper layers of soil. Actually, the function of the microbial community. Despite EAs and SBR in organic matter is considered to be the main determinant of the invaded soils being altered both in shrubland and mixed forests, the level of soil enzyme activities (Wallenius et al., 2011; Stursova and ecosystems do not perform equally. Enzymatic activities collected Baldrian, 2011). The increase in C provided by A. dealbata may in the forests were more stable between phenological stages in the contribute to the rise in BG activity and, as we found for NAGase, it invaded but also in non-invaded sites. Therefore, modifications in was independent of the phenological stage. Therefore, changes the function of soil microbial community seems to be highly reliant produced in these activities are probably more stable. Besides the on the ecosystem invaded. variation in organic matter inputs and due to the changes in plant Furthermore, during the reproductive period, rainfall leachates dominance in patches invaded by A. dealbata, a substrate with a from inflorescences and the presence of flowers in the soil ensures different composition could be deposited in the upper layers of A. the occurrence of bioactive compounds with potential phytotoxic dealbata soils. Different organic matter inputs (through litter and capacity. However, EAs and SBR values performed similarly be- decaying material) that are also quantitatively higher, would tween dates in invaded and non-invaded soils, independently of contribute to explaining the alteration in BG activity as well as al- the ecosystem selected. Our results do not match those from a terations in the remaining EAs. Composition and activity of mi- previous study that examined the allelopathic effect of A. dealbata crobial community is directly affected by litter characteristics leachates on microbial functional diversity during its reproductive (Pfeiffer et al., 2013). period, as that study found a different functional diversity of soil In addition to the altered EAs, results from correlation analyses bacteria in soils of mixed forests (Lorenzo et al., 2013a). Conse- also suggest that the presence of A. dealbata has an effect on how quently, results presented here suggest that the phenological stage P. Souza-Alonso et al. / Soil Biology & Biochemistry 79 (2014) 100e108 107 of A. dealbata is not a critical factor influencing soil microbial Fanelli, G., Lestini, M., Sauli, A.S., 2008. Floristic gradients of herbaceous vegetation e community activity. and P/N ratio in soil in a Mediterranean area. Plant Ecology 194, 231 242. Fuentes-Ramírez, A., Pauchard, A., Marticorena, A., Sanchez, P., 2010. Relationship between the invasion of Acacia dealbata Link (Fabaceae: Mimosoideae) and e 5. Conclusions plant species richness in south-central Chile. Gayana - Botanica 67, 188 197. Geisseler, D., Horwath, W.R., 2009. Relationship between carbon and nitrogen availability and extracellular enzyme activities in soil. Pedobiologia 53, 87e98. In the presented study, the occurrence of A. dealbata in mixed Guitian-Ojea, F., Carballas, T., 1976. Tecnicas de analisis de suelos (in Spanish)/ forest and shrubland altered soil chemistry characteristics, mainly Techniques in soil analyses. Pico Sacro, Santiago de Compostela. Hinojosa, M.B., García-Ruíz, R., Vinegla,~ B., Carreira, J.A., 2004. Microbiological rates C and N content (and N compounds) and the related ratios N:P and and enzyme activities as indicators of functionality in soils affected by the C:N. Soil microbial community activity, reflected in the enzymatic Aznalcollar toxic spill. Soil Biology & Biochemistry 36, 1637e1644. activities, was markedly stimulated in the presence of A. dealbata INPN, 2011. Inventaire National du Patrimoine Naturel. Service du Patrimoine Naturel, France. independently of the phenological stage of the invader. The pres- Jakmunee, J., Junsomboon, J., 2009. Determination of available phosphorus in soils ence of the invader had different effects depending on the by using a new extraction procedure and a flow injection amperometric system. ecosystem studied. In our case, alterations found in the enzymatic Talanta 79, 1076e1080. activities, together with changes in soil parameters, mainly C, N and Joanisse, G.D., Bradley, R.L., Preston, C.M., Munson, A.D., 2007. Soil enzyme inhibi- tion by condensed litter tannins may drive ecosystem structure and processes: P, indicated that A. dealbata produced larger modifications on the case of Kalmia angustifolia. New Phytologist 175, 535e546. shrubland in comparison with mixed forest. Overall, this study Kempers, A.J., 1974. Determination of sub-microquantities of ammonium and ni- underlines the necessity to take into account the soil microbial trates in soils with phenol, sodium-nitroprusside and hypochlorite. Geoderma 12, 201e206. community when studying the impact of invasive plants. Kourtev, P.S., Ehrenfeld, J.G., Haggblom, M., 2002. Exotic plant species alter the microbial community structure and function in the soil. Ecology 83, 3152e3166. Acknowledgments Li, W.-H., Zhang, C.-B., Jiang, H.-B., Xin, G.-R., Yang, Z.-Y., 2006. Changes in soil microbial community associated with invasion of the exotic weed, Mikania e We would like to thank the Xunta de Galicia for its financial micrantha H.B.K. Plant and Soil 281, 309 324. Liao, J.D., Boutton, T.W., 2008. Soil microbial biomass response to woody plant in- support through the PGIDIT05RAG31001PR project. We would also vasion of grassland. Soil Biology & Biochemistry 40, 1207e1216. like to thank Jorge Tavares for his involvement in the assay, Dr. E.F. Liu, Z., Fu, B., Zheng, X., Liu, G., 2010. Plant biomass, soil water content and soil N: P Covelo and especially Dr. P. Lorenzo for her helpful comments, and ratio regulating soil microbial functional diversity in a temperate steppe: a & e fi regional scale study. Soil Biology Biochemistry 42, 445 450. the CACTI (Scienti c and Technological Research Supporting Lorenzo, P., Gonzalez, L., 2010. La alelopatía: una característica ecofisiologica que Centre) for its collaboration with the soil analyses. Additionally, the favorece la capacidad invasora de las especies vegetales (in Spanish). Ecosis- authors would like to express their gratitude to the anonymous temas 19, 79e91. Lorenzo, P., Gonzalez, L., Reigosa, M.J., 2010a. The genus Acacia as invader: the char- reviewers for their valuable comments and suggestions which acteristic case of Acacia dealbata Link in Europe. Annals of Forest Science 101,1e11. substantially ameliorated the final version of this manuscript. Lorenzo, P., Rodríguez-Echeverría, S., Gonzalez, L., Freitas, H., 2010b. Effect of invasive Acacia dealbata Link on soil microorganisms as determined by PCR- DGGE. Applied Soil Ecology 44, 245e251. References Lorenzo, P., Palomera-Perez, A., Reigosa, M.J., Gonzalez, L., 2011. Allelopathic inter- ference of invasive Acacia dealbata Link on the physiological parameters of Allison, S.D., Vitousek, P.M., 2005. Responses of extracellular enzymes to simple and native understory species. Plant Ecology 212, 403e412. complex nutrient inputs. Soil Biology & Biochemistry 37, 937e944. Lorenzo, P., Pereira, C.S., Rodríguez-Echeverría, S., 2013a. Differential impact on soil Allison, S.D., Nielsen, C., Hughes, R.F., 2006. Elevated enzyme activities in soils microbes of allelopathic compounds released by the invasive Acacia dealbata under the invasive nitrogen-fixing tree Falcataria moluccana. Soil Biology & Link. Soil Biology & Biochemistry 57, 156e163. Biochemistry 38, 1537e1544. Lorenzo, P., Rodríguez-Echevarría, S., Freitas, H., 2013b. No allelopathic effect of the Alpert, P., Bone, E., Holzapfel, C., 2000. Invasiveness, invasibility and the role of invader Acacia dealbata on the potential infectivity of arbuscular mycorrhizal environmental stress in the spread of non-native plants. Perspectives in Plant fungi from native soils. European Journal of Soil Biology 58, 42e44. Ecology, Evolution and Systematics 3, 52e66. Marchante, E., Freitas, H., Marchante, H., 2008. Guia pratico para a identificaçao~ de Augusto, L., Ranger, J., Binkley, D., Rothe, A., 2002. Impact of several common tree species of Plantas Invasoras de Portugal Continental. Imprensa da Universidade de European temperate forests on soil fertility. Annals of Forest Science 59, 233e253. Coimbra, Coimbra. ~ Bååth, E., Anderson, T.H., 2003. Comparison of soil fungal/bacterial ratios in a pH MARM (Ministerio de Medio Ambiente, Medio Rural y Marino de Espana), 2011. ~ gradient using physiological and PLFA-based techniques. Soil Biology & Listado y catalogo espanol de especies exoticas invasoras, 2011/Spanish Envi- Biochemistry 35, 955e963. ronmental Ministery (MARM). List and catalogue of exotic invader species in Bever, J.D., 2003. Soil community feedback and the coexistence of competitors: Spain. conceptual frameworks and empirical tests. New Phytologist 157, 465e473. May, B.M., Attiwill, P.M., 2003. Nitrogen-fixation by Acacia dealbata and changes in Brantley, S.L., Megonigal, J.P., Scatena, F.N., Balogh-Brunstad, Z., Barnes, R.T., soil properties 5 years after mechanical disturbance or slash-burning following Bruns, M.A., et al., 2011. Twelve testable hypotheses on the geobiology of timber harvest. Forest Ecology and Management 181, 339e355. weathering. Geobiology 9, 140e165. Metcalfe, D.B., Fisher, R.A., Wardle, D.A., 2011. Plant communities as drivers of soil Bray, R.H., Kurtz, L.T., 1945. Determination of total, organic and available forms of respiration: pathways, mechanisms, and significance for global change. Bio- phosphorus in soils. Soil Science 59, 39e45. geosciences 8, 2047e2061. € Carballeira, A., Reigosa, M.J., 1999. Effects of natural leachates of Acacia dealbata Link Miller, M., Palojarvi, A., Rangger, A., Reeslev, M., Kjøller, A., 1998. The use of fluo- in Galicia (NW Spain). Botanical Bulletin of Academia Sinica 40, 87e92. rogenic substrates to measure fungal presence and activity in soil. Applied and Castro-Díez, P., Fierro-Brunnenmeister, N., Gonzalez-Mu noz,~ N., Gallardo, A., 2012. Environmental Microbiology 64, 613e617. Effects of exotic and native tree leaf litter on soil properties of two contrasting Nannipieri, P., Grego, S., Ceccanti, B., 1990. Ecological significance of the biological sites in the Iberian Peninsula. Plant and Soil 350, 179e191. activity in soils. In: Bollag, J.M., Stotzky, G. (Eds.), Soil Biochemistry, vol. 6. Celesti-Grapow, L., Pretto, F., Carli, E., Blasi, C., 2010. Flora vascolare alloctona e Marcel Dekker, New York, pp. 293e355. invasive della regioni d'Italia. Casa Editrice Universita La Sapienza, Roma. Parham, J.A., Deng, S.P., 2000. Detection, quantification and characterization of b- da Silva, J.P., do Nascimento, C.W., Silva, D.J., da Cunha, K.P., Biondi, C.M., 2014. glucosaminidase activity in soil. Soil Biology & Biochemistry 32, 1183e1190. Changes in soil fertility and mineral nutrition of mango orchards in Sao~ Fran- Pedrol, N., Puig, C.G., Souza, P., Forjan, R., Vega, F.A., Asensio, V., Gonzalez, L., cisco Valley, Brazil. Revista Brasileira de Ciencias^ Agrarias 9, 42e48. Cerqueira, B., Covelo, E.F., Andrade, L., 2010. Soil fertility and spontaneous Dassonville, N., Vanderhoeven, S., Vanparys, V., Hayez, M., Gruber, W., Meerts, P., revegetation in lignite spoil banks under different amendments. Soil & Tillage 2008. Impacts of alien invasive plants on soil nutrients are correlated with Research 110, 134e142. initial site conditions in NW Europe. Oecologia 157, 131e140. Pfeiffer, B., Fender, A.-C., Lasota, S., Hertel, D., Jungkunst, H.F., Daniel, R., 2013. Leaf De Vries, F.T., Hoffland, E., van Eekeren, N., Brussaard, L., Bloem, J., 2006. Fungal/ litter is the main driver for changes in bacterial community structures in the bacterial ratios in grasslands with contrasting nitrogen management. Soil rhizosphere of ash and beech. Applied Soil Ecology 72, 150e160. Biology & Biochemistry 38, 2092e2103. Prieto, L.H., Bertiller, M.B., Carrera, A.L., Olivera, N.L., 2011. Soil enzyme and mi- Ehrenfeld, J.G., 2003. Effects of exotic plant invasions on soil nutrient cycling pro- crobial activities in a grazing ecosystem of Patagonian Monte, Argentina. Geo- cesses. Ecosystems 6, 503e523. derma 162, 281e287. Esch, E.H., Hernandez, D.L., Pasari, J.R., Kantor, R.S.G., Selmants, P.C., 2013. Response Redel, Y., Rubio, R., Godoy, R., Borie, F., 2008. Phosphorus fractions and phosphatase of soil microbial activity to grazing, nitrogen deposition, and exotic cover in activity in an Andisol under different forest ecosystems. Geoderma 145, serpentine grassland. Plant and Soil 366, 671e682. 216e221. 108 P. Souza-Alonso et al. / Soil Biology & Biochemistry 79 (2014) 100e108

Remigi, P., Faye, A., Kane, A., Deruaz, M., Thioulouse, J., Cissoko, M., Prin, Y., Stock, W.D., Wienand, K.T., Baker, A.C., 1995. Impacts of invading N2-fixing Acacia Galiana, A., Dreyfus, B., Duponnois, R., 2008. The exotic legume tree species species on patterns of nutrient cycling in two Cape ecosystems: evidence from Acacia holosericea alters microbial soil functionalities and the structure of the soil incubation studies and 15N natural abundance values. Oecologia 101, arbuscular mycorrhizal community. Applied and Environmental Microbiology 375e382. 74, 1485e1493. Strickland, M.S., Rousk, J., 2010. Considering fungal:bacterial dominance in soils e Ricciardi, A., 2007. Are modern biological invasions an unprecedented form of methods, controls, and ecosystem implications. Soil Biology & Biochemistry 42, global change? Conservation Biology 21, 329e336. 1385e1395. Richardson, D.M., Rejmanek, M., 2011. Trees and shrubs as invasive alien species e a Stursova, M., Baldrian, P., 2011. Effects of soil properties and management on the global review. Diversity and Distributions 17, 788e809. activity of soil organic matter transforming enzymes and the quantification of Rousk, J., Brookes, P.C., Bååth, E., 2009. Contrasting soil pH effects on fungal and soil-bound and free activity. Plant and Soil 338, 99e110. bacterial growth suggest functional redundancy in carbon mineralization. Taylor, B.R., Parkinson, D., Parsons, W.F.J., 1989. Nitrogen and lignin content as Applied and Environmental Microbiology 75, 1589e1596. predictors of litter decay-rates-a microcosm test. Ecology 70, 97e104. Sax, D.F., Gaines, S.D., Stachowicz, J.J., 2005. Introduction. In: Sax, D.F., Thompson, K., Parkinson, J.A., Band, S.R., Spencer, R.E., 1997. A comparative study of Stachowicz, J.J., Gaines, S.D. (Eds.), ), Species Invasions: Insights into Ecology, leaf nutrient concentrations in a regional herbaceous flora. New Phytologist Evolution, and Biogeography. Sinauer Associates, Sunderland, Massachusetts, 136, 679e689. pp. 1e7. Vila, M., Espinar, J.L., Hejda, M., Hulme, P.E., Jarosík, V., Maron, J.L., Pergl, J., Schlesinger, W., 1997. Biogeochemistry: an Analysis of Global Change, second ed. Schaffner, U., Sun, Y., Pysek, P., 2011. Ecological impacts of invasive alien plants: Academic Press, San Diego (CA). a meta-analysis of their effects on species, communities and ecosystems. Sheppard, A.W., Shaw, R.H., Sforza, R., 2006. Top 20 environmental weeds for Ecology Letters 14, 702e708. classical biological control in Europe: a review of opportunities, regulations and Waldrop, M.P., Balser, T.C., Firestone, M.K., 2000. Linking microbial community other barriers to adoption. Weed Research 46, 93e117. composition to function in a tropical soil. Soil Biology & Biochemistry 32, Sinsabaugh, R.L., 1994. Enzymatic analysis of microbial pattern and processes. 1837e1846. Biology and Fertility of Soils 17, 69e74. Wallenius, K., Rita, H., Mikkonen, A., Lappi, K., Lindstrom,€ K., Hartikainen, H., Sinsabaugh, R.L., Moorhead, D.L., 1994. Resource allocation to extracellular enzyme Raateland, A., Niemi, R.M., 2011. Effects of land use on the level, variation and production: a model for nitrogen and phosphorus control of litter decompo- spatial structure of soil enzyme activities and bacterial communities. Soil sition. Soil Biology & Biochemistry 26, 1305e1311. Biology & Biochemistry 43, 1464e1473. Sinsabaugh,R.L.,Antibus,R.K.,Linkins,A.E.,McClaugherty,C.A.,Rayburn,L., Waring, B.G., 2013. Exploring relationships between enzyme activities and leaf litter Repert, D., Weiland, L., 1993. Wood decomposition: nitrogen and phosphorus decomposition in a wet tropical forest. Soil Biology & Biochemistry 64, 89e95. dynamics in relation to extracellular enzyme activity. Ecology 74, Weidenhamer, J.D., Callaway, R.M., 2010. Direct and indirect effects of invasive 1586e1593. plants on soil chemistry and ecosystem function. Journal of Chemical Ecology Soil Atlas of Europe, 2005. European Soil Bureau Network. European Commission, 36, 59e69. 128 pp. Zou, X., Binkley, D., Caldwell, B.A., 1995. Effects of nitrogen-fixing trees on phos- Sollins, P., Homann, P., Caldwell, B.A., 1996. Stabilization and destabilization of soil phorus biogeochemical cycling in contrasting forests. Soil Science Society of organic matter: mechanisms and controls. Geoderma 74, 65e105. America Journal 59, 1452e1458. Chapter 4 Soil and microbial alterations under A. dealbata

Chapter 5 Gradualism in A. dealbata invasion

Chapter 5. Gradualism in Acacia dealbata Link invasion: impact on soil chemistry and microbial community over a chronological sequence

Souza-Alonso, P., Guisande, A., González, L., 2014. Gradualism in Acacia dealbata Link invasion: impact on soil chemistry and microbial community over a chronological sequence. Accepted for publication in Soil Biol. Biochem. DOI 10.1016/j.soilbio.2014.10.022

Chapter 5 Gradualism in A. dealbata invasion

Soil Biology & Biochemistry 80 (2015) 315e323

Contents lists available at ScienceDirect

Soil Biology & Biochemistry

journal homepage: www.elsevier.com/locate/soilbio

Gradualism in Acacia dealbata Link invasion: Impact on soil chemistry and microbial community over a chronological sequence

* Pablo Souza-Alonso , Alejandra Guisande-Collazo, Luís Gonzalez

Department of Plant Biology and Soil Science, University of Vigo, 36310 Vigo, Spain article info abstract

Article history: Acacia dealbata Link, a leguminous tree native of Australia, has become a major problem due to its Received 17 January 2014 invasiveness throughout the world. However, little is known about its impact over time. In this study, we Received in revised form have explored the impact of A. dealbata on soil nutrients and on soil microbial community function and 15 October 2014 structure in 4 mixed invaded forest sites in NW Spain, in a chronosequence of invasion: (1) a minimum of Accepted 25 October 2014 25 years; (2) an average of 15 years; (3) an average of 7 years and (4) less than 3 years. pH significantly Available online 8 November 2014 diminished over time as organic matter increased. Soil nutrients were progressively altered under A. dealbata; total C, N and P invariably increased as different periods of invasion time also increased, Keywords: þ þ þ whilst Ca2 ,K and Mg2 contents showed irregular trends during the different periods of invasion. In Acacia dealbata b Chronosequence of invasion addition, soil enzymatic activities of acid phosphatase, -glucosidase, urease and N-acetyl glucosami- Soil nutrients nidase increased significantly, and soil basal respiration enhanced over the sequence of the invasion. Plant invasion DGGE analyses suggested variations in the structure of microbial and fungal communities over the whole Enzymatic activities assessed period due to A. dealbata presence. This is the first time that chronological sequences have been Soil microorganisms included to investigate the impact of A. dealbata invasion. Our results show that the initial dominance of Diversity and function A. dealbata and its negative impact on soil and microbial parameters cannot be recovered even long periods after the invasion. © 2014 Elsevier Ltd. All rights reserved.

