Translational Profiling of Cardiomyocytes Identifies an Early Jak1/Stat3 Injury Response Required for Zebrafish Heart Regenerati

Translational profiling of cardiomyocytes identifies an early Jak1/Stat3 injury response required for zebrafish heart regeneration

Yi Fang, Vikas Gupta, Ravi Karra, Jennifer E. Holdway, Kazu Kikuchi1, and Kenneth D. Poss2

Department of Cell Biology and Howard Hughes Medical Institute, Duke University Medical Center, Durham, NC 27710

Edited by Eric N. Olson, University of Texas Southwestern Medical Center, Dallas, TX, and approved July 5, 2013 (received for review May 24, 2013) Certain lower vertebrates like zebrafish activate proliferation of we used TRAP to identify ribosome-associated RNAs in spared cardiomyocytes after cardiac injury to regenerate lost zebrafish cardiomyocytes during heart regeneration. heart muscle. Here, we used translating ribosome affinity purification to profile translating RNAs in zebrafish cardiomyocytes Results during heart regeneration. We identified dynamic induction of To generate cardiomyocyte ribosome-associated RNA profiles several Jak1/Stat3 pathway members following trauma, events from transgenic zebrafish, we used regulatory sequences of accompanied by cytokine production. Transgenic Stat3 inhibition cardiac myosin light chain 2a to drive expression of an EGFP- pd61 in cardiomyocytes restricted injury-induced proliferation and regen- L10a cassette [Tg(cmlc2:EGFP-RPL10a) ] (referred to as eration, but did not reduce cardiogenesis during animal growth. cmlc2:TRAP) (Fig. 1 A and B). Because the cmlc2a promoter is The secreted protein Rln3a was induced in a Stat3-dependent man- active in virtually all adult cardiomyocytes, the cmlc2:TRAP line ner by injury, and exogenous Rln3 delivery during Stat3 inhibition is expected to identify cardiomyocytegeneexpressionduring stimulated cardiomyocyte proliferation. Our results identify an injury- early injury responses as well as regenerative responses. The specific cardiomyocyte program essential for heart regeneration. TRAP reporter was expressed in cardiomyocytes, where its pres- ence did not inhibit heart regeneration (Fig. 1C). To assess the TRAP | cardiac regeneration | interleukin | inflammation | endocardium specificity of this approach, we immunoprecipitated ribosome- associated RNAs from ventricles of adult cmlc2:TRAP fish and examined expression of cardiac genes. These experiments de- ardiac regeneration eludes adult mammals, but certain tected known cardiomyocyte markers by PCR amplification, but nonmammalian vertebrates present models of robust cardiac C genes with expression known to be restricted to other cell types repair. In particular, zebrafish maintain a high capacity for myo- were weak or undetectable (Fig. 1D). cardial regeneration throughout life and can create new heart To profile gene expression after injury, we immunoprecipi- muscle with minimal scarring after a variety of severe genetic or fi – tated cardiomyocyte RNAs from uninjured cmlc2:TRAP sh mechanical injuries (1 3). Thus, studies of how heart regener- ventricles and ventricles at 1 and 7 d after 20% apical resection ation occurs naturally can help guide approaches to stimulating (dpa). The apical halves of ventricles were collected and pooled, adult mammalian heart regeneration, for which there are now and immunoprecipitated RNA was processed for microarray – multiple promising strategies (4 9). analysis. We identified 138 genes with significant expression Genetic fate-mapping experiments indicated that spared car- differences at 1 dpa compared with uninjured ventricles, and fi diomyocytes are the primary source tissue for zebra sh heart fewer differentially expressed genes at 7 dpa (Fig. S1A and Table regeneration, with little or no contribution by a resident stem cell S1; raw data have been deposited in the National Center for population (1, 10–12). Retinoic acid, Transforming growth factor Biotechnology Information Gene Expression Omnibus Web site). beta 1, Insulin-like growth factor 2, Sonic hedgehog, and Platelet- Levels of ion transporters and channels, such as solute carrier derived growth factor ligands all are synthesized in the vicinity of family 39 member 3, chloride intracellular channel 5, solute proliferating cardiomyocytes, and have positive influences on carrier family 12,andpotassium voltage-gated channel subfamily H muscle regeneration (13–16). Other potential factors include member 6, were increased by 1 dpa, supporting previously identi- hypoxia, which appears to play a positive role in cardiomyocyte fied changes in cardiomyocyte electrical properties during re- proliferation, whereas hyperoxia, active p38α mitogen activated generation (1, 11). We also found increased levels of genes protein kinase, and microRNA miR-133 have negative roles (17– relevant to cell survival and proliferation, such as B-cell lymphoma 19). Defining additional pathways that underlie injury-induced 2 (bcl2), jun B proto-oncogene a, FOS-like antigen 1a, poly(ADP- cardiomyocyte proliferation in zebrafish is important for better ribose) polymerase family member 3 and 4 (Fig. S1B). Compared understanding heart regeneration, and is also relevant to new with a published microarray dataset using whole 1-dpa ventric- methodology to boost the low levels of cardiomyocyte proliferation ular tissue (24), only 10 genes with significant expression changes in injured mammalian hearts (20, 21). Novel transgenic profiling technologies have recently been developed for isolation of actively translated mRNAs from Author contributions: Y.F. and K.D.P. designed research; Y.F., V.G., R.K., and J.E.H. per- specific cell types (22, 23). For example, with translating ribo- formed research; Y.F., V.G., and K.K. contributed new reagents/analytic tools; Y.F., R.K., and J.E.H. analyzed data; and Y.F. and K.D.P. wrote the paper. some affinity purification (TRAP) technology, an enhanced GFP fl (EGFP) reporter gene is fused to the N terminus of the large The authors declare no con ict of interest. subunit ribosomal protein L10a, and this cassette is placed This article is a PNAS Direct Submission. downstream of a tissue-specific promoter. Translating mRNAs Data deposition: The raw data reported in this paper has been deposited in the Gene fi Expression Omnibus (GEO) database, www.ncbi.nlm.nih.gov/geo (accession no. can then be isolated from promoter-de ned cell populations in GSE48914). The microarray data can be found in Table S1. transgenic animals by immunoprecipitation with an antibody 1Present address: Developmental and Stem Cell Biology Division, Victor Chang Cardiac recognizing EGFP. Although this technology has not yet been Research Institute, Darlinghurst, NSW, 2010 Australia. applied to tissue regeneration, TRAP avoids tissue dissociation 2To whom correspondence should be addressed. E-mail: [email protected]. fi fi and cell puri cation, and thus has clear advantages for pro ling This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. injury and regeneration responses in specific cell types. Here, 1073/pnas.1309810110/-/DCSupplemental.

