Thesis
Analyse de l'expression de BARD1 dans le cancer du poumon et le cancer colorectal
ZHANG, Yong Qiang
Abstract
Les cancers du poumon et colorectaux sont les types de cancers les plus fréquents et les plus mortels. Plusieurs marqueurs pronostiques et prédictifs pour le cancer du poumon, de type "non-small cell lung cancer" (NSCLC), ont été identifiés récemment, parmi eux, BRCA1. BRCA1 est un suppresseur de tumeur, qui joue un rôle dans la réparation de l'ADN et dans la division cellulaire. La stabilité de la protéine BRCA1 dépend de son interaction avec une autre protéine, nommée BARD1. L'hétérodimère BARD1-BRCA1 a une activité d'ubiquitine-ligase E3, qui est responsable de toutes les fonctions oncosuppressives de BRCA1. Nous avons donc étudié l'expression de BARD1 et de BRCA1 dans des tissus de 100 cas de NSCLC et de 140 cas de cancers colorectaux. Des analyses par immuno-histochimie, basées sur la comparaison de plusieurs anticorps détectant des régions différentes de la protéine BARD1, ont mis en évidence que des formes de BARD1 aberrantes, mais pas la bona fide BARD1, sont exprimées dans ces cancers. Or, l'expression d'aucun antigène de BARD1 ne démontrait une corrélation avec l'expression de BRCA1. [...]
Reference
ZHANG, Yong Qiang. Analyse de l'expression de BARD1 dans le cancer du poumon et le cancer colorectal. Thèse de doctorat : Univ. Genève, 2010, no. Méd. 10625
URN : urn:nbn:ch:unige-118800 DOI : 10.13097/archive-ouverte/unige:11880
Available at: http://archive-ouverte.unige.ch/unige:11880
Disclaimer: layout of this document may differ from the published version.
1 / 1
Section de médecine Clinique Département de Gynécologie et Obstétrique Laboratoire de Gynécologie et Obstétrique Moléculaire
Thèse préparée sous la direction du Professeur Olivier Irion et du Docteur Irmgard Irminger-Finger
Analyse de l'expression de BARD1 dans le Cancer du Poumon et le Cancer Colorectal
Thèse
présentée à la Faculté de Médecine de l'Université de Genève pour obtenir le grade de Docteur en médecine par
Yong Qiang ZHANG
de
Beijing (Chine)
Thèse n° 10625
Genève
2010
i Dedicated specifically to
My wife and my daughter, for supporting my study
abroad wholeheartedly
ii ACKNOWLEDGEMENTS
In the first place, I would like to record my gratitude to my thesis supervisor, Dr. Irmgard Irminger-Finger, for her supervision, advice, and guidance of this research, as well as giving me extraordinary experiences throughout my two-year work and study. I sincerely express my thanks to Professor Olivier Irion for being my thesis director and for welcoming me to the Laboratory of Molecular Gynecology and Obstetrics. It is them who lead me into a science research world, which is very different from my clinical work field. Thanks for the help and support in both study and life during my stay in Geneva.
I would like to thank Professor Paul Bischof and Professor Werner Schlegel for accepting to be my thesis jury.
I would like to give credit to all previous and present members of the Laboratory of Molecular Gynecology and Obstetrics who helped me in various ways: specifically Dr. Eva Dizin-Bernabeu, and all others, Arwen Conod, Luciana Romano, Furaha Detraz, Filippo Molica, Dan Liu, Lin Li, JianYu Wu.
I gratefully thank Dr. S Picciau, and Professor Luigi Atzuri, Andrea Bianco, Alvin M. Malkinson, and Regine Schneider-Stock for their precious collaboration.
Great thanks to Dr. Michel Boulvain for his excellent support and help with the statistical analysis.
Many thanks to Dr. Jean-Claude Pache for the help with his expertise on pathology.
Last but not least, I also would like to thank Dr. Marie Cohen for her kindness and support, and Alice Neequaye for her joyous accompany and support.
iii Investigation of BARD1 Expression in Non-Small Cell Lung Cancer and Colorectal Cancer
CONTENTS
Page I. Abbreviations 1 II. Summary in French 2 III. Introduction in French 4 IV. Summary in English 9 V. Introduction in English 11 1. BARD1 and its diverse functions 11 1.1. Structure of BARD1 11 1.2. Tissue distribution and cellular localization of BARD1 14 1.3. BARD1 knockout in animals and plants 16 1.4. Biological functions of BARD1 17 1.4.1. BRCA1-dependent functions of BARD1 17 1.4.1.1. Functions of the BRCA1-BARD1 heterodimer 17 1.4.1.2. Formation and regulation of BRCA1-BARD1 activity 19 1.4.1.3. The BRCA1-BARD1 targets and their associated functions 19 1.4.2. BRCA1-independent functions of BARD1 26 1.4.2.1. BARD1 and p53 26 1.4.2.2. BARD1 and NF-κB 29 1.5. Genetic and epigenetic modifications of BARD1 in cancer 30 1.5.1. BARD1 mutations, polymorphisms and cancer 30 1.5.2. BARD1 spliced isoforms and cancer 33 2. Cancers investigated in this study 36 2.1. Cancer occurrence and classification 36
iv 2.2. Non-small cell lung cancer 38 2.3. Colorectal cancer 39 3. Background of this study 40 VI. Materials and methods 46 1. Patients characteristics 46 1.1. Non-small cell lung cancer patients 46 1.2. Colorectal cancer patients 48 2. Mouse model of lung cancer 49 3. Immunohistochemistry 49 3.1. Immunohistostaining 49 3.2. Analysis and semi-quantitation of immunohistochemistry 50 4. Reverse transcription and PCR 51 5. DNA purification, cloning and sequencing 52 6. Statistical analysis 53 VII. Results 54 1. Investigation of BARD1 expression in human NSCLC 54 1.1. All NSCLC samples express BARD1 epitopes 54 1.2. Non-coordinate expression of BARD1 and BRCA1 59 1.3. BARD1 isoforms more expressed in tumor than peri-tumor tissues and more elevated in female than male patients 59 1.4. Correlation of BARD1 protein expression with clinicopathological characteristics and patients prognosis 62 1.5. Sequential expression of BARD1 epitopes at different stages of tumorigenesis in a mouse model of lung cancer 68 1.6. Structure of BARD1 isoforms expressed in NSCLC 70 2. Investigation of BARD1 expression in colorectal cancer 75 2.1. BARD1 protein level expressed in colorectal cancer samples 75 2.2. Non-coordinate expression of BARD1 and BRCA1 80 2.3. Correlation of BARD1 protein expression with clinicopathological characteristics and patients prognosis 81
v 2.4. Structure of BARD1 isoforms expressed in colorectal cancer 83 2.5. Similar BARD1 expression patterns observed in tissues from males and females 85 VIII. Discussion 88 IX. Perspectives and goals 93 X. Conclusions 94 XI. References 95 XII. Appendix 107
vi Abbreviations
AJCC American Joint Committee on Cancer ANK Ankyrin domain BARD1 BRCA1-associated RING domain protein 1 BRCA1 Breast cancer susceptibility gene 1 BRCA2 Breast cancer susceptibility gene 2 BRCT BRCA1 carboxy-terminal domain DAB Diaminobenzidine tetrahydrocholoride DFS Disease-free survival DSBs Double strand breaks EGFR Epidermal growth factor receptor EtBr Ethidium bromide FL Full length GAPDH Glyceraldehyde-3-phosphate dehydrogenase IHC Immunohistochemistry MW Molecular weight NES Nuclear export signal NLS Nuclear localization signal NSCLC Non-small cell lung cancer OS Overall survival RING RING (really interesting new gene) domain RT-PCR Reverse transcription polymerase chain reaction SNP Single-nucleotide polymorphism WHO World health organization
1 Résumé
Les cancers du poumon et colorectaux sont les types de cancers les plus fréquents et les plus mortels. Plusieurs marqueurs pronostiques et prédictifs pour le cancer du poumon, de type "non-small cell lung cancer" (NSCLC), ont été identifiés récemment, parmi eux, BRCA1. BRCA1 est un suppresseur de tumeur, qui joue un rôle dans la réparation de l’ADN et dans la division cellulaire. La stabilité de la protéine BRCA1 dépend de son interaction avec une autre protéine, nommée BARD1. L’hétérodimère BARD1-BRCA1 a une activité d’ubiquitine-ligase E3, qui est responsable de toutes les fonctions oncosuppressives de BRCA1. Nous avons donc étudié l’expression de BARD1 et de BRCA1 dans des tissus de 100 cas de NSCLC et de 140 cas de cancers colorectaux. Des analyses par immuno-histochimie, basées sur la comparaison de plusieurs anticorps détectant des régions différentes de la protéine BARD1, ont mis en évidence que des formes de BARD1 aberrantes, mais pas la bona fide BARD1, sont exprimées dans ces cancers. Or, l’expression d’aucun antigène de BARD1 ne démontrait une corrélation avec l’expression de BRCA1. Ceci suggère que la fonction d’ubiquitine-ligase E3 de l’hétéromère BARD1-BRCA1 soit compromise dans des cellules de ces cancers.
Nous avons déterminé la structure des ARN messagers de BARD1 de 20 cas de NSCLC et 20 cas de cancer colorectaux. En plus des isoformes que nous avions décrites auparavant dans des cancer gynécologiques, nous avons identifié deux nouvelles formes de BARD1, les isoformes κ et π, dans des tumeurs de NSCLC et colorectales. Toutes les isoformes étaient surproduites exclusivement dans les tumeurs colorectales, par contre, pour NSCLC, toutes les formes de BARD1 étaient exprimées dans la tumeur et dans le tissu normal adjacent avec l’exception de l’isoforme π, qu’on ne trouvait que dans les tissus tumoraux. Ceci suggère que l’expression des isoformes de BARD1 serait modulée par des facteurs dépendant du type de tissu et de pathologie.
L’expression de BARD1, ainsi que de BRCA1, peuvent être modulées par les oestrogènes via le récepteur aux oestrogènes (ER). Nous avons trouvé que ER-α était exprimé dans des tissus de poumons mais pas colorectaux. Il est donc possible que BARD1 joue un rôle
2 dans la voie de signalisation des oestrogènes, qui est soupçonnée d’être responsable de la prédisposition élevée des femmes au cancer des poumons.
Il est très intéressant, que l’expression des différentes combinaisons d’isoformes soit corrélée au pronostique du patient. Ainsi, l’expression des epitopes encodés par l’exon 3 et le début de l’exon 4, qui est compatible avec l’expression de l’isoforme π, est corrélée avec un mauvais pronostique chez les patients de NSCLC et de cancer colorectaux. Par conséquent, l’isoforme π semble acquérir des fonctions oncogéniques et promouvoir la carcinogenèse et la prolifération tumorale.
L’ensemble de nos résultats suggère que l’expression aberrante de BARD1 est corrélée avec un mauvais pronostique et que BARD1 pourrait servir comme marqueur pronostique pour le NSCLC et le cancer colorectal.
3 Introduction
Le suppresseur de tumeur, BARD1 (BRCA1-associated RING domain protein 1), a été découvert en 1996 grâce à sa liaison avec la protéine BRCA1, le produit du gène Breast Cancer 1. Entre temps, des formes orthologues ont été découvertes chez la souris, le rat, Xenopus laevis, Caenorhabditis elegans et Arabidopsis thaliana.
Durant ces dernières années, BARD1 a été de plus en plus étudiée, surtout comme partenaire de BRCA1, mais aussi pour ces fonctions indépendantes de BRCA1, particulièrement son implication dans la genèse et la prolifération des tumeurs.
La structure de BARD1
Le gène BARD1 humain comprend 80 kb et est situé sur le chromosome 2 (2q34-q35), près du télomère. Il est composé de 11 exons qui codent pour 777 aa. La structure de BARD1 est similaire à la structure de son partenaire, BRCA1, et les deux séquences comprennent des régions très conservées. Alors que BARD1 et BRCA1 sont très similaires, BRCA2, le deuxième Breast Cancer gene, a une structure complètement différente. Le gène BRCA1 est composé de 24 exons et il code pour une protéine de 1863 aa. Il y a surtout deux régions qui sont conservées dans BARD1 et BRCA1: le motif RING finger, situé en N-terminal et deux domaines BRCT situés dans la partie C-terminale de chaque protéine. Il est donc suggéré que ces deux gènes sont dérivés d’un ancêtre commun.
BARD1, mais pas BRCA1, possède des "Ankyrin repeats" qui forment la région la plus conservée de la protéine. Il est intéressant de constater, qu’il n’existe pas d’autres protéines qui présentent ces mêmes trois motifs. Ceci suggère que cette combinaison doit être spécialement importante.
La distribution tissulaire et intracellulaire de BARD1
L’expression de BARD1 a été étudiée par différents moyens: par la méthode du Northern
4 blot, ou par le RNase protection assay. Il a été démontré que l’ARN messager de BARD1 est très abondant dans tous les tissus prolifératifs, tels que les poumons, les reins, le foie, et le muscle ; la plus forte expression ayant été trouvé dans les testicules et la rate chez la souris. Par contre, il n’y a pas d’expression de BARD1 dans le cerveau.
Il est important de remarquer que BARD1 et BRCA1 sont souvent co-exprimés. En revanche, dans des tissus qui sont contrôlés par les oestrogènes, ou la progestérone, BRCA1 et BARD1 sont exprimés d’une façon indépendante. Ainsi il a été montré, que BARD1 et BRCA1 ne sont pas co-exprimés lors de la spermatogénèse; si BARD1 est exprimé dans les gamètes à tous les stades de la spermatogenèse, BRCA1 est seulement exprimé dans les spermatocytes méiotiques et dans les spermatocytes ronds.
La protéine BARD1 est majoritairement nucléaire. Durant le cycle cellulaire, l’expression de BARD1 se présente de trois manières différentes: peu d’expression et non-phosphorylation en G1, peu d’expression et phosphorylation partielle en phase G1 terminale, et importante expression et phosphorylation lors de la mitose.
Ces observations nous conduisent à penser que BARD1 a un rôle important dans le maintien de BRCA1 dans le noyau. De plus, la co-expression de BARD1 et BRCA1 est importante pour assurer les fonctions de l’hétérodimère BARD1-BRCA1.
La fonction de beaucoup de protéines dépend de leur localisation intracellulaire. La littérature indique que BARD1 peut être localisée dans le cytoplasme des cellules. Cette localisation a été associée au rôle que BARD1 exerce en apoptose. Il a été conclu que la translocation nuléo-cytoplasmique de BARD1 est liée à son rôle dans l’apoptose.
Inactivation de BARD1 chez les animaux et chez les plantes
L’inactivation de BARD1 chez la souris entraine une déficience importante du développement de sorte que les embryons ne survivent que jusqu’au 8ème jour de l’embryogenèse. Ce phénotype est similaire au phénotype décrit pour les knock-outs de BRCA1 et de BRCA2. Les embryons knock-out de BARD1 semblent mourir d’une
5 déficience de la prolifération cellulaire, et pas d’une apoptose plus élevée. L’analyse cytologique a montré que les cellules de ces embryons comportaient beaucoup d’aberrations chromosomiques. Cette observation illustre bien le rôle de BARD1 lors de la mitose.
Un knock-out de BARD1 a été généré dans une plante, Arabidopsis thaliana. Dans ce cas, l’inactivation de BARD1 a induit un problème dans la formation du méristème. Cette observation a permis d’identifier une nouvelle fonction de BARD1 dans la régulation de WUSCHEL, qui est un facteur clé pour le positionnement des cellules souches dans le méristème. BARD1 a donc un rôle régulateur de l’expression de WUSCHEL dans le centre organisateur de la plante et exerce donc un rôle important dans l’organisation du méristème.
Les fonctions biologiques de BARD1
BARD1 interagit avec la protéine BRCA1 et les deux protéines se stabilisent mutuellement. Des mutations dans le domaine RING finger de BRCA1 empêchent cette interaction. Comme ces mutations se rencontrent souvent dans des cancers, cela suggère que cette interaction est importante pour la fonction oncosuppressive de BARD1 et BRCA1. Mais BARD1 et BRCA1 semblent exercer des rôles encore plus fondamentaux, car les souris knock-out meurent très tôt (jour 8) lors de l’embryogenèse. La principale fonction intracellulaire de l’hétérodimère BARD1-BRCA1 est son activité ubiquitine-ligase. Ainsi le complexe BARD1-BRCA1 joue un rôle dans la signalisation de la réparation de l’ADN, dans la mitose, et dans le contrôle de l’intégrité du génome. Les protéines cibles du complexe BARD1-BRCA1 sont multiples et incluent: RAD51, CstF-50, MSH2 et MSH6, RNA PolII, NPM, BRCA2, Aurora B, et Estrogen Receptor alpha (ER-α).
BARD1 et BRCA1 ne sont pas toujours co-exprimés dans tous les tissus. BARD1 a donc des fonctions indépendantes de BRCA1. Ainsi l’expression de BARD1 est très élevée dans les cellules apoptotiques et sa surexpression par transfection induit l’apoptose. Cette voie de signalisation est liée à la protéine p53, qui elle doit être phosphorylée pour induire l’apoptose. Il a été démontré que la phosphorylation de p53 est dépendante de BARD1 de
6 sorte que des cellules qui n’expriment pas BARD1 sont résistantes aux produits qui induisent l’apoptose. BARD1 est également phosphorylée par la kinase ATM (induite par une cassure d’ADN). Ceci suggère que, indépendamment de BRCA1, BARD1 joue un rôle dans la signalisation du stress via son interaction avec p53 et son rôle dans l’apoptose.
Modifications génétiques et épigénétiques de BARD1 dans les cancers
Il a été démontré que des mutations dans les gènes BRCA1 et BRCA2 prédisposent les femmes au cancer du sein. Des centaines de mutations ont été identifiés dans le gène BRCA1, qui toutes peuvent causer une prédisposition. Par contre, les mutations dans BARD1 sont très rares, certaines comme Q564H, V695L et S761N ont été identifiées par plusieurs groupes de chercheurs.
Il est à mentionner, que les mutations de BARD1 clairement associées aux cancers ne se trouvent pas dans la région qui code pour le domaine RING finger. Plusieurs mutations ont été décrites dans l’exon 4 (qui code une région ne présentant pas d’hélices α ou feuillets β), alors que d’autres ont été décrites dans la partie C-terminale de la protéine. Très récemment, des “single nucleotide polymorphism” (SNP) ont été découverts dans les régions non codantes de BARD1. La localisation de ces SNPs suggère qu’ils influencent l’épissage de BARD1.
Des isoformes de BARD1 dérivées d’un épissage alternatif
L’épissage des ARN crée une variabilité phénotypique plus grande. Les protéines dérivées d’un réarrangement différent des exons peuvent avoir perdu certains domaines fonctionnels ou former des structures tertiaires différentes, de sorte que l’épissage alternatif peut générer des protéines avec des fonctions différentes, voir même antagonistes des protéines normales.
Plusieurs variantes de BARD1 ont été découvertes au niveau de l’ARN ainsi qu’au niveau de la protéine. Les formes BARD1-β et BARD1-δ ont été découvertes chez le rat et chez
7 l’homme. BARD1-β ne possède pas le domaine RING finger et ne peut donc pas participer à la fonction d’ubiquitine-ligase. Pourtant BARD1-β se lie à une cible de l’ubiquitine-ligase plus fortement que la protéine BARD1 native. C’est ainsi que BARD1-β exerce un effet dominant négatif et agit comme un antagoniste. Dans les cellules qui n’expriment pas BARD1 mais uniquement BARD1-β, on constate la surexpression de la kinase Aurora B stabilisée par son interaction avec BARD1-β.
Le même principe a été observé pour l’isoforme BARD1-δ, qui stabilise ER-α, qui est normalement ubiquitiné et dégradé grâce au complexe BARD1-BRCA1.
Comme plusieurs des isoformes de BARD1 ont été décrites dans des cancers gynécologiques et qu’elles sont associées à de mauvais facteurs pronostiques, il était intéressant d’étudier si les mêmes isoformes de BARD1 existent aussi dans des cancers du poumon ou colorectaux.
8 Summary
Lung cancer and colorectal cancer are the most important types of cancer, both in incidence and in mortality. Despite recent advances in cancer biology and in cancer therapy their prognosis remains poor.
BARD1 is a tumor suppressor, identified as protein interaction and forming a stable heterodimer with BRCA1, which acts as E3 ubiquitin ligase. BRCA1 and BARD1 dimerization is required for tumor suppressor functions attributed to BRCA1, as BRCA1 protein stability and function depend on its interaction with BARD1. In addition, BARD1 has BRCA1-independent functions in apoptosis by binding and stabilizing p53. However, cancer-associated mutations of BARD1 are rare, and the contribution of these mutations to cancer predisposition is not completely clear; on the contrary, expression of differentially spliced isoforms of BARD1 was found in breast and ovarian cancers and correlated with tumor progression and poor prognosis. Since BRCA1 has been identified as a NSCLC biomarker, we were interested in investigating the expression of BARD1 and its isoforms both on the protein and RNA level, in a large series of NSCLC and colorectal cancer samples, and in a mouse model of induced lung cancer.