1. Introduction litter inputs, both quantitatively and qualitatively (Ehrenfeld, 2010). Alteration in organic matter inputs also produces changes in The loss and change of aboveground biodiversity in the decomposer community composition (http://www.sciencedirect. composition of plant species is the most evident effect of plant com/science/article/pii/S0038071705003184Parmelee et al., 1989), invasions (Reinhart et al., 2005; Brewer, 2008; Hoyos et al., 2010; de which affects the physiological capacity of the microbial commu- Abreu and Durigan, 2011). However, plant invasions can modify soil nity (Waldrop et al., 2000). Therefore, decomposition processes are structure and chemical composition (Ehrenfeld, 2003; Reinhart and strongly regulated by litter characteristics of the dominant plant Callaway, 2006; Chacon et al., 2009; Yang et al., 2010; Castro-Díez species in an ecosystem (Hoorens et al., 2003). Reciprocally, et al., 2012; Novoa et al., 2014) and soil microorganism structure belowground soil organisms, such as fungal and bacterial com- (Hawkes et al., 2006; Broz et al., 2007; Lorenzo et al., 2010a) and munities, show important feedback with plants (Van der Putten function (Castro-Díez et al., 2009; Dasonville et al., 2011; Elgersma et al., 2007), influencing the relative abundance of plant species and Ehrenfeld, 2011). Recently, authors such as Dasonville et al. within a community (Klironomos, 2002) and contributing to soil (2011) asserted that alien plant species can create novel niches by processes like litter decomposition and nutrient mineralization, modifying native conditions; mainly in the storage and release of C mainly via their enzymatic activity (Sinsabaugh, 2010). and N. The presence of plant invaders generally modifies ecosystem There is a general consensus among invasive ecologists about the noxious effects produced by the entrance of foreign plant species into the ecosystem functioning. However, information about the time elapsed since the introduction of the invader is b Abbreviations: SOM, soil organic matter; AP, acid phosphatase; BG, -glucosi- generally not provided. Consequently, in studies concerning inva- dase; Ur, urease; PPO, polyphenol oxidase; GAP, glycine aminopeptidase; NAGase, sive processes, information about changes in the impact over time N-acetyl glucosaminidase; pNP, paranitrophenol phosphate; pNA, paranitroaniline. * Corresponding author. Tel.: þ34 986 812 594; fax: þ34 986 812 556. is rarely available (Ehrenfeld, 2003). Some authors have found that E-mail address: [email protected] (P. Souza-Alonso). changes in soil properties as C or N contents and microbial http://dx.doi.org/10.1016/j.soilbio.2014.10.022 0038-0717/© 2014 Elsevier Ltd. All rights reserved. 316 P. Souza-Alonso et al. / Soil Biology & Biochemistry 80 (2015) 315e323 properties soil ecosystem parameters are more pronounced after a pinaster Aiton and where Quercus robur L., Arbutus unedo L. and long period of invasion, complicating restoration in the invasion of Quercus suber L. can also be found as tree species. Undergrowth is the related Acacia longifolia invasion (Marchante et al., 2008b). mainly composed of Ulex europaeus L., Pterospartum tridentatum L. Nevertheless, recent findings suggest that the impact of an invasive and Erica cinerea L., with the presence of Cistus spp. and Cytisus spp. species on soil characteristics and on the structure and function of Our design was based on a chronological sequence of the intro- microorganisms does not necessarily remain constant or accumu- duction of A. dealbata. In order to obtain information about sites late over the course of invasion (Strayer, 2012; Dostal et al., 2013). that had been invaded during different time periods, we used data Both ecological and adaptation processes may increase or attenuate provided by land owners and forest managers. By examining these the impact of invaders on the resident community. Strayer (2012) reports, we reconstructed the Acacia invasion dynamics in this re- indicated that several factors can influence the invasion pattern gion over the past 35 years. With this information, we chose 4 areas over time and a single model is not enough to understand the that were invaded (1) in 1985 or earlier; (2) between 1986 and whole picture of invasion gradualism. Hereafter, we use the term 2000; (3) between 2001 and 2005 and (4) between 2007 and 2010. “gradualism” defined as the accumulated degree of change in With the aim of facilitating comprehension, these intervals were measured parameters produced by time passage. To our knowl- further classified by the estimated mean age of the Acacia stands, edge, there is no data documenting the modification of invaders' yielding a chronosequence of invasive populations of differing age, impact on soil microorganisms along an invasion chronosequence. i.e. (1) a minimum of 25 years; (2) 15 years; (3) 7 years and (4) less Acacia dealbata Link is an invasive tree native to Australia with than 3 years. At least four replicates were established for each age an extremely high invasive potential (Wilson et al., 2011). This of invasion (3 m apart). The same number of non-invaded areas was species represents a major threat to Mediterranean-type ecosys- contiguous to A. dealbata areas. tems throughout the world, such as in Southern Europe, South We assumed independent invasion dynamics within the indi- Africa and South America (Richardson and Rejmanek, 2011). The vidual areas. We also assumed that, prior to the invasion, envi- success of the spread of A. dealbata in nonnative ecosystems has ronmental conditions of the sites involved in this study were been related to several mechanisms as disturbances, fast growth, similar e the historical data we collected indicated that the sites massive seed production or allelopathy (Sheppard et al., 2006; that are now colonized by Acacia were mixed forest, like the Acacia- Lorenzo et al., 2011; Gonzalez Munoz~ et al., 2012; Lorenzo et al., free sites at present. Due to their proximity, we also assumed that 2013), and explained by combining several hypotheses as the invaded and non-invaded patches had the same characteristics novel weapons, enemy release or disturbance hypotheses (Lorenzo prior to A. dealbata invasion. et al., 2010b). The negative impact of the presence of A. dealbata in bacterial and fungal communities and the increase in soil nutrient 2.2. Soil sampling availability has been previously suggested (Lorenzo et al., 2010a). Changes in soil microbial communities are particularly interesting Three sampling dates e March (winter), May (spring) and since A. dealbata establish intimate relationships with N2 fixing November (autumn) 2010 e were included according to different bacteria, mainly with the genus Bradyrhizobium (Rodríguez- phenological stages of A. dealbata. Soil samples were collected in Echeverría et al., 2011). Additionally, it was suggested that five random points (minimum 1 m apart) in the invaded and non- harboring exotic bacteria in other congeners (A. longifolia) is a factor invaded replicates. Surface litter was removed and soil was contributing to the success of invasion and the modification in collected within the first 10 cm using a hand shovel. After collec- bacterial communities in the Acacia genus (Rodríguez-Echeverría, tion, soil was immediately refrigerated (approx. 4 C) and trans- 2010). ported to the laboratory within 2 h of collection for further We hypothesize that the age of the invasion will influence processing. Once in the laboratory, soil samples were passed nutrient availability, and microbial community structure, function, through a 2 mm sieve to remove coarse roots, organic debris and and diversity, in the case of A. dealbata. From this point of view, small stones. Samples by replicate were homogenized and split into invasion gradualism is understood as the accumulation of changes three parts to characterize soil nutrients, the microbial community caused by the time elapsed since A. dealbata introduction. There- function, and the microbial community structure, respectively. The fore, our goal was to test changes in the impact of A. dealbata on soil soil intended for nutrient characterization was air-dried for at least biogeochemistry, via changes in soil nutrient and microbial com- 72 h. The soil used in enzymatic activity measurements was munity function and structure along an invasion chronosequence. refrigerated (4 C) until the start of the analyses the next day. The In order to demonstrate our hypothesis, we carried out soil nutrient soils used in the characterization of microbial and fungal commu- characterization and measured a set of soil enzyme activities. We nity structure were frozen (20 C) until their use in DGGE ana- also assessed the structure and diversity of soil bacteria and fungi lyses. The soils for DGGE analyses were exclusively collected during with PCR-DGGE, one of the most informative and commonly used the second sampling. techniques to identify the impact of invasive plant species on soil microbial and fungal communities (Wolfe and Klironomos, 2005; 2.3. Soil characterization Nie et al., 2010; Lorenzo et al., 2010a, 2013). Soil pH was determined in 1:2.5 (soil weight: distilled water 2. Material and methods volume) in a Crison digital pH meter (Guitian-Ojea and Carballas, 1976). Total C and N were estimated after combustion at 1200 C 2.1. Experimental site and design of 0.1 g soil samples using a LECO CNS-2000. Inorganic C was similarly determined by combustion at 550 C of 0.3 g soil samples This study was carried out between March and November for 24 h. Inorganic C of all samples was <0.05%, so total carbon was (2010) in a heavily invaded area in the council of Ribadavia (NW considered organic carbon. Total phosphorus, potassium, calcium Spain, 42.297 N, -8.154 W). This region is characterized by a Med- and magnesium were extracted using HCLeHNO3 after combustion iterranean sub-humid climate with Atlantic trend and granitic (3 h, 550 C), followed by quantification by inductively coupled bedrock. The mean annual temperature range varies between plasma optical emission spectrometry (ICP-OES) (MAPA, 1994). The 6.7 C and 18.0 C, with harsh droughts during summer. Patches available phosphorus was extracted in accordance with Jakmunee with A. dealbata are located in mixed forests dominated by Pinus and Junsomboon (2009) and colorimetrically determined by the P. Souza-Alonso et al. / Soil Biology & Biochemistry 80 (2015) 315e323 317

BrayeKurtz method (Bray and Kurtz, 1945). Ammonia, NO3 and containing 2.5 mLofbuffer(160mM(NH4)2SO4, 670 mM TriseHCl NO2 were analyzed according to Kempers (1974). pH 8.8, 0.1% Tween-20, 25 mM MgCl2) (BIORON, Germany), 400 nM of each primer, 200 mM dNTPs, 0.5 U of DFS-Taq poly- 2.4. Soil microbial community function: enzymatic activities (EA) merase (BIORON, Germany), and 1 mLoftemplateDNA.ThePCR and soil basal respiration (SBR) conditions for bacteria were: an initial denaturing step at 94 Cfor 5 min followed by 30 cycles of 30 s at 94 C, 30 s at 55 Cand30s Six enzymes were included in the assay due to their key role in at 72 C, followed by a final extension step at 72 Cfor30min.The C, N and P cycles: acid phosphatase (AP, E.C. 3.1.3.2) e involved in PCR conditions for fungi were: an initial denaturing step at 94 C the release of phosphate from organic matter e C-degrading en- for 3 min followed by 35 cycles consisting of 1 min at 94 C, 1 min zymes, b-glucosidase (BG, E.C. 3.2.1.21) and polyphenol oxidase at 50 Cand1minat72C, followed by a final extension step at (PPO, E.C. 1.10.3.2); and the N-liberating enzymes, urease (Ur, E.C. 72 C for 30 min. Aliquots (5 mL) of each PCR mixture were 3.5.1.5), glycine aminopeptidase (GAP, E.C. 3.4.11.-) and N-acetyl- examined via electrophoresis in an agarose gel (1%, w/v) stained glucosaminidase (NAGase, E.C. 3.2.1.50). AP and BG were with GelRedTM to check fragment size and integrity. All PCRs measured in accordance with the methods described by Tabatabai were performed using a T100™ Thermal Cycler (Bio-Rad, Hercu- and Bremner (1969) and Hayano and Tubaki (1985). Ur was les, CA, USA). measured according to Kandeler and Gerber (1988),modified by DGGE was performed with a DGGE-2401 system from CBS Sci- Kandeler et al. (1999). C-degrading enzyme PPO and the N entific (CA, USA). 20 mL of each PCR product was used for DGGE releasing enzyme GAP were measured following Sinsabaugh et al. analysis. Gels contained 6% (w/v) acrylamide for bacteria PCR (1992 and 1993, respectively) modified by Allison et al. (2006). products and 8% (w/v) acrylamide for fungi PCR products. NAGase was extracted following Wirth and Wolf (1992) and The linear gradient used was from 50 to 80% denaturant for measured in accordance with Tronsmo and Harman (1993) with bacteria and from 20 to 55% for fungi, while 100% denaturing the Naseby and Lynch (1997) modifications. The activity of each acrylamide was defined as containing 7 M urea and 40% (v/v) enzyme was four times replicated and averaged. Activity of AP, BG formamide. Gels (22 cm 17 cm) were run in 21 L 1 TAE buffer at and NAGase was indicated as the amount of p-Nitrophenol 20 V for 15 min, followed by 16 h at 70 V and maintained at a phosphate (pNP) produced (mmol pNP g 1 dry soil h 1). The ac- constant temperature of 60 C. Gels were stained for 20 min in 1.0 þ tivity of Ur was measured as the amount of NH4 produced GelStar1 and destained for 30 min in distilled water prior to þ 1 1 (NH4 g dry soil h ). GAP activity was defined as the amount of visualization. þ 1 1 p-Nitroaniline produced (pNA NH4 g dry soil h ). Finally, PPO activity was indicated as the amount of pyrogallol produced. Nevertheless, despite their useful value in comparative studies, it 2.6. Statistical analyses should be noted that enzymatic activities under laboratory con- ditions express their maximum potential and these activities do Data normality and the homogeneity of variances were checked not provide insight into the actual rates of enzymatically cata- using the KolmogoroveSmirnov test and Levene's test, respec- lyzed reactions under natural in situ conditions (Wallenstein and tively. The effects of the age of invasion and sampling date were Weintraub, 2008). subjected to a two-way analysis of variance (two-factor ANOVA) in 2 1 Soil basal respiration rate (mmol CO2 m s ) was measured at order to examine the effects of the independent variables of the four random points in the invaded and non-invaded replicates model. When interactions between independent variables were using a Li-COR 6000-09 soil respiration chamber connected to a Li- found, the main effects were ignored to avoid misleading inter- COR 6200 IRGA detector (LI-COR, Lincoln, NE, USA). Prior to mea- pretation, and the simple main effects were investigated through surements, the soil surface layer was removed to avoid the respi- pairwise comparisons using Tukey's HSD post-hoc test. In the ration of surface roots. The exposed soil surface was immediately absence of interactions, one-way ANOVA was carried out to iden- covered to protect it from solar influence, and measurements were tify single effects of each variable and Tukey's HSD test was carried taken after 25 min to ensure the stabilization of gas exchange. out as the post-hoc test for mean separations. KruskaleWallis test Environmental conditions (relative humidity, air and soil temper- was used when normality assumptions were not satisfied. Pear- ature, air flow and CO2 concentration) were recorded during each son's correlation was carried out to assess the linear relationship measurement and used as covariables in the statistical treatment of between soil parameters and microbial values. Soil basal respira- data. tion data were subjected to ANCOVA, using measured environ- mental conditions as covariables. Soil respiration data were 2.5. Soil microbial community structure. DGGE analyses transformed according to significant variables and then submitted to ANOVA. GelCompar II (Applied Maths, Belgium) was used in the Before electrophoresis, soil DNA was extracted and amplified. cluster analysis of soil bacteria and fungi based on the DGGE re- DNA extraction was carried out using a Power Soil™ DNA Isolation sults. The unweighted pair-group method with arithmetic mean Kit (MO BIO Laboratories, Inc., CA). 0.15e0.20 g of soil aliquot was algorithm and the Pearson productemoment correlation coeffi- used for each sample extraction and stored at 20 C. The DNA cient were used for the analysis. Richness, defined as the number of extracted was amplified using eubacteria-specificprimer2(50- species, was estimated as the total number of bands per sample. To ATTACCGCGGCTGCTGG-30)andprimer3(withaGCclamp)(50- estimate abundance and diversity, defined as the number of in- CGCCCGCCGC GCGCGGCG GGCGGGGCGGGGGCACGGGGGGCC- dividuals and their relative frequency, gel bands were classified TACGGGAGGAGCAG-30) for the 16S rRNA gene (Muyzer et al., according to their intensity in six categories. Diversity was calcu- 0 1993) and fungal specific-primers ITS4-GC (5 - lated using a modification of the Shannon index, H' ¼ eS [(ni/ CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGTC N) Ln (ni/N)] where ni had one of four possible values (1e6), CTCCGCTTATTGATATGC-30)andITS1F(50-CTTGGTCATTTA- depending on band intensity. However, we assume that ecological GAGGAAGTAA-30) targeted at the fungal 18S rRNA gene (White parameters as defined here require a cautious interpretation since et al., 1990; Gardes and Bruns, 1993). Experimental conditions bands from DGGE cannot be unmistakably translated into bacterial for DNA amplification are described in Lorenzo et al. (2010a, or fungal species. All statistical tests were performed using SPSS 2013). All reactions were carried out in a final volume of 25 mL v19.0 Software (SPSS Inc., Chicago, IL, USA). 318 P. Souza-Alonso et al. / Soil Biology & Biochemistry 80 (2015) 315e323

3. Results Table 2 Two way ANOVA results including independent variables (date and age of invasion) and interaction for the different enzymatic activities. Values in bold indicate sig- 3.1. Soil chemical parameters nificant differences. D A, indicates the interaction between independent variables. AP, acid phosphatase; BG, b-glucosidase; Ur, urease; NAGase, N-acetyl-glucosami- Soil parameters were significantly modified in the different ages nidase; PPO, polyphenol oxidase; GAP, glycine aminopeptidase. of invasion. Consequently, individual comparisons were carried out AP BG Ur NAGase PPO GAP (Table 1). Soil pH was not modified during the first years of inva- < < < < < sion; however, the reduction was significant (1 unit of pH) in long- Date 0.611 0.001 0.001 0.001 0.001 0.001 Age of invasion <0.001 <0.001 0.859 <0.001 0.01 0.402 > term invaded areas (15 and 25). C, N and P values were progres- D A 0.148 <0.001 0.158 <0.001 <0.001 0.387 sively enhanced and reached their highest values after 15 years of invasion. C and N increased significantly with a cumulative per- centage of 564% and 567% in long-term invaded patches. In >25 heavily in spring (73%, p 0.001) and autumn (93%, p 0.001). AP years patches, Pt and Pa experienced an increase of 38% and 64% activity in the 15 years area also increased significantly in spring respectively. NO2 and NO3 increased progressively over time (61%, p 0.01) and in autumn (69%, p 0.05). In addition, AP ac- achieving their maximum value 15 years after invasion (62% and tivity also increased heavily during spring in the 7 years area (144%, 175% respectively). They finally achieved similar values to those of p 0.001). The activity of BG also enhanced significantly in the >25 þ non-invaded patches. NH4 suffered a dramatic increase in the area in spring and autumn (300% and 138%, respectively; recently invaded patches (855%), but there were slight significant p 0.001). This could also be noticed in the 15 years area during the þ 2þ 2þ differences in the long term (19%). K ,Ca and Mg values same dates (434%, p 0.001, 113%, p 0.01, respectively) and in the þ showed different trends in the different invasion ages. K values 7 years area (201%, p 0.05 in winter and 270%, p 0.001 in remained the same without significant modification until 15 years spring). No significant alterations were collected in the recently þ 2þ from invasion, when K values diminished significantly. Ca invaded area. values increased substantially in the mid-term but returned to As in the case of AP and BG, NAGase activities increased regu- 2þ control values in the long term. Mg values were practically un- larly throughout the year in the >25 years area (28%, p 0.05 in altered. C:N ratio showed a variable trend without significant dif- winter; 156%, p 0.001 in spring; and 666%, p 0.001 in autumn) ferences after a long-term invasion. N:P ratio and C:P ratio and in the 15 years area (30%, p 0.05 in winter; 193%, p 0.001 in increased progressively and achieved significant differences in soils spring; and 369%, p 0.01 in autumn). The activity of Ur increased after 7 years of A. dealbata invasion and reached fivefold the non- significantly during spring in long-term and mid-term invaded invaded values after 25 years of invasion. patches (395%, p 0.01 in >25 area, 352%, p 0.05 in 15 years area and 402%, p 0.01 in 7 years area). The activity of GAP and PPO in 3.2. Microbial community function areas with A. dealbata presence was unaffected or slightly reduced (PPO activity in March). 3.2.1. Enzymatic activities Independent variables significantly influenced EA, both indi- 3.2.2. Soil respiration measurements vidually but also in combination (Table 2). However, the effects ANCOVA results indicated that the air temperature (p 0.05) collected were enzyme-dependent. The activity of AP was inde- and the concentration of CO2 (p < 0.01) were significantly influ- pendent of the sampling date whereas the invasion age did not encing soil respiration. Therefore, respiration data were trans- exert significant influence on Ur and GAP activities. At the same formed according to these variables and submitted to ANOVA. time, the interaction effect between independent variables was Results from ANOVA reflected a significant enhancement in SBR in observed in the activity of BG, NAGase and PPO. areas where A. dealbata was present throughout the year (Fig. 2; Individually, EA seemed to generally enhance after invasion p 0.001, p 0.001 and p 0.001 in winter, spring and autumn, (Fig. 1). Also, alterations of activities in long-term invaded sites (15 respectively). During the winter, soil basal respiration was signifi- and >25 years) were larger in comparison with the EA of control cantly increased in all invaded areas compared with control such as patches. The activity of AP generally enhanced in long-term <3 years (34%, p 0.001), 7 years (31%, p 0.01), 15 years (50%, invaded areas. In fact, AP activity in the >25 area increased p 0.001) and >25 years invaded areas (36%, p 0.001). During

Table 1 Soil nutrients results (mean ± SE) in areas with different ages of invasion of A. dealbata. Soil nutrient content is reflected as dry weight content. Different letters (italics) indicate significant differences in Tukey-HSD post-hoc test.