13416–13421 | PNAS | August 13, 2013 | vol. 110 | no. 33 www.pnas.org/cgi/doi/10.1073/pnas.1309810110 Downloaded by guest on October 1, 2021 Fig. 1. Translational profiling of cardiomyocytes during zebrafish heart regeneration. (A)Tissuesec- tion indicating localization of EGFP-L10a fluorescence to cardiomyocytes in cmlc2:TRAP hearts. (B)Higher- magnification view of an uninjured cmlc2:TRAP ventricular apex. (C) Regeneration appears normal in cmlc2:TRAP ventricles 30 d after partial resection. Dashed line indicates approximate amputation plane. (Scale bars for A–C,50μm.) (D) RT-PCR of total or immunoprecipitated (TRAP) RNAs isolated from adult cmlc2:TRAP ventricles. β-actin1, hand2, cmlc2, ventricular myosin heavy chain (vmhc) and anf (also known as natriuretic peptide precursor A) are expressed in cardiomyocytes (CMs), and flk1 (endocardial), gata2a (hematopoietic), and tcf21 (epicardial) are noncardiomyocyte genes (Non- CMs). (E) Heat map from microarray indicating increased levels of Jak1/Stat3 pathway members in cmlc2:TRAP RNA samples at 1 dpa. (F) qPCR using RNAs immunoprecipitated from cmlc2:TRAP ventricles, confirming up-regulation of Jak1/Stat3 pathway members after injury. Expression levels were normalized to that of β-actin2, and further normalized to that of the uninjured sample. Data are mean ± SEM n = 3, *P < 0.05, **P < 0.01, ***P < 0.001, Student t test (unpaired, two-tailed). (G) Western Blots using total proteins extracted from uninjured and 1-dpa hearts, indicating increased protein levels of Stat3, phosphorylated Stat3 (P-Stat3), and Bcl2 at 1 dpa. Tubulin was used as a loading control (shown for Stat3 and P-Stat3 lanes).

are shared. Possible explanations for this modest overlap in- proliferation, and other events (28, 29). Pathway up-regulation BIOLOGY