We found that aberrant expression of BARD1 is common in NSCLC and colorectal cancer. Interestingly, BARD1 was not coordinately expressed with BRCA1 in these cancers, suggesting that the E3 ubiquitin ligase functions of the BRCA1-BARD1 heterodimer are jeopardized. Based on non-correlated expression and intracellular localization of different epitopes of BARD1, we concluded that different isoforms, but not FL BARD1, are expressed in NSCLC and colorectal cancer. Structural analysis of BARD1 isoform expression by RT-PCR supported this assumption. In addition to isoforms which were previously found in gynecological cancers, we identified two novel isoforms κ and π in NSCLC and colorectal cancer. BARD1 isoforms were specifically upregulated in colorectal tumor, while in NSCLC all forms were expressed in tumor and peri-tumor tissues alike with exception of isofom π, indicating that BARD1 isoform expression is modulated by cell type or pathology-specific factors. Estrogen receptor α was expressed in lung, but not in
9 colorectal tissues, suggesting that BARD1 isoforms might be involved in estrogen signaling in lung cancer, in line with the observed estrogen related increased risk for lung cancer for women. Different expression patterns of BARD1, reflecting expression of different isoforms or isoform combinations, correlated with patient prognosis. Expression of BARD1 reactive epitopes, mapping to exon 3 and beginning of exon 4 and compatible with expression of novel isoform π, was significantly associated with poor prognosis in both NSCLC and colorectal cancer, suggesting that this form of BARD1 acquired oncogenic functions, presumably promoting carcinogenesis and tumor progression. Thus, the prominent cytoplasmic expression of BARD1 isoforms in tumor tissues and its correlation with patient prognosis, suggest that BARD1 could be a prognostic marker in both NSCLC and colorectal cancer.
10 Introduction
1. BARD1 and its diverse functions
In an effort to understand the function of BRCA1, Wu et al. (1996) used a yeast 2-hybrid system to identify proteins that associate with BRCA1 in vivo. This analysis led to the identification of a novel protein that interacts with the N-terminal region of BRCA1, which was named with BARD1 (BRCA1-associated RING domain-1). The BARD1 gene was mapped to chromosome 2q by FISH (Wu et al. 1996), and later was reported to sub-localize to 2q34-q35 (Thai et al. 1998).
Thereafter, BARD1 orthologues have also been identified in mouse (Ayi et al. 1998; Irminger-Finger et al. 1998), rat (Gautier et al. 2000), Xenopus laevis (Joukov et al. 2001), Caenorhabditis elegans (Boulton et al. 2004), and Arabidopsis thaliana (Lafarge and Montane 2003).
BARD1 has been attracting more and more attention in the last few years as a binding partner of BRCA1, moreover, independent of BRCA1, BARD1 itself possesses a series of potential functions in tumorigenesis.
1.1. Structure of BARD1
The human BARD1 gene spans 80 kb DNA residing on chromosome 2q34-q35, close to the telomere. The BARD1 is composed of 11 exons, which encode a protein of 777, 765, and 768 amino acids in human (Wu et al. 1996), mouse (Ayi et al. 1998), and rat (Gautier et al. 2000), respectively. As the main binding partner of BRCA1, BARD1 has sequence and structural similarities with BRCA1, but not BRCA2, the second breast cancer susceptibility gene identified in 1994 (Wooster et al. 1994) (Fig. 1). The BRCA1 gene is composed of 24 exons and encodes 1863 amino-acid protein (Miki et al. 1994). BARD1 shares homology with the 2 conserved regions of BRCA1: the RING domain at its N-terminus (residues 46-90) and two tandem BRCT domains at its C-terminus (residues 616-653 and 743-777)
11 of BARD1. This suggests that both proteins are derived from a common ancestor that comprised RING domain and BRCT domain (Irminger-Finger and Leung 2002; Irminger-Finger and Jefford 2006).
RING NES NLS ANK BRCT 131 408 693 mBARD1 765 aa 66 95 53 97 77 91 % of conservation with hBARD1 hBARD1 777 aa
46-90 127 139 321 365 427-525 616-653 657 705 743-777 102-120 Essential NLS
BRCA1 1823 aa
RING NES NLS BRCT
3418 aa BRCA2
TD BRC repeats NLS
Figure 1. Structure of BARD1, compared with BRCA1 and BRCA2.
RING (green), ankyrin (ANK, blue), BRCA1 carboxy-terminal (BRCT, red) domains, and location of nuclear export signal (NES, brown) and potential nuclear localization signals (NLS, light blue) are indicated.
Evolutionary conservation is indicated as the percentage of identical amino acids between the mouse and human sequences within distinct regions. BARD1 and BRCA1 are homologues in sharing two conserved domains (RING and BRCT), whereas BRCA2 is completely unrelated to either BARD1 or BRCA1 with conserved transactivation domain (TD) and 8 copies of a 70 aa motif called the BRC repeats. Mouse and human BARD1 orthologs are very similar, and are very well conserved, homologies in conserved domains are high. Human BARD1 has a NES and six predicted NLSs. Two centrally located NLSs have been identified and are active and specific to human. The third NLS (at amino acid reside 321) is essential for nuclear localization of BARD1.
The RING (Really Interesting New Gene) finger motif is a cysteine-rich sequence that
12 coordinates the binding of two zinc cations found in a variety of proteins that regulate cell growth, including the products of tumor suppressor genes and dominant protooncogenes. The BRCA1 RING motif is characterized by a short anti-parallel three-strand β-sheet, two large Zn2+ binding loops and a central α-helix. The BARD1 RING motif is structurally homologous, but lacks a central helix between the third and fourth pair of Zn2+ ligands. BARD1 is five residues shorter than BRCA1 within this segment (Brzovic et al. 2001b). Although the BRCA1 and BARD1 RING motifs are juxtaposed in the heterodimer, they do not pack tightly against each other. In vitro studies showed that individually BRCA1 and BARD1 exist as homodimers, but they preferentially form heterodimers, implicating residues 1–109 of BRCA1 and residues 26–119 of BARD1, which are more stable (Meza et al. 1999). Thus, BARD1 and BRCA1 form a heterodimer via their RING finger domains which are critical for the proper association of the two proteins (Wu et al. 1996; Meza et al. 1999).
BARD1 and BRCA1 also share another conserved domain, named BRCT domain (BRCA1 carboxy-terminal domain). Tandem repeats were identified at the C-terminus of both BRCA1 and BARD1, subsequently termed BRCT repeats. BRCT repeats are defined by conserved clusters of hydrophobic residues that occupy the core of the repeat structure and by glycine residues that facilitate a tight turn between α1 and β2. It is a basic fold of a single repeat consisting of a parallel four-stranded β-sheet, which is flanked on one side by a pair of α-helices (α1 and α3) and on the other side by a single α-helix (Glover et al. 2004). BRCT domains were also found within many DNA damage repair and cell cycle checkpoint proteins (Ljungquist et al. 1994; Caldecott et al. 1995). The unique diversity of this domain superfamily allows BRCT modules to interact forming homo/hetero BRCT multidimers, BRCT-non-BRCT interactions, and interactions within DNA strand breaks (Huyton et al. 2000). Truncation or complete loss of both BRCT repeats in BRCA1 are associated with cancer incidence, indicating that BRCT is also an essential region for tumorsuppressor functions (Huyton et al. 2000; Williams and Glover 2003; Glover et al. 2004).
In addition to RING and BRCT domains, BARD1 possesses three internal tandem ankyrin (ANK) repeats (residues 427-525), which are the most conserved region in the protein (Ayi
13 et al. 1998; Irminger-Finger et al. 1998). Ankyrin repeats mediate protein-protein interactions in very diverse families of proteins. The number of ANK repeats in a protein can range from 2 to over 20 (ankyrins, for example) (Huyton et al. 2000; Mosavi et al. 2004). ANK repeats may occur in combinations with other types of domains. The structural repeat unit contains two antiparallel helices and a beta-hairpin, repeats are stacked in a superhelical arrangement, this alignment contains 4 consecutive repeats. The precise functions of ankyrin repeats in BARD1 remain unclear.
Interestingly, no other proteins that contain RING, ANK and BRCT domains were identified till now. Thus, these three highly conserved structural domains might mediate essential functions of BARD1.
In addition to the three functional domains, human BARD1 has a nuclear export signal (NES) (at amino acide residues 102-120) (Rodriguez et al. 2004) and 6 predicted nuclear localization signals (NLS), situated in the vicinity of the three functional domains (at amino acide residues 127, 139, 321, 365, 657 and 705 respectively) (Schuchner et al. 2005). Two active NLSs, which are centrally located, are specific to human and have been identified by deletion mapping and mutagenesis. The integrity of the third NLS (at amino acide residue 321) is essential for nuclear localization of BARD1 (Schuchner et al. 2005).
1.2. Tissue distribution and cellular localization of BARD1
Different means of detection lead to variant expression of BARD1 in different organs. Northern blot experiments showed that BARD1 RNA messengers were abundantly expressed in spleen and testis, not in liver, lung, skeletal muscle, heart, brain or kidney (Ayi et al. 1998), but more sensitive RNase protection experiments showed expression of BARD1 in most proliferate tissues of the mouse (Irminger-Finger et al. 1998). Indeed, BARD1 is expressed highly in testis and spleen, it was also detected in a large variety of tissues, such as lung, colon, prostate, thymus, liver, stomach, muscle, bone (Irminger-Finger et al. 1998). More updated information is available in Gene Expression on website ASAP II Output for Hs.54089 (http://bioinfo.mbi.ucla.edu/ASAP2/).
14 BARD1 and BRCA1 transcripts are coordinately expressed in the mammary gland and during mouse embryogenesis (Irminger-Finger et al. 1998). However, expression of BARD1 and BRCA1 was non-coordinate in hormonally controlled organs at specific stages of the estrous cycle. In the uterus, BARD1 expression increased from dioestrus through post-oestrus phase, whereas BRCA1 increased from diestrus to early oestrus and decreased during oestrus and post-oestrus (Irminger-Finger et al. 1998). In testis, BARD1 was expressed at all stages of spermatocyte maturation, whereas BRCA1 expression was only seen in meiotic and early round spermatocytes (Scully et al. 1997b; Feki et al. 2004).
BARD1 was originally found in nuclear extracts and described as a nuclear protein (Wu et al. 1996). BARD1 forms a heterodimer with BRCA1 through the interaction of their respective RING finger domains. Concomitant expression of BARD1 and BRCA1 was observed during S phase (Hayami et al. 2005). Indeed, BARD1 colocalized with BRCA1 and repair protein Rad51 in nuclear dots during S phase in vivo (Jin et al. 1997), and to nuclear foci in response to DNA damage (Scully et al. 1997a). A mutation in the RING finger of BRCA1, disrupting BRCA1-BARD1 interaction, abolished the formation of nuclear foci (Chiba and Parvin 2002; Fabbro et al. 2002), indicating that this region is necessary for BARD1-BRCA1 colocalization.
Further studies showed that BARD1 can play a chaperone role in translocation of BRCA1 into nucleus (Fabbro et al. 2002). BARD1 retains BRCA1 in the nucleus by masking BRCA1’s NES sequence (Brzovic et al. 2001a; Fabbro et al. 2002; Schuchner et al. 2005).
Heterodimerization of BRCA1 and BARD1 masks NES located within each protein, causes nuclear retention of the BRCA1-BARD1 complex, and potentially influences its role in DNA repair, cell survival, and regulation of centrosome duplication.
During the cell cycle, BARD1 expression can largely be categorized into three patterns: moderately expressed in a predominantly unphosphorylated form in early G1 phase, expressed at low levels in both phosphorylated and unphosphorylated forms during late G1 and S phases, and highly expressed in its phosphorylated form during mitosis coinciding with BRCA1 expression (Hayami et al. 2005). Therefore, BARD1 plays an important role
15 in trapping BRCA1 within the nucleus. Thus, the concomitant expression of BARD1 and BRCA1 supports the functions ascribed to the BRCA1-BARD1 heterodimer.
The subcellular location and function of many proteins are regulated by nuclear-cytoplasmic shuttling. Further studies reported that BARD1 was also found in the cytoplasm. Its cytoplasmic localization was associated with apoptotic functions. These observations suggest that BARD1 can shuttle from the nucleus to the cytoplasm, correlated with its apoptotic activity (Jefford et al. 2004; Rodriguez et al. 2004).
1.3. BARD1 knockout in animals and plants
Depletion of BARD1 leads to early embryonic lethality in mice and displays genomic instability. This phenotype has also been observed for BRCA1 or BRCA2 deficiencies (Gowen et al. 1996; Hakem et al. 1996; Liu et al. 1996; Ludwig et al. 1997; McCarthy et al. 2003). The BARD1-null mouse embryos died in utero between day E7.5 and E8.5 post-fecundation (McCarthy et al. 2003). Death was due to severe cell proliferation defects but not to apoptosis. Partial rescue was obtained in Bard1-/-;p53-/- double knockout embryos, and embryonic death was delayed until day E9.5. Cytogenetic analysis of the Bard1-/-;p53-/- cells displayed an increase of structural and numerical chromosome aberrations compared to p53-/- cells (McCarthy et al. 2003). The phenotypes of the knockout mice demonstrate that BARD1 is essential for a wide panel of cellular events (Jasin 2002). It is clear that BARD1 assures vital functions for cell cycle progression and maintenance of genome integrity.
Interestingly, severe shoot apical meristem (SAM) defects was observed in the knockout mutant bard1-3, one of Arabidopsis mutant lines with disrupted of bard1 (Han et al. 2008). BARD1 functions through regulation of WUSCHEL (WUS), which is a key gene involved in positioning the stem cells and is essential for organization and maintenance of the SAM (Laux et al. 1996; Schoof et al. 2000; Muller et al. 2006). BARD1 confines WUS transcription to the SAM organization center. In a Bard1-3 Arabidopsis knockout mutant, WUS was released to the outer layers and expressed at extremely high levels compared to
16 the wild-type (Han et al. 2008). This finding indicated that BARD1 is also important for organization and maintenance of the SAM in plants.
1.4. Biological functions of BARD1
BARD1 was originally identified due to its interaction with the RING domain of BRCA1. The BARD1-BRCA1 interaction is disrupted by cancer-associated mutations within the RING domain of BRCA1 (Wu et al. 1996), suggesting a role for BARD1 in mediating tumor suppression by BRCA1. BARD1 is required for cell viability. Loss of BARD1 may result in early embryonic lethality and chromosomal instability (McCarthy et al. 2003). BARD1 is required for S-phase progression, contact inhibition and normal nuclear division (Irminger-Finger et al. 1998). BARD1 functions as a chaperone or a scaffold protein involved in a diverse range of cellular pathways such as DNA damage repair, transcriptional regulation, genomic integrity, mitotic events, and apoptosis, though its interaction or association with a number of proteins, either BRCA1-dependently or independently (Jasin 2002).
1.4.1. BRCA1-dependent functions of BARD1
1.4.1.1. Functions of the BRCA1-BARD1 heterodimer
The important discovery for understanding BRCA1-BARD1 function is that this heterodimer has a ubiquitin ligase (E3) activity. Ubiquitination is a post-translational modification of proteins by the covalent attachment of one or more ubiquitin monomers. There are three enzymes involved in ubiquitination: ubiquitin-activating enzyme (E1), ubiquitin-conjugating enzyme (E2) and ubiquitin ligase (E3). The ubiquitin-activating enzyme binds ubiquitin by forming a thiolester bond, in an ATP-dependent way, and then transfers ubiquitin to the ubiquitin-conjugating enzyme which, in term, forms an isopeptide bond with the substrate via the ubiquitin ligase. A ubiquitin ligase functions at the crossroad
17 between the ubiquitin activity and the attachment of ubiquitin to a protein substrate. In general, the ubiquitin ligase is involved in polyubiquitination which marks proteins for degradation by the proteasome. However, there are some ubiquitination events that are limited to monoubiquitination, in which only a single ubiquitin is added by the ubiquitin ligase to a substrate molecule. In some cases, monoubiquitinated proteins are not targeted to the proteasome for degradation, but may instead be altered in their cellular location or function (Ardley and Robinson 2005; Deshaies and Joazeiro 2009).
In vitro, BRCA1 and BARD1 have very low ubiquitin ligase activity individually, but the E3 ubiquitin ligase activity is increased when they form a heterodimer through their RING finger domains (Hashizume et al. 2001). This reflects that the heterodimer is a more stable structure. Several studies have demonstrated that tumor-associated RING domain mutations in BRCA1, C61G and C64G, disrupt the E3 ubiquitin ligase activity of BRCA1-BARD1 (Brzovic et al. 2001a; Hashizume et al. 2001; Ruffner et al. 2001). This demonstrates that E3 ubiquitin ligase activity is critical for BRCA1-BARD1 tumor suppressor function.
The most commonly catalyzed polyubiquitin chain is K48-linked, which targets proteins for degradation by proteasome. However, other polyubiquitin chains can also be synthesized with links between the C-terminus of ubiquitin and the K6, K11, K29 and K63 on the adjacent ubiquitin. The BRCA1–BARD1 heterodimer directs polymerization of ubiquitin primarily through K6, which is an unconventional linkage (Wu-Baer et al. 2003).
In vitro, autoubiquitination occurs for BARD1 and BRCA1, but it does not appear to result in degradation of BARD1 or BRCA1. In contrast, it increases the ubiquitin ligase activity of the heterodimer by 20-fold and most likely its stability (Chen et al. 2002; Mallery et al. 2002). The autoubiquitination reactions promote formation of K6-linked ubiquitin chains (Wu-Baer et al. 2003; Nishikawa et al. 2004). The ubiquitinated BRCA1-BARD1 complex has an increased affinity for binding to DNA repair intermediates (Simons et al. 2006), suggesting that this modification is a regulator of BARD1-BRCA1 activity in DNA damage response.
18 1.4.1.2. Formation and regulation of BRCA1-BARD1 activity
How the ubiquitin ligase activity of BRCA1-BARD1 is regulated is investigated by many groups. Ubiquitin ligase activity of BRCA1-BARD1 is regulated by CDK2 (Hayami et al. 2005). BARD1 is phosphorylated by CDK2 and CDK1 on its NH2 terminus. CDK2-cyclin A1/E1, but not CDK1-cyclin B1, completely abolished the ubiquitination of nucleophosmin/B23 (NPM) in vivo by BRCA1-BARD1 and autoubiquitination of BRCA1. However, the inhibition of ubiquitin ligase activity is not due to BARD1 phosphorylation, as autoubiquitination of BRCA1 mediated by unphosphorylatable mutants of BARD1, S148A/S251A/S288A/T299A, is still inhibited by CDK2-cyclin E1. It was also found that BRCA1-BARD1 is likely exported to the cytoplasm by CDK2-cyclin E1 coexpression (Hayami et al. 2005). These results demonstrated that the ubiquitin ligase activity of BRCA1-BARD1 is down-regulated by CDK2.
More recently it was reported that BRCA1 associated protein 1 (BAP1) also inhibits the E3 ligase activity of BRCA1-BARD1 (Nishikawa et al. 2009). BAP1 is a nuclear-residing ubiquitin carboxyl-terminal hydrolase, a subfamily of deubiquitinating enzymes. It interacts with the RING finger domain of BRCA1 and functions in the BRCA1 growth control pathway (Jensen et al. 1998). Indeed, BAP1 also interacts with BARD1 in vivo (Nishikawa et al. 2009). BAP1 inhibits the E3 ubiquitin ligase activity of BRCA1-BARD1 by binding to the RING finger domain of BARD1 and disturbing the BRCA1-BARD1 heterodimer formation. Furthermore BAP1 inhibition by short hairpin RNA retards S-phase progression and leads to hypersensitive to ionizing irradiation (Nishikawa et al. 2009). These observations indicated another regulation mechanism of BRCA1-BARD1 ubiquitin ligase activity.
1.4.1.3. The BRCA1-BARD1 targets and their associated functions
Targets with functions in DNA repair
BARD1 and BRCA1 are involved in DNA damage repair, which is important for
19 maintenance of genomic stability. Both colocalize in nuclear dots during S phase, but relocate with RAD51, a protein involved in eukaryotic double strand break repair, to proliferating cell nuclear antigen (PCNA) ( a protein involved in DNA replication ) containing structures after DNA damaging agents exposure (Jin et al. 1997; Scully et al. 1997a). This dynamic localization suggests that BRCA1 and BARD1 containing complexes function in DNA replication checkpoint response (Scully et al. 1997a).
BARD1 also interacts with mRNA polyadenylation factor CstF-50 (cleavage stimulation factor), which is a protein complex involved in the polyadenylation and 3' end cleavage of pre-mRNAs. The BARD1-CstF-50 interaction inhibited polyadenylation in vitro (Kleiman and Manley 1999). BARD1 binding to CstF-50 is induced by DNA damage after hydroxyurea treatment or exposure to UV light. A transient inhibition of mRNA transcription, accompanied with increased amounts of a CstF/BARD1/BRCA1 complex, was also observed in extracts of cells treated with hydroxyurea and UV light (Kleiman and Manley 2001). Furthermore, a tumor associated germline mutation in BARD1 (Q564H) results in reduced binding to CstF-50 and diminished inhibition of polyadenylation (Kleiman and Manley 2001). These results indicate that BARD1 links mRNA 3' processing to DNA repair and tumor suppression.
The CstF-50 binding site on BARD1 is present within its C-terminal region, containing ANK repeats and BRCT domain (Kleiman and Manley 1999). Recent studies indicate that interactions between the CstF-50 WD-40 domain and BARD1 involve the ANK-BRCT linker, but do not require ANK or BRCT domains. This finding helps to explain the regulated assembly of different protein BARD1 complexes with distinct functions in DNA damage signaling, including BARD1-dependent induction of apoptosis by p53 stabilization (Edwards et al. 2008).
BRCA1 and BARD1 also interact with MSH2, a DNA mismatch repair (MMR) gene product, and its heterodimeric partner MSH6 both in vitro and in vivo. BRCA1-BARD1 heterodimer acts as downstream effector of the MSH2-MSH6 signaling complex. This observation implicates a role for BRCA1-BARD1 in DNA mismatch repair (Wang et al. 2001).