Invasion age

Native <3 years 5e10 years 10e20 years >25 years Significance in ANOVA

pH 4.76 ± 0.01a 4.75 ± 0.27a 4.73 ± 0.01ab 3.72 ± 0.01b 3.83 ± 0.01b 0.004 SOM (%) 11.3 ± 0.48a 21.13 ± 2.43b 29.81 ± 0.17b 67.75 ± 0.09c 75.13 ± 0.18c <0.001 C (g/Kg) 65.55 ± 0.27a 122.51 ± 14.06b 172.80 ± 0.97c 392.76 ± 0.52c 435.56 ± 1.07c <0.001 N (g/Kg) 2.88 ± 0.02a 4.90 ± 0.34b 10.81 ± 0.06c 12.83 ± 0.04c 19.22 ± 0.08c <0.001 P (mg/kg) 205.58 ± 0.87a 349.14 ± 23.75b 346.41 ± 5.22b 465.01 ± 4.30c 282.92 ± 9.31bc <0.001

Pa (mg/Kg) 30.93 ± 0.47a 58.81 ± 8.27b 45.60 ± 0.70b 60.66 ± 0.79b 50.69 ± 0.12b <0.001 þ Ca2 exc (mg/kg) 603.33 ± 51.04a 1328.61 ± 341.1ab 2472.50 ± 13.91b 1369.17 ± 11.02b 504.17 ± 29.20ab 0.04 þ K exc (mg/kg) 1459.66 ± 21.15a 1631.61 ± 306.95a 1453.08 ± 45.89a 649.83 ± 9.11b 842.42 ± 50.65b 0.008 þ Mg2 exc (mg/kg) 1472.42 ± 4.31a 1534.19 ± 180.11a 1374.83 ± 27.45ab 953.33 ± 9.35b 1234.91 ± 19.02ab 0.009 NO2 (mg/kg) 0.37 ± 0.016a 0.55 ± 0.033b 0.30 ± 0.001c 0.60 ± 0.002b 0.36 ± 0.07a 0.001 NO3 (mg/kg) 20.30 ± 2.23a 31.98 ± 3.83b 25.70 ± 1.45ab 55.80 ± 1.88c 11.47 ± 0.89d 0.002 þ NH4 (mg/kg) 32.70 ± 0.85a 312.44 ± 32.42c 18.26 ± 7.63a 32.20 ± 1.09a 38.87 ± 1.37b <0.001 Soil C:N ratio 22.70 ± 0.10a 24.54 ± 2.01a 15.99 ± 0.10b 30.62 ± 0.05c 22.67 ± 0.04a 0.013 Soil N:P ratio 14.05 ± 0.07a 14.70 ± 1.47a 31.21 ± 0.34c 27.59 ± 0.29b 68.02 ± 2.13d 0.001 Soil C:P ratio 318.85 ± 2.78a 382.05 ± 60.48ab 498.82 ± 8.72b 844.66 ± 8.16c 1539.56 ± 48.14d 0.007 P. Souza-Alonso et al. / Soil Biology & Biochemistry 80 (2015) 315e323 319

100 60 b

80 -1 b -1 *** 45 ab ) 60 ) -1 ** -1 b c mol pNP·g

mol pNP·g * 30 μ μ *** ** a 40 ab b b a dry soil·h dry dry soil·h dry 15 20 a a AP activity activity ( AP BG activity ( a a a

0 0

12 0,3 c -1 0,25

-1 9 ·g + 4 0,2 ) ) 1 mol pNP·g bc - -1 μ 6 mol NH mol 0,15 μ b b b ab ab dry soil·h dry dry soil·h dry 0,1 a b 3 ** * ** b

Ur activity activity ( Ur a 0,05 a a a a NAGase activity ( NAGase activity

0 0

60 4 1 - 45 3 a ) 1 - )

1 ab - 30 2 ab dry soil·h dry b -1 dry soil·h dry g 15 1 b PPO activity (nmol pyrogallol PPO activity GAP activity pNA·g activity (nmol GAP 0 0 Winter Spring Autumn Winter Spring Autumn

Fig. 1. Enzymatic activity results (mean ± SE) for the selected enzymes in the different sampling dates. The charts in the left column (AP, Ur and GAP activities) represent data analyzed using ANOVA. The values above the horizontal lines indicate the results of ANOVA, comparing different ages of invasion. Asterisks indicate significant differences with respect to the control, using Tukey HSD as post-hoc test. *p 0.05; **p 0.01 and ***p 0.001. The charts in the right column (BG, NAGase and PPO activities) represent data analyzing simple main effects and using Tukey's HSD post-hoc test. Different letters indicate significant differences. Note the distinct scale for the different enzymes. spring, respiration significantly increased in <3 (42%, p 0.001) No differences dealing with bacteria richness, density and di- and >25 areas (43%, p 0.001), and slightly enhanced in the 15 versity were found (Fig. 4). On the contrary, fungi richness, density years area (28%, p 0.05). The increase in soil respiration during and diversity were significantly altered in A. dealbata soils (ANOVA: autumn was limited to the recently invaded area (97%, p 0.001) p 0.001; p 0.001 and p 0.006, respectively). All parameters and 15 years area (47%, p 0.001). decreased in the <3 years and 7 years invaded areas. An opposite trend was observed in long-term invaded soils: richness, density and diversity increased significantly. Richness, density and bacte- 3.3. Microbial community structure rial diversity detected using PCR-DGGE were higher than soil fungi.

The cluster analyses showed a different trend of results depending on the microbial group considered. However, a tree di- 4. Discussion agram was rather accurate to separate different ages of invasion (Fig. 3). Control and recent invaded ages (<3 years and 7 years area) 4.1. Soil nutrients were clustered together and separated from long-term invaded ages in bacteria. Similarly, recently invaded patches were also In the present study, soil nutrients were significantly modified clustered together in a fungi tree diagram. However, control soils along the chronological gradient of the A. dealbata invasion in were clustered together between 15 and >25 areas. Atlantic mixed forests e mainly pools related to N and C cycling. An 320 P. Souza-Alonso et al. / Soil Biology & Biochemistry 80 (2015) 315e323

15 Contrasting recent findings for A. dealbata (Castro-Díez et al., 2012) but according to Lorenzo et al. (2010a), nutrient variation seems to derive from the enhancement in soil organic matter 12 ) *** *** 1

- (SOM). The alteration in the SOM input entailed higher C and N * · s levels under the invasion by A. dealbata, which progressively 2

·m 9 *** increased in accordance with the age of invasion. Consequently, due 2 to the huge amount of SOM, a significant drop in pH values has been recorded (Ritchie and Dolling, 1985). *** * mol CO 6 ** fi μ *** Due to their relationship with N2- xer bacteria, acacias improve

( *** Soil Basal Respiration soil N levels, but also concentrate other nutrients in the top layers of the soil (Witkowski, 1991). In our case, besides the sustaining and 3 linear increase in C, N and P, the enhancement in soil nutrients such þ þ þ as K ,Ca2 and Mg2 seems to be temporary and to even decrease þ 0 the availability of K after a long-term invasion. Moreover, the N- Winter Spring Autumn fixing ability of A. dealbata also leads us to expect modifications in N:P and C:N ratios. However, N enrichment did not correspond Fig. 2. Soil basal respiration rate (mean ± SE) under the different treatments during sampling dates. Asterisks indicate significant differences with respect the control in with P levels, which grew slightly, with probable consequences at ANOVA with Tukey HSD as post-hoc test. *p 0.05; **p 0.01 and ***p 0.001. ecosystem-level due to the influence of the N:P ratio on the func- tional diversity of soil microbial community (Liu et al., 2010). alteration of nutrient pools in soils where A. dealbata is present has Changes in the C:N ratio did not follow a predictable trend. Litter been previously indicated in recent works (Lorenzo et al., 2010a). decomposition rates of invasive species are generally higher than However, our results reflect the chronological effect of Acacia in- those of native ones (Ehrenfeld, 2003), and diminished values in vasion. This suggests that, besides the presence of A. dealbata, the this ratio are indicators of enhanced litter decomposition. There- age of invasion is a significant factor influencing the degree of fore, low C:N values were expected. Indeed, we previously found a nutrients change in soil nutrients. significant reduction in C:N ratio in mixed forests (Souza-Alonso et al., 2014). Hence, this ratio seems to be variable depending on

Fig. 3. Dendrograms of soil bacteria and fungi community structure based on PCR- DGGE bands, using the unweighted pair-group method with arithmetic mean algo- Fig. 4. Richness, abundance and diversity (H0) in bacteria and fungi communities in rithm and the Pearson productemoment correlation coefficient. (a) Bacteria dendro- the different ages of invasion. Different letters indicate significant differences in gram, (b) Fungi dendrogram. ANOVA with Tukey HSD as the post-hoc test. P. Souza-Alonso et al. / Soil Biology & Biochemistry 80 (2015) 315e323 321 the age of invasion. However, due to the constant inputs of SOM and investment (http://www.sciencedirect.com/science/article/pii/ the balanced deposition of C and N in the invasive litter, the C:N S0038071706001878Allison and Vitousek, 2005), as in the case of ratio should remain stable in A. dealbata invaded soils in the long- PPO. On the other hand, although it was expected to decrease with term. Gradualism in the impact on soil parameters has already been higher N availability, the activity of NAGase, and less pronounced Ur suggested for other woody acacias, such as A. longifolia (Marchante activity (significantly in spring), was generally increased in invaded et al., 2008b). Even with high litter inputs, soil C and N accumula- areas. Ur activities seem to generally increase after an exotic plant tion takes time, and therefore recently invaded areas are more invasion (Allison et al., 2006; Li et al., 2006; Chacon et al., 2009) and likely to achieve a successful restoration (Marchante et al., 2008b). N fertilization (Guo et al., 2011). On the contrary, NAGase results Long-term impacts during invasive processes of A. dealbata showed a consistent trend of increasing activity according to emphasize the importance of an early detection of these invasions. Michel and Matzner (2003), who found increased or no effects on In fact, it is crucial to minimize the impact on ecosystems and to NAGase activity under N supply. An enhancement in NAGase ac- reduce costs and efforts that derive from its management; since tivities could indicate alterations on fungal community because this exotic plant species often develop a legacy effect in invaded soils enzyme is expressed by a diverse group of fungi (Miller et al., 1998). through their litter inputs (Meisner et al., 2012; Novoa et al., 2013). However, these changes can only be ascribed to long term invaded areas (15 and >25 years after invasion). 4.2. Microbial community function and structure In our case, a decrease in pH and N enrichment can provide us with evidence to explain the change towards a fungi dominated As we expected, soil enzymatic activities (EAs) were generally community. Firstly, the ability of A. dealbata to alter soil fungal and enhanced in patches invaded by A. dealbata, suggesting an accel- bacterial communities has already been suggested (Lorenzo et al., eration of the nutrient cycling. As a general statement, in our study, 2010a). Secondly, low pH favors, in general, conditions for fungal areas with a longer history of invasion presented higher EAs, as dominance (Bååth and Anderson, 2003; de Vries et al., 2006), occurs with soil main nutrients C, N and P. Significant changes on whereas N enrichment can promote different responses in the individual EAs across annual sampling dates have been detected, fungal/bacterial ratio (Bardgett et al., 1999; de Vries et al., 2006). As with the exception of Ur and GAP. However, general trends seemed in the case of enzymatic activities, soil basal respiration is generally to be consistent in the enzymes included in this assay. Neverthe- enhanced in the presence of exotic plant invaders (Yang et al., 2007; less, interactions within the sampling date and invasion age in the Marchante et al., 2008b; Yang et al., 2010). However, similarly to the two-way ANOVA indicate that BG, NAGase and PPO activities are process that takes place under A. dealbata canopy, N mineral probably influenced by the sampling date. fertilization can also produce a decrease in soil basal respiration The availability of P increased significantly under invasion, so an (Schimel and Weintraub, 2003). In our case, according to enzymatic enhancement in the AP activity, indicating higher P mineralization, activities, the results of soil basal respiration reflect an impulse in was not expected. According to Allison and Vitousek (2005),an the activity of soil microbial community after the A. dealbata “apparent” limitation (in spite of P values, which were not limiting) invasion. in P availability due to SOM enrichment could be a strong incentive In light of DGGE results, soil fungi seemed to be less resistant to for microbes to invest in P acquisition. In addition, the C:P ratio in invasion than bacteria. These results partially support our original non-invaded sites is close to 300:1, which is suggested as a hypothesis, since we expected larger changes due to longer inva- threshold from which C:P becomes critical (Blair, 1988). Above this sion times in the diversity and richness of both bacterial and fungal threshold, immobilization occurs, and microorganisms are forced communities under A. dealbata invasion. Nevertheless, the cluster to scavenge soil for P. Therefore, AP activity should hypothetically analyses strongly suggested that the age of invasion is a crucial increase where differences in C:P and N:P ratios enhance signifi- factor for structuring both fungal and bacterial communities. As cantly, as occurred in medium and long-term invaded sites. inferred by fingerprint arrangement, the structure of soil bacterial The trend of increased BG activity in long-term invaded areas community seemed to be resistant during the first years of (15 and >25 years after invasion) and along the year indicate an A. dealbata presence but progressively altered. This fact could lead acceleration in C mineralization under the invasion by A. dealbata, to a change in the structure of microbial community, favoring since BG activity is considered the rate limiting step in cellulose species with positive feedback with A. dealbata (like species related decomposition (Gong and Tsao, 1979; Michel and Matzner, 2003). to N2-fixation). In fact, associated rhizobia communities in Acacia Possibly, the increase of SOM and the acidification cause the rise of invasions can also be exotic, probably co-introduced with the BG activity since fungi are proposed to be the predominant source invasive legume (Rodríguez-Echeverría et al., 2007; Rodríguez- of BG in certain soils (http://www.sciencedirect.com/science/ Echevarría, 2010; Ndlovu et al., 2013). On the other hand, the article/pii/S0038071711001313Hayano and Tubaki, 1985) and fungal community structure was initially altered but gradually fungal community is more tolerant than bacteria to acid soil con- seemed to become similar to non-invaded soils (>25 years and ditions (Hogberg€ et al., 2007). control were closely related). However, the increase of NAGase (an High concentrations of available N seem to exert negative in- indicator of fungal activity) together with the decrease of pH, fluence on the degradation of lignin due to their effects on phenol indicate the possibility of a different scenario in long-term invaded oxidase (Carreiro et al., 2000; Frey et al., 2004). In addition, the areas. Changes in fungal community structure at early stages of the decrease of pH under A. dealbata could also contribute to reduced A. dealbata invasion partially accord with the results obtained by PPO activity since phenol oxidase activities increase with pH Lorenzo et al. (2010a) in grassland soils. However, these authors do (http://www.sciencedirect.com/science/article/pii/ not identify the exact point at which the invasion took place. This S0038071709003915Williams et al., 2000). In this context, an in- period is crucial, since our results suggest that the impact of the vestment in PPO seems to be worthless to achieve C due to the large presence of A. dealbata in the structure and diversity of soil mi- and available pools of C in soils invaded by A. dealbata. Differential crobial communities does not follow a linear trend. Therefore, these effects of A. dealbata invasion on N-degrading enzymes seem to be findings highlight the importance of the time that has passed since related to N sources. Enhanced NAGase activity contrasts with the the alien introduction. Nevertheless, changes in soil community absence of effect in the activity of GAP and the slight effect on Ur. composition do not entail per se changes in the microbial com- High N availability provided by other sources probably makes the munity activity and vice versa. In fact, Marchante et al. (2008a) production and release of GAP to degrade proteins a useless suggested a relationship between catabolic diversity and 322 P. Souza-Alonso et al. / Soil Biology & Biochemistry 80 (2015) 315e323 community structure, whereas other authors reported changes in De Vries, F.T., Hoffland, E., van Eekeren, N., Brussaard, L., Bloem, J., 2006. Fungal/ the catabolic activity without necessarily altering soil microbial bacterial ratios in grasslands with contrasting nitrogen management. Soil Biology & Biochemistry 38, 2092e2103. community composition and diversity (Orwin et al., 2006). Dostal, P., Müllerova, J., Pysek, P., Pergl, J., Klinerova, T., 2013. The impact of an invasive plant changes over time. Ecology Letters 16, 1277e1284. 5. Conclusions Ehrenfeld, J.G., 2003. Effects of exotic plant invasions on soil nutrient cycling pro- cesses. Ecosystems 6, 503e523. Ehrenfeld, J.G., 2010. Ecosystem consequences of biological invasions. Annual Re- Our results indicate that the invasion by A. dealbata gradually views in Ecology Evolution and Systematics 41, 59e80. changes the soil ecosystem in terms of pH, SOM, nutrients, and soil Elgersma, K.J., Ehrenfeld, J.G., 2011. Linear and non-linear impacts of a non-native plant invasion on soil microbial community structure and function. Biological community function and structure. Furthermore, alterations in soil Invasions 13, 757e768. parameters were not reversed or alleviated even after longer in- Frey, S.D., Knorr, M., Parrent, J.L., Simpson, R.T., 2004. Chronic nitrogen enrichment vasion periods. Therefore, these results emphasize the importance affects the structure and function of the soil microbial community in temperate hardwood and pine forests. Forest Ecology and Management 196, 159e171. of the time elapsed from the appearance of the exotic invader in Gardes, M., Bruns, T.D., 1993. ITS primers with enhanced specificity for order to understand the patterns of invasion. The use of pop- basidiomycetes-application to the identification of mycorrhizae and rusts. ulations invaded over time provides a more comprehensive picture Molecular Ecology 2, 113e118. that information based on a single sampling date or short-time Gong, C.S., Tsao, G.T., 1979. Cellulase and biosynthesis regulation. Annual Reports on Fermentation Processes 3, 111e140. invaded periods' Additionally, accumulated rate of change, as Gonzalez-Mu noz,~ N., Costa-Tenorio, M., Espigares, T., 2012. Invasion of alien Acacia indicated in this assay, appears as an important factor to keep in dealbata on Spanish Quercus robur forests: impact on soils and vegetation. e mind in invasive plant control in order to reduce ecological damage Forest Ecology and Management 269, 214 221. Guitian-Ojea, F., Carballas, T., 1976. Tecnicas de analisis de suelos (in Spanish). Pico and costs of management operations. Sacro, Santiago de Compostela. Guo, P., Wang, C., Feng, X., Su, M., Zhu, W., Tian, X., 2011. Mixed inorganic and Acknowledgments organic nitrogen addition enhanced extracellular enzymatic activities in a subtropical forest soil in east China. Water, Air, and Soil Pollution 216, 229e237. Hawkes, C.V., Belnap, J., D'Antonio, C., Firestone, M.K., 2006. Arbuscular mycorrhizal We thank the forest community of Ribadavia for approving our assemblages in native plant roots change in the presence of invasive exotic soil sampling so easily and especially to its president Benito Alonso grasses. Plant and Soil 281, 369e380. Hayano, K., Tubaki, K., 1985. Origin and properties of b-glucosidase activity of for his kindness and helpful comments. We thank our colleague tomato-field soil. Soil Biology & Biochemistry 17, 553e557. Oscar Martínez for his technical support. We thank the Xunta de Hogberg,€ M.N., Hogberg, P., Myrold, D.D., 2007. Is microbial community composi- Galicia for its necessary funding and support through the PGIDI- tion in boreal forest soils determined by pH, C-to-N ratio, the trees, or all three? Oecologia 150, 590e601. T05RAG31001PR project. We also thank valuable comments pro- Hoorens, B., Aerts, R., Stroetenga, M., 2003. Does initial litter chemistry explain litter vided by anonymous reviewers and editor that substantially mixture effects on decomposition? Oecologia 137, 578e586. improve the final version of this manuscript. Hoyos, L.E., Gavier-Pizarro, G.I., Kuemmerle, T., Bucher, E.H., Radeloff, V.C., Tecco, P.A., 2010. Invasion of glossy privet (Ligustrum lucidum) and native forest loss in the Sierras Chicas of Cordoba, Argentina. Biological Invasions 12, References 3261e3275. Jakmunee, J., Junsomboon, J., 2009. Determination of available phosphorus in soils Allison, S.D., Vitousek, P.M., 2005. Responses of extracellular enzymes to simple and by using a new extraction procedure and a flow injection amperometric system. complex nutrient inputs. Soil Biology & Biochemistry 37, 937e944. Talanta 79, 1076e1080. Allison, S.D., Nielsen, C., Hughes, F., 2006. Elevated enzyme activities in soils under Kandeler, E., Gerber, H., 1988. Short-term assay of soil urease activity using the invasive nitrogen-fixing tree Falcataria moluccana. Soil Biology & colorimetric determination of ammonium. Biology and Fertility of Soils 6, Biochemistry 38, 1537e1544. 68e72. Bååth, E., Anderson, T.H., 2003. Comparison of soil fungal/bacterial ratios in a pH Kandeler, E., Stemmer, M., Klimanek, E.M., 1999. Response of soil microbial biomass, gradient using physiological and PLFA-based techniques. Soil Biology & urease and xylanase within particle size fraction to long-term soil management. Biochemistry 35, 955e963. Soil Biology & Biochemistry 31, 261e273. Bardgett, R.D., Mawdsley, J.L., Edwards, S., Hobbs, P.J., Rodwell, J.S., Davies, W.J., Kempers, A.J., 1974. Determination of sub-microquantities of ammonium and ni- 1999. Plant species and nitrogen effects on soil biological properties of trates in soils with phenol, sodium-nitroprusside and hypochlorite. Geoderma temperate upland grasslands. Functional Ecology 13, 650e660. 12, 201e206. Blair, J.M., 1988. Nitrogen, sulfur and phosphorus dynamics in decomposing de- Klironomos, J.N., 2002. Feedback with soil biota contributes to plant rarity and ciduous leaf litter in the southern appalachians. Soil Biology & Biochemistry 20, invasiveness in communities. Nature 417, 67e70. 693e701. Li, W.-H., Zhang, C.-B., Jiang, H.-B., Xin, G.-R., Yang, Z.-Y., 2006. Changes in soil Bray, R.H., Kurtz, L.T., 1945. Determination of total, organic and available forms of microbial community associated with invasion of the exotic weed, Mikania phosphorus in soils. Soil Science 59, 39e45. micrantha H.B.K. Plant and Soil 281, 309e324. Brewer, S., 2008. Declines in plant species richness and endemic plant species in Liu, Z., Fu, B., Zheng, X., Liu, G., 2010. Plant biomass, soil water content and soil N:P longleaf pine savannas invaded by Imperata cylindrica. Biological Invasions 10, ratio regulating soil microbial functional diversity in a temperate steppe: a 1257e1264. regional scale study. Soil Biology & Biochemistry 42, 445e450. Broz, A.K., Manter, D.K., Vivanco, J.M., 2007. Soil fungal abundance and diversity: Lorenzo, P., Rodríguez-Echeverría, S., Gonzalez, L., Freitas, H., 2010a. Effect of another victim of the invasive plant Centaurea maculosa. ISME Journal 1, invasive Acacia dealbata Link on soil microorganisms as determined by PCR- 763e765. DGGE. Applied Soil Ecology 44, 245e251. Carreiro, M.M., Sinsabaugh, R.L., Repert, D.A., Parkhurst, D.F., 2000. Microbial Lorenzo, P., Gonzalez, L., Reigosa, M.J., 2010b. The genus Acacia as invader: the enzyme shifts explain litter decay responses to simulated nitrogen deposition. characteristic case of Acacia dealbata Link in Europe. Annuals of Forest Science Ecology 81, 2359e2365. 67, 101e110. Castro-Díez, P., Gonzalez-Mu noz,~ N., Alonso, A., Gallardo, A., Poorter, L., 2009. Ef- Lorenzo, P., Palomera-Perez, A., Reigosa, M.J., Gonzalez, L., 2011. Allelopathic inter- fects of exotic invasive trees on nitrogen cycling: a case study in Central Spain. ference of invasive Acacia dealbata Link on the physiological parameters of Biological Invasions 11, 1973e1986. native understory species. Plant Ecology 212, 403e412. Castro-Díez, P., Fierro-Brunnenmeister, N., Gonzalez-Mu noz,~ N., Gallardo, A., 2012. Lorenzo, P., Pereira, C.S., Rodríguez-Echeverría, S., 2013. Differential impact on soil Effects of exotic and native tree leaf litter on soil properties of two contrasting microbes of allelopathic compounds released by the invasive Acacia dealbata sites in the Iberian Peninsula. Plant and Soil 350, 179e191. Link. Soil Biology & Biochemistry 57, 156e163. Chacon, N., Herrera, I., Flores, S., Gonzalez, J.A., Nassar, J.M., 2009. Chemical, phys- M.A.P.A, 1994. Metodos Oficiales de Analisis. Suelos y Aguas (in Spanish). Ministerio ical, and biochemical soil properties and plant roots as affected by native and de Agricultura, Pesca y Alimentacion, Madrid. exotic plants in Neotropical arid zones. Biology and Fertility of Soils 45, Marchante, E., Kjøller, A., Struwe, S., Freitas, H., 2008a. Invasive Acacia longifolia 321e328. induce changes in the microbial catabolic diversity of sand dunes. Soil Biology & Dasonville, N., Guillaumaud, N., Piola, F., Meerts, P., Poly, F., 2011. Niche construction Biochemistry 40, 2563e2568. by the invasive Asian knotweeds (species complex Fallopia): impact on activity, Marchante, E., Kjøller, A., Struwe, S., Freitas, H., 2008b. Short- and long-term im- abundance and community structure of denitrifiers and nitrifiers. Biological pacts of Acacia longifolia invasion on the belowground processes of a Medi- Invasions 13, 1115e1133. terranean coastal dune ecosystem. Applied Soil Ecology 40, 210e217. de Abreu, R.C.R., Durigan, G., 2011. Changes in the plant community of a Brazilian Meisner, A., de Boer, W., Cornelissen, J.H.C., van der Putten, W.H., 2012. Reciprocal grassland savannah after 22 years of invasion by Pinus elliottii Engelm. Plant effects of litter from exotic and congeneric native plant species via soil nutri- Ecology and Diversity 4, 269e278. ents. PLoS ONE 7 art. no. e31596. P. Souza-Alonso et al. / Soil Biology & Biochemistry 80 (2015) 315e323 323