clude: (i) background noise from gene-expression changes in was further confirmed by in situ hybridization. Similar to dy- DEVELOPMENTAL nonmuscle cells; (ii)specificity of the TRAP technique to ri- namic expression signatures of certain epicardial and endocar- bosome-associated RNAs; and (iii) variation in gene coverage dial factors (15, 30), induction of Jak1/Stat3 pathway genes was among microarrays. TRAP did not identify some genes pre- first organ-wide at 1 dpa, but then localized to a region of car- viously detected by visual techniques in cardiomyocytes at 7 diomyocytes at the site of regeneration by 7 dpa (Fig. 2 A and B, dpa, such as gata4 and mps1 (3,11).Wesuspectthatthis and Fig. S2A). finding is at least in part a result of dilution of signals by Many ligands transduce signaling via Jak1/Stat3. Based on cardiomyocytes that are not participating in regeneration at identification of il6st up-regulation after injury, we examined this stage. expression of cytokine receptors that are known to mediate Il6st Most remarkably, several members of the Janus kinase 1/Sig- dimerization (31). We did not detect expression of the oncostatin nal transducer and activator of transcription 3 (Jak1/Stat3) M receptor osmr from cmlc2:TRAP samples (Fig. S2B). Of in- pathway represented on the microarray, including interleukin terleukin 6 receptor alpha (il6r-α), interleukin 11 receptor alpha 6 signal transducer (il6st), jak1, stat3, and the target gene (il11r-α), and leukemia inhibitory factor receptor alpha a (lifra), we suppressor of cytokine signaling 3b (socs3b), had highly ele- found that il11r-α was most abundantly expressed in uninjured fi vated levels in 1-dpa cardiomyocytes (Fig. 1E), results con rmed cardiomyocytes, and its levels increased by 1 d following injury. by quantitative PCR (qPCR) (Fig. 1F). Among seven Stat factors – lifra was the next most abundantly expressed receptor, although (Stat1 4, -5a, -5b, and -6), Stat3 is activated by a variety of we could not detect increased levels after injury (Fig. S2B). cytokines/growth factors and has multiple functions in embryo- Correspondingly, we detected increased levels of il11r-α ligands genesis and cell survival/proliferation (25, 26). The Jak1/Stat3 interleukin 11 a and b (il11a, il11b) and the lifra ligand lif from pathway was the top enriched pathway at 1 dpa as analyzed by whole ventricular tissue at 1 dpa, but no increases in other po- the DAVID functional annotation clustering tool (P value: 1.4 tential ligands like ciliary neurotrophic factor (Fig. 2C and Fig. S2 E-4), but did not emerge as a significantly enriched pathway in C–E). Among these genes, il11a was the most abundant ligand at previous transcriptome analyses of zebrafish heart regeneration that used whole-tissue samples (24, 27). jak2a and stat2, which is 1 dpa (Fig. S2E). By in situ hybridization, we detected induction expected to provide a more restricted immunoregulatory func- of il11a throughout the ventricle in endocardial cells at 1 dpa tion, were recently reported by microarray or qPCR as up-reg- (Fig. 2D), localization that was supported by histological coloc- alization with fli1:EGFP and by RT-PCR analysis of purified fli1: ulated in 7-dpa whole-cardiac tissue (18). However, stat2 and + other stat genes did not show significant myocardial up-regula- EGFP endothelial/endocardial cells (Fig. 2E and Fig. S2F). By tion in our experiments. To confirm that these profiles could 7 dpa, il11a reactivity was detected only at the injury site in en- represent increased translation products, we assessed protein docardial cells, as well as other cell types (Fig. 2D). We did not levels in whole cardiac tissue by Western blotting. We detected detect the expression of il11b or lif by in situ hybridization, and increased levels of Stat3, phosphorylated Stat3, and Bcl2 protein by contrast with il11a, their expression was detectable at 1 dpa at 1 dpa, consistent with rapid induction in cardiomyocytes after by RT-PCR in cells enriched for the myeloid marker pu.1 (Fig. injury (Fig. 1G). 2E). We also detected weak expression of il11b in endothelial/ Jak1/Stat3 signaling is initiated by dimerization of the signal endocardial cells, whereas lif was exclusively detected in pu.1- transducer Il6st upon cytokine binding to its receptor. Following enriched cells (Fig. 2E). Thus, our data indicate that cardiac Il6st dimerization, Jak is activated and phosphorylates Il6st, injury triggers rapid induction of Jak1/Stat3 pathway members creating a docking site for Stat3. After phosphorylation, Stat3 in cardiomyocytes that is coordinated with ligand production dimers dissociate from the receptor, translocate to the nucleus, from auxiliary cells. This program activates first in an organ- and activate transcription of genes involved in cell survival, cell wide manner, then localizes to the injury site.

Fang et al. PNAS | August 13, 2013 | vol. 110 | no. 33 | 13417 Downloaded by guest on October 1, 2021 Fig. 2. Induction of Jak1/Stat3 pathway members and ligands after cardiac injury. (A and B) In situ hybridization revealing Jak1/Stat3 pathway members (shown here are il6st and socs3b) induced in an organ-wide manner at 1 dpa (A), and then restricted to the injury site at 7 dpa (B). Dashed lines indicate approximate amputation plane. Brackets indicate injury site. (C) qPCR from ventricular RNA samples revealed induction of il11a, il11b, and lif at 1 and 7 dpa. Data are mean ± SEM n = 3, *P < 0.05, **P < 0.01, ***P < 0.001, Student t test (unpaired, two- tailed). Expression levels were normalized to that of β-actin2, and further normalized to that of the uninjured sample. (D) il11a expression was induced in an organ-wide manner in endocardial cells at 1 dpa, and localized to the injury site at 7 dpa. Dashed line indicates approximate amputation plane. Brackets indicate injury site. (E) RT-PCR of samples from pu- + rified endocardial/endothelial (fli1:EGFP ) cells or pu.1-enriched cells at 1 dpa. il11a was detected in fli1:EGFP+ samples, similar to the Vegf receptor flk1. lif was detected in pu.1-enriched samples; it was undetectable when the same amount of total ventricular RNA was used for amplification (total). il11b was detected in pu.1-enriched samples and less so in + fli1:EGFP samples. anf and tcf21 are markers for cardiomyocytes and epicardium, respectively, and were detected in total ventricular RNA samples. (Scale bars, 50 μm.)