20 Dissection of repair pathways showed that the BRCA1-BARD1 heterodimer has a role in homologous repair before the branch point of HDR (homology-directed repair) and SSA (single-strand annealing) (Stark et al. 2004). A recent study showed that the ANK and BRCT motifs of BARD1 are required for this function (Laufer et al. 2007).
The holoenzyme complex containing BRCA1, BRCA2, BARD1 and RAD51, which was named the BRCA1-BRCA2 containing complex (BRCC), was identified as a E3 ubiquitin ligase (Dong et al. 2003). BRE (BRCA1-A complex subunit, a protein that in humans is encoded by the BRE gene) and BRCC36 (an enzyme that in humans is encoded by the BRCC3 gene) enhanced ubiquitination by BRCC, as compared to that of BRCA1-BARD1 heterodimer, and the association of BRE and BRCC36 with BRCC was reduced by cancer-associated truncations in BRCA1. Furthermore, RNA interference of BRE and BRCC36 in HeLa cells increased cell sensitivity to ionizing radiation and resulted in a defect in G2/M checkpoint arrest. It was concluded that BRCC, which functions as a E3 ubiquitin ligase, enhances cellular survival following DNA damage (Dong et al. 2003).
Targets with functions in transcriptional regulation
BRCA1-BARD1 has been shown to ubiquitinate phosphorylated RNA polymerase II (RNA Pol II) as part of a possible genome surveillance pathway (Kleiman et al. 2005; Starita et al. 2005). The BRCA1-BARD1 ubiquitination of phosphorylated RNA Pol II occurs in response to DNA damage. Depletion of BRCA1 or BARD1 in cells by siRNA treatment significantly reduced ubiquitination of RNA Pol II after DNA damage (Kleiman et al. 2005). Inversely, over-expression of BRCA1 in cells stimulated the recovery of cells and ubiquitination of RNA Pol II after DNA damage (Starita et al. 2005). These finding implicate that BARD1-BRCA1 are involved in the regulation of transcription.
BARD1 was also shown to interact with CtIP via BRCA1. CtIP is a nuclear protein, which interacts with nuclear regulatory factors like CtBP1 and Rb1 involved in regulation of RNA transcription (Yu and Baer 2000). During cell cycle, the steady-state levels of CtIP, which remain low in G0 and G1 phases, increase dramatically in G1/S boundary. Thus, CtIP is
21 expressed in a cell cycle-specific fashion similar to BRCA1. In addition, it was found that CtIP exists in a protein complex that includes both BRCA1 and BARD1, and this complex remains stable in cells in face to genotoxic stress (Yu and Baer 2000). It was also demonstrated that the BRCT domains of BRCA1 interacted in vivo with CtIP, while BRCA1 was co-immunoprecipitated with BARD1 residues 26-142. Moreover, the interaction between BRCA1 and CtIP was completely abolished by tumor associated mutations within the BRCT motifs of BRCA1, namely A1708E, M1775R and Y1853D (Yu et al. 1998). Thus, the in vivo interaction of BARD1, BRCA1, and CtIP is likely to be important for BRCA1 functions in transcriptional regulation and tumor suppression, and this interaction might be involved in the ubiquitin ligase activity of the BRCA1-BARD1 heterodimer.
Targets with functions in chromatin modification and remodelling
The BRCA1-BARD1 ubiquitin ligase also targets nucleosome core histones, including the variant histone H2AX, via monoubiquitination (Chen et al. 2002; Mallery et al. 2002). Attachment of a single ubiquitin to histones H2A and H2B leads to alternation of chromatin structure and opens DNA for transcriptional activity. A more recent study demonstrated that the BRCA1-BARD1 complex can ubiquitinate both free H2A and H2B histones and histones in the context of nucleosomal particles. These results raise the possibility that BRCA1-BARD1 can directly affect nucleosomal structure, dynamics, and function through its ability to modify nucleosomal histones (Thakar et al. 2010). These finding indicate that BRCA1-BARD1 activity is involved in chromatin modification.
BARD1 and BRCA1 may also be involved in heterochromatin chromosome re-structuring and in X chromosome inactivation, because BRCA1 and BARD1 interact with the inactive X chromosome (Xi) specific transcript (XIST) RNA, a non-coding RNA known to coat Xi and to participate in the initiation of its inactivation during early embryogenesis (Ganesan et al. 2002). Female somatic cells lacking wild-type BRCA1 show lack of proper XIST RNA localization to Xi, but reintroduction of wild-type BRCA1 can correct this defect in
22 XIST localization in these cells (Ganesan et al. 2004). In addition, BRCA1 depletion by RNAi decreased XIST concentration on Xi, and depletion of BRCA1 by Cre-mediated excision also decreased XIST concentration on Xi (Ganesan et al. 2004). Furthermore, Brca1-defective breast cancer cell lines did not show XIST RNA concentration on Xi despite the presence of two X chromosomes (Silver et al. 2007). These findings indicated that BRCA1 and BARD1 may play a important role in the regulation of XIST concentration on Xi in somatic cells, and therefore, may reflect a role in maintaining heterochromatin structure or function. However, the detailed mechanism of XIST function is not completely resolved.
Targets with functions in cell cycle regulation
The regulation of centrosome number is critical for mitosis. BRCA1 localizes to the centrosome during mitosis (Hsu and White 1998). The BRCA1-BARD1 ubiquitin ligase activity may directly regulate centrosome number, which is important for maintaining chromosomal stability and ploidy (Lingle et al. 2002; Pihan et al. 2003). Consistently, a number of centrosome proteins were found as targets of BRCA1-BARD1. One of these proteins was γ-tubulin , a centrosomal component, which is important for the nucleation and polar orientation of microtubules. BRCA1-BARD1 ubiquitinates γ-tubulin in vivo using K48 and K344 residues (Starita et al. 2004). Expression of the K48R mutated form of γ-tubulin in cells caused a marked amplification of the centrosomes (Starita et al. 2004). This result suggested that the BRCA1-BARD1 complex is involved in cell-cycle checkpoint control.
Another centrosome protein that is targeted by the BRCA1-BARD1 ubiquitin ligase is the nucleolar phosphoprotein nucleophosmin (NPM), also known as B23, which is important for multiple cellular functions including ribosomal biogenesis, cell proliferation and centrosome duplication (Okuda et al. 2000; Itahana et al. 2003). NPM/B23 interacts and colocalizes with BRCA1 and BARD1 in mitotic cells. BRCA1 and BARD1 co-expression in cells leads to NPM/B23 stabilization (Sato et al. 2004). In human tumors, mutations of
23 NPM/B23 are associated with haematological disorders. Therefore, the ubiquitination function, driven by the BRCA1-BARD1 heterodimer, might be responsible for mediating checkpoint functions and cell cycle arrest.
Targets with functions in genomic stability
A more recent study demonstrated that BARD1 also interacts with Aurora B and BRCA2 (Ryser et al. 2009). FL BARD1 interacts with BRCA1 and is involved in Aurora B ubiquitination and degradation during mitosis. Depletion of BARD1 resulted in massive up-regulation of Aurora B, but overexpression of FL BARD1 leads to increased degradation of Aurora B (Ryser et al. 2009). BARD1 interacts and colocalizes with BRCA2 at late mitosis at the midbody. Depletion of BARD1 leads to similar cell phenotype as BRCA2 deletion or Aurora B over-expression. Thus, BARD1 sequentially interacts with BRCA1 at the spindle poles in early mitosis and then interacts with BRCA2 and Aurora B at the midbody during cytokinesis. Aurora B is a protein kinase that functions in the attachment of the mitotic spindle to the centromere and microtubule abscission at cytokinesis. Over-expression of Aurora kinases causes unequal distribution of genetic information, generating aneuploid cells. Together these findings suggest a molecular pathway which explains the tumorsuppressor and genome maintenance of BRCA1-BARD1 functions.
Targets with functions in mitotic spindle formation
It has been demonstrated that the BRCA1-BARD1 heterodimer participates in mitotic spindle assembly. In fact, the BRCA1-BARD1 complex was required for mitotic spindle assembly and for accumulation of TPX2, a major spindle organizer, on spindle poles in both Xenopus egg extracts and HeLa cells. The BRCA1-BARD1 complex regulates microtubule organization and operates downstream of Ran GTPase in a BRCA1-BARD1 E3 ubiquitin ligase activity-dependent, but centrosome independent manner (Joukov et al. 2006). This finding provides a clear evidence that the BRCA1-BARD1 complex has a distinct role in mitosis (Clarke and Sanderson 2006).
24
Targets with functions in preventing DNA double-strand breaks
BRCA1-BARD1 has a role in preventing double strand breaks (DSBs) by regulating the activity of topoisomerase II α (topo II α) in an ubiquitination-dependent manner (Lou et al. 2005). Topo II α is an enzyme which cuts both strands of the DNA helix simultaneously in order to unwind it. Ubiquitination of topo II α by BRCA1-BARD1 stimulates its activity, regulates the mobility of topo II α, and consequently DNA decatenation, which implies an important role for protecting cells from DNA damage.
Targets with functions in preventing hormone dependent carcinogenesis
Estrogen receptor α R (E α) has been identified as a putative substrate for the BRCA1-BARD1 ubiquitin ligase in vitro (Eakin et al. 2007). The regions of BRCA1-BARD1 that are necessary for ERα ubiquitination include at least 241 and 170 residues of the BRCA1 and BARD1 RING domains, respectively. Cancer-predisposing mutations within this region abrogate ERα ubiquitination (Eakin et al. 2007). A more recent study has shown that the BRCA1-BARD1 complex also plays a role in vivo in ERα ubiquitination and degradation, and it is the BARD1 C-terminus that is required for target recognition. ERα can induce BRCA1 and BARD1 transcriptional up regulation. Moreover, repression of BRCA1 or BARD1 leads to ERα accumulation, suggesting a feedback loop between BRCA1-BARD1 and ERα (Dizin and Irminger-Finger 2010). It is well-known that endogenous exposure to female reproductive hormones is a central factor in the development of many cancers, such as breast (Conneely et al. 2003; Trauernicht and Boyer 2003) and ovarian cancers (Sun et al. 2005). This report therefore provides a link between BRCA1-BARD1 ubiquitin ligase activity and hormone-dependent carcinogenesis.
In summary, the BRCA1-BARD1 complex participates in diverse cellular functions, such as DNA repair, transcription regulation, cell cycle control, genomic stability, and mitotic
25 spindle formation through its E3 ubiquitin ligase activity (Fig. 2). Collectively, these findings support a role for BARD1 in tumor suppression.
NF-κκκB/p50 CDK2 BAP1 Ku-70 p53 Bcl-3
UTR UTR 5’ RING A N K BRCT BRCT 3’
BRCA1 RAD51 PCNA Aurora B CstF-50 RNA Pol II -tubulin Topo II ααα BRCA2 hMSH2-hMSH6 γγγ BRE BRCC36 EWS NPM/B23 P300/CBP ERααα Ran GTPase XIST H2A H2B MRE11 RAD50
BASC NBS1 CtIP BACH1
Figure 2. Proteins interacting with BARD1.
BARD1 has been shown to interact with a number of proteins via BRCA1-dependent or BRCA1-independent manner. Interacting proteins are shown in ellipse frame covering the approximate region of interaction with
BARD1. Proteins that are thought to have a direct interaction are shown in colour. Proteins that are known to bind indirectly with BARD1 are shown in grey, all of which may be detected in biochemical complexes. The functional domains of BARD1: RING (green), ankyrin (ANK, blue), and BRCA1 carboxy-terminal (BRCT, red) are indicated. UTR, untranslated region.
1.4.2. BRCA1-independent functions of BARD1
1.4.2.1. BARD1 and p53
As BARD1 was originally discovered as a binding partner of BRCA1, and many functions of BARD1 are linked to the interaction of BARD1 and BRCA1. However, BARD1 and BRCA1 were not consistently co-expressed in all tissues (Irminger-Finger et al. 1998), indicating that BARD1 might have BRCA1-independent functions. In vivo, BARD1 and BRCA1 expression levels are modulated differently in hormonally controlled tissues during the ovulatory cycle of the mouse (Irminger-Finger et al. 1998) and during spermatogenesis
26 in rats (Feki et al. 2004). In vivo, BARD1 expression is absent in the central nervous system, but it was upregulated in response to hypoxia in the mouse brain, whereas BRCA1 was not detected in the brain (Irminger-Finger et al. 1998; Irminger-Finger et al. 2001).
Elevated expression of BARD1 was associated with apoptosis. BARD1 is transcriptionally upregulated in response to genotoxic stress (Irminger-Finger et al. 2001). Overexpression of exogenous BARD1 leads to DNA fragmentation and caspase-3 activation, indicative of apoptosis. Additionally, transfection of BARD1 can induce apoptosis, but overexpression of BRCA1 is competing this pro-apoptotic effect. Transfection of BRCA1 diminished rather than enhanced apoptosis induction by BARD1 (Irminger-Finger et al. 2001).
Indeed, BARD1 exerts its apoptotic activity through its interaction with p53. Indeed, BARD1 co-immunoprecipitates with p53, and the interaction of BARD1 and p53 leads to p53 stabilization. It was found that the increased BARD1 expression level is accompanied by an increase in p53 protein but not mRNA levels (Irminger-Finger et al. 2001). Absence of functional BARD1 is sufficient for abolishing p53 phosphorylation (Feki et al. 2005), overexpression of exogenous BARD1 can catalyze the phosphorylation of p53-serine 15 (Feki et al. 2005). BARD1 binds to Ku-70, a subunit of DNA-dependent protein kinase (DNAPK) and catalyzes phosphorylation of p53-serine 15 (Feki et al. 2005). The apoptotic activity of BARD1 is regulated by nuclear-cytoplasmic shuttling, and the increased cytoplasmic localization of BARD1 is associated with apoptosis (Jefford et al. 2004; Rodriguez et al. 2004). The minimal region required for p53 binding and p53-dependent apoptosis comprises BARD1 residues 510-604, which are located between ANK and BRCT domains (Fig. 2). There are two known cancer-associated missense mutations of BARD1, C557S and Q564H, localized within this region (Thai et al. 1998; Ghimenti et al. 2002; Jefford et al. 2004; Karppinen et al. 2004), indicating that this region is necessary for its tumor suppressor and pro-apoptotic functions. These experiments identified BARD1 as a mediator between pro-apoptotic stress and p53-dependent apoptosis.
Thus, in addition to being an essential binding protein of BRCA1, BARD1 also functions as a tumorsuppressor by binding and stabilizing p53 and inducing apoptosis, in a BRCA1-independent manner.
27 Based on BRCA1-dependent and independent functions, a dual model of BARD1 functions was raised (Fig. 3) (Irminger-Finger et al. 2001). In the survival mode, BARD1 is involved in DNA repair, as heterodimer with BRCA1. In the death mode, BARD1 binds to p53 and induces apoptosis, a function independent of BRCA1. The ratio of BRCA1 and BARD1 may determine the cell fate: survive or die (Irminger-Finger et al. 2001; Irminger-Finger and Jefford 2006).
Figure 3. Presumed dual model of tumor supression by BARD1.
BRCA1-associated ring domain 1 (BARD1) participates in two major pathways. The first is a cell survival
pathway (a), mediated by the BRCA1-BARD1 heterodimer. The second (b) is a cell death pathway, which is
independent of BRCA1. In pathway a, the activity of the BRCA1-BARD1 ubiquitin ligase leads to RNA Pol
II degradation and cell-cycle arrest, to γ-tubulin degradation and control of centrosome duplication, to
H2A/H2AX ubiquitination and epigenetic control, and to NPM ubiquitination and stabilization. Increased
expression of NPM is known to inhibit apoptosis, and it causes centrosome amplification and genetic
instability. So, NPM antagonizes BARD1 functions. In pathway b, expression of BARD1 can be increased by
DNA damage, exposure to ultraviolet light, hypoxia and hormone signalling. Increased expression levels of
28 BARD1 stabilize p53 and facilitate its phosphorylation by DNAPK. The role of BARD1 in p53
phosphorylation at serine 15 (Pser15) by ataxia telangiectasia mutated (ATM) is unknown. Post-translational
modification, through phosphorylation by CDK2-cyclin complexes, might regulate the interaction of BARD1
with BRCA1 and trigger its mitotic activity. BARD1 also has transcriptional activity as it can induce the transcription activity of NF-κBs through binding to the NF-κB co-factor BCL3 (B cell leukaemia/lymphoma
3). Finally, the proteolytic cleavage product of BARD1 (p67) is immunogenic and has anti-tumorigenic properties.
(Adapted from Irminger-Finger and Jefford, Nat Rev Can 2006)
1.4.2.2. BARD1 and NF-κB
The transcriptional role for BARD1 also cames from the discovery that BARD1 interacts with the NF-κ B/Rel transcription factor. NF-κB plays a key role in regulating the immune response to infection. Incorrect regulation of NF-κB has been linked to cancer, inflammatory and autoimmune diseases, septic shock, viral infection, and improper immune development (Gilmore 2006). A fragment of BARD1, comprising half of ANK through BRCT domain (residues 464-777), binds in vitro to the ANK repeats domain of Bcl-3, a member of the IκB family of NF-κB inhibitor. Bcl-3 serves as a bridge between NF-κB and BARD1, and modulates the transcriptional activity of the NF-κB complex (Dechend et al. 1999) (Fig. 2). Furthermore, it has been shown that the p65/RelA subunit of NF-κB binds to BRCA1 and thus causes an increase of the transcription levels of NF-κB target genes, such as Fas and interferon-β, although BRCA1 is not required for the interaction of BARD1 with Bcl3 (Benezra et al. 2003). Whether BRCA1 depends on BARD1 for this interaction remains to be proved, as BRCA1 and BARD1 act antagonistically in this pathway.
1.5. Genetic and epigenetic modification of BARD1 in cancer
It was demonstrated that mutations in BRCA1 and/or BRCA2 predispose women to cancer
29 (Miki et al. 1994), but do not account for all familial breast and ovarian cancer predispositions. Hundreds of cancer predisposing mutations have been identified in BRCA1, and they span the entire BRCA1 gene (Human Gene Mutation Database: http://archive.uwcm.ac.uk/uwcm/mg/hgmd0.html). Indeed, they are associated with only about 50% of familial breast cancer cases (Rahman and Stratton 1998). It was therefore hypothesized BARD1 mutations could account for additional cases of hereditary and sporadic breast and ovarian cancers.
1.5.1. BARD1 mutations, polymorphisms and cancer
Screening a panel of sporadic breast, ovarian and endometrial cancers, three missense mutations were identified in the BARD1 gene at amino acid positions Q564H, V695L, and S761N (Thai et al. 1998). Loss-of-heterozygosity was accompanied with Q564H and S671N mutations, substantiating BARD1’s role as a tumor suppressor. The V695L and S761N mutations were found in somatic breast tissue, but not in the germline, whereas the Q564H mutation arose in the germline of a patient with clear cell adenocarcinoma of the ovary (Thai et al. 1998).
Five alterations were discovered in an Italian cohort with familial breast and ovarian cancers that were chosen for absence of BRCA1 and BRCA2 gene alterations in the proband (Ghimenti et al. 2002). These mutations included 3 missense mutations, K312R, C557S, N295S, and an in-frame deletion of 7 amino acid residues, 1139Del21-(PLPECSS). The last alteration was a C1579G transversion with no amino acid change at position A502, which was found in 15 probands, indicative of a novel polymorphism variant (Ghimenti et al. 2002). The mutations C557S and 1139Del21, which were considered as polymorphisms, were described previously by Thai et al. (1998). The analysis of BARD1 in Japanese patients with familial breast cancers who did not carry BRCA1 or BRCA2 germline mutations, revealed six alterations comprising four missense mutations, S241C, R378S, N470S, V507M, one silent mutation, H506, and one in-frame deletion variant, 1139del21, which was previously identified in the Italian cohort (Ghimenti et al. 2002). The N470S
30 was considered as a putative germline mutation, and the V507M mutation was associated with the inceased risk of breast cancer (Ishitobi et al. 2003).
A genotyping analysis of three non-synonymous single nucleotide polymorphisms (SNP), P24S, R378S, V507M in a case-control study of 507 patients with sporadic breast cancer in Chinese women indicated that the potentially functional polymorphisms P24S and R378S in BARD1 may jointly contribute to the susceptibility of breast cancer (Huo et al. 2007).
More recently, another screening of 196 non-BRCA1/2 breast cancer or, concomitance of ovarian cancer families, for BARD1 germline mutations, found eleven intron variants and fifteen exon variants (nine missense mutations, four silent mutations, one in-frame deletion and one frameshift mutation (E652fs) causing the removal of the entire second BRCT domain of BARD1), of which the missense mutation R658C was also described before (Thai et al. 1998; Karppinen et al. 2004; Vahteristo et al. 2006). Four of these mutations, V85L, 1203T>C(p.=), I509T and E652fs, were reported for the first time. Importantly, the evaluation of candidate breast cancer predisposing mutations found that three variants, I509T, R658C and E652fs appear to possess cancer predisposing properties (De Brakeleer et al. 2010).
The C557S is the most frequently studied mutation of BARD1 among these variants. The germline variant C557S of BARD1 is a missense mutation which resides between the ankyrin repeats and BRCT domains of BARD1. It was initially identified as polymorphisms in breast cancer samples and cell lines of Caucasian origin (Thai et al. 1998). Further study suggested that C557S is not a polymorphism but may contribute to the cancer phenotype (Sauer and Andrulis 2005). Furthermore, several studies provided some support that this variant is associated with breast cancer risk (Ghimenti et al. 2002; Karppinen et al. 2004; Karppinen et al. 2006; Stacey et al. 2006), even the risk of breast cancer in a double carrier of BARD1 C557S and BRCA2 999del5 is more than 3-fold greater than the risk in a BRCA2 999del5 carrer alone (Stacey et al. 2006), but other studies have failed to confirm these finding (Vahteristo et al. 2006; Gorringe et al. 2008; Jakubowska et al. 2008; Johnatty et al. 2009), possibly because of population substructure, insufficient power, or false positive reports.