Michel, K., Matzner, E., 2003. Response of enzyme activities to nitrogen addition in Sinsabaugh, R.L., 2010. Phenol oxidase, peroxidase and organic matter dynamics of forest floors of different C-to-N ratios. Biology and Fertility of Soils 38, 102e109. soil. Soil Biology & Biochemistry 42, 391e404. Miller, M., Palojarvi, A., Rangger, A., Reeslev, M., Kjøller, A., 1998. The use of fluo- Sinsabaugh, R.L., Antibus, R.K., Linkins, A.E., McClaugherty, C.A., Rayburn, L., rogenic substrates to measure fungal presence and activity. Soil Applied and Repert, D., Weiland, T., 1992. Wood decomposition over a first-order watershed: Environmental Microbiology 64, 613e617. mass loss as a function of lignocellulase activity. Soil Biology & Biochemistry 24, Muyzer, G., de Waal, E.C., Uitterlinden, A.G., 1993. Profiling of complex microbial 743e749. populations by denaturing gradient gel electrophoresis analysis and polymer- Sinsabaugh, R.L., Antibus, R.K., Linkins, A.E., McClaugherty, C.A., Rayburn, L., ase chain reaction-amplified genes coding for 16S rRNA. Applied and Envi- Repert, D., Weiland, T., 1993. Wood decomposition: nitrogen and phos- ronmental Microbiology 59, 695e700. phorus dynamics in relation to extracellular enzyme activity. Ecology 74, Naseby, D.C., Lynch, J.M., 1997. Rhizosphere soil enzymes as indicators of pertur- 1586e1593. bations caused by enzyme substrate addition and inoculation of a genetically Souza-Alonso, P., Novoa, A., Gonzalez, L., 2014. Soil biochemical alterations and modified strain of Pseudomonas fluorescens on wheat seed. Soil Biology & microbial community responses under Acacia dealbata Link invasion. Soil Biochemistry 29, 1353e1362. Biology & Biochemistry 79, 100e108. Ndlovu, J., Richardson, D.M., Wilson, J.R.U., Le Roux, J.J., 2013. Co-invasion of South Strayer, D.L., 2012. Eight questions about invasions and ecosystem functioning. African ecosystems by an Australian legume and its rhizobial symbionts. Journal Ecology Letters 15, 1199e1210. of Biogeography 40, 1240e1251. Tabatabai, M.A., Bremner, J.M., 1969. Use of p-nitrophenol phosphate for assay of Nie, M., Gao, L.X., Yan, J.H., Fu, X.H., Xiao, M., Yang, J., Li, B., 2010. Population vari- soil phosphatase activity. Soil Biology & Biochemistry 1, 301e307. ation of invasive Spartina alterniflora can differentiate bacterial diversity in its Tronsmo, A., Harman, G.G., 1993. Detection and quantification of N-acetyl-b-D- rhizosphere. Plant Ecology 209, 219e226. glucosamine, chitobiosidase and endochitinase in solutions and gels. Analytical Novoa, A., Gonzalez, L., Moravcova, L., Pysek, P., 2013. Constraints to native plant Biochemistry 208, 14e18. species establishment in coastal dune communities invaded by Carpobrotus Van Der Putten, W.H., Klironomos, J.N., Wardle, D.A., 2007. Microbial ecology of edulis: implications for restoration. Biological Conservation 164, 1e9. biological invasions. ISME Journal 1, 28e37. Novoa, A., Rodríguez, R., Richardson, D., Gonzalez, L., 2014. Soil quality: a key factor Waldrop, M.P., Balser, T.C., Firestone, M.K., 2000. Linking microbial community in understanding plant invasion? The case of Carpobrotus edulis (L.) N.E.Br. composition to function in a tropical soil. Soil Biology & Biochemistry 32, Biological Invasions 16, 429e443. 1837e1846. Orwin, K.H., Wardle, D.A., Greenfield, L.G., 2006. Ecological consequences of carbon Wallenstein, M.D., Weintraub, M.N., 2008. Emerging tools for measuring and substrate identity and diversity in a laboratory study. Ecology 87, 580e593. modeling the in situ activity of soil extracellular enzymes. Soil Biology and Parmelee, R.W., Beare, M.H., Blair, J.M., 1989. Decomposition and nitrogen dynamics Biochemistry 40, 2098e2106. of surface weed residues in no-tillage agroecosystems under drought condi- White, T.J., Buns, T.D., Lee, S., Taylor, J., 1990. Analysis of phylogenetic relationships tions: influence of resource quality on the decomposer community. Soil Biology by amplification and direct sequencing of ribosomal RNA genes. In: Innis, M.A., & Biochemistry 21, 97e103. Gefland, D.H., Sninsky, J.J., White, T.J. (Eds.), PCR Protocols: a Guide to Methods Reinhart, K.O., Callaway, R.M., 2006. Soil biota and invasive plants. New Phytologist and Applications. Academic, New York, pp. 315e322. 170, 445e457. Williams, C.J., Shingara, E.A., Yavitt, J.B., 2000. Phenol oxidase activity in peatlands Reinhart, K.O., Greene, E., Callaway, R.M., 2005. Effects of Acer platanoides invasion in New York State: response to summer drought and peat type. Wetlands 20, on understory plant communities and tree regeneration in the Rocky Moun- 416e421. tains. Ecography 28, 573e582. Wilson, J.R.U., Gairifo, C., Gibson, M.R., Arianoutsou, M., Bakar, B.B., Baret, S., Celesti- Richardson, D.M., Rejmanek, M., 2011. Trees and shrubs as invasive alien species e a Grapow, L., Ditomaso, J.M., Dufour-Dror, J.M., Kueffer, C., Kull, C.A., global review. Diversity and Distributions 17, 788e809. Hoffmann, J.H., Impson, F.A.C., Loope, L.L., Marchante, E., Marchante, H., Ritchie, G.S.P., Dolling, P.J., 1985. The role of organic matter in soil acidification. Moore, J.L., Murphy, D.J., Tassin, J., Witt, A., Zenni, R.D., Richardson, D.M., 2011. Australian Journal of Soil Research 23, 569e576. Risk assessment, eradication, and biological control: global efforts to limit Rodríguez-Echeverría, S., 2010. Rhizobial hitchhikers from Down Under: invasional Australian acacia invasions. Diversity and Distributions 17, 1030e1046. meltdown in a plant-bacteria mutualism? Journal of Biogeography 37,1611e1622. Wirth, S.J., Wolf, G.A., 1992. Microplate colourimetric assay for endo-acting cellu- Rodríguez-Echeverría, S., Crisostomo, J.A., Freitas, H., 2007. Genetic diversity of lase, xylanase, chitinase, 1,3, b-glucanase and amylase extracted from forest soil rhizobia associated with Acacia longifolia in two stages of invasion of coastal horizons. Soil Biology & Biochemistry 24, 511e519. sand dunes. Applied Environmental Microbiology 73, 5066e5070. Witkowski, E.T.F., 1991. Effects of invasive alien acacias on nutrient cycling in the Rodríguez-Echeverría, S., Le Roux, J.J., Crisostomo, J.A., Ndlovu, J., 2011. Jack-of-all- coastal lowlands of the Cape fynbos. Journal of Applied Ecology 28, 1e15. trades and master of many? How does associated rhizobial diversity influence Wolfe, B.E., Klironomos, J.N., 2005. Breaking new ground: soil communities and the colonization success of Australian Acacia species? Diversity and Distribu- exotic plant invasion. Bioscience 55, 477e487. tions 17, 946e957. Yang, Z., Li, W., Zhang, C., Gao, G., Zan, Q., 2007. Relationship between Mikania Schimel, J.P., Weintraub, M.N., 2003. The implications of exoenzyme activity on micrantha invasion and soil microbial biomass, respiration and functional di- microbial carbon and nitrogen limitation in soil: a theoretical model. Soil versity. Plant and Soil 296, 197e207. Biology & Biochemistry 35, 549e563. Yang, Z., Fan, L., Chen, Y., Yuan, J., 2010. The effect of Lantana camara Linn. invasion Sheppard, A.W., Shaw, R.H., Sforza, R., 2006. Top 20 environmental weeds for on soil chemical and microbiological properties and plant biomass accumula- classical biological control in Europe: a review of opportunities, regulations and tion in southern China. Geoderma 154, 370e378. other barriers to adoption. Weed Research 46, 93e117. Chapter 5 Gradualism in A. dealbata invasion

Chapter 6 Effectiveness of management strategies

PART IV What can we do?

Chapter 6 Effectiveness of management strategies

Chapter 6 Effectiveness of management strategies

Chapter 6. Effectiveness of management strategies in Acacia dealbata Link invasion, native vegetation and soil microbial community responses

Souza-Alonso, P., Lorenzo, P., Rubido-Bará, M., González, L., 2013. Effectiveness of management strategies in Acacia dealbata Link invasion, native vegetation and soil microbial community responses. For. Ecol. Manag. 304, 464-472.

Chapter 6 Effectiveness of management strategies

Author's personal copy

Forest Ecology and Management 304 (2013) 464–472

Contents lists available at SciVerse ScienceDirect

Forest Ecology and Management

journal homepage: www.elsevier.com/locate/foreco

Effectiveness of management strategies in Acacia dealbata Link invasion, native vegetation and soil microbial community responses ⇑ Pablo Souza-Alonso a, , Paula Lorenzo b, Margarita Rubido-Bará a, Luís González a a Department of Plant Biology and Soil Science, University of Vigo, 36310 Vigo, Spain b Centre for Functional Ecology, Department of Life Sciences, University of Coimbra, Calçada Martim de Freitas, 3000-455 Coimbra, Portugal article info abstract

Article history: Acacia dealbata Link is an aggressive invasive tree currently widely distributed but little information con- Received 18 March 2013 cerning its management is available. To our knowledge, this paper presents the first approach to its con- Received in revised form 13 May 2013 trol in Europe. Presented assay was carried out in an invaded area in the NW of Spain using direct Accepted 28 May 2013 herbicide (triclopyr) spraying and herbicide application after cutting of saplings and adult plants. Biomet- rical measurements were periodically carried out and soil microbial community activity, plant diversity and species composition were monitored. A. dealbata individuals were severely affected by treatments, Keywords: causing all of the treated individuals to die. Enzymatic activities and soil respiration were significantly Invasive plant control enhanced when cutting and herbicide were applied in combination but not after herbicide application Herbicide spraying Soil enzymatic activity on its own. Species richness, diversity, evenness and cover were significantly reduced in the sprayed her- Soil basal respiration bicide treatment one year after the last herbicide application, but the differences disappeared in the fol- Plant richness lowing spring. Plant species and functional group distribution were conditioned due to the treatment. plant species diversity This study provides the first approach to A. dealbata management in Europe. Due to the effectiveness of treatments and the absence of long-term effects, further application of triclopyr would seem to be fea- sible to reduce A. dealbata spreading. Ó 2013 Published by Elsevier B.V.

1. Introduction was introduced in Europe during 1800s; A. dealbata was initially established as an ornamental species but currently occupying long Over the last few decades, the recognition of plant invasion im- motorway verges and abandoned areas in and around the towns pact has led to increased calls for management and policy (Keller (Sheppard et al., 2006). Due its characteristics, this species has et al., 2011). Estimation of the economic impact of alien plant spe- been regularly used in railway construction and as a tutor in creat- cies are usually difficult and extended management programs be- ing vineyards (Lorenzo et al., 2010b). As a result of the strong cor- come a lengthy task as a number of stages, including relation between the previous use of the soil and the extent of environmental, social, scientific and policymaking aspects, should invasion (van Wilgen et al., 2011) today is threatening extensive be overcome to lead management action. areas. Several studies have been conducted with the aim of eluci- Australian acacias are a group of leguminous woody plants that dating the effects of A. dealbata on native ecosystems (Lorenzo include some of the most important plant invaders on a global et al., 2011; González-Muñoz et al., 2012; Castro-Díez et al., scale (Richardson and Rejmánek, 2011). The ecological role, uses 2012). The features as the N-fixing ability, fast sprouting after dis- and perceptions, invasiveness, and management of this group have turbances (Spooner, 2005), re-sprouting after cutting, fire or frost been reviewed recently (Diversity and distributions, 17 (5)). Within (Sheppard et al., 2006) and the early flowering period at this lati- this genus, the spreading of Acacia dealbata Link (silver wattle) has tude have been identified as conductors of its high invasiveness. received less attention compared to other ones, but presently, it is Besides these abilities, allelopathy has been suggested as a power- causing huge ecological concerns in Southern Europe. This specie ful tool that contributes towards its invasive potential (Carballeira and Reigosa, 1999; Lorenzo et al., 2011). Together with the identification of traits promoting A. dealbata

Abbreviations: EA, enzymatic activities; SBR, soil basal respiration; C0, control; invasiveness, extensive research has also been conducted to iden- H, herbicide treatment; C+H, cut+herbicide treatment; AP, acid phosphatase; BG, ß- tify the consequences of its occurrence in native communities. glucosidase; Ur, urease; PPO, polyphenol oxidase; GAP, glycine aminopeptidase; CA, Studies have mainly focused on processes associated with soils, correspondence analysis. ⇑ Corresponding author. Tel.: +34 986 812 594; fax: +34 986 812 556. where A. dealbata principally enhances nutrient mineralisation E-mail address: [email protected] (P. Souza-Alonso). and decomposition rates (Castro-Díez et al., 2012). A. dealbata also

0378-1127/$ - see front matter Ó 2013 Published by Elsevier B.V. http://dx.doi.org/10.1016/j.foreco.2013.05.053 Author's personal copy