To define requirements for the Jak1/Stat3 pathway during levels of resection-induced proliferation (34). In contrast with heart regeneration, we created a transgenic line that enabled effects on regenerative proliferation, dnStat3 induction did not inducible expression of a dominant-negative Stat3 cassette reduce cardiomyocyte proliferation indices during 10 d under [Tg(bactin2:loxp-DsRED-STOP-loxp-dnStat3-GFP)pd59] (referred accelerated growth conditions, and animals grew normally (Fig. to as β-act2:RSdS) (Fig. 3A). This cassette is based on published 3D and Fig. S4 A–C). We also found that zebrafish larvae survive studies showing that mutation of a tyrosine blocks phosphory- to adulthood after myocardial induction of dnStat3 at 4 d lation and dimerization, functioning as a dominant-negative to postfertilization (Fig. S4D). Taken together, these results in- specifically inhibit Stat3 signaling (32, 33). To express dnStat3 dicate that Stat3 requirements during cardiomyocyte prolifera- specifically in cardiomyocytes, we crossed this line to a second tion are preferential or unique to the context of injury. transgenic line permitting 4-hydroxytamoxifen (4-HT)-inducible To determine how Stat3 levels might control cardiomyocyte Cre-mediated recombination in cardiomyocytes [Tg(cmlc2: proliferation, we performed a second round of unbiased screening: CreER)pd13], and incubated animals with 4-HT. Following microarray analysis using total RNA samples collected from 4-HT introduction and ventricular injury, there was an ∼80% cmlc2:CreER;β-act2:RSdS and control ventricles at 1 and 7 dpa. reduction in expression of the target gene socs3b from whole We then analyzed these microarray data together with TRAP ventricular tissue at 1 dpa, indicating reduced Stat3 activity (Fig. microarray data. We searched for genes encoding factors with S3A). To examine the effects of dnStat3 on regeneration, we increased expression after injury represented on both microarray treated cmlc2:CreER;β-act2:RSdS and control β-act2:RSdS fish datasets, and with reduced expression during Stat3 inhibition. with 4-HT, injured their ventricles 3 d later, and allowed ani- Relaxin 3a (Rln3a), a member of the Relaxin family of secreted mals to regenerate for 30 d. Although the ventricular walls of peptide hormones first studied in reproductive tissues but also control animals regenerated with little or no scarring, animals with reported roles in other tissues, met these criteria. Relaxin with induced dnStat3 displayed prominent cardiac muscle defi- ligands interact with Relaxin/Insulin-like family peptide recep- ciencies and scarring (Fig. 3B). To assess how Stat3 inhibition tors, G protein-coupled receptors that transduce signals via a blocks regeneration, we examined cardiomyocyte prolifera- cAMP/protein kinase A (PKA)-dependent pathway (35, 36). In tion after injury. We observed ∼80% and ∼36% reductions in our experiments, rln3a was up-regulated 36.2-fold in cardio- proliferation indices at 7 and 14 dpa, respectively, in 4-HT– myocytes by 1 dpa (Fig. 4A), and its expression was reduced 90% treated fish expressing dnStat3 (Fig. 3 C and D, and Fig. S3 B and by myocardial Stat3 inhibition (Fig. 4B). Analysis of rln3a up- C), indicating a sustained requirement in normal cardiomyocyte stream sequences identified multiple predicted Stat binding sites proliferation. (Fig. S5). Moreover, ChIP experiments with an antibody against We also examined whether Stat3 activity was required for Stat3 showed enrichment of rln3a upstream sequences in sam- cardiomyocyte proliferation that is stimulated by low popula- ples from 1-dpa ventricles (Fig. 4 C and D), providing additional tion density in juvenile and young adult animals, conditions that evidence of endogenous regulation by Stat3. enable rapid animal and cardiac growth. Low density-stimulated To test if diminished Rln3a production contributed to the cardiomyocyte proliferation levels are typically comparable with dnStat3-based regenerative deficits, we treated cmlc2:CreER;

13418 | www.pnas.org/cgi/doi/10.1073/pnas.1309810110 Fang et al. Downloaded by guest on October 1, 2021 BIOLOGY DEVELOPMENTAL

Fig. 3. Cardiomyocyte Stat3 activity is essential for heart regeneration. (A) Cartoon representation of transgenes used for inducible expression of a dominant-negative Stat3 (dnStat3-GFP) cassette in cardiomyocytes. (B) cmlc2:CreER;β-act2:RSdS (dnStat3) and β-act2:RSdS (control) clutchmates were administered 4-HT, injured 3 d later, and collected for histological analysis of muscularization and scarring at 30 dpa. Muscle regeneration was blocked, and wounds healed by fibrin retention and scar formation in dnStat3-expressing fish (n = 9). MHC, myosin heavy chain. Dashed lines indicate approximate amputation plane. (C) Confocal images of sections from 7dpa ventricles, stained with antibodies against PCNA (a proliferation marker) and Mef2 (a cardiomyocyte marker). (Insets) Higher-magnification images of the squares; arrows, proliferating cardiomyocytes. (D) Quantification of cardiomyocyte (CM) proliferation during regeneration (7 dpa) or after 10 d of rapid or slow (normal) growth conditions. Ventricular resection in adults triggered similar levels of cardiomyocyte proliferation as rapid growth conditions in juveniles/young adults. However, inhibitory effects of dnStat3 expression were apparent only during injury-induced regeneration. Data are mean ± SEM n = 6 (regeneration) or 12 (growth), *P < 0.05, ***P < 0.001. Student t test (unpaired, two-tailed). (Scale bars, 50 μm.)