31 Importantly, more recent data found three common nonsynonymous SNPs in BARD1, P24S, R378S and V507M, which were previously found in breast and/or ovarian cancers, and another SNP rs7585356 located 3’ downstream of BARD1 showed statistically significant association with high-risk neuroblastoma by a SNP-based genome-wide association study (Capasso et al. 2009), suggesting that SNPs in BARD1 are not only important for breast and ovarian cancer, but also for other cancers like neuroblastoma.
Interestingly, many mutations in BRCA1 have been found in the RING finger, which disrupt the BRCA1-BARD1 interaction (Wu et al. 1996). On the contrary, none of the BARD1 variants appears to affect localization and interaction with BRCA1, BARD1 mutations are mostly around the ANK repeats, the BRCT domains and the region in between these domains (Fig. 4).
5UTR RING ANKYRIN BRCT 3UTR 46-90 aa 427-525 aa 616-653 743-777 aa 1 (74) 2530 bp i ii iii iv v vi vii viii ix x xi P PP PP PPP PP PP 777 aa
P24S K153E S241C Del 358-364 Q406R V507M I738V
N293K R378S N470S C557SQ564H E652fs LOH V85L N295S L312N I509T T598I R658C V695L * S761N * I692T LOH
Figure 4. Mutations and polymorphisms of BARD1.
Mutations are marked in red, germline mutations in blue, somatic mutations in red with *, polymorphisms in
black, and putative cancer predisposing mutations are underlined, Loss of heterozygosity indicated LOH
below (Thai et al., 1998; Ghimenti et al., 2002; Ishitobi et al., 2003; Karppinen, 2004; Sauer et al., 2005;
Vahteristo et al., 2006; Huo et al., 2007; Gorringe et al., 2008; Brakeller et al., 2010). SNPs which showed statistically significant associated with high-risk neuroblastoma are in rectangle, and another located 3’ downstream (intron region) of BARD1: rs7585356, are not shown (Capasso et al., 2009). Silent mutations are not indicated. Phosphorylation sites are marked with P RING, ANK, and BRCT motifs, and their corresponding amino acid residues are indicated.
32
In summary, BARD1 is a potential candidate breast cancer gene. But only a small percentage of mutations with rather unclear pathogenic consequences in both sporadic and non-BRCA1/2 familial breast and/or ovarian cancers have been reported, suggesting that the contribution of the BARD1 germline variants to breast cancer predisposition is very limited.
1.5.2. BARD1 spliced isoforms and cancer
Alternative splicing is an important mechanism allowing the generation of multiple mRNA isoforms from a single primary transcript. The resulting different mRNAs may be translated into different protein isoforms. It is a major source of protein diversity as well as a subtle way of regulating gene expression (Caceres and Kornblihtt 2002; Black 2003). In humans, over 80% of genes present alternatively spliced forms (Matlin et al. 2005). This event leads to the production of distinct protein isoforms, which might have diverse and even antagonistic functions. Abnormal spliced variants have been associated with multiple diseases including the development of cancer (Skotheim and Nees 2007; Fackenthal and Godley 2008; He et al. 2009).
Several spliced variants have been identified for BRCA1 (Pettigrew et al. 2010). Likewise, BARD1 has also several transcripts supplied by alternative splicing (Fig. 5) (Feki et al. 2005; Tsuzuki et al. 2006; Li et al. 2007a; Li et al. 2007b; Lombardi et al. 2007).
The spliced mRNA isoforms BARD1β and BARD1δ, which deletion of exon 2 to 3 and exon 2 to 6, were firstly identified in Nutu-19 cells, a rat ovarian cancer cell line which is resistant to apoptosis (Feki et al. 2005) (Fig. 5). Isoform BARD1δ was later reported in HeLa cells (Tsuzuki et al. 2006). These isoforms lack most of the RING domain which is required for binding and stabilising BRCA1. Whereafter, BARD1 α, γ, ϕ, ε and η, which were missing exon 2, exon 4, exon 3 to 6, exon 4 to 9, and 2 to 9, respectively, including BARD1β and BARD1δ were found in gynaecological cancer cell lines (Li et al. 2007b).
33 The same BARD1 isoforms δ, ϕ, and η were also indentified in sporadic breast cancers by RT-PCR. Isoform δ and ϕ were specifically associated with breast cancer by quantitative PCR analysis, while a number of additional spliced variants were also found in circulating lymphocytes and might represent minor spliced variants (Lombardi et al. 2007). These BARD1 spliced variants could encode internally deleted BARD1 proteins using translation starts in known BARD1 reading frame or alternative open reading frame. Interestingly, all these isoforms lack either the RING finger or ANK repeats, or both, which are required for the tumor suppressor functions of BARD1 (Irminger-Finger and Jefford 2006).
MWaa RING NLS NLS NLS ANK BRCT NLS BRCT
1 2 3 4 5 6 7 8 9 10 11 87 kD777 FL
85 kD758 ααα 1 3 4 5 6 7 8 9 10 11
βββ 1 4 5 6 7 8 9 10 11 75 kD680 39 kD345 γγγ 1 2 3 5 6 7 8 9 10 11
37 kD326 ϕϕϕ 1 2 7 8 9 10 11
δδδ 1 7 8 9 10 11 35 kD307
εεε 1 2 3 10 11 30 kD264 ηηη 1 10 11 28 kD167
Figure 5. Structure of BARD1 spliced isoforms.
Full length (FL) BARD1 is composed of eleven exons. Schematic exon structure of FL BARD1 and protein
features (RING, ANK, BRCT) and nuclear localization signals (NLS) are indicated. Spliced variants named
with Greek letters (left) are as published for isoforms expressed in gynecological cancers. Schematic
presumed protein structures of isoforms are shown below in green, noncoding exons in white, and alternative
open reading frames (β, γ and η) in yellow with green points. BARD1 β and γ are expressed in preleptotene
spermatocytes, BARD1 δ is overexpressed in a rat ovarian cancer cell line and in HeLa cells. BARD1 α, ϕ, ε
and η, including BARD1 β and BARD1 δ were found in gynaecological cancer cell lines. The same BARD1
isoforms δ, ϕ, and η were also indentified in sporadic breast cancers by RT-PCR. Isoforms δ and ϕ were
34 specifically associated with breast cancer by quantitative PCR analysis.
Indeed, several of these isoforms identified on mRNA level in gynaecological cancers are also translated into proteins, as revealed by immunohistochemistry using antibodies distinguishing FL BARD1 and isoforms, Western blots, and ELISA (Wu et al. 2006; Li et al. 2007a; Li et al. 2007b). Repression of cancer-associated BARD1 isoforms, but not FL BARD1, lead to proliferation arrest in vivo. This indicated that BARD1 isoform expression is required for cancer cell proliferation (Li et al. 2007b). In fact, these isoforms were highly upregulated and cytoplasmic in gynaecological cancers and correlated with poor prognosis, such as tumortype, tumorsize and stage (Wu et al. 2006; Li et al. 2007b).
Recently, BARD1δ was found to localize to mitochondria. But unlike FL BARD1, isoform BARD1δ did not stimulate apoptosis or alter membrane permeability, but might have a function in regulation of mitochondrial response to stress (Tembe and Henderson 2007). Furthermore, functional studies revealed that BARD1β has a dominant negative function in stabilizing Aurora B. BARD1β scaffolds Aurora B and BRCA2 at the midbody during telophase and cytokinesis, opposing Aurora B ubiquitination and degradation by FL BARD1 and BRCA1 ubiquitin ligase (Ryser et al. 2009). This result suggests a proliferative function for BARD1 isoform β.
The intracellular localization, protein interaction pattern, and pro-proliferative functions of BARD1 isoforms differ from FL BARD1 (Jefford et al. 2004; Ryser et al. 2009), which suggests that isoforms have not only lost the tumor suppressor functions of FL BARD1, but acquired new and presumably tumor-promoting functions. Interestingly, BARD1 isoforms were also upregulated in the adjacent healthy tissue of the patient (Lombardi et al. 2007), which might suggest that isoform expression is involved in the initiation of tumorigenesis (Irminger-Finger 2009).
Interestingly, more recent data indicate SNPs in BARD1 intronic regions are significantly associated with high risk neuroblastoma (Capasso et al. 2009), supporting a link with aberrant expression of differentially spliced BARD1 isoforms.
35
2. Cancers investigated in this study
2.1. Cancer occurrence and classification
Cancer is a group of diseases characterized by uncontrolled growth and spread of abnormal cells. It is a generic term for a large group of diseases that can affect any part of the body. Cancer is a leading cause of death worldwide: The disease accounted for 7.9 million deaths (around 13% of all deaths) in 2007 (WHO, February 2009. "Cancer". World Health Organization. Retrieved 4 February 2010). Indeed, it is the second leading cause of death in economically developed countries (following heart diseases) and the third leading cause of death in developing countries (following heart diseases and diarrhoeal diseases) (Global Cancer Facts and Figures 2007 rev2). Deaths from cancer worldwide are projected to continue to rise, with an estimated 12 million deaths in 2030. Tobacco use is the single most important risk factor for cancer (WHO, February 2009. "Cancer". World Health Organization. Retrieved 4 February 2010).
The main types of cancer leading to overall cancer mortality each year are: lung (1.3 million deaths/year), stomach (803 000 deaths), colorectal (639 000 deaths), liver (610 000 deaths), breast (519 000 deaths). The most frequent types of cancer worldwide differ between men and women. Among men are lung, stomach, liver, colorectal, oesophagus and prostate cancers. Among women are breast, lung, stomach, colorectal and cervical cancers (WHO, February 2009. "Cancer". World Health Organization).
Every case of cancer is unique, with its own set of genetic changes and growth properties. Genetic abnormalities found in cancer typically affect two general classes of genes: oncogenes and tumor suppressor genes. Activation of oncogenes and inactivation of tumor suppressor genes result in the gain of malignant properties and the loss of normal functions in cells. These changes that occur in cancer cells include mutation of key regulatory genes, changes in protein products, and changes in the amount of product produced by genes (gene expression). As changes accumulate, cells become more abnormal and cancer may result.
36 Definitive diagnosis requires the histologic examination of a biopsy specimen. Once diagnosed, cancer is usually treated with a combination of surgery, chemotherapy, and radiotherapy, depending on the specific type, location, and stage.
Staging describes the extent or spread of the disease at the time of diagnosis. It is essential in determining the choice of therapy and in assessing prognosis. Stage is based on the primary tumor’s size and location and on whether it has spread to other areas of the body. A number of different staging systems are used to classify tumors. The most common staging system is the TNM system, from the American Joint Committee on Cancer (AJCC). T denotes the size and local invasion of the primary tumor, N the degree of lymphatic node involvement, and M the degree of metastasis. Once the T, N, and M are determined, a stage of I, II, III, or IV is assigned, with stage I being early stage and stage IV being advanced (AJCC cancer staging manual, 6th edition. Springer-Verlag: New York. 2002). The histologic grade (G) is a qualitative assessment of the differentiation of the tumor, it reflects how much the tumor cells differ from the cells of the normal tissue they have originated from. The grade score (numerical: G1 up to G4) increases with the lack of cellular differentiation. The following are the grading categories (AJCC cancer staging manual, six edition. Springer-Verlag: New York. 2002):
G1 Well differentiated
G2 Moderately differentiated
G3 Poorly differentiated
G4 Undifferentiated
GX Grade cannot be assessed
The prognosis of cancer patients is most influenced by the type and the stage of cancer. In addition, histologic grading and the presence of specific molecular markers can also be useful in establishing prognosis.
37
2.2. Non-small cell lung cancer
Lung cancer is the leading cause of cancer related death. The primary risk factor for lung cancer is smoking, which accounts for more than 85% of all lung cancer-related deaths (WHO, February 2009. "Cancer". World Health Organization. Retrieved 4 February 2010).
The vast majority of primary lung cancers are carcinomas, malignancies that arise from epithelial cells. There are two main types of lung carcinoma: non-small cell lung cancer (NSCLC, 80%) and small cell lung cancer (SCLC, 15%) (Travis et al. 1995). NSCLC is divided into three categories, adenocarcinoma (AC, 40%), squamous cell carcinoma (SCC, 25-30%), and large cell carcinoma (LCC, 10-15%), based on appearance and other characteristics of the cancer cells. They are grouped together because their prognosis and management are similar (Travis 2002).
Treatment and prognosis depend on the histological type, the stage, and the patient's performance status. Possible treatments include surgery, chemotherapy, radiotherapy, and targeted biological therapy, like epidermal growth factor receptor inhibitor, which is a promising therapy in the treatment of NSCLC.
Prognosis for NSCLC is generally poor. Only 15% of all lung cancer patients are alive five years or more after diagnosis, this is reduced to about 1% for stage IV NSCLC. Early diagnosis improves survival. Patients with early NSCLC (stage I) have a 5-year survival of 54% (Raz et al. 2007). But only 16% of the patients are diagnosed at this stage (Important Facts & Figures 2009, from www.cancer.org/).
Similar to many other cancers, lung cancer is initiated by activation of oncogenes or inactivation of tumor suppressor genes (Fong et al. 2003). There are over 100 genes known to be associated with the development of lung cancer. Some of the most frequently altered genes are K-ras, Myc, Rb, TP53, and Epidermal Growth Factor Receptor (EGFR). Mutations in the K-ras proto-oncogene are responsible for 10–30% of lung adenocarcinomas (Aviel-Ronen et al. 2006; Herbst et al. 2008). The TP53 tumor suppressor
38 gene is affected in 60-75% of cases (Devereux et al. 1996). The EGFR regulates cell proliferation, apoptosis, angiogenesis, and tumor invasion (Herbst et al. 2008). Mutations and amplification of EGFR are common in NSCLC and provide the basis for treatment with EGFR-inhibitors. Molecular markers have become an integrated part in the decisions about the treatment of NSCLC, largely through the discovery of mutations in the EGFR that are predictive of the response to treatment with gefitinib and erlotinib (Lynch et al. 2004; Paez et al. 2004; Tsao et al. 2005). Recently, it was found that high levels of BRCA1 expression in NSCLC were correlated with poor prognosis, and expression levels of BRCA1 might be predictive of response to different chemotherapeutic drugs in NSCLC (Rosell et al. 2007; Reguart et al. 2008). We therefore investigated the role of the BRCA1 binding partner BARD1 in NSCLC.
2.3. Colorectal Cancer
Colon cancer and rectal cancer are collectively known as colorectal cancer, including cancer growths in the colon, rectum and appendix. Colorectal cancer is the third leading cause of cancer death and the fourth most common cancer in both men and women worldwide (WHO (February 2009). "Cancer". World Health Organization). The risk factors for developing colorectal cancer include family history of colorectal cancer, age, dietary factors, obesity, and smoking.
The most common colorectal cancer cell type is adenocarcinoma, which accounts for 95% of cases. Other types include lymphoma and squamous cell carcinoma. Colorectal cancer stage depends on the extent of local invasion, the degree of lymph node involvement, and whether there is distant metastasis. The TNM system is one of the most common methods used for colorectal cancer staging. Treatment options are dependent on the size of tumor, location, physical condition of patient, and stage of cancer. Treatments can include: surgery, radiation therapy, chemotherapy, immunotherapy, and recently, targeted therapy such as Bevacizumab, a VEGF (vascular endothelial growth factor) inhibitor, is approved for use in the treatment of colorectal cancer.
39 When colorectal cancer is caught at early stages, it can be cured. However, when it is detected at later stages it is less likely to be curable. The five-year survival for patients with colorectal cancer is 64% in the United States. Survival rate for early stage detection is about 5 times that of late stage cancers. However, only 39% of colorectal cancers are diagnosed at this stage (Global Cancer Facts and Figures 2007 rev2).
Some of the genes that have been shown to be important in the development of colorectal cancer are APC, TP53, MSH2 and MLH1, and K-Ras. The most commonly mutated gene in all colorectal cancer is the APC gene, a tumor suppressor gene that causes colorectal cancer when it is mutated. In carriers of APC inactivating mutations, the risk of colorectal cancer by age 40 is almost 100% (Markowitz and Bertagnolli 2009).
In summary, Cancer is a leading cause of death worldwide. Deaths from cancer worldwide are projected to continue rising. Lung cancer and colorectal cancer are the major types of cancer both in incidence and in mortality. Early stages of these cancers may be curative, but only a small member of patients are diagnosed at this stage. Indeed, many cancer patients are diagnosed at a stage when they have lost the opportunity for cure, and their prognosis remains poor.
Thus, a better understanding of the molecular and cellular events involved in tumorigenesis and cancer progression could help for prevention, detection, early diagnosis, and treatment of these cancers. But unfortunately, the molecular pathways that govern cancer initiation and progression are only poorly understood. It still requires continued basic and clinical research.
3. Background of this study
Lung cancer is the leading cause of cancer death worldwide. The most successful treatment remains surgery, but even early detected cancers have a recurrence rate of 40%. Chemotherapy has reached a plateau, and molecularly targeted therapy, aimed mainly at EGFR and VEGF pathways, are efficient only transiently before they encounter resistance.
40 Insights into the etiology of lung cancer and its progression are urgently needed. Recently, many groups have addressed the mechanisms that drive lung cancer by comparing tumor with healthy tissue protein, RNA, and microRNA (Bishop et al. ; Kohno et al. ; Goto et al. 2009; Han et al. 2009). TP53 is one the most frequently deleted or mutated genes in lung cancer, and components of the p53-ARF pathway are consistently deleted, mutated, or epigenetically modified (Bastide et al. 2009).
Molecular profiles are emerging with promising utility as predictive and prognostic parameters in NSCLC. These include genes involved in nucleotide metabolism and DNA damage repair, such as ERCC1, RRM1, and BRCA1 (Bartolucci et al. 2009). The upregulated expression of the breast cancer predisposition gene, BRCA1 (Miki et al. 1994) in NSCLC and its usefulness as a prognostic and predictive marker for response to treatment (Rosell et al. 2007; Reguart et al. 2008), was a surprising finding.
However, this falls in line with the accumulating evidence for a gender-specific susceptibility for lung cancer development, as female smokers and non-smokers are more prone to develop lung cancer than males (Planchard et al. 2009). This suggests a hormonal component to susceptibility, consistent with the upregulated expression of the Estrogen Receptors (ER) in lung cancers (Chen et al. 2008).
ERα stability and turnover is at least partially controlled by BRCA1 and its heterodimeric partner, BARD1 (Eakin et al. 2007; Dizin and Irminger-Finger 2010). BRCA1 is a tumor suppressor, whose deficiency is associated with breast cancer. Mutations in BRCA1 confer increased risk for breast cancer development to carriers. Ovarectomy and/or inhibition of estrogen signalling are preventive in BRCA1 mutation carriers, underscoring the function of BRCA1 in controlling estrogen signalling. In addition, BRCA1 expression is partially regulated by estrogen (Gorski et al. 2009). Thus a functional role of BRCA1 in estrogen signalling and proliferation of cancer cells is likely and may explain the increased lung cancer incidence in women.
BRCA1 acts as a tumor suppressor in DNA repair pathways and cell cycle control and is expressed in many proliferating tissues. However, BRCA1 protein stability and function
41 depend on its interaction with BARD1 (BRCA1 associated RING domain protein 1) (Baer and Ludwig 2002; Irminger-Finger and Jefford 2006). The BRCA1-BARD1 heterodimer acts as E3 ubiquitin ligase. Ubiquitination and the control of stability of key target proteins underlie the mechanism behind BRCA1-BARD1’s regulation of DNA repair pathways. BARD1 is also involved in p53-dependent apoptosis, which is deficient in most lung cancers. BARD1 stabilizes p53 and promotes its phosphorylation, and expression of BARD1 is required for proper p53 functioning in a pathway of genotoxic stress and apoptosis (Irminger-Finger et al. 2001; Feki et al. 2005). Thus, BARD1 plays a dual role in tumor suppression, as binding partner of BRCA1 and of p53 (Irminger-Finger and Jefford 2006).
Recent data showed that BARD1 is transcriptionally upregulated during mitosis by E2F, and at the protein level by stabilizing phosphorylation by mitotic kinases (Ren et al. 2002; Hayami et al. 2005). Work from our laboratory and others has shown that BARD1 is essential for mitosis (Joukov et al. 2006; Ryser et al. 2009).
In gynecological cancers and in lung cancer, we observed that deletion-bearing isoforms of BARD1 are highly upregulated and aberrantly localized to the cytoplasm (Wu et al. 2006). In breast and ovarian cancers, these isoforms are correlated with poor prognosis (Wu et al. 2006; Li et al. 2007b). Structural analysis of these isoforms in gynecological cancers showed that they lacked the regions for interacting with BRCA1 or inducing apoptosis (Li et al. 2007b; Ryser et al. 2009). Repression of isoforms in cancer cells that lack full length (FL) BARD1 leads to growth arrest, suggesting that the aberrant isoforms acquired oncogenic functions (Li et al. 2007b; Ryser et al. 2009). In particular, two isoforms, BARD1β and BARD1δ displayed dominant negative functions by opposing the E3 ligase activity of the BRCA1-BARD1 heterodimer (Ryser et al. 2009; Dizin and Irminger-Finger 2010).
Since BRCA1 is a prognostic marker in NSCLC and BARD1 acts as the major regulator of BRCA1, in addition to its function in p53-dependent apoptosis, we postulated a role in lung carcinogenesis. We therefore investigated expression of BARD1 and its isoforms in NSCLC to determine whether this may be relevant for lung cancer initiation and progression or
42 correlated with patient prognosis.