P. Souza-Alonso et al. / Forest Ecology and Management 304 (2013) 464–472 465 modifies the structure of soil microbial communities (Lorenzo a relative humidity level around 66%. The absence of rainfall to- et al., 2010a), diminishes diversity and richness of invertebrate gether with high regional temperatures causes harsh droughts dur- communities (Coetzee et al., 2007) as well as interfere with native ing the summer period. The vegetation is dominated by Pinus plant physiology (2011), also reducing plant richness (Lorenzo, pinaster Aiton conforming a mixed-forest with Quercus robur L. 2010; Fuentes-Ramírez et al., 2010) and biodiversity (González- and, in the warmest areas, Quercus suber L. with an understory of Muñoz et al., 2012). shrubs mainly composed by Arbutus unedo L., Ulex europaeus L., The perception of the noxious effects caused by the entire Aca- Ulex minor Roth., Pterospartum tridentatum (L.) Willk., Erica cinerea cia genus has entailed worldwide actions to diminish its impacts. L. and different species of the genus Cytisus and Cistus. Here, A. deal- Several works have been published using different methodology bata presence has been reported at least since 1990, and popula- to control the spreading of this genus throughout the world (Car- tions are distributed in patches, with different degrees of mona et al., 2001; Viljoen and Stoltsz, 2008; Marchante et al., invasion mainly depending on the distance to the forest roads. 2011). Herbicide, and specifically triclopyr application, has already demonstrated its efficacy on the control of acacias (Viljoen and 2.2. Experimental design Stoltsz, 2008). In combination with the cutting of individuals, tri- clopyr even avoided the emergence of sprouts (Carmona et al., To control A. dealbata, saplings and adult A. dealbata plants re- 2001). However, despite the positive effects to control invasive ceived different management approaches. In both sizes, two treat- plant species, herbicide application occasionally results in negative ments plus a control were established. The herbicide TRIDENTÒ effects, such as the appearance of non-native species (Ogden and (Triclopyr, 48%) was used due to its versatility under different Rejmanek, 2005; Mason and French, 2007). Also, when herbicide application systems. We selected spring (April, 2010) for the first overdoses are applied, negative effects on soil microbial communi- herbicide application and early autumn (September, 2010) for ties are evident (Weaver et al., 2007). These microbial communities the second one coinciding with the growth active periods of A. are essential components in terrestrial ecosystems; in fact, soil dealbata at this latitude (Lorenzo et al., 2010b). The application of processes are fundamentally catalysed by the enzymatic activities control methods and subsequent measurements were recorded of the microbial community (Coyne, 1999) such as litter decompo- over 26 months (Fig. 1). sition, which governs nutrient and carbon cycling (Hoorens et al., Sapling management (diameter 61.5 cm): for each treatment, a 2003). Besides the key role in belowground processes, microbial total of 9 plots (1 1 m) with similar plant density, orientation, influence also determines aboveground plant development, since and altitude and adequately distanced (minimum 1 m apart) were current vegetation is reflected by the range of enzymatic activities randomly placed in the A. dealbata patch. In April 2010, two treat- that characterises a given soil (Kourtev et al., 2002). Despite the po- ments were applied over selected plots: (a) single herbicide spray- sitive effects on invasive plant control, management regimes can ing (H) through a sprayer machine (Triclopyr 1%) and (b) have adverse impact on plant species, and these regimes must be Cut + Herbicide (C + H) spraying. In the C + H plots, the saplings considered as a form of disturbance (Mason and French, 2007). had been cut prior to herbicide application (10 cm from the soil). Consequently, in order to manage exotic plant invasions the risks After five months, herbicide was sprayed again in both treatments. should be reduced and selected methods must be carefully chosen After cutting, C + H saplings developed replacement trunks, and to minimise the impact on soil microbes and plant communities. measurements were carried out on the most prominent sprout in Despite the abundant literature concerning A. dealbata invasion order to monitor the herbicide effects. In H, the herbicide effects processes, less attention has focused on managing its expansion in were followed up on five individuals per plot by measuring their Europe, so the scientific literature concerning its management is height, diameter and sprouts. In C + H treatment five stumps with virtually inexistent. To our knowledge, this assay represents the sprouts were identified to follow up on the herbicide. The height first scientific work to control A. dealbata in Europe, through the and diameter of the sprout at the top of each stump were mea- use of the herbicide triclopyr and programmed cuts of individuals. sured before and after the herbicide application (Fig. 1). Nine plots

Therefore, the main objective of the study was to evaluate the where no actions were carried out (C0) were considered as effectiveness of selected management strategies to control A. deal- controls. bata through the collection of parameters directly related with Adult plant management (diameter >3 cm): in April 2010, two treatment application (plant height, diameter and sprouts). Due herbicide treatments were directly applied to A. dealbata trees. to their relevance, the other objective is to assess the effect of se- Nine independent and randomly distributed individuals per treat- lected treatments on soil microbial community function and native ment were selected and chopped at 20 ± 1 cm (distance from soil). vegetation through belowground (soil basal respiration and enzy- After cutting, the stumps were immediately treated to avoid cavi- matic activities) and aboveground (plant richness, diversity, cover tation with herbicide at 1% and 48%. Herbicide was applied using a and functional groups composition) measurements. Through this paintbrush to ensure direct contact and to avoid unnecessary diffu- study we expect to establish an initial approach to A. dealbata con- sion into the surrounding environment. Stumps without any herbi- trol in Atlantic forests and temperate climates. cide application were selected as controls. Growth was recorded during the following months by measuring the sprouts. The num- ber, height and diameter of sprouts were assessed after herbicide 2. Materials and methods application (Fig. 1).

2.1. Study site 2.3. Microbial parameter measurements

The present study was carried out in an invaded pine forest in To elucidate treatment effects over microbial community func- the region of O Ribeiro (42° 170 26.480400 N, 8° 90 15.253200 W; Gali- tion, soil enzymatic activities (hereafter EA) and soil basal respira- cia, NW Spain) from April 2010 to June 2012. The substrate was tion (SBR) measurements were carried out in the sapling granitic, and the study site slope faced SE, receiving high sunlight management plots from the moment the herbicide was sprayed and reduced north winds. This region is on the boundary of the there. Enzymatic activities and SBR and measurements were taken main dominant phytoclimate regions in Galicia (European Atlan- according to the herbicide half-life and when the herbicide was tic-Mediterranean subhumid with middle-European tendencies). biodegraded: 3 and 6 weeks after herbicide application, respec- Mean annual temperature values range from 6.7 °C to 18.0 °C, with tively (Fig. 1.). Author's personal copy

466 P. Souza-Alonso et al. / Forest Ecology and Management 304 (2013) 464–472

Fig. 1. Timeline representing methodology (figures below temporal line) and measurements carried out (above temporal line) during the assay. In September, herbicide was only applied on saplings. Abbreviations are as follows: SBR = Soil basal respiration, BM = Biometrical measurements, EA = Enzymatic activities, PSC = Plant species composition.

P 2 1 0 0 Soil basal respiration rate (lmol CO2 m s ) was determined at (H ) index computed as H = (pi Ln(pi)) (Magurran, 1988), nine random points of each plot using a Li-COR 6000-09 soil respi- where pi corresponds to the relative abundance of each species in ration chamber connected to a Li-COR 6200 IRGA detector (LI-COR, the plot, and the evenness was determined according to Pielou’s 0 0 0 0 Lincoln, NE, USA). At each point, the soil surface layer (±5 cm) was (J ) index (Pielou, 1975), computed as J = H /Hmax, where H is Shan- removed to avoid surface root respiration and then covered to sta- non’s index, and Hmax equals Ln of the maximum number of spe- bilize soil conditions. Measurements were taken after 25 min to cies counted in the plots. Functional group membership (trees, ensure stabilization of gas exchange. Ambient conditions such as shrubs, forbs, grasses, ferns and bryophytes) was determined for relative humidity, air flow, air and soil temperature and CO2 con- all collected plants, in order to compare the effects of selected centration were also recorded. treatments on functional group distribution. Soil enzymatic activities were measured through absorption spectrophotometry techniques (Fig. 1). To collect soil for the enzy- 2.5. Statistical analyses matic activity analyses, soil litter was removed at 10 random points in each plot and soil was collected within the first 10 cm. With the aim of comparing treatments, biometric data from Soil samples from the same plot were pooled in plastic bags, imme- management methods were organised in intervals: April–July diately refrigerated at 4 °C and taken to the laboratory within 2 h (2010), July–September (2010), September–November (2010), for further processing. In the laboratory, the soil samples were November (2010)–September (2011) and September (2011)–June sieved (1-mm mesh) to remove coarse roots, organic debris and (2012). Values were transformed as differential percentage (%) small stones and kept at 4 °C to initiate the analyses on the follow- with respect to the previous date and compared with control val- ing day. Six different enzymes were selected for analyses by their ues. Effects of control methods on height, diameter and sprouts direct implication in C, N, and P nutrient cycles. Acid phosphatase percentages in acacia saplings and adult plants were analysed by (AP, 3.1.3.2), enzyme involved in the release of phosphate from or- Mann Whitney’s U non-parametric test due to variance heteroge- ganic matter; C-degrading enzymes b-glucosidase (BG, 3.2.1.21), neity. A two-way ANOVA was applied to evaluate the effect of date which breaks down cellulose and polyphenol oxidase (PPO, and treatment on EA and SBR. Soil basal respiration was subjected 1.10.3.2) involved in lignin and humic compound oxidation; N-lib- to covariance analyses (ANCOVA) with control method as a factor erating enzymes urease (Ur, 3.5.1.5), which degrades urea to and air relative humidity, air flow, air and soil temperature and ammonium and glycine aminopeptidase (GAP, 3.4.11.-) involved CO2 concentration as covariables. Bonferroni correction was used in protein degradation, were included in the assay together with as the post-hoc test to test for significant differences among treat- appropriate controls. Acid phosphatase and BG were measured ments. The T-test was performed to assess differences in EA and according to the methods described by Tabatabai and Bremner plant species richness, density, cover, and H0 and J0 indices. Mann (1969) and Hayano and Tubaki (1985), respectively modified by Whitney’s U test was also used to analyse functional group distri- García et al. (1993). Urease was measured according to Kandeler bution. Correspondence analyses (CA) were carried out to repre- and Gerber (1988), modified by Kandeler et al. (1999). PPO and sent plant species and functional groups distribution. All tests GAP were measured according to the assay techniques from Sin- were performed using SPSS v19.0 Software (SPSS Inc., Chicago, IL, sabaugh et al. (1992 and 1993, respectively) modified by Allison USA). et al. (2006). Enzymatic activities in each treatment were repli- cated nine times and averaged. Adequate controls were disposed 3. Results in the same manner. All results were expressed on the basis of oven-dried (70 °C, 72 h) soil weight. 3.1. Biometrical measurements

2.4. Plant species survey Sapling management: herbicide was highly effective in reducing the growth of A. dealbata saplings. Significant differences were gen-

Understory vegetation was surveyed one year after the last her- erally found between the C0 and treatments on the height and bicide application, in September 2011 (Autumn) and also in June diameter of treated plants (Table 1). In fact, acacia saplings in H 2012 (Spring), since spring is the season with the highest number were found dead after the first application, whereas C + H individ- of species, including annuals. All woody and herbaceous species uals experienced a significant initial sprouting (basal sprouting) in less than 1 m high were identified in the C0, H and C + H plots. July–September interval but no growth was recorded after this Plant species composition was assessed using the species rich- interval. After the second herbicide spraying in September, active ness, calculated as the number of all plant species; plant density, growth was not registered. Sprouts (root sprouts) were only regis- obtained by adding the number of individual plants of each plant tered in H during the July–September interval and none remained species per plot; and species% cover, calculated as the sum of spe- after the second application (September). In June 2012, root cies-specific cover values in each plot. Species present, but not fully sprouts were recorded in H (6 ± 1.56/plot) and C + H plots covering 1% of plot area, were recorded as 1% to indicate their pres- (5.13 ± 1.01/plot) but due to the intricate root system under the ence. Cover of bryophytes was pooled for all moss and liverwort A. dealbata canopy, it was unfeasible to determine whether the species in each plot. We also determined the Shannon diversity sprouts had appeared spontaneously or from treated individuals. Author's personal copy

P. Souza-Alonso et al. / Forest Ecology and Management 304 (2013) 464–472 467

Table 1 Effect of treatments (% with respect to the control) on saplings and adult plants growth in biometrical parameters.

April–July July–September September–November November–September(11) September(11)–June(12) Saplings

Height (%) C0 28.83 (±2.34) 5.25 (±0.83) 0.75 (±0.22) 15.35 (±2.26) 12.62 (±4.3) H0*** 0*** 0*** 0*** 0*** C+H 0*** 37.01 (±9.45)*** 0*** 0*** 0***

Diameter (%) C0 12.99 (±1.88) 3.95 (±1.15) 3.63 (±0.79) 0 5.25 (±2.19) H0*** 0*** 0*** 00*** C+H 0*** 28.31 (±9.76)* 0*** 00***

Sprouts C0 –0 – – – H – 9 (±2.50)*** –– – C+H – 0 – – – Adult plants

Height (%) C0 100 40.20 (±14.24) 11.66 (±5.50) 1059.28 (±751.43) 23.42 (±5.14) H1% 0*** 0*** 0** 0* 0* H48% 0*** 0*** 0** 0* 0*

Diameter (%) C0 100 21.29 (±8.19) 14.16 (±7.17) 191.11 (±75.06) 44.11 (±8.61) H1% 0*** 0* 0* 0* 0* H48% 0*** 0⁄ 0⁄ 0⁄ 0⁄

Sprouts C0 3 (±0.86) 0.75 (±0.36) 0.50 (±0.18) 0.67 (±0.66) – H1% 0*** 0* 0* 0– H48% 0*** 0* 0* 0–

– = No sprouts recorded. * Represent significant differences in Mann Whitney’s U P < 0.05. ** Represent significant differences in Mann Whitney’s U P < 0.005. *** Represent significant differences in Mann Whitney’s U P 0.0000.

However, their presence was significantly reduced in the C + H between date and treatment was not significant (Table 2). As oc- treatment plots (P = 0.036). curred with EA, SBR was significantly increased after the applica- Adult plant management: all treated trees were found dead tion of C + H treatment. Concretely, SBR values were significantly after the herbicide application, and significant differences were enhanced in April (>20%, P = 0.000), May (>26%, P = 0.001), July found between C0 and 1% and 48% treatments without any notice- (>24%, P = 0.002) and largely in November (>47%, P = 0.007). Apart able differences in the effects between herbicide treatments (Ta- from treatment comparison, SBR values (also C0 values) showed ble 1). Sprouting was only recorded in the C0 (collar and stem, evident seasonal (date as independent variable) variations clearly with no root sprouts recorded). No sprouts in treated trees were separating April, May and July from the remaining dates (see also registered at the end of the assay. Fig. 2.). Soil temperature and humidity did not show significant dif- ferences between treatments at any sampling date, but there were significant differences in soil temperature between dates (data not 3.2. Microbial parameters shown).

Individually, date and treatment had significant effect on enzy- matic activities and SBR; however, the two-way ANOVA was only 3.3. Plant species composition significant for AP and BG (Table 2). Enzymatic activities were en- hanced under the influence of C + H treatment (Table 3). The in- The herbicide treatments had a negative influence on plant spe- crease in EA was significant in July (AP > 52%, P = 0.005; cies composition (Fig. 3). In September, plots under H treatment BG > 77%, P = 0.04), October (BG > 32%, P = 0.041) and November showed a significant reduction in diversity values (H0 = 80%, (AP > 69%, P = 0.014; BG > 94%, P = 0.044; Ur > 58%, P = 0.028). Dur- P = 0.001), plant cover (47%, P = 0.04), richness (50%, ing the assay, altered EA were exclusively found in AP, BG and Ur, P = 0.001), and evenness (78%, P = 0.012). C + H treatment signif- globally enhancing their activities on average by 42%, 59% and 23%, icantly decreased plant species density (49%, P = 0.021) and cover respectively. Polyphenol oxidase and GAP activities were not sig- (44%, P = 0.03). In June, all indices were generally enhanced and nificantly modified during the assay. neither H nor C + H indices showed significant differences with C0. Soil basal respiration results between treatments were signifi- Plant species presence was variable between the sampling dates cantly different throughout the dates, although the interaction (Table 4). Within the total of species surveyed, 15.3% was found exclusively in September, 42.3% was found exclusively in June and the remaining 42.3% was found in both sampling dates. The most Table 2 Analysis of variance (two-way ANOVA) of the effects of the independent variables of common species observed that largely accounts for the registered the model (date and treatment) and their interaction. values in total species cover and density was Pteridium aquilinum (L.) Kuhn. This fern represented a huge part of the total individuals Date (d) Treatment (t) d *t found in treatments, mainly in September, reaching 86% of the total Acid phosphatase 0.000*** 0.000*** 0.003** individuals found in H, 65% in C0 and 46% in C + H. In June, the pres- b-glucosidase 0.000*** 0.000*** 0.002** Urease 0.000*** 0.006* 0.513 ence of P. aquilinum was drastically reduced, reaching 49%, 35% and *** * Polyphenol oxidase 0.000 0.024 0.142 27% of decline in H, C0 and C + H, respectively. Glycine aminopeptidase 0.000*** 0.005* 0.207 At the end of the assay, the most part of species appeared in all Soil basal respiration 0.000*** 0.000*** 0.110 treatments or exclusively in C0 plots but plant species were exclu- * P < 0.05. sively native and included the regional endemic Daboecia cantabrica ** P < 0.005. (Huds.) K. Koch. Within the total of surveyed species, five natives, *** P = 0.000. Arenaria montana L., Asterolinon linum-stellatum (L.) Duby, Cerastium Author's personal copy

468 P. Souza-Alonso et al. / Forest Ecology and Management 304 (2013) 464–472

Table 3 Enzymatic activity results (mean ± SE) for the selected enzymes in the different sampling dates. Asterisks and italics indicate significant differences with the control in T-test. AP 1 1 þ 1 1 1 1 and BG activities are expressed in lmol pNP g dry soilh ; Ur activity is expressed in lmol NH4 g dry soilh ; PPO activity is expressed in lmol pyrogallolkg dry soilh ; GAP is expressed in lmol pNAg1 dry soilh1.

May July September October November Acid phosphatase (AP)

C0 56.21 (±5.55) 14.34 (±1.30) 19.88 (±2.59) 21.70 (±3.80) 9.12 (±0.58) H 56.17 (±0.63) 14.01 (±1.24) 18.29 (±2.35) 14.33 (±1.95) 8.39 (±0.31) C + H 71.66 (±9.14) 21.80 (±1.93)** 23.15 (±2.58) 40.11 (±9.43) 15.41 (±1.74)* b-glucosidase (BG)

C0 20.23 (±2.77) 11.79 (±2.34) 14.28 (±3.07) 68.58 (±7.4) 7.95 (±1.34) H 15.12 (±2.01) 10.20 (±1.73) 10.41 (±1.19) 62.30 (±7.5) 6.46 (±0.85) C + H 23.29 (±4.18) 20.88 (±3.72)* 21.42 (±4.74) 90.19 (±6.3)* 15.39 (±2.95)* Urease (Ur)

C0 11.98 (±2.07) 10.68 (±1.70) 3.55 (±0.49) 14.95 (±0.18) 0.40 (±0.07) H 8.61 (±0.96) 10.14 (±0.90) 2.86 (±0.74) 16.21 (±1.22) 0.24 (±0.04) C + H 12.77 (±2.21) 11.59 (±1.39) 2.74 (±0.85) 17.48 (±1.37) 0.63 (±0.06)* Polyphenol oxidase (PPO)

C0 0.89 (±0.13) 0.62 (±0.08) 1.15 (±0.16) 1.19 (±0.16) 1.40 (±0.17) H 0.76 (±0.13) 0.54 (±0.05) 1.16 (±0.11) 1.45 (±0.09) 1.69 (±0.09) C + H 0.85 (±0.10) 0.55 (±0.04) 1.27 (±0.13) 0.86 (±0.08) 1.62 (±0.22) Glycine aminopeptidase (GAP)

C0 10.89 (±1.06) 11.35 (±1.66) 21.86 (±2.09) 20.53 (±2.95) 42.37 (±3.62) H 8.87 (±1.06) 9.15 (±1.38) 20.68 (±2.93) 21.06 (±2.18) 47.41 (±1.61) C + H 13.33 (±1.02) 8.06 (±1.23) 18.39 (±2.29) 17.16 (±2.21) 36.38 (±3.65)

⁄⁄⁄ P = 0.000. * P < 0.05. ** P < 0.005.