β-act2:RSdS zebrafish with 4-HT, injured their ventricles, and a sensitive means to identify new wild-type and mutant/trans- retro-orbitally introduced recombinant human Rln3 daily over genic expression features during cardiac morphogenesis and a 1-wk period. Notably, a daily 100 ng Rln3 protocol increased regeneration. Our profiling during heart regeneration pointed to the cardiomyocyte proliferation index by ∼61% at 7 dpa, ac- early myocardial activation of Jak1/Stat3 downstream mediators counting for ∼33% of the effects of Stat3 inhibition (Fig. 4 E by tissue damage, events that occur concomitantly with cytokine and F). Rln3 delivery to wild-type fish did not increase 7-dpa production in endocardial and inflammatory cells. After an cardiomyocyte proliferation, and a single 100-ng treatment at initial organ-wide response, these components are coordinately 6 dpa was insufficient to increase cardiomyocyte proliferation enhanced at the injury site, where their activities stimulate Rln3a (Fig. 4E). These results indicate that the effects of myocardial production and are required for cardiomyocyte proliferation. Jak1/Stat3 signaling on heart regeneration are mediated at least Notably, evidence from previous studies indicates that Stat3 in part by cardiac production and mitogenic activity of Rln3a. and Il11 are cytoprotective for murine cardiomyocytes after ischemic injury. Il11 expression is increased in mouse hearts Discussion after myocardial infarction, and intravenous delivery of Il11 In summary, we have described a new transgenic line that ena- protected cardiomyocytes from apoptosis and reduced infarct bles the profiling of translated RNAs in zebrafish cardiomyocytes. size through a mechanism that requires Stat3 in cardiomyocytes. This reagent, and similar transgenic lines representing other Similarly, mice with Stat3-deficient cardiomyocytes are suscep- cardiac cells, like endocardium and epicardium, should prove tible to both age-related and injury-induced heart failure (37–39).

Fang et al. PNAS | August 13, 2013 | vol. 110 | no. 33 | 13419 Downloaded by guest on October 1, 2021 Fig. 4. Evidence that Rln3a acts downstream of Stat3 during heart regeneration. (A) qPCR using cmlc2:TRAP RNA samples, indicating that rln3a is highly induced in cardiomyocytes (CMs) at 1 dpa. Data are mean ± SEM n = 3, **P < 0.01, Student t test (unpaired, two-tailed). Expression levels were normalized to that of β-actin2, and further normalized to that of the uninjured sample. (B) qPCR indicating reduced rln3a levels in dnStat3-expressing fish at 1 and 7 dpa. Data are mean ± SEM n = 3, ***P < 0.001, Student t test (unpaired, two-tailed). Expression level was normalized to that of β-actin2, and further normalized to that of the uninjured control sample. (C and D) Enrichment of Stat3 at its predicted binding sites in the rln3a promoter in 1-dpa ventricular tissue. ChIP was performed using anti-Stat3 or IgG antibodies. Immunoprecipitated genomic DNA was analyzed by PCR (C) and qPCR (D). Genomic DNA isolated before immunoprecipitation was also analyzed by PCR and qPCR as the input control. (E) Retro-orbital injection of human recombinant Rln3 to dnStat3-expressing fish (cmlc2:CreER;β-act2:RSdS) for 7-d stimulated cardiomyocyte proliferation at 7 dpa. No detectable effect was observed in wild-type fish (WT) when ex- posed to the same regimen. A one-time injection of Rln3 to dnStat3-expressing fish at 6 dpa did not significantly increase cardiomyocyte proliferation at 7 dpa. Data are mean ± SEM n = 7–9, *P < 0.05, Student t test, (unpaired, 2-tailed). (F) Confocal images indicating increased cardiomyocyte proliferation in 7 dpa ventricles of animals given seven daily injections of human recombinant Rln3. Brackets indicate injury site. (Insets) Higher-magnification images of the squares; arrows, proliferating cardiomyocytes. (Scale bar, 50 μm.)