Colorectal cancer is the third leading cause of cancer-related death and the fourth most common cancer in both men and women worldwide (WHO (February 2009). "Cancer". World Health Organization). The survival and prognosis of colorectal cancer patients depends on the stage of the tumor at the time of diagnosis. Early stages of colorectal cancer can be curable. Unfortunately, over 57% have regional or distant spread of the disease at the time of diagnosis (Figueredo et al. 2008). Despite significant investment and advances in the management of cancer, the five-year survival is only 15% for advanced stage colorectal cancer patients (Hewitson et al. 2007).
The challenges for colorectal cancer are to understand the molecular basis, and to determine factors that initiate the development, and drive the progression. The molecular events involved in colorectal cancer onset and metastatic progression have only been partially clarified (Rudmik and Magliocco 2005). Recent studies have revealed the potential use of molecular and biochemical markers in colorectal cancer to predict outcome and response to chemotherapy, like MLH1, MSH2, β-Catenin, and p53 (Markowitz and Bertagnolli 2009).
The studies of BRCA1 in colorectal cancer are mainly limited in colorectal cancer risk and BRCA1 mutations. Several studies attempted to correlate BRCA1 mutations and colorectal cancer risk. Early studies indicated that BRCA1 may play an important role in colon cancer development, since 49% of colonic adenocarcinoma presented loss of heterozygosity in the region including BRCA1 on 17q (Garcia-Patino et al. 1998). Two large studies estimated the risk of any other than breast and ovarian cancers in BRCA1 mutation carriers. Elevated risk for colorectal cancer was found for BRCA1 mutation carriers, as compared to the general population (Brose et al. 2002; Thompson and Easton 2002). However, case-control studies did not confirm this observation. They found no correlation between BRCA1 mutation carriers and colorectal cancer risk (Lin et al. 1999; Kirchhoff et al. 2004; Niell et al. 2004). Interestingly, one of these studies determined that women and men with BRCA1
43 and BRCA2 mutations were not any more likely to get colon cancer than people without these gene mutations. But, those BRCA1 and BRCA2 mutations carriers who developed colorectal cancer, got it about five years earlier than the non-mutation carriers, and had better survival rates (Lin et al. 1999).
A more recent study indicated a 2.5-fold increased risk of any other than breast and ovarian cancers in BRCA1/2 mutation carriers, and especially, a three-fold increase in colon cancer in BRCA1 but not in BRCA2 mutation carriers (Kadouri et al. 2007). Thus, the correlation of BRCA1 mutation and colorectal cancer risk is inconclusive. Based on the current limited available evidence, BRCA1/2 mutation carriers should be regarded as at high risk for colorectal cancer (Mohamad and Apffelstaedt 2008; Russo et al. 2009).
The specific role of BRCA1 expression in colorectal cancer is unclear. One study showed that BRCA1 mRNA expression level was higher in the right colon than in the left colon, and BRCA1’s role in the mechanisms of colorectal carcinogenesis might differ according to tumor site (Le Corre et al. 2005). The relationship between BRCA1 expression and clinicopathological variables has not been reported.
BARD1 was not investigated in colorectal cancer. Preclinical studies showed BARD1 expression in a rat colon adenocarcinoma cell line (PROb) and a human colon carcinoma cell line (SW48) (Gautier et al. 2000). Moreover, both BRCA1 and BARD1 were shown to interact with hMSH2 (Wang et al. 2001), a gene commonly associated with hereditary nonpolyposis colorectal cancer (HNPCC) and mutations of hMSH2 appear to account for approximately 30-40% of HNPCC (Lynch et al. 1997). Defects in the BRCA1-hMSH2 signaling process lead to increased susceptibility to tumorigenesis (Wang et al. 2001). These interactions may, in partial, explain the high incidence of gynecological tumors in HNPCC kindreds, as well as the increased susceptibility to colon cancer in BRCA1 kindreds (Easton et al. 1995; Lynch et al. 1997). Thus, BARD1 may play important roles in colorectal cancer.
BARD1 expression has not been characterized in human colorectal cancer, and its role in colorectal cancer has not been documented.
44 As tumor suppressor genes, BRCA1 and BARD1 have important roles in gynecological cancers, and both of them have somehow linked to colorectal cancer. It was interesting to investigate the role of BARD1 in colorectal cancer.
The aim of this study was to investigate BARD1 mRNA and protein expression levels in a large series of colorectal cancer samples, and to test their correlation with clinicopathological characteristics and patient outcome.
45 Materials and methods
1. Patients characteristics
Pathologic diagnoses were made by experienced pathologists based on WHO criteria and staged according to American Joint Committee on Cancer classification. All patients were informed and compliance was obtained as well as approval of the local ethical committees.
1.1. Non-small cell lung cancer patients
Table 1. Patient characteristics of NSCLC Samples Napoli Cagliari Total Cases 1004060 Gender Male 742054 Female 26206 Age Range 34-77 33-77 33-77 Median 626063 Normal (peri-tumor) 20200 Tumor 1004060 Histology Adenocarcinoma 664026 Squamous Cell Carcinoma 21021 Large Cell Carcinoma 909 Adenosquamous Carcinoma 404 Grade Well-differentiated 12102 Moderately differentiated 321220 Poorly differentiated 441826 Undifferentiated 101 Unspecified 11011 Stage IA 321814 IB 27819
IIA 651 IIB 1239
IIIA 13211 IIIB 514
IV 431 Unknown 101
46 A total of 100 cases of non-small cell lung cancer (NSCLC) comprising 60 cases from Napoli and 40 cases from Cagliari, 20 of these 40 cases including both tumor tissue and their adjacent morphologically normal (peri-tumor) tissue samples, were examined. These 100 patients were composed of 66 cases of adenocarcinoma (including bronchioalveolar carcinoma), 21 cases of squamous cell carcinoma, 9 cases of large cell carcinoma, and 4 cases of adenosquamous carcinoma. The patients were 74 males and 26 females, with age at diagnosis ranging from 33 to 77 years (median age, 62 years). Fifty-nine patients had stage I disease, 18 stage II, 18 stage III, and 4 stage IV; the remaining 1 patient diagnosis was unknown since the regional lymph node involvement could not be assessed. Twelve patients had well differentiated (G1), 32 moderately differentiated (G2), 44 poorly differentiated (G3), and 1 undifferentiated (G4) tumors; the remaining 11 patients were unspecified (GX) (Table 1).
Eight cases with benign (non-cancer) lung disease were used as control samples for BARD1 mRNA expression. These samples comprised 5 males and 3 females with ages ranging from 24 to 66 years (median age, 38 years). They were 5 cases of pulmonary emphysema and 3 cases of pulmonary tuberculosis.
Forty-eight of 60 patients from Napoli had follow-up records. Follow-up was from 1 to 69 months. Two patients died during perioperative period, and remaining 10 patients had no survival data. Of these 48 patients with follow-up records, 17 were treated with surgery only, 4 treated with chemotherapy post surgery, 1 treated with chemotherapy and radiotherapy post surgery, 4 treated with chemotherapy and 1 with radiotherapy only, 7 treated with chemotherapy and radiotherapy, and remaining 14 patients without treatment till last follow-up visit or death. Of these 48 patients, 35 were dead, and 13 were still alive during last follow-up period.
Seventeen of 40 patients from Cagliari had follow-up records, follow-up was from 5 to 95 months. Of these 17 patients, 11 patiens were still alive during last follow-up period, 6 patients were dead. Overall survival was calculated from the date of surgery, beginning of chemotherapy or radiotheraphy, or the date of diagnosis for patients without treatment to the last follow-up visit or death.
47
1.2. Colorectal cancer patients
Table 2. Patient characteristics of colorectal cancer Samples Magdeburg Cagliari Total Cases 148 20 168
Gender Male 83 10 93 Female 65 10 75 Age Range 41-97 33-73 33-97 Median 73 60.5 71 Normal (peri-tumor) 0 20 20 Tumor 148 20 168 Histology Adenocarcinoma 148 20 168 Grade Well-differentiated 10 0 10 Moderately differentiated 105 12 117 Poorly differentiated 32 6 38 Undifferentiated 0 0 0 Unspecified 1 2 3 Tumor T1 3 1 4
T2 32 4 36 T3 69 13 82 T4 42 2 44 TX 2 0 2
Node N0 74 7 81 N1 34 7 41 N2 36 6 42 N3 1 0 1 NX 3 0 3 Metastasis M0 101 15 116 M1 44 5 49 MX 3 0 3 Stage I 26 4 30 II 38 3 41 III 35 9 44
IV 44 4 48 UUnknownnknown 5 0 5
A total of 168 cases with colorectal cancer containing 20 cases from Cagliari and 148 cases from Magdeburg were examined (Table 2). Twenty cases from Cagliari including both tumor tissue and their adjacent morphologically normal tissue (peri-tumor) samples were used for reverse-transcriptase PCR detection. One hundred and forty-eight cases with colorectal cancer from Magdeburg were used for immunohistochemistry on tissue arrays.
48 These 168 cases were composed of 106 colon cancers and 62 rectal cancers, they were all adenocarcinomas. The patients were 93 males and 75 females, with age at diagnosis ranging from 33 to 97 years (median age, 71 years). Thirty patients had stage I disease, 41 stage II, 44 stage III, and 48 stage IV; the remaining 5 patients were of unknown stage since the primary tumor or/and the regional lymph nodes or/and distant metastasis could not be assessed. Ten patients had well differentiated (G1), 117 moderately differentiated (G2), and 38 poorly differentiated (G3) tumors; the remaining 3 patients were unspecified (GX).
The sections used for immunochemical staining were tissue microarrays with tetramer for each case. 75 of 148 cases had follow-up records, follow-up was from one to 72 months, and remaining 73 patients had no survival data. Of these 75 patients with follow-up records, 22 were dead, and 53 were still alive during last follow-up period.
2. Mouse model of lung cancer
Lung tumors were chemically induced in BALB/c mice as described before (Redente et al. 2009).
Male mice, 6 – 8 weeks of age, were injected intraperitoneally with 1 mg urethane per g body weight once weekly for seven weeks. Mice were sacrificed after 16, 24 and 32 weeks of treatment. Lung tissues and tumors were dissected and processed for immunochemistry analysis. Tissues from three mice were analyzed for each time point.
3. Immunohistochemistry
3.1. Immunohistostaining
Tissue samples were obtained from sugery and immediately paraffin-fixed according to standard procedures. Formalin-fixed and paraffin-embedded 5 µm tissues sections were de-paraffinized in xylene and re-hydrated through descending ethanol concentrations
(100% alcohol, 95% alcohol, 70% alcohol, dH2O). The sections were boiled for 5 min in a
49 microwave for antigen retrieval, and endogenous peroxidases were blocked. Slides were incubated overnight at 4°C in a humidifying chamber with the first antibody after BSA (bovine serum albumin) blocking of the non-specific epitopes. The primary antibodies BARD1 N19 (sc-7373, Santa Cruz Biotechnology), which recognizes epitopes in exon 1, and BARD1 C20 (sc-7372, Santa Cruz, CA), which recognizes epitopes in exon 11, were used in 8 µg/ml and 10 µg/ml concentrations, respectively. BARD1 PVC, WFS (Irminger-Finger et al. 1998; Li et al. 2007a; Li et al. 2007b), and p8, which recognize epitopes in exons 3, 4, and 11, respectively, were used as a 1:100 dilution of the rabbit antisera. The BRCA1 antibody C20 (sc-642, Santa Cruz Biotechnology), recognizing BRCA1 C-terminal epitopes, was used in a 2 µg/ml concentration and the Aurora B antibody also known as AIM-1 (BD Biosciences) in a 10 µg/ml concentration. Secondary antibodies (goat anti-rabbit, rabbit anti-goat, or rabbit anti-mouse) conjugated with horse radish peroxidase (HRP) were applied in 1:100 dilutions at room temperature for 1 hour. Then diaminobenzidine (DAB) staining was permitted for maximum 15 minutes at room temperature. Slides were counter-stained with hematoxylin before de-hydration and mounting. To ascertain sensitivity and specificity, immunohistochemistry was performed omitting the primary antibodies on control sections.
3.2. Analysis and semi-quantitation of immunohistochemistry
Expression levels of BARD1 and BRCA1 were measured semi-quantitatively. Staining was scored using intensity and percentage of the stained tumor cells at 100x magnification. The value of the staining intensity and positive cell percentage were multiplied to get the final staining score. The total staining score of each antibody is from 0 to 100, 25 or less staining score is defined as negative staining (“-”), more than 25 is defined as positive staining (“+”), and it was distinguished “+”, “++”, and “+++” according to the total staining score more than 25 to 50, more than 50 to 75, and more than 75. For statistical analysis, only positive versus negative cases were considered, except the correlation of different antibodies staining using staining score. Four different regions were chosen for each tumor section and scored independently by three observers (Y,Z; L,L and J,W) without knowledge of clinical data.
50
4. Reverse transcription and PCR
RT-PCR was performed to qualitatively show expression of different isoforms and to determine their structure. RNA isolation from frozen tissue sections was obtained using Trizol reagent according to the protocol of RNA isolation. Chloroform (0.1 ml) was added, and samples were centrifuged at 14,000 g for 15 min at 4°C to separate the phases. The aqueous phase was transferred to an RNase-free Eppendorf tube, and an equal volume of isopropanol was added for RNA precipitation. RNA pellet was washed with 75 percent ethanol and dissolved in 20 µl RNase-free water. Concentrations were measured to ascertain that D260/D280 ratios were at least 1.8.
For reverse transcription, 1.5 µg of RNA was used in final volume of 25 µl, containing M-MLV RT 5x Reaction Buffer 5 µl, 2 µl of oligo dT (500µg/ml), 1.5 µl of 10 mM dNTP, Recombinant RNasin Ribonuclease Inhibitor 1µl (25 u/µl) and 1 µl of M-MLV Reverse Transcriptase (200 u/µl). The reaction was incubated at 70°C 5 minutes followed by 42°C 60 minutes and 70°C 10 minutes. Three µl of cDNA were used as a template for amplification of FL BARD1, and 2 µl of cDNA were used for amplification of various fragments of BARD1. PCR was performed with Taq polymerase in a final volume of 50 µl. Primary denaturation (94°C, 2 min) and final extension (72°C, 10 min) were the same for all PCR reactions. Annealing temperatures and extension times were variable according to different primers and length of the expected product for BARD1 (Table 3). Estrogen Receptor α (ERα) was amplified using annealing temperature 56°C and extension time 1 min with primers 5’-ACAAGCGCCAGAGAGATGAT-3’ and 5’-GATGTGGGAGAGGATGAGGA-3’. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was amplified as internal control with primers 5’-AGCCACATCGCTCAGACACC-3’ and 5’-GTATCTAGCGCCAGCATCG-3’.
The number of PCR cycles, optimal for non-saturated comparable PCR products, was determined for each pair of primers. This semiquantitative PCR was performed analysing amplicons after 20, 25, 30, 35 and 40 cycles. Thus, for GADPH we applied 25 cycles. For
51 BARD1 primers, 35 cycles proved ideal for simultenous amplification of FL BARD1 and isoforms.
The same volume of PCR product was loaded on agarose/TBE gels (0.8% for FL, 1% for others) containing 0.1µg/ml ethidium bromide (EtBr) for visualization of fragments of BARD1 (20 µl for exon 1-11, 10 µl for exon 1-6, 5 µl for others) under UV light.
Table 3. Primers and conditions for PCR
Forward primer Reverse primer PCR Anealing Extension Start Start product position position Tem (°C) (sec) sequence Sequence (bp) (bp) (bp) (Exon) (Exon)
-28 506 5' GAGGAGCCTTTCATCCGAAG 3' 5’ ATTGCAGGCTGGGTTTGCACTGAAG 3’ 534 56 60 (Ex 1) (Ex 4) -28 1481 5' GAGGAGCCTTTCATCCGAAG 3' 5' TTTTGATACCCGGTGGTGTT 3' 1509 56 90 (Ex 1) (Ex 6)
-28 2252 5' GAGGAGCCTTTCATCCGAAG 3' 5' CGAACCCTCTCTGGGTGATA 3' 2280 56 120 (Ex 1) (Ex11) 438 2252 5' GTTTAGCCCTCGAAGTAAGAAAG 3' 5' CGAACCCTCTCTGGGTGATA 3' 1815 56 120 (Ex 4) (Ex11) 461 2252 5'GTCAGATATGTTGTGAGTAAAGCTTC3' 5' CGAACCCTCTCTGGGTGATA 3' 1792 56 120 (Ex 4) (Ex11) 783 2252 5' AGCAAGTGGCTCCTTGACAG 3' 5' CGAACCCTCTCTGGGTGATA 3' 1470 56 90 (Ex 4) (Ex11) 986 2252 5' CCAGTCCCATTTCTAAGAGATGTAG 3' 5' CGAACCCTCTCTGGGTGATA 3' 1267 56 90 (Ex4) (Ex11) 1280 2252 5' GAGGAGAGACTTTGCTCC 3' 5' CGAACCCTCTCTGGGTGATA 3' 973 56 60 (Ex4) (Ex11)
1378 2252 5' GCTGGATGGACACCATTG 3' 5' CGAACCCTCTCTGGGTGATA 3' 875 56 60 (Ex5) (Ex11)
1441 2252 5' CTCCAGCATAAGGCATTGGT 3' 5' CGAACCCTCTCTGGGTGATA 3' 812 56 60 (Ex 6) (Ex11)
Note: Primers for BARD1 mRNA expression analysis were defined according to the RefSeq NM_000465.2
(http://ncbi.nlm.nih.gov/LocusLink) in which nucleotide 1 is the A of the ATG-translation initiation codon.
5. DNA purification, cloning and sequencing
The QIAquick Gel Extraction Kit (Qiagen, Hombrechtikon, Switzerland) was used for DNA purification. Purified DNA was cloned into pGEM-T Easy vector (Promega, Madison, WI). Ligation and transformation were performed according to the manufacturer’s instructions. The insert to vector ratio was 3:1. Two microliters of the ligation reaction
52 mixed with 25 µl of JM109 High Efficiency Competent Cells in LB medium were plated
onto LB/ampicillin/IPTG/X-Gal plates and incubated at 37℃ overnight.
Recombinant clones could be identified by color screening on indicator plates. We chose 8 white colonies in each plate and incubated in 1 ml LB supplemented with ampicillin at
37℃ overnight. Recombinant plasmid DNA was isolated using the Wizard Plus SV
Miniprep System (Promega, Madison, WI), followed by sequencing with primers T7 and SP6 after validation with restriction enzyme digestion of DNA.
6. Statistical analysis
The Spearman’s correlation coefficient was used to assess the correlation between expression levels of distinct epitopes of BARD1 and BRCA1. The Pearson’s χ2 or Fisher’s exact test were used to compare the percentage of positive cases in tumor tissues versus peri-tumor tissues, and correlation of positive cases of BARD1 expression with clinicopathological variables. Survival differences were estimated using Kaplan–Meier method compared by the log-rank test. Multivariate survival analysis was performed using the Cox proportional hazards model. For all calculations, the tests performed were two-sided, a value of P < 0.05 was considered statistically significant. Analyses were performed using Statistical Package for the Social Sciences (SPSS) for Windows version 15 (SPSS Inc, Chicago, IL).
53 Results
We have previously reported that expression of aberrant forms of BARD1 is upregulated in gynecological cancers (Wu et al. 2006). These isoforms not only correlated with tumor progression and poor prognosis, but encoded essential functions for cancer cell viability by opposing the functions of the BRCA1-BARD1 ubiquitin ligase (Li et al. 2007b; Ryser et al. 2009; Dizin and Irminger-Finger 2010). It was therefore of interest to determine whether such isoforms were expressed in lung cancer and colorectal cancer.
1. Investigation of BARD1 expression in human NSCLC
1.1. All NSCLC samples express BARD1 epitopes
To investigate BARD1 expression in human lung cancer, we performed immunohistochemistry (IHC) on lung tumor sections from 100 patients with NSCLC. These samples comprised adenocarcinomas including bronchioloalveolar carcinoma, squamous and large cell carcinomas, and adenosquamous carcinomas with different grades and stages (Table 1). We used BARD1 antibodies N19, PVC, WFS, and C20 directed against different epitopes of BARD1 encoded on exon 1, exon 3, the 5’end of exon 4, and exon 11, respectively (Fig. 6A-D). For 80 of 100 cases we performed IHC with N19 and C20, for 93 of 100 cases with PVC and WFS.
The positive staining rate for each of the four antibodies was similar in NSCLC. BARD1 N19, PVC, WFS and C20 positive staining were classified in 78.8%, 81.7%, 74.2% and 81.3% of NSCLC cases, respectively (Fig. 6E).
Seventy-three of the 100 cases were probed with all four BARD1 antibodies. Interestingly, all but one of the 73 cases stained with at least one antibody (Fig. 6F). These staining patterns were reproducible among cohorts from the two different centers in experiments performed in two different laboratories.
54
A N19 PVC WFS C20 RING ANK BRCT BRCT
1 2 3 4 5 6 7 8 9 10 11
BRCA1 B BARD1 N19 PVC WFS C20
C BARD1 BRCA1 N19 PVC WFS C20
D BARD1 BRCA1 N19 PVC WFS C20
55
E EpitopesPosi t i ve of st BARD1 ai ni ng and of BRCA1 BARD1 andexpression BRCA1 iin n NSCLC NSCLC 100 81. 7 81. 3 78. 8 74. 2 80 66. 7 60
40
% positive% of cases 20
0 % % of posi ti ve cases N19 PVC WFS C20 BRCA1 ( n=80) ( n=93) ( n=93) ( n=80) ( n=30)
F BARD1 Expression pattern in NSCLC
N19 PVC WFS C20 n=73 + + + + 44 － + + － 9 + － － + 7 － + + + 5 + + － + 4
－ + － － 2 + + + 1 － － － － － 1
Figure 6. BARD1 expression in NSCLC. Immunohistochemistry was performed on 100 NSCLC cases with BARD1 antibodies N19, C20, PVC, WFS, and BRCA1.