Fig. 2. Soil basal respiration rate (mean ± SE) under the different treatments during sampling dates in 2010. Capital letters indicate significant differences between treatments in each date. Lower case letters indicates significance between sampling dates in each treatment (ANOVA, Tukey HSD post-hoc test). fontanum Baumg, Jasione montana L. and Pseudoarrhenatherum longi- group distribution on both dates was similarly represented in the folium (Thore) Rouy were exclusively found in treated plots and 3 ordination plot of CA (Fig. 6.). Trees and shrubs appeared more re- species (A. montana, J. montana and Osyris alba L.) appeared exclu- lated with Co and grasses with C + H. No functional groups were sively related with H plots in correspondence analyses (Fig. 4). Cor- exclusively related with H, although ferns appeared to be slightly respondence analyses also show that plant species found in June and related with this treatment. September were not equally distributed. In September none of the species were clearly related with H, few species were related with 4. Discussion C + H, whereas most species were affiliated with C0. In June, the vast majority of species were also related with C0, although during this 4.1. Herbicide application sampling date the number of species related with treated plots was clearly enhanced. Results of saplings management are in agreement with the only Functional group composition showed different proportions be- available reference of triclopyr use on A. dealbata in the literature tween dates (Fig. 5.) In September, ferns widely dominated plant (Campbell and Kluge, 1999). These authors found >95% plant mor- proportions (i.e. represented an average of >60% in H). In treated tality after herbicide application on A. dealbata stumps. Generally, plots, grasses were globally enhanced, and the presence of shrubs more than a single stem cut must be carried out to diminished was significantly diminished in the H treatment. In June, the func- plant reserves and achieve a long-term exhaustion (Canadell and tional group proportions were more balanced, mainly by the in- Lo´ pez-Soria, 1998). In present study, positive effects controlling crease in forbs. In contrast with single plant species, functional A. dealbata growth could be further extended by the absence of Author's personal copy

P. Souza-Alonso et al. / Forest Ecology and Management 304 (2013) 464–472 469

enhanced and maintained over time. Therefore, cutting treatment alone has demonstrated its inefficacy to control A. dealbata adult plants whereas herbicide treatments could, at least during the time of the assay, prevent or interrupt its sprouting ability. One interesting finding of the experiment was the different ori- gin of sprouts recorded between saplings and adult plants. Whereas sprouts in sapling management were entirely from belowground, probably from roots, in the adult plant management we exclusively registered aboveground sprouts, directly emerging from the damaged zone or from the collar where the greatest po- tential for the production of secondary trunks is located. The differ- ential sprouting behaviour could indicate a differential-age sprouting response after disturbances in A. dealbata. This is sug- gested since the collar is a secondary structure that does not devel- op until a tree is several years old (Del Tredici, 2001).

4.2. Microbial parameters

Due to the absence of differences with the C0, single H applica- tion did not exert any direct influence on microbial responses. This argument is supported by the general lack of significant differences in EA during the herbicide half-life (May and October). In our case, EA fluctuated during the assay, but H results were not significantly

different from the C0 at any sampling date, so variations may be attributable to other reasons, i.e. the effects of seasonality on tem- perate forests (Baldrian et al., 2013). As was the case with EA, SBR Fig. 3. T-test results (mean ± SE) in richness, density and species cover, H0 and J0 indices. Asterisks represent significant differences with the control: *P < 0.05; was only enhanced in the C + H treatment. Again, an increase in **P < 0.005 and ***P = 0.000. SBR seemed to be independent of the herbicide spraying. Therefore, the rise in EA and SBR suggest an enhancement in the microbial community activity under C + H treatment. The soil rainfall and harsh climatic conditions registered during the follow- microbial activity increase in C + H cannot be attributable to soil ing summer, since rainfall and weather, in general, promote warming caused by the absence of vegetal cover (Lloyd and Taylor, sprouting and growth (Constán-Nava et al. 2010). 1994) as there were no significant differences in soil temperature In terms of adult plant management, similar results were also between C + H and C0. Besides the irradiation enhancement, plant found on related acacias after cutting and herbicide application removal causes direct plant damage and the consequent blockage (A. farnesiana in Carmona et al., 2001). In our case, C + H treatment of future litter entering the soil. So, the effects of cutting caused was effective in preventing plant sprouting in comparison with C0 by C + H treatment could be associated with logging, harvesting plants, where sprout growth was continuous, significantly or even drastic herbivore effects. The observations by Constán-Nava

Table 4 List of plant species collected in the assay. Abbreviations used; P = perennial; A = annual; Bi = biannual; = no data available.

Species Family Life cycle N° Plots Plot Sampling

1 Aira praecox L. Poaceae A 8 C0, H, C + H September

2 Agrostis castellana Boiss. & Reut. Poaceae A 1 C0 June

3 Agrostis curtisii L. Poaceae A 10 C0, H, C + H September, June

4 Arbutus unedo L. Ericaceae P 2 C0, H September, June 5 Arenaria montana L. Caryophyllaceae P 2 H June 6 Asterolinon linum-stellatum (L.) Duby Primulaceae A 1 C + H June 7 Cerastium fontanum Baumg Caryophyllaceae P–Bi 1 C + H June

8 Cistus psilosepalus Sweet Cistaceae P 8 C0, C + H September, June

9 Crucianella angustifolia L. Rubiaceae A 1 C0 June

10 Daboecia cantábrica (Huds.) K. Koch Ericaceae P 1 C0 September 11 Jasione Montana L. Campanulaceae A–Bi 1 H June

12 Lithodora (glandora) Boraginaceae P 5 C0, H, C + H June

13 Lotus corniculatus L. Fabaceae P 6 C0, H, C + H June

14 Osyris alba L. Santalaceae P 2 C0, H September, June

15 Picris sp. Asteraceae – 1 C0 June 16 Pseudoarrhenatherum longifolium (Thore) Rouy Poaceae A 9 H, C + H June

17 Pteridium aquilinum (L.) Kuhn Hypolepydaceae A 18 C0, H, C + H September, June

18 Polygonum cf. aviculare L. Polygonaceae A 1 C0 September

19 Quercus robur L. Fagaceae P 3 C0 September, June

20 Rubus ulmifolius Schott Rosaceae P 2 C0, C + H September, June

21 Simethis planifolia (L.) Gren. et Godr. Xanthorrhoeaceae P 12 C0, H, C + H September, June

22 Specie 1 Poaceae – 1 C0 June

23 Stellaria sp Caryophyllaceae – 1 C0 September

24 Ulex europaeus L. Fabaceae P 5 C0, H, C + H September, June

25 Ulex minor Roth. Fabaceae P 1 C0 September, June

26 Bryophytes P35C0, H, C + H September, June Author's personal copy

470 P. Souza-Alonso et al. / Forest Ecology and Management 304 (2013) 464–472

September 2011 June 2012

C+H

22 25 C0 25 19 23

Dimension 2 H

C0 Plant species C+H Treatments H

Dimension 1

Fig. 4. Plant species distribution obtained with the correspondence analysis (Chi-Square, P =0.000 and P =0.000 in September and June, respectively). Ellipses include species strongly related with treatments whereas species outside were weakly related with treatments. Species references are collected in Table 4. Individuals (n er ) Functional group composition (%)

Sept 11 June 12

Fig. 5. Functional groups composition (bars) and total number of plant individuals (circles) as determined in September 2011 and June 2012. Asterisks and white circles represent significant differences with the control in Mann Whitney’s U test: *P < 0.05, **P < 0.005, and *** P = 0.000. et al. (2010) who suggested an imbalance on resource allocation, Semmartin et al. (2008) proposed aerial litter removal as a pro- displacing metabolism to the roots, appears to be a possible effect cess affecting nutrient cycling by changing the soil environment for caused by individual cutting. Reserve allocation should be even decomposition and the chemical composition and decomposition more noticeable in A. dealbata case due to its sprouting ability dynamics of the litter. Litter modification is also generally recogni- and the N2 fixation capacity (Ta et al., 1990) since C reserves play sed as a factor driving changes in decomposer community compo- a key role in N2 fixation. After plant damage, root C release into sition (Parmelee et al., 1989) which could affect the physiological the rhizosphere may also be increased (Paterson and Sim, 2000) capacity of the microbial community (Waldrop et al., 2000). In even more in C + H treatment due to the entire removal of the our case, logging would reduce the total A. dealbata biomass enter- aboveground material. Assuming that under normal circumstances, ing the decomposition process, but also the variety and proportions compound exudation by roots is suggested as a regulator of the soil of plant compounds introduced with A. dealbata material affecting microbial community in their vicinity (Bais et al., 2004), after cut- litter composition. However, the effects of an altered flux litter ting, affected individuals could be altering normal rhizosphere probably would require more time to demonstrate its evidence. function. An alteration in root exudation patterns is also suggested by the rise in BG activities; this enzyme hydrolyzes glucose dimers, 4.3. Plant species responses which are abundant in root exudates (Bastida et al., 2007) that were probably enhanced after plant damage. Therefore, plant Contrary as we found during the first year, other authors have damage may contribute towards explaining enhanced microbial previously described no effects on plant species richness, evenness community activity through rhizosphere alteration in the affected and diversity in the first two years of triclopyr application (Nolte saplings. However, further research is required to clarify the role and Fulbright, 1997). However, plant composition and richness of A. dealbata cutting on rhizosphere structure and function. was not equally affected by H and C + H. Lower impact found in Author's personal copy

P. Souza-Alonso et al. / Forest Ecology and Management 304 (2013) 464–472 471

September 2011 June 2012

Trees Functional groups Treatments Shrubs

C0

Forbs Dimension 2 Trees C+H Bryophytes Ferns Grasses Shrubs C Bryophytes Forbs H 0 Grasses C+H Ferns H

Dimension 1

Fig. 6. Functional groups distribution obtained with the correspondence analysis (CA, Chi-Square, P = 0.000 and P =0.000 in September and June, respectively). Ellipses include groups strongly related with treatments whereas groups outside were weakly related with treatments.

C + H could be explained by the removal of A. dealbata individuals. methodology, small patches of mature A. dealbata adult trees In this case, tree canopy removal may provide seed colonisation could be easily eradicated. However, to control the spreading of opportunities, also reducing neighbouring shoot competition A. dealbata (where saplings are involved) single H could be feasible (McIntyre et al., 1995) counteracting the effects produced by her- to apply annually or biannualy to control the expansion in border- bicide application. Simultaneously, sunlight enhancement linked ing areas in which eradication is not a feasible option. We would to tree thinning could be related with plant richness and cover also draw attention to the collaboration required between scien- enhancement (Thomas et al., 1999). Indeed, richness was not af- tific areas and operational units to increase horizontal transmis- fected by C + H treatment but plant cover and density were signif- sion of information and cooperating efforts to progress in the icantly diminished. Here, the extensive presence of P. aquilinum control of A. dealbata and other undesirable species. may be masking plant cover and density reductions. With its exclusion, the reduction produced by C + H in plant cover and den- 5. Conclusions sity disappeared, but significant differences arise between C0 and H in plant density. Nevertheless, the negative effects on vegetation The selected treatments proved to be effective at controlling A. found in September had been overcome by the following spring. dealbata growth in both sapling and adult plant stages. Triclopyr The 2-dimension solution obtained in the CA revealed an altered application at a low concentration (1%) after cutting was a success- plant species distribution between treatments. Based on the plot ful method for controlling adult plants of A. dealbata as all of the ordination results, the negative effects of H on richness in Septem- individuals were found to be dead whereas no sprouting was re- ber were corroborated in the CA solution and again, these effects corded. However, the effects on saplings seemed to be limited to seemed to be overcome in June. This remarkable fact is supported the first two years after herbicide application. Soil microbial com- by the presence of five native species (A. montana, A. linum- munity activity was not significantly affected by herbicide applica- stellatum, C. fontanum, J. montana and P. longifolium) exclusively in tion, whereas individual removal globally enhanced microbial treated plots in June, instead of the non-native species presence activity. All of the plant parameters studied were initially reduced, after herbicide spraying which is a common trend in invasive plant but understory vegetation showed a medium term recovery after control assays (Ogden and Rejmanek, 2005; Mason and French, application of the treatment. 2007). Despite the differences found in species composition, func- tional groups distribution seems to be directly related with treat- Acknowledgements ments, regardless of the date. Trees and shrub forms seemed to be directly related with ‘‘undisturbed’’ plots -plots are in invaded We would like to thank the two anonymous reviewers for their patches- probably due to the slow growth and reproductive rates helpful comments and improvements on earlier versions of this of these groups. On the other hand, the first stages of recolonisation manuscript. We also thank the forest community of Ribadavia for after application of the treatments may be easier for grasses, which its facilities to establish management plots, and especially its due to their rapid growth usually define pioneering vegetation. As president, Benito Alonso, for his kindness and helpful comments. Kaye et al. (2008) found, after disturbances grasses and forbs - Our special thanks to Pablo Oitavén for sharing his experience in mainly grasses- were mostly related with disturbed sites contrary A. dealbata control. We would also like to thank the Xunta de to the shrubs, which were related to undisturbed sites. Neverthe- Galicia for its essential funding and support through the PGI- less, grass and forbs responses usually vary following herbicide DIT05RAG31001PR project. application (Monaco et al., 2005; Cipriotti et al., 2012). References The selected treatments produced promising results in terms of managing A. dealbata invasion. Death and a reduction in A. dealbata Allison, S.D., Nielsen, C., Hughes, F., 2006. Elevated enzyme activities in soils under growth together with key location and the absence of previous the invasive nitrogen-fixing tree Falcataria moluccana. Soil Biol. Biochem. 37, control studies with this species in Europe lead us to draw atten- 1537–1544. Bais, H.P., Park, S.W., Weir, T.L., Callaway, R.M., Vivanco, J.M., 2004. How plants tion to this assay and consider it as a significant step in managing communicate using the underground information superhighway. Trends Plant A. dealbata invasion in temperate climates. With the presented Sci. 9, 26–32. Author's personal copy

472 P. Souza-Alonso et al. / Forest Ecology and Management 304 (2013) 464–472

Baldrian, P., Šnajdr, J., Merhautová, V., Dobiášová, P., Cajthaml, T., Valášková, V., Lorenzo, P., González, L., Reigosa, M.J., 2010b. The genus Acacia as invader: the 2013. Responses of the extracellular enzyme activities in hardwood forest to characteristic case of Acacia dealbata link in Europe. Ann. For. Sci. 67, 101p1– soil temperature and seasonality and the potential effects of climate change. 111p11. Soil Biol. Biochem. 56, 60–68. Lorenzo, P., Palomera-Pérez, A., Reigosa, M.J., González, L., 2011. Allelopathic Bastida, F., Moreno, J.L., Hernández, T., García, C., 2007. The long-term effects of the interference of invasive Acacia dealbata Link on the physiological parameters of management of a forest soil on its carbon content, microbial biomass and native understory species. Plant Ecol. 212, 403–412. activity under a semi-arid climate. Appl. Soil Ecol. 37, 53–62. Magurran, A.E., 1988. Ecological Diversity and Its Measurement. Princeton Campbell, P.L., Kluge, R.L., 1999. Development of integrated control strategies for University Press, Princeton, New Jersey. wattle. 1. Utilization of wattle, control of stumps and rehabilitation with Marchante, H., Freitas, H., Hoffmann, J.H., 2011. Assessing the suitability and safety pastures. S. Afr. J. Plant Soil. 16, 24–30. of a well-known bud-galling wasp, Trichilogaster acaciaelongifoliae, for Canadell, J., Lo´ pez-Soria, L., 1998. Lignotuber reserves support regrowth following biological control of Acacia longifolia in Portugal. Biol. Control. 56, 193–201. clipping of two Mediterranean shrubs. Funct. Ecol. 12, 31–38. Mason, T.J., French, K., 2007. Management regimes for a plant invader differentially Carballeira, A., Reigosa, M.J., 1999. Effects of natural leachates of Acacia dealbata impact resident communities. Biol. Conserv. 136, 246–259. Link in Galicia (NW Spain). Bot. Bull. Acad. Sinica 40, 87–92. McIntyre, S., Lavorel, S., Tremont, R.M., 1995. Plant life-history attributes: their Carmona, R., Neto, B.S.C.A., Pereira, R.C., 2001. Control of Acacia farnesiana and of relationship to disturbance responses in herbaceous vegetation. J. Ecol. 83, 31– Mimosa pteridofita in pastures|Controle de Acacia farnesiana e de Mimosa 44. pteridofita em pastagem. Pesqui. Agropecu. Bras. 36, 1301–1307. Monaco, T.A., Osmond, T.M., Dewey, S.A., 2005. Medusahead control with fall- and Castro-Díez, P., Fierro-Brunnenmeister, N., González-Muñoz, N., Gallardo, A., 2012. spring-applied herbicides on northern Utah foothills. Weed Technol. 19, 653– Effects of exotic and native tree leaf litter on soil properties of two contrasting 658. sites in the Iberian Peninsula. Plant Soil. 350, 1–13. Nolte, K.R., Fulbright, T.E., 1997. Plant, small mammal, and avian diversity following Cipriotti, P.A., Rauber, R.B., Collantes, M.B., Braun, K., Escartín, C., 2012. Control control of honey mesquite. J. Range Manage. 50, 205–212. measures for a recent invasion of Hieracium pilosella in Southern Patagonian Ogden, J.A.E., Rejmanek, M., 2005. Recovery of native plant communities after the rangelands. Weed Res. 52, 98–105. control of a dominant invasive plant species, Foeniculum vulgare: Implications Coetzee, B.W.T., Van Rensburg, B.J., Robertson, M.P., 2007. Invasion of grasslands by for management. Biol. Conserv. 125, 427–439. silver wattle, Acacia dealbata (Mimosaceae), alters beetle (Coleoptera) Parmelee, R.W., Beare, M.H., Blair, J.M., 1989. Decomposition and nitrogen dynamics assemblage structure. Afr. Entomol. 15, 328–339. of surface weed residues in no-tillage agroecosystems under drought Constán-Nava, S., Bonet, A., Pastor, E., Lledó, M.J., 2010. Long-term control of the conditions: influence of resource quality on the decomposer community. Soil invasive tree Ailanthus altissima: Insights from Mediterranean protected forests. Biol. Biochem. 21, 97–103. For. Ecol. Manage. 260, 1058–1064. Paterson, E., Sim, A., 2000. Effect of nitrogen supply and defoliation on loss of Coyne, M., 1999. Soil enzymes. In: Soil Microbiology: an Exploratory Approach. organic compounds from roots of Festuca rubra. J. Exp. Bot. 51, 1449–1457. Thomson Publishing Inc., pp. 23–32. Pielou, E.C., 1975. Ecological Diversity. John Wiley & Sons, Inc., New York. Del Tredici, P., 2001. Sprouting in temperate trees: a morphological and ecological Richardson, D.M., Rejmánek, M., 2011. Trees and shrubs as invasive species – a review. Bot. Rev. 67, 121–140. global review. Divers. Distrib. 17, 788–809. Fuentes-Ramírez, A., Pauchard, A., Marticorena, A., Sánchez, P., 2010. Relationship Semmartin, M., Garibaldi, L.A., Chaneton, E.J., 2008. Grazing history effects on between the invasion of Acacia dealbata Link (Fabaceae: Mimosoideae) and above-and below-ground litter decomposition and nutrient cycling in two co- plant species richness in south-central Chile|Relación entre la invasión de Acacia occurring grasses. Plant Soil. 303, 177–189. dealbata Link (Fabaceae: Mimosoideae) y la riqueza de especies vegetales en el Sheppard, A.W., Shaw, R.H., Sforza, R., 2006. Top 20 environmental weeds for centro-sur de Chile. Gayana Bot. 67, 188–197. classical biological control in Europe: a review of opportunities, regulations and García, C., Hernández, T., Costa, C., Ceccanti, B., Masciandaro, G., Ciardi, C., 1993. A other barriers to adoption. Weed Res. 46, 93–117. study of biochemical parameters of composted and fresh municipal wastes. Sinsabaugh, R.L., Antibus, R.K., Linkins, A.E., McClaugherty, C.A., Rayburn, L., Repert, Bioresour. Technol. 44, 17–23. D., Weiland, T., 1992. Wood decomposition over a first-order watershed: mass González-Muñoz, N., Costa-Tenorio, M., Espigares, T., 2012. Invasion of alien Acacia loss as a function of lignocellulase activity. Soil Biol. Biochem. 24, 743–749. dealbata on Spanish Quercus robur forests: Impact on soils and vegetation. For. Sinsabaugh, R.L., Antibus, R.K., Linkins, A.E., McClaugherty, C.A., Rayburn, L., Repert, Ecol. Manage. 269, 214–221. D., Weiland, T., 1993. Wood decomposition: nitrogen and phosphorus dynamics Hayano, K., Tubaki, K., 1985. Origin and properties of b-glucosidase activity of in relation to extracellular enzyme activity. Ecology 74, 1586–1593. tomato-field soil. Soil Biol. Biochem. 17, 553–557. Spooner, P.G., 2005. Response of Acacia species to disturbance by roadworks in Hoorens, B., Aerts, R., Stroetenga, M., 2003. Does initial litter chemistry explain litter roadside environments in southern New Wales, Australia. Biol. Conserv. 122, mixture effects on decomposition? Oecologia 137, 578–586. 231–242. Kandeler, E., Gerber, H., 1988. Short-term assay of soil urease activity using Ta, T.C., Macdowall, F.D.H., Faris, M.A., 1990. Utilization of carbon and nitrogen colorimetric determination of ammonium. Biol. Fertil. Soils. 6, 68–72. reserves of alfalfa roots in supporting N2-fixation and shoot regrowth. Plant Kandeler, E., Stemmer, M., Klimanek, E.M., 1999. Response of soil microbial biomass, Soil. 127, 231–236. urease and xylanase within particle size fraction to long-term soil management. Tabatabai, M.A., Bremner, J.M., 1969. Use of p-nitrophenol phosphate for assay of Soil Biol. Biochem. 31, 261–273. soil phosphatase activity. Soil. Biol. Biochem. 1, 301–307. Kaye, T.N., Blakeley-Smith, M., Thies, W.G., 2008. Long-term effects of post-harvest Thomas, S.C., Halpern, C.B., Falk, D.A., Liguori, D.A., Austin, K.A., 1999. Plant diversity stump removal and N-fertilization on understory vegetation in Western USA in managed forests: Understory responses to thinning and fertilization. Ecol. forests. For. Ecol. Manage. 256, 732–740. Appl. 9, 864–879. Keller, R.P., Geist, J., Jeschke, J.M., Kühn, L., 2011. Invasive species in Europe: van Wilgen, B.W., Dyer, C., Hoffmann, J.H., Ivey, P., Le Maitre, D.C., Richardson, D.M., Ecology, status, and policy. Environ. Sci. Eur. 23, art. 23. Rouget, M., Wannenburgh, A., Wilson, J.R.U., 2011. National-scale strategic Kourtev, P.S., Ehrenfeld, J.G., Haggblom, M., 2002. Exotic plant species alter the approaches for managing introduced plants: insights from Australian acacias in microbial community structure and function in the soil. Ecology 83, 3152– South Africa. Divers. Distrib. 17, 1060–1075. 3166. Viljoen, B.D., Stoltsz, C.W., 2008. Control of black wattle (Acacia mearnsii De Wild.) Lloyd, J., Taylor, J.A., 1994. On the temperature dependence of soil respiration. seedlings with Garlon herbicide applied by backpack mistblower. S. Afr. J. Plant Funct. Ecol. 8, 315–323. Soil. 25, 242–244. Lorenzo, P., 2010. Invasion of Acacia dealbata Link: New Perspectives on Allelopathic Waldrop, M.P., Balser, T.C., Firestone, M.K., 2000. Linking microbial community Process. European PhD Thesis. University of Vigo. composition to function in a tropical soil. Soil Biol. Biochem. 32, 1837–1846. Lorenzo, P., Rodríguez-Echeverría, S., González, L., Freitas, H., 2010a. Effect of Weaver, M.A., Krutz, L.J., Zablotowicz, R.M., Reddy, K.N., 2007. Effects of glyphosate invasive Acacia dealbata Link on soil microorganisms as determined by PCR- on soil microbial communities and its mineralization in a Mississippi soil. Pest DGGE. Appl. Soil Ecol. 44, 245–251. Manage. Sci. 63, 388–393. Chapter 6 Effectiveness of management strategies