These findings together with the current study indicate that Jak1/ at different densities. Recombinant human Rln3 peptide (ProSci) was dis- Stat3 signaling is activated by cardiac injury in multiple verte- solved in 0.9 × PBS and retro-orbitally injected once daily for 7 d after heart fi brate species, but with different outcomes of cardiac regener- surgery, or once at 6 dpa (50). Experiments with zebra sh were performed ation (zebrafish) or nonhyperplastic remodeling (mice). It will be in accordance with animal use guidelines at Duke University. interesting to identify factors that interact with Jak1/Stat3 sig- Generation of Transgenic Zebrafish. To generate Tg(cmlc2:EGFP-RPL10a)pd61, naling and influence these outcomes. In our study, an unbiased fi fi fi the zebra sh ribosomal protein L10a (RPL10a) (NM_199636) was ampli ed approach found Rln3a as a direct target of Stat3 during zebra sh using the primers 5′- TCCGGCCGGACTCAGATCTCGAGCTCAAGCTTCGAAT- heart regeneration. Relaxin has been described to have anti- TCAGCAAGGTCTCGAGG ACACGTTG -3′ and 5′- AAGTGCGGCCGCCTAGT- fibrotic, anti-inflammatory, or angiogenic effects in multiple AGAGGCGCTGTGGTTTTCCCATGGTGCT -3′,andEGFPwasamplified using tissues, including the heart (40). To our knowledge, whether the primers 5′- ACAGGATCCGCCACCATGGTGAGCAAGGGCGAGGAGCTG -3′ Stat3 mediates some of its functions through Relaxin in mam- and 5′GAATTCGAAGCTTGAGCTCGAGATCTGAGTCCGGCCGGACTTGTACAG- mals has not been explored. CTCGTCCATGCCGAG -3′. The resulting PCR products were used to amplify fi ′ Jak/Stat signaling was recently shown to stimulate self- the nal EGFP-RPL10a fusion cassette using the primers 5 - ACAGGATCCG- CCACCATGGTGAGCAAGGGCGAGGAGCTG -3′ and 5′- AAGTGCGGCCGCCT- renewal and differentiation of Drosophila intestinal stem cells AGTAGAGGCGCTGTGGTTTTCCCATGGTGCT -3′. The TRAP cassette was then in response to cytokine production from stressed or dying cells subcloned downstream of the ∼5-kb regulatory sequence of cmlc2. (41). In this tissue, Jak/Stat signaling is titrated and localized to To make the Tg(bactin2:loxp-DsRED-STOP-loxp-dnStat3-GFP)pd59 line, the stimulate cell replacement as necessary. Jak/Stat signaling is zebrafish Stat3 dominant-negative mutant was created as described pre- also critical for murine liver and intestinal epithelial regenera- viously (33). Briefly, the zebrafish stat3 cDNA was isolated by PCR using tion, and in regenerative neural tissues of zebrafish, such as primers: 5′- ATGGCCCAGTGGAATCAGTTGC -3′ and 5′- CTAAGCATTTCGG- retina and hair cells (42–46). It is also interesting to note that CAGGTGTCCATA -3′. A tyrosine to phenylalanine change was introduced via ′ recent studies have indicated proregenerative roles of inflam- PCR-mediated, site-directed mutagenesis using the primers 5 - ATGTGTA- fi ACTCAACCCTTCCTGAAGACCAAGTT -3′ and 5′- AACTTGGTCTTCAGGAAGG- matory cytokines in tissues like zebra sh brain, axolotl limb, and ′ – GTTGAGTTACACAT -3 . The C terminus was fused with a 9-aa spacer followed adult mouse skeletal muscle (47 49). Thus, cytokine release and by hrGFPII. The resultant cassette was subcloned into the previously described Jak/Stat signaling appear to represent general mechanisms for β-actin2:loxp-DsRED-STOP-loxp-EGFP construct (11) with Age1/NotI to replace how injury induces and maintains local tissue regeneration in EGFP. Plasmids were injected together with IsceI into one cell-stage embryos multiple contexts and species. and founders were screened by examining fluorescence in embryos. Tg(cmlc2:CreER)pd13 is an independent founder line similar to lines de- Methods scribed previously (11, 51). This line displays more efficient, but also occa- Zebrafish and Injuries. Outbred wild-type or transgenic zebrafish of the sionally leaky, recombination compared with other published cmlc2:CreER Ekkwill strain were used for ventricular resection surgeries, as described lines. See Table S2 for primers for PCR and qPCR. previously (3). All transgenic strains were analyzed as hemizygotes. To in- duce dnStat3-GFP expression in cardiomyocytes, cmlc2:CreER;β-act2:RSdS Histological Methods. All histology was performed with 10-μm cryosections. In fish were incubated with 5 μM 4-HT for 24 h. Three days later, ventricular situ hybridization with digoxigenin-labeled cRNA probes, Acid Fuchsin- resections were performed. Animal growth conditions were implemented Orange G staining, and immunofluoresence staining with PCNA/Mef2 anti- as described previously (34), with 4-HT administered 3 d before placement bodies were performed, imaged, and quantified as described previously (15).

13420 | www.pnas.org/cgi/doi/10.1073/pnas.1309810110 Fang et al. Downloaded by guest on October 1, 2021 Confocal images were obtained using a LSM 700 microscope (Zeiss). Primary zebrafish genome. For microarray analysis of uninjured and injured ven- antibodies used in this study were: anti-EGFP (rabbit; Invitrogen), anti-Myosin tricles from control and cmlc2:CreER;β-act2:RSdS animals, four to six apical heavy chain (MHC; F59, mouse; Developmental Studies Hybridoma Bank), halves of ventricles was collected for each total RNA sample (also performed and anti-PCNA (mouse; Sigma). Alexa fluor 488-, 633-, or 594-labeled sec- in triplicate). Genes with P value < 0.05 (Student t test) and fold-changes ≥ 2 ondary antibodies were obtained from Invitrogen. were considered as differentially expressed. See Supporting Information for additional methods. RNA Purification by TRAP, and Microarrays. Fifty apical halves of ventricles from cmlc2:TRAP zebrafish were collected, homogenized, and subjected to ACKNOWLEDGMENTS. We thank T. Wahlig for technical help; B. Liu for help polysome purification, as described previously (23). RNAs were purified with with ChIP assays; A. Dickson for cell counting; J. Burris, A. Eastes, P. Williams, Picopure RNA isolation kit (Arcturus), and cDNAs were synthesized and and N. Blake for zebrafish care; and K.D.P. laboratory members for amplified using the Nugen Pico WTA system (Nugen). Microarrays were comments on the manuscript. This work was supported in part by a post- performed using the zebrafish 12 × 135 Nimblegem chip at Mogene, and doctoral fellowship from the American Heart Association (to Y.F.); a National Heart, Lung, and Blood Institute (NHLBI) Medical Scientist Training analyzed using the R/Bioconductor oligo and limma packages (52, 53). Genes < Program supplement (to V.G.); National Institutes of Health Training Grant with a false-discovery rate-adjusted P value 0.10 were considered to be T32 HL007101-35 and an American Heart Association Fellow-to-Faculty differentially expressed. For each time point, three independent microarray Award 12FTF11660037 (to R.K.); Grant HL081674 from NHLBI (to K.D.P.); experiments were undertaken. Annotation was confirmed by mapping and a grant from the Mandel Foundation (to K.D.P.). K.D.P. is an Early probe sequences provided by the manufacturer to the Zv9 version of the Career Scientist of the Howard Hughes Medical Institute.