A. Schematic presentation of BARD1 exons (1-11) with protein motifs indicated above as RING finger
(RING), ankyrin repeats (ANK), and BRCT domains. Approximate positions of epitopes recognized by the
various antibodies are designated (N19, PVC, WFS, C20).
B-D. Examples of immunohistostaining patterns observed with BARD1 antibodies and BRCA1 antibody.
BARD1 N19 and C20 showed granular staining in cytoplasm and on membranes, and sometimes colocalized
to the same cells or regions. BARD1 PVC and WFS staining was cytoplasmic or diffusely nuclear and
cytoplasmic. BRCA1 staining was granular in both cytoplasm and nucleus (B). Examples of no or little
56 staining with PVC and WFS (C) and negligible staining with N-19 and C20 (D) are shown. Scale bars are indicated (upper panels = 200 µm; lower panels = 100 µm).
E. Frequency of positive staining cases with antibodies for BARD1 and BRCA1 in 100 NSCLC patients.
Percentage of positive cases for each of the four antibodies of BARD1 was similar. BRCA1 positive cases were less frequent.
F. Observed staining of 73 of 100 NSCLC cases probed with all four N19, PVC, WFS, and C20. “+” indicates positive staining, “-” indicates negative staining (see methods). Positive staining with all four antibodies was the most frequent expression pattern.
Staining with antibodies for four different epitopes could theoretically give rise to 16 different staining patterns. However, only 7 different patterns were observed. Staining for all four antibodies was observed in the majority of tumors (60.3%), expression of only the middle epitopes was the second, loss of the middle epitopes was the third, and loss of the N-terminus was the fourth most frequently encountered pattern (Fig. 6F).
To determine whether all epitopes were expressed coordinately, we compared staining on adjacent sections. Different epitopes were expressed in different regions of the sections and in different sub-cellular compartments (Fig. 6B-D), suggesting that different isoforms of BARD1 were expressed within a single tumor. Typically, BARD1-N19 and C20 showed cytoplasmic granular staining and were co-localized to the same cell or to similar regions of a tumor. BARD1 PVC and WFS immunostainings in the cytoplasm were diffuse. The intensity and intracellular localization of staining suggested that expression of all four epitopes did not reflect wild type BARD1, but rather the simultaneous expression of different isoforms.
To investigate this further, we quantified the expression pattern obtained with each antibody and compared the results. Indeed, N19 and C20 staining strongly correlated (r = 0.80; P = 0.000), as it was the case for PVC and WFS (r = 0.65; P = 0.000) (Fig. 7A). Other antibody stainings did not correlate with each other. We therefore concluded that
57
A 100 100 90 r = 0.80 90 r = 0.65 80 80 70 70 60 60 50 50 WFS C20 40 40 30 30 20 20 10 10 0 0 0 20 40 60 80 100 0 20 40 60 80 100 PVC N19
100 100 90 r = 0.34 90 r = 0.22 80 80 70 70 60 60 50 50 WFS PVC 40 40 30 30 20 20 10 10 0 0 0 20 40 60 80 100 0 20 40 60 80 100 N19 N19
100 100 90 r = 0.27 90 r = 0.17 80 80 70 70 60 60 50 50 C20 40 C20 40 30 30 20 20 10 10 0 0 0 20 40 60 80 100 120 0 20 40 60 80 100 PVC WFS
B 100 100 90 90 r = 0.16 r = -0.06 80 80 70 70 60 60 50 50 40 40 BARD1 N19 30 PVC BARD1 30 20 20 10 10 0 0 0 10 20 30 40 50 60 70 80 90 100 0 10 20 30 40 50 60 70 80 90 100 BRCA1 BRCA1
100 100 90 90 80 r = -0.02 80 r = 0.24 70 70 60 60 50 50 40 40 BARD1 C20 BARD1 BARD1 WFS 30 30 20 20 10 10 0 0 0 10 20 30 40 50 60 70 80 90 100 0 10 20 30 40 50 60 70 80 90 100 BRCA1 BRCA1
58 Figure 7. Correlation between distinct antibody staining for BARD1 and BRCA1 in NSCLC.
A. Correlation of BARD1 N19, PVC, WFS, and C20 staining. BARD1 N19 and C20, and PVC and WFS were strongly correlated. Weak or no correlation was observed between N19 and PVC, N19 and WFS, C20 and PVC, C20 and WFS.
B. Correlation of BRCA1 with BARD1 N19, PVC, WFS, and C20 staining. BRCA1 expression was not correlated with expression of any of the four epitopes of BARD1.
N-terminally and C-terminally truncated forms, as well as forms with internal deletions, are expressed in NSCLC. Of particular novelty, the WFS-responsive epitope (at beginning at 5’ end of exon 4) was upregulated in many lung cancers, in strong contrast to the epitope expression pattern observed for ovarian cancer, where WFS staining was rare (Li et al. 2007b).
1.2. Non-coordinate expression of BARD1 and BRCA1
FL BARD1 is required for BRCA1 stability and sub-cellular localization (Fabbro et al. 2002), as well as E3 ubiquitin ligase activity. Since most isoforms lack the RING finger, which is the BRCA1 interaction domain, we compared BRCA1 expression and expression of different BARD1 epitopes in adjacent tissue sections (Fig. 6B-D). We found that BRCA1 expression was not coordinated with any of the BARD1 epitopes (Fig. 7B). Moreover, in 30 cases with both BRCA1 and BARD1 N19 detection, positively staining cases for BRCA1 were 66.7% (20 of 30) and for N19 43.3% (13 of 30). Only 36.7% (11 of 30 cases) that stained positive for BRCA1 were also positive for N19. These findings suggest that all NSCLC express at least two forms of BARD1 that differ from FL BARD1 and do not interact with BRCA1.
1.3. BARD1 isoforms more expressed in tumors than peri-tumors and more elevated in female than male patients
59
A Peri-tumor Tumor
N19 C20 BRCA1 Aurora B N19 C20 p8 BRCA1 Aurora B -- - - +- +++ +++ + + - ++ + +++ +++ - +++ +++ (n) ++ ++ +++ + + + +++ ++ + (n) -- + - + + +++ +++ + -- + - +++-- + + (n) -- - - + + + ++ + Male +- + - +-- - ++ (n) -- ++ - +-- - ++ (n) -- + - + + ++ +++ + -- - - +-- + (n) + (n)
-- - - ++ +++ +++ +++ +++ -- ++ - +++-- + +++ (n) -- - - + ++ +++ +++ +++ + + ++ + + + ++ + + (n) -- ++ + +++ +++ +++ +++ ++ -- +++ - - ++- +++ + (n)
Female ++ ++ +++ - +++ +++ ++ +++ (n) +++ (n) ++- - + + + ++ + + (n) -- - - + ++- +++ + -- - - ++ ++ +++ +++ +
B BARD1 BRCA1 N19 C20 C20 Peri-tumor 20X 20X 20X Tumor
20X 20X 20X
C D BARD1 and BRCA1 expression in peri-tumor BARD1 and BRCA1 expression in tumors and tumor tissues of male and female patients 120 120 P = 0.004 P = 0.025 P = 0.065 P = 0.051 P = 0.640 P = 0.136 100 100
80 80 Peri- Male 60 60 tumor Female 40 Tumor 40 % of pisitive cases %of positive cases 20 20
0 0 N19 C20 BRCA1 N19 C20 BRCA1
60 Figure 8. Comparison of BARD1, BRCA1, and Aurora B expression in paired samples of peri-tumor
and tumor tissues, and of male and female NSCLC patients.
A. Individual comparison of BARD1, BRCA1, and Aurora B expression in 20 tumor tissues (right) and their
respective morphologically normal peri-tumor tissues (left) of 10 male and 10 female NSCLC patients.
BARD1 (N19, C20, and p8), BRCA1, and Aurora B antibodies were used for immunohistochemistry.
N19 and C20 were used in all experiments described in this manuscript. Antibody p8 was generated against a
C-terminal epitope of BARD1, specifically expressed in BARD1 isoforms (Ryser et al., 2009). Aurora B was used for immunohistochemistry, because it was reported to be upregulated in NSCLC (Wang et al., 2009) and it was identified as a target for the BRCA1-BARD1 ubiquitin ligase and is antagonized by BARD1 isoform β
(Ryser et al., 2009). Denotation n = nuclear staining. +, ++ and +++ indicate staining levels as described in
Methods.
B. Example of BARD1 N19, C20, and BRCA1 staining in peri-tumor tissues and tumor tissues of NSCLC.
BARD1 N19, C20, and BRCA1 were strongly stained in tumor tissues, but only few cells stained in peri-tumor tissues.
C. Comparison of BARD1 N19, C20, and BRCA1 staining in peri-tumor and tumor tissues of 20 (10 female
and 10 male) NSCLC patients. Staining for all antibodies was increased in tumor tissues as compared to
peri-tumor tissues.
D. BARD1 N19, BARD1 C20, and BRCA1 staining were tested in tumor tissues of 10 female and 10 male
NSCLC patients. Staining for all antibodies was increased in tumors from female as compared to male
patients.
The P value is obtained by the Fisher’s exact test.
To investigate the difference of BARD1 isoform expression between samples from tumor and peri-tumor tissues, and from males and females, we compared BARD1 and BRCA1 expression in 20 tumor and 20 peri-tumor tissue samples of NSCLC, comprised of 10 male and 10 female age-matched patients. We found BARD1 expression in peri-tumor tissues; but the expression in tumor tissues was significantly more frequent (Fig. 8A-C). The expression was higher in
61 tumors from females than from males (Fig. 8D). These results, although obtained with small numbers of patients, suggest that expression of BARD1 epitopes is increased in tumors versus peri-tumor tissues (P < 0.05) with higher expression in tissues from female than from male patients.
1.4. Correlation of BARD1 protein expression with clinicopathological characteristics and patients prognosis
We analyzed correlation of expression of BARD1 epitopes with respect to prognostic indicators such as tumor grade, tumor size, lymph node involvement, tumor stage and histological type. We compared the frequency of positive cases for all four antibodies.
Tumor types Grade A 120 B 100 P = 0.498 P = 0.010 P = 0.016 P = 0.169 P > 0.05 100 80 80 60 AC 60 G1 non- 40 G2 40 AC G3 % of positive cases positive of % % of positive cases of positive % 20 20 0 0 N19 PVC WFS C20 N19 PVC WFS C20 Tumor C 120 D Node 120 P > 0.05 P > 0.05 100 100 80 80
60 T1 60 N0 T2 40 N1 T3 40 % of positive cases positive of % N2 % of positive cases positive of % 20 20 0 0 N19 PVC WFS C20 N19 PVC WFS C20 Stage Age E 120 F 100 P > 0.05 P > 0.05 100 80
80 60
60 I Younger II 40 40 III Older % of positive casespositive of % casespositive of % 20 20
0 0 N19 PVC WFS C20 N19 PVC WFS C20
62 Figure 9. Correlation of distinct epitopes of BARD1 expression with clinicopathological characteristics in 100 NSCLC cases.
A. Correlation of BARD1 antibody staining with tumor types. Positive staining was more frequent in non-adenocarcinoma (AC) (including squamous cell carcinoma and large cell carcinoma) than in AC.
Increased PVC and WFS staining were statistically significant.
B-F. Correlation of BARD1 antibody staining with tumor grade (Grade) (B), primary tumor (Tumor) (C) and lymph node (Node) (D) status, tumor stage (Stage) (E), and patient age (Age) (F). No correlation was obtained between distinct epitopes of BARD1 expression with tumor grade, primary tumor and lymph node status, tumor stage, and patient age.
The P value is obtained by the Pearson’s χ2 or Fisher’s exact test.
Expression of four epitopes was less frequent in adenocarcinomas than in non-adenocarcinomas (including squamous cell carcinoma and large cell carcinoma). Especially, expression of epitopes recognized by PVC and WFS were significantly correlated with the non-adenocarcinoma histological types (P = 0.010, P = 0.016, respectively) (Fig. 9A). We found no correlation of antibody staining with patient age, tumor grade, primary tumor and lymph node status, and stage (Fig. 9B-F).
To assess the correlation of BARD1 expression with survival, we compared expression of individual BARD1 epitopes and different expression patterns with disease-free survival (DFS) and overall survival (OS) in 65 patients with follow-up data. Comparing expression of individual epitopes of BARD1 with patient survival times, we found that patients with positive staining for BARD1 PVC had significantly shorter DFS (Fig. 10A) and OS (Fig. 10B) than patients with negative staining for PVC. Analogously, patients with positive BARD1 WFS staining had significantly shorter DFS (Fig. 10C) and OS (Fig. 10D) than patients with negative WFS staining. Interestingly, patients showing simultaneous positive staining for PVC and WFS also had shorter survival times (Fig. 10E, F). No correlations were found for N19, C20, or combinations of other staining patterns, with either DFS or OS (Table 4).
63 A PVC with DFS
1.0 “-” P = 0.002 “+” “-”-censored 0.8 “+”-censored
0.6 PVC negative (n=11)
0.4
PVC positive (n=49) Survivalprobability 0.2
0.0
0 20 40 60 80 100 Time (Months)
B PVC with OS
1.0 “-” P = 0.006 “+” “-”-censored PVC negative (n=11) 0.8 “+”-censored
0.6
PVC positive (n=49) 0.4
Survival probability ”-” 0.2 ”+” “-” Censored
0.0 “+” Censored
0 20 40 60 808 0100 Time (Months)
64 C WFS with DFS
1.0 “-” P = 0.002 “+” “-”-censored 0.8 “+”-censored
WFS negative (n=14) 0.6
0.4
WFS positive (n=46)
Survivalprobability 0.2
0.0
0 20 40 60 80 100 Time (Months)
D WFS with OS
1.0 “-” P = 0.038 P = 0.038 “+” “-”-censored 0.8 “+”-censored
WFS negative (n=14) 0.6
0.4 ”-” WFS positive (n=46)
Survivalprobability ”+” 0.2 “-” Censored
“+” Censored 0.0
0 20 40 60 80 100 Time (Months)
65 E PVC and WFS with DFS
1.0 “-” for PVC and/or WFS P = 0.002 “+” for PVC and WFS
“-”-censored 0.8 “+”-censored
PVC and WFS negative (n=15) 0.6
0.4
PVC and WFS positive (n=45) Survivalprobability 0.2
0.0 0 20 40 60 80 100
Time (Months)
F PVC and WFS with OS
1.0 “-” for PVC and/or WFS P = 0.012 “+” for PVC and WFS “-”-censored
0.8 “+”-censored PVC and WFS negative (n=15)
0.6
PVC and WFS positive (n=45) 0.4
Survivalprobability 0.2
0.0
0 20 40 60 80 100
Time (Months)
Figure 10. Correlation of BARD1 expression with patient survival.
A/B. Kaplan-Meier curves of disease-free survival (DFS) and overall survival (OS) depending on
PVC positive or negative staining. Patients with positive PVC staining had significantly shorter
66 DFS (A) and OS (B) times than those with negative staining.
C/D. Kaplan-Meier curves of DFS and OS depending on WFS positive or negative staining.
Patients with positive WFS staining had significantly shorter DFS (C) and OS (D) than those with negative staining.
E/F. Kaplan-Meier curves of DFS and OS depending on combined PVC and WFS positive or their other different combinations. Patients with combined PVC and WFS positive staining had significantly shorter DFS (E) and OS (F) than those with either PVC and/or WFS negative staining.
Denotation: “-” negative staining, “+” positive staining. In (E, F), “-” indicates either PVC and/or
WFS negative staining, “+” indicates the simultaneously positive staining for PVC and WFS.
Censored: a patient withdraws from the study before the final outcome was observed. The P value
(log-rank test) for each graph is reported.
Univariate and multivariate analysis using Cox’s proportional hazards model were performed to evaluate whether BARD1 PVC and WFS staining had prognostic significance independently of other prognostic factors. Multivariate analysis included the pathological stage (which showed prediction of DFS and OS in univariate analysis) and two other possible prognostic factors, histological type of tumors and patient gender (Table 4).
Table 4. Univariate analysis of survival in 65 NSCLC patients with follow-up data DFS OS Predictors HR 95% CI P HR 95% CI P N19 pos vs neg 1.08 0.50-2.32 0.849 1.11 0.46-2.67 0.811 PVC pos vs neg 3.84 1.50-9.87 0.005 4.79 1.41-16.2 0.012 WFS pos vs neg 3.39 1.50-7.67 0.003 2.47 1.01-6.00 0.047 C20 pos vs neg 1.26 0.53-2.98 0.602 1.45 0.51-4.12 0.481 N19 and C20 pos vs others 1.08 0.50-2.32 0.849 1.11 0.46-2.67 0.811 PVC and WFS pos vs others 3.22 1.49-6.96 0.003 3.02 1.22-7.46 0.017
4 Abs pos vs others 2.04 1.11-3.77 0.123 1.86 0.91-3.81 0.091
Stage III, IV vs I, II 3.04 1.61-5.72 0.001 3.60 1.85-7.02 0.000
AC vs non-AC 0.72 0.41-1.24 0.232 0.62 0.33-1.14 0.124
Grade 3, 4 vs 1, 2 1.50 0.84-2.66 0.167 1.87 0.96-3.66 0.068
Age (years) ≤ 60 vs > 60 1.06 0.61-1.83 0.837 1.21 00.64-2.28.64-2.28 0.557 Male vs female 1.35 0.65-2.80 0.414 0.89 0.35-2.27 0.804
Note: HR, hazard ratio; 95% CI, 95% confidence interval; P, P – value; pos, positive staining; neg, negative staining. AC, adenocarcinoma; non-AC, including squamous cell carcinoma and large cell carcinoma; others, all other combinations.
67
Multivariate analysis showed that individual PVC or WFS positive staining have significance as independent prognostic factors for DFS, but simultaneous PVC or WFS positive stainings has significance for DFS and OS (Table 5).
Table 5. Multivariate analysis of survival in 65 NSCLC patients with follow-up data DFS OS Predictors HR 95% CI P HR 95% CI P PVC pos vs neg* 2.94 1.09-7.94 0.034 3.36 0.93-12.1 0.064 Stage III, IV vs I, II 2.47 1.26-4.85 0.009 2.96 1.46-6.00 0.003 AC vs non-AC 1.34 0.73-2.48 0.348 1.51 0.76-3.01 0.238 Male vs female 1.42 0.66-3.03 0.367 1.09 0.41-2.90 0.865
WFS pos vs neg* 3.81 1.61-9.04 0.002 2.52 0.98-6.53 0.056 Stage III, IV vs I, II 3.71 1.86-7.41 0.000 3.97 1.94-8.15 0.000 AC vs non-AC 1.14 0.62-2.11 0.668 1.41 0.70-2.85 0.336 Male vs female 1.58 0.74-3.39 0.242 1.26 0.47-3.39 0.645
PVC and WFS pos vs others* 3.50 1.54-7.95 0.003 3.03 1.16-7.94 0.024 Stage III, IV vs I, II 3.56 1.79-7.06 0.000 3.93 1.92-8.04 0.000 AC vs non-AC 1.12 0.60-2.08 0.718 1.31 0.65-2.65 0.449 Male vs female 1.52 0.70-3.26 0.287 1.23 0.46-3.31 0.678
Note: HR, hazard ratio; 95% CI, 95% confidence interval; P, P – value; pos, positive staining; neg, negative staining. AC, adenocarcinoma; non-AC, including squamous cell carcinoma and large cell carcinoma; others, all other combinations. * HR adjusted for all the other predictors in the model (pathology, stage and sex).
1.5. Sequential expression of BARD1 epitopes at different stages of tumorigenesis in a mouse model of lung cancer
To investigate the correlation of BARD1 isoforms with initiation and progression of lung cancer, we monitored BARD1 expression in experimentally induced lung cancer. Multiple injections of urethane into BALB/c mice induce primary lung tumors progressing into adenocarcinomas (Redente et al. 2009). This treatment leads to macroscopic tumors at 16 weeks, they become larger at 24 weeks, and invade into normal adjacent tissue after 32 weeks.
68 A Normal B Tumor PVC WFS C20 PVC WFS C20
wk 16 40x 40x 40x 40x 40x 40x
24 wk 24 40x 40x 40x 40x 40x 40x
wk32 40x 40x 40x 40x 40x 40x
C Normal D Tumor
100 100 80 80 PVC PVC 60 60 WFS WFS 40 40 C20 C20 20 20 % of staining% cells % of staining cells 0 0 16 wk 24 wk 32 wk 16 wk 24 wk 32 wk
Figure 11. Time course of BARD1 isoform expression in an experimental mouse model of induced lung cancer.
A. BARD1 expression in morphologically normal lung tissue (Normal) in urethane treated animals. BARD1 PVC and WFS stainings were detected in some type II pneumocytes (great alveolar cell), but not in type I pneumocytes (squamous alveolar cell) at 16 weeks (wk). All epitopes were expressed in both type II and type I pneumocytes at 24 weeks and 32 weeks, and expression was upregulated from 24 weeks to 32 weeks. C20 staining was inversed to the others: strong staining at 16 weeks, week staining at 24 weeks, and almost negative at 32 weeks.
B. BARD1 expression in tumors. In tumor regions, BARD1 PVC and specifically WFS stainings were increased from 16 to 32 weeks, while C20 staining was decreased from 16 to 32 weeks.
C-D. Expression pattern of time course of BARD1 epitopes in normal (C) and tumor (D) tissues of three mice is summarized. The staining was scored according to percentage of positive cells.