Chapter 7 Microbial changes after triclopyr application

Chapter 7. Structural changes in soil communities after triclopyr application in soils invaded by Acacia dealbata Link

Souza-Alonso, P., Guisande, A., González, L., 2014. Structural changes in soil communities after triclopyr application in soils invaded by Acacia dealbata Link. Accepted for publication in Journal of Environmental Science and Health, Part B: Pesticides, Food Contaminants, and Agricultural Wastes (JESH part B). DOI 10.1080/03601234.2015.982419

Chapter 7 Microbial changes after triclopyr application

Chapter 7 Microbial changes after triclopyr application

1. Introduction

Triclopyr is a pyridine-based herbicide frequently used for the control of woody plants and annual and perennial broadleaf weeds (Ganapathy, 1997).In the U.S. and Europe, within the main synthetic herbicides used to manage noxious weeds, the use of pyridine based herbicides such as triclopyr but also picloram or clopyralid is noticeable. Effective and commonly used since the 60´s, it is only during the last five-years that several works have been carried out successfully applying triclopyr at foliar level (Langeland and Meisenburg, 2009; Vitelli et al., 2009; Ward et al., 2009), directly applied at barks (Holmes and Berry, 2009) or in combination (Wehtje and Gilliam, 2012). Despite the effectiveness of triclopyr in managing exotics, the impact produced by its application on soil community structure has rarely been addressed (Houston et al., 1998) and therefore, its effects on non-target microorganisms are still unclear. Moreover, to our knowledge, the effect of triclopyr in the structure of soil communities under invasive processes has not yet been described. Due to their extraordinary importance, disturbances of microbial communities ensure several key ecological processes in soil, such as organic matter degradation and nutrient cycling, which could harmfully alter soil fertility and sustainable agricultural productivity (Crouzet et al., 2010). Herbicide triclopyr has been effectively employed to manage even Acacia dealbata L. invasions (Campbell and Kluge, 1996; Souza-Alonso et al., 2013). Native from Australia, this aggressive invader is currently threatening many areas of the world (Lorenzo et al., 2010a; Fuentes-Ramírez et al., 2010; Richardson and Rejmanek, 2011). Moreover, the entrance of A. dealbata in a new ecosystem entails differences in soil community structure and functionality at different levels (Lorenzo et al., 2010b, 2013). However, as far as we know, the function of soil microbial community is not affected when triclopyr is applied solely at recommended doses (Souza-Alonso et al., 2013). Therefore, the aim of this study was to assess the short term and long term responses of the structure of bacterial and fungal community exposed to triclopyr in soils invaded by A. dealbata. The assessment of microbial community structure was carried out through the use of denaturing gradient gel electrophoresis (DGGE), a very useful technique in ecotoxicology to analyze the variation of microbial community structures at a much higher resolution in comparison to conventional isolation techniques (Lin et al., 2012).

Chapter 7 Microbial changes after triclopyr application

2. Material and Methods

2.1. Study Site and Experimental Design The study was carried out between April 2010 and September 2011. The site location, soil type, climate conditions and plant composition are properly described in Souza- Alonso et al (2013). Experimental assay comprised of three different patches invaded by A. dealbata, separated at least 100 m from each other. At each invaded patch, three plots (1x1 m) in which triclopyr would be sprayed and three untreated plots (control plots) were disposed. Plots with similar plant density, orientation, and adequately distanced (>1 m apart) were randomly placed in each A. dealbata patch. Triclopyr was applied in the TRIDENT® formulation (Fig. 1). Prior to the field application, triclopyr was diluted (1%) and sprayed twice: in spring (April 2010) and in early autumn (September, 2010), coinciding with the active growth periods of A. dealbata at this latitude (Lorenzo et al., 2010). Microbial community structure was monitored immediately before herbicide spraying and 3 weeks after triclopyr spraying, during the active period of herbicide (May, 2010 and October 2010). To explore possible long-term effects of triclopyr, community structure was also monitored one year after the final herbicide application (September, 2011).

CO2 + H20 + organic acids

OH

Triclopyr butoxyethil ester Trichloropyridnol (TCP) Triclopyr acid

Figure 1. Molecular structure of triclopyr (butoxyethyl ester) as formulated in TRIDENT® and major pathway of degradation in soils (Ganapathy, 1997). It is the triclopyr acid (known simply as triclopyr) that causes phytotoxicity.

2.2. Microbial Community Structure At each plot, a minimum of 10 soil subsamples were collected to form a composite sample. The same soil collection was repeated for the different sampling dates. Samples were maintained at 4 ºC and once in the laboratory were freshly sieved (<2 mm), and immediately frozen (-20 °C) until their use in DGGE analyses. Prior to electrophoresis, soil DNA was extracted and amplified. DNA extraction was carried out using a Power SoilTM DNA Isolation Kit (MO BIO Laboratories, Inc., CA). A

Chapter 7 Microbial changes after triclopyr application

0.15-0.20 g of soil aliquot was used for each sample extraction and stored at -20 °C. The extracted DNA was amplified using eubacteria-specific primer 2 (5'- ATTACCGCGGCTGCTGG-3') and primer 3 (with a GC clamp) (5'- CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGCCTACGGGAGG CAG-3') for the 16S rRNA gene (Muyzer et al., 1993) and fungal specific-primers ITS4- GC (5'-CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGTCCTCCG CTTATTGATATGC-3') and ITS1F (5'-CTTGGTCATTTAGAGGAAGTAA -3') targeted at the fungal 18S rRNA gene (White et al., 1990; Gardes et al., 1993). Experimental conditions for DNA amplification are described in Lorenzo et al. (2010b, 2013). The DGGE was performed with a DGGE-2401 system from CBS Scientific (CA, USA). A sample of 20 mL of each PCR product was used for DGGE analysis. Gels contained 6% (w/v) acrylamide for bacteria PCR products and 8% (w/v) acrylamide for fungi PCR products. The linear gradient used was from 49 to 76% denaturant for bacteria and from 32 to 53% for fungi, while 100% denaturing acrylamide was defined as containing 7 M urea and 40% (v/v) formamide. Gels (22 cm x 17 cm) were run in a 21 L 1x TAE buffer at 20 V for 15 min, followed by 16 h at 70 V and maintained at a constant temperature of 60 °C. Gels were stained for 25 min in 1.0x GelStar1 and destained for 30 min in distilled water prior to visualization.

2.3. Statistical Analyses GelCompar II (Applied Maths, Belgium) was used for the cluster analysis of soil bacteria and fungi based on the DGGE results. The unweighted pair-group method with arithmetic mean algorithm and Jaccard coefficient were used for the analysis. Richness, defined as the number of species, was calculated as the total number of bands per sample. To calculate abundance and diversity, defined as the number of different species and their relative frequency, DGGE gel bands were classified according to their intensity in six categories. Therefore, we carried out an indirect quantitative assessment of microbial population abundance and diversity in treated and untreated soils. Diversity was then calculated using a modification of the Shannon-

Wiener index, H´= –Σ [(ni/N) Ln (ni/N)] where ni had one of six possible values (1–6) depending on band intensity. F:B ratio was individually calculated from the data of abundance. Differences between herbicide and control plots were analyzed using test- t, whereas ANOVA was used to assess differences within sampling dates. All statistical tests were performed using SPSS v19.0 Software (SPSS Inc., Chicago, IL, USA).

3. Results

Chapter 7 Microbial changes after triclopyr application

DGGE fingerprints showed several common strong bands and numerous faint bands, indicating complex microbial community structure in control and treated soils. The cluster analyses showed different results depending on the microbial group considered. However, tree diagrams were rather accurate in separating herbicide and control plots (Fig. 2). Bacterial fingerprints presented high sensitivity to triclopyr. Multivariate analysis of the DGGE profiles showed temporal variations in the bacterial community structure in both control and herbicide plots. Single date comparison indicated that herbicide and control plots clustered apart within the half-life of triclopyr (May, October) but sample clustering before herbicide application (April, September) was unclear. One year after the last herbicide application (September 11), the herbicide plots remained clustered together and separate from control. However, seasonal effect on bacterial structure was reflected as the control plots clustered together during different sampling dates, similar to what had occurred with herbicide plots (tree diagram not shown). On the contrary, there was no clear separation between treatments on soil fungal structure throughout the different sampling dates (Fig. 2). In fact, comparison of all sampling dates analyzed together does not reflect a clear separation in either control or herbicide (data not shown).

Bacteries Bacteries 61 Bacteries 79 85 55 95 55 67 Bacteries Bacteries 86 84

10 81

84 10 60 60 50 83

15 97 20 55 20 65 a) April 2010 65 May 2010 Sept 2010 Oct 2010 91 Sept 2011

25 Bacteries Bacteries Bacteries Bacteries Bacteries 61 95 79 84 86 85 55 55 30 81 60 67 1030 100 84 70 50 10 83 70 60 50 10 153515 60 60 40 60

65 20 97 55 20 40 25 75 65 91 65 75 6070 3045 100 3050 35 70 50 70 65 40 80 80 75 40 55 60 45 75 70 60 75 50 50 80 85 75 556555 8580 75 70 80 80 60 6070 80 8085 60 65 85 75 8590 90 7080 70 8590 7580 90 80 80 90 90 90 85 95 95 95 8590 95 90 90 95 95 95 100 100 95 100 Bacteries Bacteries 100100 100 Bacteries 100 100100 100 100 Bacteries 100 Bacteries Bacteries Bacteries Bacteries 100 Bacteries Bacteries

. herbicida . control . control . control . herbicida . herbicida . control . control . control . herbicida . herbicida . herbicida . herbicida . herbicida . herbicida . control . control . control . control . control . herbicida . control . herbicida . herbicida .control .control .control .herbicida .herbicida .herbicida 1 3 2 1 3 2 3 1 2 3 1 2 3 2 1 1 3 2 2 1 1 3 3 2

3 1 2 2 1 3 . control . control . herbicida . control . herbicida . herbicida .control .control .control .herbicida .herbicida .herbicida . herbicida . herbicida . herbicida . control . control . control . control . control . control . herbicida . herbicida . herbicida H. herbicida C. control C. control C. control H. herbicida H. herbicida C C C H H H C C H C H H H H H C C C C C C H H H 1 3 2 1 3 2 3 1 2 2 1 3 2 1 1 3 3 2 3 2 1 1 2 3 3 1 2 3 1 2 2 1 1 3 3 2 3 2 1 1 3 2 3 1 2 2 1 3 3 1 2 3 1 2 1 3 2 1 3 2

Chapter 7 Microbial changes after triclopyr application

Fungi 88 Fungi 64 Fungi 63 74

64 50 Fungi 91 Fungi 66 69 76

61 70 55 60

b) 62 68 73 Sept 2011 April 2010 May 2010 72 Sept 2010 78 Oct 2010 70 Fungi Fungi Fungi 69 91 Fungi 88 Fungi 63

64 60 72 74 7480 65 64 70 74 93 73 76 76 50 60

74 50 66 72 7682 50 60 61 66 72 62 65 6876 7874 78 55 70 65

70 58 78 8076 8084 72 6070 74 93 80 78 50 70 75 74 82 8286 86 77 7682 78 80 65 84 84 75 78 82 88 58 75 84 70 86 80 78 86 80 84 86 86 90 77 80 82 98 8886 88 75 80 848288 86 88 75 8085

92 98 86 9088 90 8085 90 85 88 9290 92 92 94 90 90 92 8590 9294 94 94 90 94 96 90 9496 96 96 95 95 96 96 95 98 98 98 95 98 98 98 100 100 100100 100100 100100 100 100 Fungi 100 100 100 100 Fungi 100 Fungi Fungi

Fungi Fungi Fungi Fungi Fungi

Fungi

. control . herbicida . control . herbicida . control . herbicida . herbicida . control . control . herbicida . herbicida . control . control . herbicida . herbicida . control . herbicida . control . control . control . herbicida . herbicida . herbicida . control . control . herbicida . herbicida . herbicida . control . control 1 3 2 3 2 1 1 3 2 1 3 2 2 3 1 3 2 1 2 1 2 1 3 3 3 1 3 2 1 2 . control . herbicida . herbicida . herbicida . control . control

.control .control .herbicida .herbicida .herbicida .control . control . herbicida . control . herbicida . control . herbicida . herbicida . control . control . herbicida . herbicida . control . control . herbicida . herbicida . control . herbicida . control H1 C3 C2 H3 H2 C1 C3 H1 H3 H2 C1 C2 C2 H3 H1 C3 H2 C1 C1 H3 C2 H1 C3 H2 C2 C1 H2 H1 H3 C3 2 1 2 1 3 3 3 1 3 2 1 2

1 3 2 3 2 1

2 3 1 3 2 1 1 3 2 1 3 2

Figure 2. Dendrograms of soil bacteria and fungi community structure including control (C1, C2, C3) and herbicide (H1, H2, H3) plots based on PCR-DGGE bands. Clustering arrangement was carried out using the unweighted pair-group method with arithmetic mean algorithm and the Pearson product–moment correlation coefficient. (a) bacteria dendrogram, (b) fungi dendrogram.

Despite differences found in fingerprint clustering, no alterations in bacterial richness, density, diversity, and F:B ratio were collected after triclopyr application through the different sampling dates (Table 1). In fact, bacterial density and F:B ratio were significantly modified through the year in plots sprayed with triclopyr (p≤0.001 and p≤0.001, respectively); but similarly in control plots (p≤0.001 and p≤0.001, respectively). On the other hand, herbicide promoted a significant increase in fungal density (p≤0.01) and diversity (p≤0.05) in September 2010, before the second herbicide spraying (Fig. 3.). Nevertheless, as occurred with bacteria, density was significantly altered throughout the year (reduced in October 2010 and increased in September 2011) in both control (p≤0.01) and herbicide (p≤0.001) plots. Richness, density and bacterial diversity detected using PCR-DGGE were higher than soil fungi.

Chapter 7 Microbial changes after triclopyr application

Table 1. Differences between plots treated with triclopyr and control plots in test t. Asterisks indicate significant differences at * p ≤ 0.05, ** p ≤ 0.01 and *** p ≤ 0.001.

April 2010 May 2010 Sept 2010 Oct 2010 Sept 2011

Richness 0.613 0.710 1.000 0.676 0.874 Bacteria Density 0.978 0.266 0.923 0.393 0.677 Diversity 0.690 0.302 0.843 0.536 0.685

Richness 0.185 0.091 0.411 0.387 0.097 Fungi Density 0.133 0.698 0.002** 0.287 0.135 Diversity 0.068 0.380 0.041* 0.284 0.147

F:B ratio 0.055 0.135 0.084 0.045* 0.342

Figure 3. Fungal richness a), density b), and diversity (H´) c) of control and soils sprayed with triclopyr during the different sampling dates of the assay. Asterisks indicate significant differences at * p≤0.05, ** p≤0.005 and *** p≤0.001 in test-t.

Chapter 7 Microbial changes after triclopyr application

4. Discussion

Short and medium-term impact of triclopyr on the structure of soil bacterial and fungal communities was addressed. Despite the pertinent use of DGGE to explore changes in microbial communities, especially for application in comparative studies, due to its ability to detect single-nucleotide changes, unknown soil bacterial and fungal genotypes (scarce or rare genotypes) are probably excluded from our final fingerprints. As a consequence, the effect of triclopyr on these genotypes remains unexplored, and therefore, our results might be carefully interpreted. Detached clustering indicated that triclopyr, but also seasonality, are producing changes in the dominant bacterial species in soils invaded by A. dealbata. Triclopyr is rapidly degraded to organic acids by soil microbial communities (Ganapathy, 1997) and therefore, it could be being used by some bacteria, favoring the dominance of specific groups and addressing changes collected in DGGE fingerprints. On the contrary, main fungal species collected in DGGE fingerprints do not reflect significant changes due to herbicide or date. Therefore, clustering analyses might suggest that genetic structures of soil fungal communities had higher tolerance to triclopyr and, at the same time, higher temporal stability in comparison with bacterial communities. Nevertheless, Houston et al (1998) indicated some degree of fungal sensitivity to triclopyr, since its application after harvest decreased isolation frequencies of certain fungal groups. Although previous work suggested that the activity of soil microbial community activities was not affected by triclopyr application (Souza-Alonso et al., 2013), changes in DGGE fingerprints indicated a different trend. However, individual tree diagrams showing an alteration in bacterial structure do not necessarily disagree with the absence of alterations in the microbial community activity. In fact, contrasting soil community responses between activities and genetic structures have previously been reported after different herbicide management regimes (Bending et al., 2007; Weaver et al., 2007; Crouzet et al., 2010). Despite the alteration reflected in fingerprints in bacterial community structure one year after the final triclopyr application (September, 2011), it is difficult to ascribe this effect to the triclopyr application since, theoretically, this herbicide has a field dissipation half- life of 39 days (ganapathy, 1997). In our case, the increase in fungal density and diversity in September was collected 5 months after the first herbicide application. However, some authors indicated that triclopyr can remain active in soils producing plant mortality 6 months after the final application, even when herbicide was directly applied in tree barks (Holmes et al., 2009). The indirect interpretation of abundance

Chapter 7 Microbial changes after triclopyr application and diversity based on the intensity of DGGE bands could be troublesome to describe accurately soil microbial community; however, this method is very effective in treatment comparison. In the present study, DGGE analyses were used to compare the effects of triclopyr on the structure of sprayed and non-sprayed soil communities. Changes in bacterial fingerprints and the increase in fungal density and diversity might hypothetically suggest that triclopyr can remain active in soils invaded by A. dealbata during larger periods. On the other hand, changes in bacterial dominant groups and fungal density and diversity derived from triclopyr applications could be persistent, at least during several months after triclopyr spraying. Nevertheless, these preliminary findings should be further supplemented with other molecular techniques to obtain a better comprehension of the ecological fate of triclopyr.