1. Wang J, et al. (2011) The regenerative capacity of zebrafish reverses cardiac failure 29. Schindler C, Darnell JE, Jr. (1995) Transcriptional responses to polypeptide ligands: caused by genetic cardiomyocyte depletion. Development 138(16):3421–3430. The JAK-STAT pathway. Annu Rev Biochem 64:621–651. 2. González-Rosa JM, Martín V, Peralta M, Torres M, Mercader N (2011) Extensive scar 30. Lepilina A, et al. (2006) A dynamic epicardial injury response supports progenitor cell formation and regression during heart regeneration after cryoinjury in zebrafish. activity during zebrafish heart regeneration. Cell 127(3):607–619. Development 138(9):1663–1674. 31. Taga T, Kishimoto T (1997) Gp130 and the interleukin-6 family of cytokines. Annu Rev 3.PossKD,WilsonLG,KeatingMT(2002) Heart regeneration in zebrafish. Science Immunol 15:797–819. 298(5601):2188–2190. 32. Kaptein A, Paillard V, Saunders M (1996) Dominant negative stat3 mutant inhibits 4. Eulalio A, et al. (2012) Functional screening identifies miRNAs inducing cardiac re- interleukin-6-induced Jak-STAT signal transduction. J Biol Chem 271(11):5961–5964. generation. Nature 492(7429):376–381. 33. Conway G (2006) STAT3-dependent pathfinding and control of axonal branching and 5. Jayawardena TM, et al. (2012) MicroRNA-mediated in vitro and in vivo direct re- target selection. Dev Biol 296(1):119–136. programming of cardiac fibroblasts to cardiomyocytes. Circ Res 110(11):1465–1473. 34. Wills AA, Holdway JE, Major RJ, Poss KD (2008) Regulated addition of new myocardial 6. Qian L, et al. (2012) In vivo reprogramming of murine cardiac fibroblasts into induced and epicardial cells fosters homeostatic cardiac growth and maintenance in adult fi – BIOLOGY cardiomyocytes. Nature 485(7400):593–598. zebra sh. Development 135(1):183 192.