69 We selected normal tissues and tumor regions at all stages and scored the antibody staining (Fig. 11A-D). Consistently, expression of PVC and WFS was weak, and C20 was strong in adjacent normal tissues. This pattern was similar in 16 weeks tumors. However, in 24 week tumors, PVC and WFS expressions increased, in comparison to C20, and were highly upregulated in 32 week tumors. These experiments demonstrate that the BARD1 expression pattern changes during different stages of tumorigenesis and suggest that BARD1 epitopes mapping to exons 3 and 4 may be involved in tumor promotion and progression towards an invasive stage.
1.6. Structure of BARD1 isoforms expressed in NSCLC
To determine the structure of different isoforms expressed in NSCLC, we performed RT-PCR with primers that amplify the entire BARD1 coding region on samples from 20 female and male patients. RNA was extracted from frozen tissue sections. Additional 8 samples obtained from individuals with benign lung disease were used as control tissues.
A Control B Male Female bp M 1 2 3 4 5 6 7 8 bp M 13N 13T 14N 14T M 3N 3T 4N 4T
2500 2000 2500 FL FL 1500 2000 β β γ 1500 γ γ 1000 φ δ 800 δ 1000 φ δ Ex 1-11 Ex 1-11 Ex 800 ε ε 600 η η 600 η 600 GAPDH FL FL 400 κ κ 200 β
Ex 1-4 Ex β
GAPDH GAPDH
C Male Female bp M 16N 16T 18N 18T M 8N 8T 9N 9T
2000 FL FL κ 1500 κ β β Ex 1-6 Ex π π 1000
GAPDH GAPDH D Male Female bp M 15N 15T 17N 17T M 9N 9T 10N 10T
1000 750 ER-ααα ER-ααα 500
GAPDH GAPDH
70 MWaa E RING NLS NLS NLS ANK BRCT NLS BRCT
FL 1 2 3 4 5 6 7 8 9 10 11 87 kD777
-28 bp 534 bp 1509 bp 2280 bp ATG
κκκ 1 2 4 5 6 7 8 9 10 11 70 kD633 215 bp 365 bp del149bp A1009T G1207C (K312N) (R378S) 1144del21bp A1291G (del7aa) ((Q406R)Q406R)
π 1 2 3 4 5 6 7 8 9 10 11 7241 kD641 kD6 del408bp 136 aa 906 bp 1315 bp 302 aa 439 aa
βββ 1 4 5 6 7 8 9 10 11 75 kD680
γγγ 1 2 3 5 6 7 8 9 10 11 39 kD345
ϕϕϕ 1 2 7 8 9 10 11 37 kD326 δδδ 1 7 8 9 10 11 35 kD307 εεε 1 2 3 10 11 ηηη 30 kD264 1 10 11 28 kD167
Figure 12. Expression and structure of BARD1 transcripts in human lung tumor (T) and peri-tumor (N) tissues.
A-D. RT-PCR was performed with primers amplifying the entire BARD1 coding region or regions comprising exons 1- 4, or 1- 6. GAPDH was amplified as control. Molecular size markers (M) are shown on the left. Presumed FL BARD1 and differentially spliced isoforms are indicated on the right.
A. BARD1 RNA expression in normal lung tissue. RT-PCR performed on lung biopsies of individuals with benign lung diseases (see methods section) shows absence of BARD1 expression in three samples and amplification of individual isoforms (γ, δ, η) in 5 cases of 8.
B. Amplification of FL BARD1 and/or truncated isoforms using forward primer in exon 1, and reverse primer in exon 11 or exon 4. Examples of pairs of normal peri-tumor and tumor tissue are shown for tissues from male and female patients. Presumed FL BARD1 and differentially spliced isoforms are indicated on the right. Peri-tumor and tumor tissues expressed the same pattern of isoforms. Novel isoform κ is indicated.
C. Amplification of exons 1 to 6 was performed to distinguish FL BARD1, isoform β, and novel
71 isoforms κ and π. Isoform π was specifically expressed in tumors, but not or weakly in peri-tumors.
D. Expression of Estrogen Receptor α (ERα), determined by RT-PCR, was found in most cases.
Similar expression levels were found in peri-tumor and tumor, in male and female samples.
E. Structure of known BARD1 isoforms and lung cancer specific novel isoforms κ and π.
Schematic exon (1 to 11) structure of FL BARD1 and protein features (RING, ANK, BRCT), nuclear localization signals (NLS), and positions of primers are indicated.
Schematic presumed protein structures of isoforms are shown below in green, noncoding exons in white, and alternative open reading frames (β, γ and η) in yellow with green points. Novel isoform
κ is shown with deletion of exon 3 and presumed translation start (ATG) within exon 4. Novel isoform π is designed with deletion of 408 bp at the end of exon 4, and known BARD1 mutations and polymorphisms that map within this region are indicated. Designated names of isoforms are shown on the left, size (amino acids) and molecular weights (MW) on the right side.
PCR reactions were optimized to permit qualitative comparison of BARD1 expression patterns in tumor and peri-tumor tissues from different patients (see Matherial and Methods). In most cases, the expression pattern composed of FL and isoforms of BARD1 was identical in peri-tumor tissues and in tumor tissues (Fig. 12B).
To distinguish isoforms of similar molecular weight, we performed RT-PCR with primers amplifying the region comprising exons 1 to 4. We found, in addition to FL BARD1 expression, the previously reported isoform β, but not α, which lacks exon 2 (Li et al. 2007a; Li et al. 2007b). Additionally, we identified a new isoform with a deletion of exon 3, denoted κ (Fig. 12B). Isoform κ was similarly expressed in peri-tumor and tumor tissues. Isoform α can lead to in-frame translation of exon 1 into exon 3 resulting in a protein missing most of the RING finger. In contrast, translation of exon 2 into exon 4, as in isoform κ, is not in-frame, and initiation of translation may be initiated within exon 4 (Fig. 12E). The resulting protein product would be similar in antibody reactivity to isoform β.
In addition to the isoforms described above, we identified a new isoform carrying a
72 deletion of 408 bp, encoding amino acids 301 to 436, at the end of exon 4, which we termed π. Isoform π could be translated into a protein comprising the RING structure (Fig. 12C, E). The resulting protein is consistent with expression of epitopes within exons 3 (detected by PVC) and 4 (detected by WFS). RT-PCR analysis showed that the second half of exon 4 was variable and presumably deleted in many tumors (Fig. 13). Isoform π was absent or only weakly expressed in peri-tumor tissues, but elevated in tumors, which was not the case for any other form of BARD1; these were expressed in peri-tumor tissue, and expression was not or weakly increased in tumors (Fig. 12B, C).
A B Male Female Ex11 M 11N 11T 13N 13T 16N 16T 19N 19T 7N 7T 9N 9T 6N 6T 8N 8T
438 （（（1815））） 2252 Ex 4
461 （（（1792) 2252 Ex 4
783 （（（1470））） 2252 Ex 4
986 （（（1267））） 2252 Ex 4
1280 （（（973））） 2252 Ex 4
1378 （（（875））） 2252 Ex 5
1441（（（812））） 2252 Ex 6
GAPDH
Figure 13. Alternative splicing and/or transcription initiation within exon 4.
A. Diagram of fragments of BARD1 presumably amplified with forward primers within exon (Ex) 4, exon 5, and exon 6 (positions indicated on the left), and reverse primer in exon 11 (position indicated on the right). Expected size (bp) of amplified bands is marked in parentheses.
B. Amplification of BARD1 transcripts in human lung tumor tissues (T) and adjacent normal peri-tumor tissues (N) of male (left panel) and female (right panel) NSCLC patients with primers indicated in A. Note that amplification with primers within exon 4 is variable in different samples, but all samples can be amplified with primers in exon 5 or exon 6. Variations in BARD1 mRNA and protein expression might be due to alternatively spliced or differential initiation of transcription
73 in this region.
Although the complexity of BARD1 expression pattern makes it difficult to quantify the expression of individual isoforms, these experiments demonstrate at least qualitatively that FL BARD1 and spliced isoforms were expressed in tumor and peri-tumor tissue, suggesting that these isoforms might contribute to tumor initiation and progression. However, isoform π is specifically expressed in tumors and might be involved in oncogenic progression.
74 2. Investigation of BARD1 expression in colorectal cancer
2.1. BARD1 protein level expressed in colorectal cancer samples
To investage BARD1 expression in colorectal cancer, we performed IHC on tumor sections from 148 paraffin-embeded tissue samples of colorectal cancer presented as tissue microarray with tetramerous for each of the cases (Table 2). 145 cases were eligible for analysis after IHC assay, and they were analyzed in this study. We used four antibodies (N19, PVC, WFS, and C20) against different regions of BARD1 (exon 1, exon 3, exon 4, and exon 11, respectively) to distinguish different BARD1 epitopes on adjacent tissue sections (Fig. 6A). We also investigated BRCA1 expression using BRCA1 C20 antibody against a C-terminal epitope of BRCA1.
The positive staining for each of the four antibodies was variable in colorectal cancer (Fig. 14A). BARD1 N19, PVC, WFS, and C20 staining were classified as positive in 36 (24.8%), 122 (84.1%), 129 (89%), and 61 (42.1%) cases of colorectal cancer, respectively. 142 cases were observed with at least one antibody positive staining, and no expression of BARD1 was found in only three cases (Fig. 14B). In other words, 97.9% (142 of 145) of colorectal cancer cases expressed at least one epitope of BARD1.
Although in principle 16 different combinations for expressing of the 4 epitopes are possible, we found three major combinations of positively staining BARD1 epitopes (Fig. 14B-F). These three BARD1 expression patterns in colorectal cancer included: expression of only the middle epitopes (Fig. 14B, D) was the most frequent (38.6%) expression pattern, staining for all four antibodies (Fig. 14B, C, E) was the second (18.6%), and loss of the N-terminal epitope (Fig. 14B, F) was the third (17.9%) most frequently observed expression pattern.
To determine whether BARD1 epitopes were expressed coordinately, we compared staining on adjacent sections. Like BARD1 expression in NSCLC tissues, it was found that all four antibodies stained the cytoplasm but in different regions. BARD1 N19 and C20 showed granular staining, while PVC and WFS showed diffuse staining, and they were colocalized to the same cells or same regions, respectively (Fig. 14C-F).
75
A Positive staining of BARD1 and BRCA1 in CRC 100 89.0 84.1 80
60 42.1 40 24.8 22.1 20 % of positive cases 0 N19 PVC WFS C20 BRCA1
B BARD1 Expression pattern in CRC n=145 N19 PVC WFS C20 56 - + + - 27 + + + + 26 - + + + 12 - - + - 6 - + - - 4 - - + + 3 + + - - 2 + - + + 1 - + - + 1 - + - - 1 + - - - 1 + - + - 1 + + - + 1 + + + - 3 - - - -
C BARD1 BRCA1 N19 PVC WFS C20
76
D BARD1 BRCA1 N19 PVC WFS C20
E BARD1 BRCA1 N19 PVC WFS C20
77
F BARD1 BRCA1 N19 PVC WFS C20
Figure 14. Immunohistochemistry of BARD1 and BRCA1 expression in colorectal cancer. Immunohistochemistry was performed on samples of 148 colorectal cancer cases with BARD1 antibodies N19, C20, PVC, WFS, and BRCA1. All samples were presented as tissue microarray with tetramerous for each of the cases. One hundred and forty-five samples were eligible for analysis after immunohistochemistry assay.
A. Frequency of positive staining cases with antibodies for BARD1 and BRCA1. Positive staining rates for each of the four antibodies were variable. BARD1 N19 and C20 stainings were less frequent, as well as BRCA1 staining. BARD1 PVC and WFS positive stainings were observed in most of the colorectal cancer cases.
B. BARD1 expression pattern in colorectal cancer. Expression patterns were obtained with four BARD1 antibodies based on positive (+) and negative (-) staining for each of the cases. PVC and WFS positive, but N19 and C20 negative staining was the most frequent expression pattern, “all four antibodies positive” staining was the second, N19 negative while PVC, WFS and C20 positive staining was the third most frequently observed expression pattern.
C-F. Examples of immunohistostaining using BARD1 antibodies and BRCA1 antibody. BARD1 N19 and C20 showed cytoplasmic granular staining, and colocalized to the same cells or regions. BARD1 PVC and WFS staining was diffusely cytoplasmic. BRCA1 staining was granular in both cytoplasm and nucleus. Examples of positive staining with BARD1 antibodies and BRCA1 antibody (C), negligible staining with N-19 and C20 (D), positive staining with all four BARD1 antibodies (E) and negative staining with N19 (F) are shown. Scale bars are shown (upper panels = 200 µm ; lower panels = 50 µm ).
78 To investigate this further, we quantified the expression levels obtained with each antibody of BARD1 and compared the results. Strong correlation was observed between N19 and C20 (r = 0.71; P = 0.000). Other comparisons, such as PVC and WFS (r = 0.39; P = 0.000), PVC and C20 (r = 0.36; P = 0.000), and WFS and C20 (r = 0.27; P = 0.001) showed weak correlations. No correlation was found between N19 and PVC, and N19 and WFS staining (Fig. 15A).
A 100 100 r = 0.71 r = 0.39 80 80 60 60 C20 40 WFS 40
20 20
0 0 0 20 40 60 80 100 0 20 40 60 80 100 N19 PVC
100 100 r = 0.36 r = 0.27 80 80
60 60 C20 C20 40 40
20 20
0 0 0 20 40 60 80 100 0 20 40 60 80 100 PVC WFS
100 100 r = 0.17 r = 0.09 80 80
60 60 PVC 40 WFS 40
20 20
0 0 0 20 40 60 80 100 0 20 40 60 80 100 N19 N19
B 100 100 r = 0.15 r = -0.07 80 80
60 60 BRCA1 BRCA1 40 40
20 20
0 0 0 20 40 60 80 100 0 20 40 60 80 100 PVC N19
100 100 r = 0.28 r = 0.15 80 80
60 60 C20
BRCA1 40 40
20 20
0 0 0 20 40 60 80 100 0 20 40 60 80 100 Figure 15. Correlation WFS between distinct antibody staining for BARD1BRCA1 and BRCA1 in
79 colorectal cancer.
A. Correlation of BARD1 N19, PVC, WFS, and C20 staining.
BARD1 N19 and C20 staining was strongly correlated, PVC and WFS, PVC and C20, and WFS and C20 staining was weakly correlated. No correlation was observed between N19 and PVC, and N19 and WFS.
B. Correlation of antibody staining of BRCA1 and BARD1. BRCA1 staining was not correlated with any staining of the four BARD1 antibodies.
From the correlated and uncorrelated expression level and the intracellular localization of different BARD1 epitopes, we concluded that the N-terminally truncated forms, as well as both N-terminally and C-terminally truncated forms, and internally deleted forms of BARD1, were expressed in colorectal cancer.
2.2. Non-coordinate expression of BARD1 and BRCA1
As aforementioned, BARD1 has an important function for stability and subcellular localization of BRCA1. BARD1 and BRCA1 form a heterodimer via their RING finger domains, which are critical for the proper association of the two proteins. Therefore we also investigated BRCA1 expression in adjacent sections of same samples and compared BRCA1 expression and expression of different BARD1 epitopes. Unlike BARD1, BRCA1 staining showed both cytoplasmic and nuclear granular staining within the same cell (Fig. 14C). BRCA1 positive staining was observed in 22.1% (32 of 145) of colorectal cancer cases, while N19 positive staining was observed in 24.8% (36 of 145) cases. Interestingly, only 7 of 61 cases (11.5%) that were N19 positive were also BRCA1 positive. Moreover, no correlations were found between BRCA1 expression and expression of distinct BARD1 epitopes (Fig. 15B). These results demonstrated that BRCA1 expression was not coordinated with BARD1 in colorectal cancer.
2.3. Correlation of BARD1 protein expression with clinicopathological characteristics and patients prognosis
80 The immunohistochemical analysis of BARD1 N19, PVC, WFS, and C20, and BRCA1 expression and its relation with clinicopathological characteristics was done in the 145 colorectal cancer patients.
Frequency of N19 positive staining was significantly associated with female sex (P = 0.014) (Fig. 16A), this is consistent with the results of increased BARD1 N19 staining in female as compared to male NSCLC (Fig. 8A, D). Expression of different BARD1 epitopes and BRCA1 expression were not correlated with any of the clinicopathological variables, which are tumor grade, primary tumor, lymph node and distant metastasis status, and tumor stage (Fig. 16B-F). In addition, we also analyzed correlation of three major expression patterns of BARD1 with clinicopathological variables. No significant correlation was obtained between different expression patterns and clinicopathological variables (data not shown).
A Gender B Grade 100 100 90 P > 0.05 90 P > 0.05 80 80
4
70 1 70
Male 0 . (n=82) G1
60 0 60 (n=10) 50 = Female 50
P (n=63) G2 40 40 (n=102) 30 30 G3 % of positive cases positive of % % of positive cases positive of % (n=31) 20 20 10 10 0 0 N19 PVC WFS C20 BRCA1 N19 PVC WFS C20 BRCA1
C Tumor D Node 120 100 P > 0.05 90 P > 0.05 100 80 70 80 T1+T2 (n=34) 60 N0 (n=63) 60 T3 50 (n=67) N1 (n=34) T4 40 N2 40 (n=42) 30 (n=35) % of positive casespositive of % % of positive cases positive of % 20 20 10 0 0 N19 PVC WFS C20 BRCA1 N19 PVC WFS C20 BRCA1
E Metastasis F Stage 100 100 90 P > 0.05 90 P > 0.05 80 80 I 70 70 (n=25) II 60 M0 60 (n=37) (n=99) 50 50 III M1 40 40 (n=35) (n=44) 30 30 IV (n=44) % of positive cases positive % of 20 20
10 cases positive % of 10 0 0 N19 PVC WFS C20 BRCA1 N19 PVC WFS C20 BRCA1 Figure 16. Correlation of distinct epitopes of BARD1 and BRCA1 expression with
81 clinicopathological variables in colorectal cancer.
BARD1 N19 positive staining was more frequent in female gender (P = 0.014) (A). No correlation were found between different antibodies of BARD1 and BRCA1 staining and tumor histopathological grade (Grade) (B), tumor size or nearby tissue invasion (Tumor) (C), lymph node involvement (Node) (D), distant metastases (Metastasis) (E) and tumor stage (Stage) (F). The P value is obtained by the Pearson’s χ2 or Fisher’s exact test.
To assess the correlation between BARD1 expression and survival, we compared different BARD1 expression patterns (Fig. 14B) and expression of individual four epitopes of BARD1 and BRCA1 with survival in 75 colorectal cancer cases with follow-up data.
Comparison of patient survival with expression of epitopes of BARD1 and with BRCA1 (Table 6), showed that patients with BARD1 N19 positive staining had higher 1-year, 2-year, and 3-year survival rates, patients with C20 positive staining had higher 1-year and 3-year survival rates, as compared to those with negative staining. No differences were obtained for the comparison of BARD1 PVC and WFS (negative staining cases were not enough for further analysis), and BRCA1 positive and negative staining with survival.
When expression pattern was used as comparison (Table 7), we found the expression pattern of “all four antibodies positive” correlated with higher 1-year, 2-year, and 3-year survival rates as compared to expression patterns of “only the middle epitopes expressed” (detected with PVC and WFS) and all other expression patterns in a group. However, the expression pattern of “only the middle epitopes expressed” was correlated with lower 1-year, 2-year, and 3-year survival rates, as compared to all other expression patterns in a group, as well as compared to “all four antibodies positive” staining pattern. No correlation was found between expression pattern of “loss of the N-terminal epitope” and other expression patterns, including expression pattern of “all four antibodies positive” (with the exception of 1-year survival rate), “only the middle epitopes expressed” pattern, and all the other expression patterns in a group.
82 Table 6. Correlation of distinct epitopes of BARD1 and BRCA1 expression with survival in 75 colorectal cancer patients 1- Year survival 2- Year survival 3- Year survival Abs Expression No.of Median level patients survival (m) % P-Value % P-Value % P-Value
N19 "-“ : "+" 55:20 11:26 47.3:85.0 0.0035 21.8:50.0 0.0178 12.7:40.0 0.009
PVC "-“ : "+" 14:61 14:15 57.1:57.4 0.9873 28.6:29.5 0.9446 21.4:19.7 0.8822
WFS "-“ : "+" 4:71
C20 "-“ : "+" 42:33 9:17 45.2:72.7 0.0169 21.4:39.4 0.0898 11.9:30.3 0.048
BRCA1 "-“ : "+" 60:15 16:12 60.0:46.7 0.3504 31.7:20.0 0.3747 23.3:6.7 0.1489 Note: “-”, negative staining; “+”, positive staining. For WFS, negative staining cases were not enough for further analysis.
Table 7. Correlation of BARD1 expression patterns with survival in 75 colorectal cancer patients 1- Year survival 2- Year survival 3- Year survival No.of Median survival Expression pattern patients (m) % P-Value % P-Value % P-Value
++++ : -++- 17:31 27:9 88.2:41.9 0.0019 52.9:16.1 0.0073 41.2:6.5 0.0032
++++ : -+++ 17:11 27:12 88.2:45.5 0.0144 52.9:18.2 0.0659 41.2:9.1 0.0664
++++ : others 17:58 27:12 88.2:48.3 0.0034 52.9:22.4 0.0151 41.2:13.8 0.0131
-++- : -+++ 31:11 9:12 41.9:45.5 0.839 16.1:18.2 0.875 6.5:9.1 0.7702
-++- : others 31:44 9:16.5 41.9:68.2 0.0236 16.1:38.6 0.035 6.5:29.5 0.0138 -+++ : others 11:64 12:15.5 45.5:59.4 0.3885 18.2:31.3 0.3792 9.1:21.9 0.3274
Note: ++++, four Abs positive staining; -++-, only PVC and WFS positive staining; -+++, only N19 negative staining; others, other than the expression pattern which is compared.