5. Conclusions

These results pointed out that, regardless of the microbial group studied, both bacterial and fungal communities were affected after triclopyr spraying. The structure of bacterial community was affected from the first application and alteration persisted one year after the final triclopyr spraying. In contrast, fungal structure was not affected; however density and diversity of the main fungal species were increased during the time of the assay. This 18-month study reveals the possibility of unexpected persistent effects of triclopyr on invaded soil communities, highlighting the importance of herbicide selection and application to manage plant invasion.

Acknowledgements

We would like to thank the forest community of Ribadavia for its facilities to establish management plots, and especially its president, Benito Alonso, for his kindness and helpful comments. Our special thanks to Pablo Oitavén for sharing his experience in A. dealbata control.

References

Bending, G.D., Rodriguez-Cruz, M.S., Lincoln, S.D., 2007. Fungicide impacts on microbial communities in soils with contrasting management histories. Chemosphere. 69, 82-88.

Chapter 7 Microbial changes after triclopyr application

Campbell, P.L., Kluge, R.L., 1999. Development of integrated control strategies for wattle. 1. Utilization of wattle, control of stumps and rehabilitation with pastures. S. Afr. J. Plant Soil. 16, 24-30. Crouzet, O., Batisson, I., Besse-Hoggan, P., Bonnemoy, F., Bardot, C., Poly, F., Bohatier, J., Mallet, C., 2010. Response of soil microbial communities to the herbicide mesotrione: a dose-effect microcosm approach. Soil Biol. Biochem. 42, 193-202. Fuentes-Ramírez, A., Pauchard, A., Marticorena, A., Sánchez, P., 2010. Relationship between the invasion of Acacia dealbata Link (Fabaceae: Mimosoideae) and plant species richness in south-central Chile | Relación entre la invasión de Acacia dealbata Link (Fabaceae: Mimosoideae) y la riqueza de especies vegetales en el centro-sur de Chile. Gayana Bot. 67, 188-197. Ganapathy, C., 1997. Environmental fate of triclopyr. Environmental Monitoring & Pest Management Branch. Department of Pesticide Regulation, Sacramento (CA). Gardes, M., Bruns, T.D., 1993 ITS primers with enhanced specificity for basidiomycetes- application to the identification of mycorrhizae and rusts. Mol. Ecol. 2, 113-118. Holmes, K.A., Berry, A.M., 2009. Evaluation of off-target effects due to basal bark treatment for control of invasive fig trees (Ficus carica). Invas. Plant Sci. Manag. 2, 345-351. Houston, A.P.C., Visser, S., Lautenschlager, R.A., 1998. Response of microbial processes and fungal community structure to vegetation management in mixedwood forest soils. Can. J. Bot. 76, 2002-2010. Langeland, K., Meisenburg, M., 2009. Herbicide evaluation to control Clematis terniflora invading natural areas in Gainesville, Florida. Invas. Plant Sci. Manag. 2, 70-73. Lin, X.Y., Yang, Y.Y., Zhao, Y.H., Fu, Q.L., 2012. Biodegradation of bensulfuron-methyl and its effect on bacterial community in paddy soils. Ecotoxicology. 21, 1281-1290. Lorenzo, P., González, L., Reigosa, M.J., 2010a. The genus Acacia as invader: The characteristic case of Acacia dealbata Link in Europe. Ann. For. Sci. 67, 101-111. Lorenzo, P., Rodríguez-Echeverría, S., González, L., Freitas, H., 2010b. Effect of invasive Acacia dealbata Link on soil microorganisms as determined by PCR-DGGE. Appl. Soil Ecol. 44, 245-251. Lorenzo, P., Pereira, C.S., Rodríguez-Echeverría, S., 2013. Differential impact on soil microbes of allelopathic compounds released by the invasive Acacia dealbata Link. Soil Biol. Biochem. 57, 156-163. Muyzer, G., de Waal, E.C., Uitterlinden, A.G., 1993. Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis and polymerase chain reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microbiol. 59, 695-700. Richardson, D.M., Rejmánek, M., 2011. Trees and shrubs as invasive alien species - a global review. Divers. Distrib. 17, 788-809. Souza-Alonso, P., Lorenzo, P., Rubido-Bará, M., González, L., 2013. Effectiveness of management strategies in Acacia dealbata Link invasion, native vegetation and soil microbial community responses. For. Ecol. Manag. 304, 464-472.

Chapter 7 Microbial changes after triclopyr application

Vitelli, J.S., Madigan, B.A., Van Haaren, P.E., Setter, S., Logan, P., 2009. Control of the invasive liana, Hiptage benghalensis. Weed Biol. Manag. 9, 54-62. Ward, J.S., Worthley, T.E., Williams, S.C., 2009. Controlling Japanese barberry (Berberis thunbergii DC) in southern New England, USA. For. Ecol. Manag. 257, 561-566. Wehtje, G., Gilliam, C.H., 2012. Cost-effectiveness of glyphosate, 2, 4-D, and triclopyr, alone and in select mixtures for poison ivy control. Weed Technol. 26, 469-473. Weaver, M.A., Krutz, L.J., Zablotowicz, R.M., Reddy, K.N., 2007. Effects of glyphosate on soil microbial communities and its mineralization in a Mississippi soil. Pest Manag. Sci. 63, 388- 393. White, T.J., Buns, T.D., Lee, S., Taylor, J., 1990. Analysis of phylogenetic relationships by amplification and direct sequencing of ribosomal RNA genes. In: Innis, M.A., Gefland, D.H., Sninsky, J.J. and White, T.J. (Eds.), PCR Protocols: A Guide to Methods and Applications. Academic, New York, pp. 315-322

Chapter 8 General discussion and future perspectives

PART V

Chapter 8 General discussion and future perspectives

Chapter 8 General discussion and future perspectives

Chapter 8. General discussion and future perspectives

Chapter 8 General discussion and future perspectives

Chapter 8 General discussion and future perspectives

Summarizing, each chapter in this PhD dissertation has its own discussion and conclussions section. Therefore, our goal with this final chapter is to encourage a comprehensive and critical discussion on the plant invasive process related to the current socio-political scenario and future research perspectives. As our results indicated through these lines, A. dealbata is a heavy ecosystem modifier. Due to the magnitude of change, we recently recommended the term transformer referring to A. dealbata and other Australian acacias (A. melanoxylon, A. mearnsii, A. longifolia) (Souza-Alonso et al., 2014, under review), a term previously described by Richardson et al (2000) to identify “a subset of invasive plants which change the character, condition, form or nature of ecosystems over a substantial area relative to the extent of that ecosystem”. Therefore, there is no surprise in the fact that this species also produce some alterations that endure even when the invasive has already been removed. These “legacy effects” or “residual effects” have also been suggested as impacts produced by acacias in invaded ecosystems (Marchante et al., 2009). This legacy consists in changes in a long-term even resisting invader removal. Due to the severe changes produced by A. dealbata, we can predict that legacy effects should be probably found even in areas where A. dealbata was removed long time ago. It would be interesting to investigate the possible role of already known changes induced by A. dealbata (structural, chemical, microbial, plant diversity) conditioning the normal function of restored communities. Nevertheless, we would like to remark that the net effect of A. dealbata is highly conditioned by preexisting ecosystem conditions. We also found that variation in soil pH after A. dealbata invasion can have opposite trends depending on the ecosystem studied (Souza-Alonso et al., 2014; Chapter 4). In this case, pH was slightly but significantly increased in organic matter-rich, highly conserved mixed forest whereas a significant acidification was collected in open shrublands, indicating that different ecosystems do not present equal responses after invasion (Koutika et al., 2007). Additionally, even within the same ecosystem, the variation in soil parameters seems to be conditioned to the age of invasion (Chapter 5). Different litter input provided by different dominant species within a community can also be an interesting point of discussion. Different C-sources provided by acacias to the root-soil matrix can affect nutrient cycling and decomposition with possible ecological ramifications (Ens et al., 2009a). Mixed forest present, in general, highest plant diversity than shrublands and this fact can contribute to explain changes recorded (Chapter 4). Increased plant species richness may also alter the soil microbial

Chapter 8 General discussion and future perspectives community by increasing the heterogeneity of resources (Ettema and Wardle, 2002). As a result, microbial communities provided with more heterogeneous sources of C, due to plant richness, might present more resistance to chemical addition, as effectively occurs in this case. A. dealbata is recognized as a fast growing tree (Sheppard et al., 2006) and this trait probably favors its competition against native species. We include a strong competitor –Cytisus scoparius-, usually considered as pioneer species. After these results, oxidative stress did not appear as a powerful tool by which this species outcompete native plants (Chapter 3). Complementary, at this time some efforts are being carried out to test the reciprocal effect of A. dealbata (and other invasive species as A. melanoxylon or Ailanthus altissima) vs native shrubland species (including C. scoparius), trying to investigate the potential of this native pioneer ecosystem to face plant invasions. This novel and sustainable approach has been recently developed and first results are being processed at this moment (Nogueira et al., unpublished results). Recent data indicate that during the last years (from 1998 to 2008) the presence of A. dealbata in shrublands from the NW of Spain was reduced (almost 1%) (Hernández et al., 2014), this support our hypothesis and give it ecological sense. Complementary, we are designing experimental approaches to elucidate and differentiate the effects of aboveground and belowground competition invader-native shrubland. Allelopathic effects have been suggested frecuently as a potential tool increasing competitive ability of A. dealbata. To approximate our results to the concept of allelopathy, we think that two conditions are essential: the use of natural concentrations and the inclusion of soil natural conditions. Integrating the complexity, we are currently working in a bioassay approach based on Ens et al., (2009a) work, with similar concentrations to those that occurred in the field (Souza-Alonso et al., under redaction). Additionally, we recognize that plant chemicals or extracts could be individually tested in the lab to identify their potential role on plants, seeds, or microbial communities. In this sense, chemical structure of bioactive compounds from A. dealbata is currently under study (Lorenzo et al., unpublished work). However, allelopathy is a natural phenomenon and there is no possibility of disentangle the dimensions (wide, depth and time) and intricate factors (soil texture and composition, chemistry, bacterial and fungal communities, mesofauna) that synchronically interact in the natural soil matrix and could be influencing the fate (production, release, transformation and degradation) of chemicals in the field. In other cases, we should refer it properly as phytotoxicity. Related to A. dealbata phytotoxicity, an unexplored factor arises from our work. The possible role of VOCs released by A. dealbata influenced the germination and early

Chapter 8 General discussion and future perspectives development of native seeds (Chapter 2). These results are promising and could help us to understand the whole picture of intricate interactions plant invader-native species. Nevertheless, it would be interesting and necessary elucidate the role of VOCs released from A. dealbata flowers and other plant parts in the field to test if phytotoxic effects as collected in our assay present ecological relevance. Actually, flowers are produced in a short space of time. Curiously, flowering period of the invasive overlaps with one of the key points of plant development in the Northern Hemisphere, early spring. Nevertheless, inhibitoriest results of VOCs from our assay indicate a possible autotoxic effect on A. dealbata. This fact is ecological possible since A. dealbata mostly spreads from vegetative reproduction in Europe Mediterranean climate (personal observation). Nevertheless, autotoxic effects contrasts with auto-stimulation results previously found (Lorenzo et al., 2010). For these reasons, efforts are being carried out to design adequate field assays in order to evaluate the possible ecological role of VOCs in the invasive process. Furthermore, we recorded acute changes due to the presence of A. dealbata in different ecosystems over time (Chapter 5). More accurate assays including novel DNA techniques to identify the functional group of microorganisms vulnerable to this attack should be desirable. Additionally, it would be interesting to go in depth in the impact that the presence of A. dealbata has on the assemblage of other groups in the upper layers of trophic chain as birds or other vertebrates. Other related species, as A. saligna has previously shown its influence on avian communities (Dures and Cumming, 2010). In this sense, there is a lack of information concerning the impacts produced due to the presence of A. dealbata. There is abundant literature concerning several aspects of the invasion processes of A. dealbata; however less consideration has taken the management of its spreading in Europe. As far as we know, until the date only one work (Souza-Alonso et al., 2013; Chapter 6 and 7) has been published in scientific journals concerning the management of A. dealbata in Spain but also in Europe. Despite, long-term management studies are more useful to infer straight conclusions, this assay showed promising results through the use of the largely used herbicide triclopyr combined with systematical cuttings of A. dealbata individuals (Chapter 6). Small-scale triclopyr applications on mature plants produced extraordinary results inhibiting stem resprouting during the first two years after cutting. Triclopyr also sprayed caused A. dealbata saplings to die. However, subsidiary effects -reduced plant diversity, richness and cover- were initially recorded but were gone one year after last herbicide application. Additionally, we should take into account that our results indicate that the effect of triclopyr could be affecting microbial communities in an unpredictable manner.

Chapter 8 General discussion and future perspectives

Despite that common procedures must be developed, each recovery case presents specific idiosyncrasies that lead to specific actuations. Our short-term control assay has proved effective; however, efforts to eradicate this species have to be maintained several years to achieve successful results and so long term monitored assays should be desirable. Probably, the time to eradicate A. dealbata is intimately linked with the duration of invasion. As occurred with other acacias, recovery of native plant communities seems could be increasingly difficult with time elapsed since invasion, as in A. longifolia (Marchante et al. 2008). Moreover, this is more pronounced when we are dealing with species that produces heavy modifications in their niches/ecosystems or ecosystem-level processes. As we demonstrated, in the case of A. dealbata the degree of change is linked with the age of invasion (Chapter 5). Experience has shown that successful control projects require clear, time-based goals, adequate resources to achieve the desired level of control, and actual and in-kind support from the stakeholders (Forsyth et al., 2012). To reduce investments and assure restoration sustainability in a long-term, it would be very interesting the involvement of local communities in the development of management programs. The inclusions of suggestions for a managed plantation could be a desirable option (de Neergaard et al., 2005); however, other alternatives can be proposed. To accumulate more valuable information, it might be useful the inclusion of novel techniques remote detection based on spectral, textural and phenological analysis (Bradley, 2014) or the use of satellite imaging and GIS. Based on aerial photographs, the last one was recently used to assess the advance of A. dealbata in the latest decades (as in Vazquez de la Cueva, 2014) and develop forecast models to predict the threat to surrounding environments. Once reached this point, the horizontal transmission of information between all agents involved (society - land owners - stakeholders- scientists - industry) becomes critical. On the other hand, the prevention of the invasion is the key starting point for a sustainable management. The adequate maintenance of native vegetation, especially native forest is highly recommended to avoid the spreading of acacias, since shade intolerance of this group can slow down invasive process. In addition, shrubland formations (composed by native species) can also act as natural fences, due to their thickness, density and highly competitive abilities. As we stated above, some efforts are being carried out to test the possibility of implantations of these natural barriers against invasive species (Nogueira et al., unpublished data). Probably, open prairies, or ecosystem without a dense tree canopy can be more vulnerable to Acacia spp invasions and efforts must be employed to identify them and avoid the propagule pressure nearby. Nevertheless, and contrary to these expectations, the presence of

Chapter 8 General discussion and future perspectives invasive species as A. dealbata and A. melanoxylon was reduced in shrublands during the last years (Hernández et al., 2014) After several years of observation, we are certain that forced human migration from rural areas leaded to land neglect and misuse which was one of the key dominating forces in the spread of acacias. According to de Neergaard et al. (2005), we believe that facilitating land use for arable and/or grazing purposes could result in greater concern, care and, ultimately, control of the invasive species. On the opposite, unworked or unprotected land does not represent a significant value in the collective imaginary. In developed countries, management actions per se have been demonstrated expensive but ineffective in the long-term. However, due to the degree of change under A. dealbata stands, to achieve effective control and profitable land uses management actions alone are insufficient and novel approaches could be necessary (Seastedt et al., 2008). In our opinion, government policies exclusively oriented on fighting against plant invasions avoid the dormant problem of land misuse. Together with management actions, we argue that effective stakeholder, managers or government solutions should be oriented to maintain population on rural areas leading to ameliorate exploitation of environmental resources, permanently involving local communities in the maintenance of system stability. Nevertheless, further actions to achieve society participation should be a motivational challenge for who are involved in controlling invasive species (Le Maitre et al., 2011). Idealistically, in the current context of a worldwide economic scenario and unsustainable resources consumption, policies in this sense can provide long-term incentives and opportunities to ameliorate human life conditions, drastically reorganizing our concepts of human progress, sustainable society and land development.

References

Bradley, B.A., 2014. Remote detection of invasive plants: a review of spectral, textural and phenological approaches. Biol. Invasions, 16, 1411-1425. de la Cueva, A.V., 2014. Case studies of the expansion of Acacia dealbata in the valley of the river Miño (Galicia, Spain). For. Syst. 23, 3-14. Dures, S.G., Cumming, G.S., 2010. The confounding influence of homogenising invasive species in a globally endangered and largely urban biome: Does habitat quality dominate avian biodiversity?. Biol. Conserv., 143, 768-777. Ens, E.J., French, K., Bremner, J.B., 2009. Evidence for allelopathy as a mechanism of community composition change by an invasive exotic shrub, Chrysanthemoides monilifera spp. rotundata. Plant Soil, 316, 125-137.

Chapter 8 General discussion and future perspectives

Ens, E.J., Bremner, J.B., French, K., Korth, J., 2009b. Identification of volatile compounds released by roots of an invasive plant, bitou bush (Chrysanthemoides monilifera spp. rotundata), and their inhibition of native seedling growth. Biol. Invasions. 11, 275-287. Ettema, C.H., Wardle, D.A., 2002. Spatial soil ecology. Trends Ecol Evol. 17, 177-183. Forsyth, G.G., Le Maitre, D.C., O'Farrell, P.J., Van Wilgen, B.W., 2012. The prioritisation of invasive alien plant control projects using a multi-criteria decision model informed by stakeholder input and spatial data. J. Environ. Manag. 103, 51-57. Hernández, L., Martínez-Fernández, J., Cañellas, I., de la Cueva, A.V., 2014. Assessing spatio- temporal rates, patterns and determinants of biological invasions in forest ecosystems. The case of Acacia species in NW Spain. For. Ecol.Manage. 329, 206-213. Koutika, L.S., Vanderhoeven, S., Chapuis-Lardy, L., Dassonville, N., Meerts, P., 2007. Assessment of changes in soil organic matter after invasion by exotic plant species. Biol. Fertil. Soils. 44, 331-341. Le Maitre, D.C., Gaertner, M., Marchante, E., Ens, E.J., Holmes, P.M., Pauchard, A., Richardson, D.M., 2011. Impacts of invasive Australian acacias: implications for management and restoration. Divers. Distrib. 17, 1015-1029. Lorenzo, P., Pazos-Malvido, E., Reigosa, M.J., González, L., 2010. Differential responses to allelopathic compounds released by the invasive Acacia dealbata Link (Mimosaceae) indicate stimulation of its own seed. Aust. J. Bot. 58, 546-553.

Marchante, E., Kjøller, A., Struwe, S., Freitas, H., 2008. Soil recovery after removal of the N2- fixing invasive Acacia longifolia: consequences for ecosystem restoration. Biol. Invasions 11, 813-823. de Neergaard, A., Saarnak, C., Hill, T., Khanyile, M., Berzosa, A.M., Birch-Thomsen, T., 2005. Australian wattle species in the Drakensberg region of South Africa–An invasive alien or a natural resource? Agr. Syst. 85, 216-233. Richardson, D.M., Pyšek, P., Rejmánek, M., Barbour, M.G., Panetta, F D., West, C.J., 2000. Naturalization and invasion of alien plants: concepts and definitions. Divers. Distrib. 6, 93- 107. Seastedt, T.R., Hobbs, R.J., Suding, K.N., 2008. Management of novel ecosystems: are novel approaches required? Front. Ecol. Environ. 6, 547-553. Sheppard, A.W., Shaw, R.H., Sforza, R. 2006. Top 20 environmental weeds for classical biological control in Europe: A review of opportunities, regulations and other barriers to adoption. Weed Res. 46, 93-117. Souza-Alonso, P., Novoa, A., González, L., 2014. Soil biochemical alterations and microbial community responses under Acacia dealbata Link invasion. Soil Biol. Biochem. 79, 100-108.

Chapter 8 General discussion and future perspectives

Chapter 8 General discussion and future perspectives

Chapter 8 General discussion and future perspectives

From trees to molecules. The invasive process of Acacia dealbata Link at different scales