7. Song K, et al. (2012) Heart repair by reprogramming non-myocytes with cardiac 35. Hsu SY, et al. (2002) Activation of orphan receptors by the hormone relaxin. Science DEVELOPMENTAL – transcription factors. Nature 485(7400):599–604. 295(5555):671 674. fi 8. Choi WY, Poss KD (2012) Cardiac regeneration. Curr Top Dev Biol 100:319–344. 36. Sudo S, et al. (2003) H3 relaxin is a speci c ligand for LGR7 and activates the receptor 9. Laflamme MA, Murry CE (2011) Heart regeneration. Nature 473(7347):326–335. by interacting with both the ectodomain and the exoloop 2. J Biol Chem 278(10): – 10. Kikuchi K, et al. (2011) tcf21+ epicardial cells adopt non-myocardial fates during 7855 7862. fi zebrafish heart development and regeneration. Development 138(14):2895–2902. 37. Hil ker-Kleiner D, et al. (2004) Signal transducer and activator of transcription 3 is 11. Kikuchi K, et al. (2010) Primary contribution to zebrafish heart regeneration by gata4 required for myocardial capillary growth, control of interstitial matrix deposition, and – (+) cardiomyocytes. Nature 464(7288):601–605. heart protection from ischemic injury. Circ Res 95(2):187 195. 12. Jopling C, et al. (2010) Zebrafish heart regeneration occurs by cardiomyocyte de- 38. Jacoby JJ, et al. (2003) Cardiomyocyte-restricted knockout of STAT3 results in higher sensitivity to inflammation, cardiac fibrosis, and heart failure with advanced age. Proc differentiation and proliferation. Nature 464(7288):606–609. Natl Acad Sci USA 100(22):12929–12934. 13. Choi WY, et al. (2013) In vivo monitoring of cardiomyocyte proliferation to identify 39. Obana M, et al. (2010) Therapeutic activation of signal transducer and activator of chemical modifiers of heart regeneration. Development 140(3):660–666. transcription 3 by interleukin-11 ameliorates cardiac fibrosis after myocardial in- 14. Chablais F, Jazwinska A (2012) The regenerative capacity of the zebrafish heart is farction. Circulation 121(5):684–691. dependent on TGFβ signaling. Development 139(11):1921–1930. 40. Du XJ, Bathgate RA, Samuel CS, Dart AM, Summers RJ (2010) Cardiovascular effects of 15. Kikuchi K, et al. (2011) Retinoic acid production by endocardium and epicardium is an relaxin: From basic science to clinical therapy. Nat Rev Cardiol 7(1):48–58. injury response essential for zebrafish heart regeneration. Dev Cell 20(3):397–404. 41. Jiang H, et al. (2009) Cytokine/Jak/Stat signaling mediates regeneration and ho- 16. Kim J, et al. (2010) PDGF signaling is required for epicardial function and blood vessel meostasis in the Drosophila midgut. Cell 137(7):1343–1355. formation in regenerating zebrafish hearts. Proc Natl Acad Sci USA 107(40): 42. Bollrath J, et al. (2009) gp130-mediated Stat3 activation in enterocytes regulates cell 17206–17210. survival and cell-cycle progression during colitis-associated tumorigenesis. Cancer Cell 17. Yin VP, Lepilina A, Smith A, Poss KD (2012) Regulation of zebrafish heart re- 15(2):91–102. generation by miR-133. Dev Biol 365(2):319–327. 43. Li W, Liang X, Kellendonk C, Poli V, Taub R (2002) STAT3 contributes to the mitogenic 18. Jopling C, Suñé G, Faucherre A, Fabregat C, Izpisua Belmonte JC (2012) Hypoxia in- response of hepatocytes during liver regeneration. J Biol Chem 277(32):28411–28417. duces myocardial regeneration in zebrafish. Circulation 126(25):3017–3027. 44. Grivennikov S, et al. (2009) IL-6 and Stat3 are required for survival of intestinal epi- 19. Jopling C, Suñe G, Morera C, Izpisua Belmonte JC (2012) p38α MAPK regulates thelial cells and development of colitis-associated cancer. Cancer Cell 15(2):103–113. fi – myocardial regeneration in zebra sh. Cell Cycle 11(6):1195 1201. 45. Liang J, et al. (2012) The stat3/socs3a pathway is a key regulator of hair cell re- 20. Senyo SE, et al. (2013) Mammalian heart renewal by pre-existing cardiomyocytes. generation in zebrafish. [corrected]. J Neurosci 32(31):10662–10673. – Nature 493(7432):433 436. 46. Nelson CM, et al. (2012) Stat3 defines three populations of Müller glia and is required 21. Bersell K, Arab S, Haring B, Kühn B (2009) Neuregulin1/ErbB4 signaling induces car- for initiating maximal Müller glia proliferation in the regenerating zebrafish retina. J – diomyocyte proliferation and repair of heart injury. Cell 138(2):257 270. Comp Neurol 520(18):4294–4311. fi 22. Doyle JP, et al. (2008) Application of a translational pro ling approach for the 47. Kyritsis N, et al. (2012) Acute inflammation initiates the regenerative response in the – comparative analysis of CNS cell types. Cell 135(4):749 762. adult zebrafish brain. Science 338(6112):1353–1356. fi 23. Heiman M, et al. (2008) A translational pro ling approach for the molecular char- 48. Godwin JW, Pinto AR, Rosenthal NA (2013) Macrophages are required for adult sal- acterization of CNS cell types. Cell 135(4):738–748. amander limb regeneration. Proc Natl Acad Sci USA 110(23):9415–9420. 24. Sleep E, et al. (2010) Transcriptomics approach to investigate zebrafish heart re- 49. Heredia JE, et al. (2013) Type 2 innate signals stimulate fibro/adipogenic progenitors generation. J Cardiovasc Med (Hagerstown) 11(5):369–380. to facilitate muscle regeneration. Cell 153(2):376–388. 25. O’Shea JJ (1997) Jaks, STATs, cytokine signal transduction, and immunoregulation: 50. Pugach EK, Li P, White R, Zon L (2009) Retro-orbital injection in adult zebrafish. JVis Are we there yet? Immunity 7(1):1–11. Exp (34), pii, 1645. 26. Shuai K, Liu B (2003) Regulation of JAK-STAT signalling in the immune system. Nat 51. Liu J, et al. (2010) A dual role for ErbB2 signaling in cardiac trabeculation. De- Rev Immunol 3(11):900–911. velopment 137(22):3867–3875. 27. Lien CL, Schebesta M, Makino S, Weber GJ, Keating MT (2006) Gene expression 52. Smyth G (2005) Limma: Linear models for microarray data. Bioinformatics and Com- analysis of zebrafish heart regeneration. PLoS Biol 4(8):e260. putational Biology Solutions Using R and Bioconductor, eds Gentleman R, Carey V, 28. Hirano T, Ishihara K, Hibi M (2000) Roles of STAT3 in mediating the cell growth, Dudoit S, Irizarry R, Huber W (Springer, New York), pp 397–420. differentiation and survival signals relayed through the IL-6 family of cytokine re- 53. Carvalho BS, Irizarry RA (2010) A framework for oligonucleotide microarray ceptors. Oncogene 19(21):2548–2556. preprocessing. Bioinformatics 26(19):2363–2367.

Fang et al. PNAS | August 13, 2013 | vol. 110 | no. 33 | 13421 Downloaded by guest on October 1, 2021