Taken together we concluded that BARD1 expression pattern of all four antibodies positive staining is a positive prognostic factor, as well as expression of N-terminal epitope of BARD1; inversely, only the simultaneous expression of middle two epitopes is a negative prognostic factor, but not expression of their individual epitopes in colorectal cancer.
2.4. Structure of BARD1 isoforms expressed in colorectal cancer
Since BARD1 proteins were aberrantly expressed in colorectal cancer, and expression of these BARD1 isoforms correlated with patient prognosis. It was interesting to investigate the structure of BARD1 isoforms expression in colorectal cancer.
We assessed BARD1 mRNA expression by RT-PCR in 20 tumor and their adjacent
83 peri-tumor tissues, including 10 male and 10 female cases. RNA was extracted from frozen tissue sections. We performed RT-PCR using forward primer in exon 1 and reverse primers in exon 11 and exon 4 to amplify the BARD1 coding regions (exon 1 to exon 11, and exon 1 to exon 4), GAPDH was amplified as control. Together, ERα was also amplified from these series of samples, as was done in NSCLC (Fig. 17A).
A Male Female
bp M 36N 36T 37N 37T 38N 38T 39N 39T 40N 40T M 26N 26T 27N 27T 28N 28T 29N 29T 30N 30T
2500 FL β 2000 π 1500 γ
Ex 1-11 1000 φ 800 δ ε 600 η
600 FL 400 κ
Ex1-4 β 200
GAPDH
B M 36N 36T 37N 37T 38N 38T 39N 39T 40N 40T MCF-7 M 26N 26T 27N 27T 28N 28T 29N 29T 30N 30T MCF-7 1000 800 ERα 600
Figure 17. Expression and structure of BARD1 transcripts in colorectal cancer tissue (T) and normal peri-tumor tissue (N).
A. Amplification of FL BARD1 and/or truncated isoforms using forward primer in exon 1, and reverse primer in exon 11 (Ex 1-11) or exon 4 (Ex 1- 4). As examples, pairs of peri-tumor and tumor tissues of 5 male and 5 female patients are shown. Glyceraldehyde 3-phosphate dehydrogenase
(GAPDH) expression is shown for the same samples as standard. Molecular marker is shown on the left (M). Presumed FL BARD1 and truncated isoforms are indicated on the right. Peri-tumor and tumor tissues expressed different patterns of isoforms: less frequent expression in peri-tumor tissues than tumor tissues. Two novel isoforms, κ and π, also identified in NSCLC, were expressed in colorectal cancer. Denotation: two forms between isoforms γ and ϕ have not been further analyzed.
B. Amplification of estrogen receptor α (ERα) in same samples, MCF-7 was used as positive
84 control (right). No ERα expression was observed in colorectal tissues, neither in peri-tumor nor in tumor samples of males and females.
As described for NSCLC, the PCR conditions were optimized to produce amplicons in the linear range of amplification, which permitted quanlitatively compare FL BARD1 and
BARD1 isoforms, and ERα expression in tumor and peri-tumor tissues and from different patients.
Unlike in NSCLC, BARD1 mRNA expression patterns were quite different in tumor and peri-tumor tissues of the colorectum. We compared the results based on presence or absence of BARD1 expression in each of the peri-tumor or tumor samples. FL BARD1 and isoforms were expressed in most tumor samples (90%, 18 of 20 cases); but in peri-tumor tissues, only 7 of 20 cases (35%) were expressed FL BARD1 or isoforms. This was statistically significant (P < 0.01). These results were similar in males (8/10 vs 4/10, respectively) (P = 0.07) and females (10/10 vs 3/10, respectively) (P < 0.01) (Fig. 18A).
Interestingly, all BARD1 isoforms expressed in NSCLC tissues, including the novel isoform κ, with a deletion of exon 3, and isoform π, with a deletion of 408 bp at the 3’ end of exon 4, were also expressed in colorectal cancer tissues. Importantly, FL BARD1 and all BARD1 isoforms were frequently expressed in tumor tissues, but less or not in peri-tumor tissues (P < 0.05 for all). (Fig. 18B).
2.5. Similar BARD1 expression patterns observed in tissues from males and females
To see the gender difference of BARD1 expression, we also compared FL BARD1 and isoforms expression between males and females in both peri-tumor and tumor samples, based on absence or presence of any of the forms of BARD1. We found frequency of FL BARD1 and of isoforms expression were similar in colorectal tissues from males and females, both in peri-tumor tissues (P > 0.05 for all) (Fig. 18C) and in tumor tissues (P > 0.05 for all) (Fig. 18D).
85
A BARD1 expression in colorectal tissues B Isoform expression in colorectal tissues 120 120 P = 0. 07 P < 0. 01 P < 0. 01 P < 0. 05 100 100 80 80 Normal 60 60 Normal Tumor (n=20) Tumor 40 40
% of positive cases positive of % (n=20) % of positivecases of % 20 20 0 0 Male (n=10) Female (n=10) M+F (n=20) FL β γ φ δ ε η κ π
C D Isoform expression in peritumor tissues Isoform expression in tumor tissues 120 120 P > 0. 05 P > 0. 05 100 100 80 80 Male Male 60 60 (n=10) (n=10) 40 Female 40 Female (n=10) (n=10) % of positive cases positive of % % of positive casespositive % of 20 20
0 0 FL β γ φ δ ε η κ π FL β γ φ δ ε η κ π
Figure 18. Comparison of BARD1 mRNA isoforms expression in tumor (Tumor) and
peri-tumor (Normal) tissues of male and female colorectal cancer patients. Presence or absence
of overall expression of BARD1 and isoforms (A) or individual isoforms (B, C, D) in each pair of
peri-tumor and tumor samples is presented.
A. Comparison of BARD1 expression in peri-tumor and tumor tissues, including in males, females
and in combined samples, based on absence or presence of any of the forms of BARD1. BARD1
expression was more abundant and more frequent in tissues from tumors than peri-tumors (P < 0.01),
both in females (P < 0.01) and in males (P = 0.07).
B. Comparison of FL BARD1 and isoform expression in peri-tumor and tumor tissues. All forms were upregulated in tumors with statistical significance (P < 0.05 for all).
C/D. Comparison of FL BARD1 and isoform expression in colorectal tissues from males and
females. The expression of FL BARD1 and isoforms was similar in tissues from males and females,
both in peri-tumor (C) and in tumor (D) tissues (P > 0.05 for all).
The P value is obtained by the Fisher’s exact test.
86
To investigate any gender difference for ERα expression, we evaluated ERα mRNA expression in colorectal peri-tumor and tumor tissues, and in MCF-7 cells, which were used as positive control. We found no ERα expression in colorectal tissues in any of the samples, including in peri-tumor tissues and tumor tissues, in males and females, while ERα was expressed in MCF-7 cells (Fig. 17B). This result could, at least partially, explain why there was no correlation of BARD1 expression patterns with gender in colorectal tissues.
87 Discussion
We demonstrate that BARD1 isoforms, but not FL BARD1, are expressed in each sample of a 100 NSCLC and a 165 colorectal cancer patient cohort. The expression and localization is not correlated with BRCA1, indicating that the E3 ubiquitin ligase functions of the BRCA1-BARD1 heterodimer (Baer and Ludwig 2002) are jeopardized in both types of cancer. BRCA1 protein stability and localization largely depend on BARD1 (Fabbro et al. 2002). Absence of FL BARD1, causing absence of the tumor suppressor functions of BRCA1-BARD1, leads to genomic instability (Irminger-Finger et al. 1998) and resistance to apoptosis (Irminger-Finger et al. 2001; Feki et al. 2005).
An increasing number of preclinical and clinical studies suggest that BRCA1 mRNA expression is a relevant determinant of chemotherapy sensitivity and that upregulated BRCA1 expression correlates with poor prognosis in NSCLC (Boukovinas et al. 2008). However, BRCA1 protein expression and prognosis do not correlate with outcome and the mechanism behind BRCA1 mRNA correlation with tumor and patient prognostics is not understood. Our data indicate that BRCA1 protein expression and function are reduced in the absence of FL BARD1, thus the observed high BRCA1 mRNA levels might result from a compensatory transcriptional feedback loop, which induces autoregulatory upregulation of BRCA1 mRNA (De Siervi et al.).
The role of BRCA1 in colorectal cancer is linked to colorectal cancer risk. Some studies have shown that BRCA1 mutations increased colorectal cancer risk (Garcia-Patino et al. 1998; Brose et al. 2002; Thompson and Easton 2002; Kadouri et al. 2007), but other reports claimed no link between BRCA1 mutations and colorectal cancer risk (Lin et al. 1999; Kirchhoff et al. 2004; Niell et al. 2004). Thus, the correlation of BRCA1 mutations and colorectal cancer risk is inconclusive to date. However, the expression of BRCA1 in colorectal cancer was not investigated neither on the mRNA nor on the protein level, nor has BARD1 expression been shown before.
In addition to the effect of loss of FL BARD1 in cancer cells, differentially spliced BARD1 isoforms are expressed, which might be drivers of tumorigenesis, as they are associated
88 with poor prognosis of breast and ovarian cancers (Wu et al. 2006; Li et al. 2007b). Further evidence for an oncogenic role has been established for some isoforms, as their suppression leads to cancer cell growth arrest in vitro (Li et al. 2007b; Ryser et al. 2009). Single nucleotide polymorphisms (SNPs) in BARD1 intronic regions are significantly associated with high risk of neuroblastoma (Capasso et al. 2009), supporting the view that aberrant expression of differentially spliced BARD1 isoforms might be a mechanism driving tumorigenesis in neuroblastoma.
As cancer cells need BARD1 or BARD1 isoforms to proliferate (Ryser et al. 2009), BARD1 isoform expression in NSCLC and colorectal cancer is not merely a bystander, but may be a driver of tumorigenesis. Especially isoforms that express epitopes mapping to exons 3 and 4 seem to be correlated with short survival in both NSCLC and colorectal cancer. These epitopes were upregulated in invasive tumors in the mouse lung cancer model. These observations are in line with previous studies showing that isoform expression is required for cancer cell growth and that siRNA depletion of these isoforms leads to growth arrest (Li et al. 2007b; Ryser et al. 2009).
The BARD1 isoforms expressed in NSCLC and colorectal cancer are derived from alternative splicing. Alternative splicing is frequently observed and has been demonstrated for a number of regulatory proteins, including Bcl-x, Cyclin D1, Fibronectin, MDM2, PPARg (Pio and Montuenga 2009) in lung cancer, as well as for survivin, a unique member of the inhibitor of apoptosis protein family, and its differentially spliced isoforms, in colorectal cancer (Li 2005). Some of these spliced isoforms are translated into aberrant protein isoforms with antagonistic functions, as in the case of BARD1. This has been described for two BARD1 spliced variants, BARD1β and BARD1δ, which act antagonistically to FL BARD1 functions on Aurora B and on ERα, respectively (Ryser et al. 2009; Dizin and Irminger-Finger 2010).
Evidence is accumulating that estrogen is a risk factor for lung cancer susceptibility. ERα is a target for the BRCA1-BARD1 ubiquitin ligase (Eakin et al. 2007; Dizin and Irminger-Finger 2010). BARD1 isoform δ, which is overexpressed in breast and ovarian cancers binds and stabilizes ERα, opposing the function of the BRCA1-BARD1
89 heterodimer (Dizin and Irminger-Finger 2010). All lung tumor samples and peri-tumor tissue samples express ERα and isoform δ, suggesting that BARD1 isoforms might be involved in estrogen signaling in lung cancer. Another isoform, BARD1η, which is specifically upregulated in tumors from female patients, has not been associated with invasiveness of human cytotrophoblastic cells after hCG treatment (Li et al. 2007a).
Unlike NSCLC, epidemiological studies found that combined hormone (estrogen and progestin) replacement therapy (HRT) reduced the risk of colorectal cancer by about 40% (Chlebowski et al. 2004), which indicated that estrogen might act as protective factor for colorectal cancer susceptibility. However, there was no ERα mRNA expression in the series of colorectal cancer cases investigated in this study, and no differences were found between BARD1 isoform expression and gender. These findings support the view that estrogen might not be involved in colorectal cancer carcinogenesis, at least not through ERα.
Interestingly, however, high frequency of N19 positive staining was significantly associated with female sex in colorectal cancer (P = 0.014), and this finding is in line with correlation of a BARD1 N-terminal epitope expression with female sex in NSCLC (the statistical significance was marginal, P = 0.051). Seemingly, in NSCLC, expression levels of BARD1 isoforms γ, ε, and η were higher in females, while isoforms β and κ were higher in males. Isoform ε could potentially be detected by BARD1 N19, but not isoforms β, κ, γ, and η. Although mRNA expression was not detemined quantitatively, we suspect that N19 positive staining might reflect isoform ε expression.
BARD1 isoforms showed a different pattern of expression in tumor tissues versus peri-tumor tissues in NSCLC and colorectal cancer. In NSCLC, all isoforms, with the exception of isoform π, were expressed similar pattern in peritumor and tumor tissues, but less or no expression of any form of BARD1 was observed in control tissues obtained from benign lung disease. On the contrary, in colorectal cancer, BARD1 isoforms were more frequently expressed in tumor tissues, but not or less expressed in peri-tumor tissues. This result might be explained by diverse modulation of alternative splicing according to different cell types, in response to external stimuli or certain pathological conditions (Pajares et al. 2007), and/or the difference of ERα expression between lung and colorectal
90 tissues.
Here we identified two new BARD1 isoforms, κ and π, which have not been described before. Indeed, the pattern of BARD1 isoforms expression was similar in tumor tissues of NSCLC and colorectal cancer, they all expressed two novel isoforms κ and π, which differ from BARD1 isoforms identified in gynecological cancers. This finding indicates that pattern of expression of BARD1 isoform might be different in gynecological cancers and other hormone-independent tumors.
Isoform π seems particularly important for lung cancer, as it is the only isoform that is significantly upregulated in tumor tissue and is absent or only weakly expressed in peri-tumor tissue. Isoform π is derived from a novel splicing mechanism that generates a partial deletion of exon 4, but retains the exons 1- 3 and the beginning of exon 4, thus maintaining the BRCA1-binding RING finger domain. The partial deletion of exon 4 leads to loss of an important NLS on BARD1 (Henderson 2005), which might explain the cytoplasmic localization (Fig. 12E). Aberrant intracellular localization could affect protein modifications, e.g. phosphorylation, and protein-protein interactions. The region deleted in isoform π harbors several cancer-associated mutations, as indicated in Fig. 12E, suppoting this hypothesis.
Simultaneously positive staining for PVC and WFS was significantly correlated with shorter survival in NSCLC and colorectal cancer. Intriguingly, no BARD1 isoforms have been described today that correspond to this pattern of epitope expression: N-terminal and C-terminal truncation. However, positivity of PVC and of WFS could be explained by expression of isoform π, in which N-terminal and/or C-terminal epitopes are masked by protein modification. Positivity of WFS, but not PVC, could be explained with expression of isoform β or κ, both of which are loss of the N-terminal epitope.
In fact, BARD1π expression is consistent with the epitopes recognized by PVC and WFS, a combination of epitopes not found in any other isoform. Indeed, PVC and WFS staining is cytoplasmic. This suggests that isoforms that express these epitopes in exon 3 and at the beginning of exon 4 are involved in mechanisms that dictate tumor progression. Indeed this
91 hypothesis is supported by the BARD1 expression study in the mouse model of lung cancer (Fig. 11) which showed that upregulated expression of PVC and WFS-reactive epitopes was correlated with cancer progression. Thus, expression of PVC and WFS is clearly linked with poor prognosis and with shorter patient survival in both NSCLC and colorectal cancer, and in the mouse lung cancer model.
Strong expression of PVC and WFS reactive epitopes, coupled with weak expression of N-terminal and C-terminal epitopes, might indicate that these epitopes are blocked by steric configuration and/or protein-protein interactions. Posttranscriptional regulation or differential protein stability of FL BARD1 versus BARD1 isoforms might also account for the absence of FL BARD1 on the protein level, while it is present on the mRNA level.
In summary, our data demonstrate that BARD1 isoform expression is common in NSCLC and colorectal cancer. Expression of BARD1 isoforms was significantly associated with prognosis in NSCLC and colorectal cancer, and strongly suggests that BARD1 isoforms are involved in tumorigenesis and progression. Therefore, BARD1 could be a promising prognostic marker, not only to identify individuals with poor prognostic potential for more aggressive treatment, but also point to a new direction for searching effective molecular targeted therapies.
92 Perspectives and goals
BARD1 commands vital cellular functions and is definitely a multifunctional protein that still holds many secrets. Various BARD1 isoforms have been identified in NSCLC and colorectal cancer, and previously in gynecological cancers. The consistency of the results from different primary cancers may allow us to conclude that BARD1 has an important role in determing the behavior of NSCLC and colorectal cancer, and is a promising biomarker. This could be helpful for identification of patients with the highest risk of dying of NSCLC and colorectal cancer after potentially curative surgical treatment, since it is a critical step in selecting patients for subsequent treatment with adjuvant chemotherapy.
In the future, it would be necessary to find new tools, such as BARD1 isoform-specific antibodies, to dissect the precise role for these isoforms in carcinogenesis. And thereafter, BARD1 isoforms could be targets for new strategies for cancer treatment.
Further more, different levels of BRCA1 mRNA expression have been linked to differential sensitivity to different chemotherapeutic drugs (Taron et al. 2004). As the major regulator of BRCA1, BARD1 could play some roles in the relationship with clinical response to chemotherapy, this would be another point for further study.
93 Conclusions
1. Aberrant expression of BARD1 is common in NSCLC and colorectal cancer. 2. BARD1 expression was not coordinated with BRCA1, suggesting that the E3 ubiquitin ligase functions of the BRCA1-BARD1 heterodimer are jeopardized in both NSCLC and colorectal cancer. 3. The non-correlated expression levels and different subcellular localizations of BARD1 epitopes might reflect expression of different isoforms, but not FL BARD1, in NSCLC and colorectal cancer. 4. Structural analysis of BARD1 isoform by RT-PCR validated that various BARD1 isoforms, namely those previously identified in gynecological cancers, and two novel isoforms κ and π, were expressed in NSCLC and colorectal cancer. 5. Similar expression of mRNAs of FL BARD1 and isoforms was found in tumor tissues from NSCLC and colorectal cancer, but neither FL BARD1 nor isoforms were expressed in peri-tumor tissues of colorectal cancer, but they were expressed in peri-tumor tissues of NSCLC, indicating that BARD1 isoform expression is modulated by different cell types or by specific pathological conditions. 6. Estrogen receptor α was expressed in all lung tumor and peri-tumor tissues, but not in colorectal tissues, suggesting that BARD1 isoforms, like in breast cancer, might be involved in estrogen signaling in lung cancer, in line with the presumed involvement of estrogen as risk factor for lung cancer susceptibility. 7. The expression of different BARD1 isoforms or isoform combinations, correlated with patient prognosis in NSCLC and colorectal cancer. In particular the expression of BARD1 reactive epitopes mapping to exon 3 and begin of exon 4, compatible with expression of a novel isoform π, was significantly correlated with poor prognosis in both NSCLC and colorectal cancer, suggesting that this form of BARD1 acquired oncogenic functions in promoting both carcinogenesis and tumor progression. 8. Thus, the expression of BARD1 isoforms in tumor tissues, correlated with patient prognosis, suggests that BARD1 could be a prognostic marker in both NSCLC and colorectal cancers.
94 References
Ardley, H. C. and P. A. Robinson (2005) E3 ubiquitin ligases. Essays Biochem. 41, 15-30. Aviel-Ronen, S., F. H. Blackhall, F. A. Shepherd and M. S. Tsao (2006) K-ras mutations in non-small-cell lung carcinoma: a review. Clin Lung Cancer. 8, 30-8. Ayi, T. C., J. T. Tsan, L. Y. Hwang, A. M. Bowcock and R. Baer (1998) Conservation of function and primary structure in the BRCA1-associated RING domain (BARD1) protein. Oncogene. 17, 2143-8. Baer, R. and T. Ludwig (2002) The BRCA1/BARD1 heterodimer, a tumor suppressor complex with ubiquitin E3 ligase activity. Curr Opin Genet Dev. 12, 86-91. Bartolucci, R., J. Wei, J. J. Sanchez, L. Perez-Roca, I. Chaib, F. Puma, R. Farabi, P. Mendez, F. Roila, T. Okamoto, M. Taron and R. Rosell (2009) XPG mRNA expression levels modulate prognosis in resected non-small-cell lung cancer in conjunction with BRCA1 and ERCC1 expression. Clin Lung Cancer. 10, 47-52. Bastide, K., M. N. Guilly, J. F. Bernaudin, C. Joubert, B. Lectard, C. Levalois, B. Malfoy and S. Chevillard (2009) Molecular analysis of the Ink4a/Rb1-Arf/Tp53 pathways in radon-induced rat lung tumors. Lung Cancer. 63, 348-53. Benezra, M., N. Chevallier, D. J. Morrison, T. K. MacLachlan, W. S. El-Deiry and J. D. Licht (2003) BRCA1 augments transcription by the NF-kappaB transcription factor by binding to the Rel domain of the p65/RelA subunit. J Biol Chem. 278, 26333-41. Bishop, J. A., H. Benjamin, H. Cholakh, A. Chajut, D. P. Clark and W. H. Westra Accurate classification of non-small cell lung carcinoma using a novel microRNA-based approach. Clin Cancer Res. 16, 610-9. Black, D. L. (2003) Mechanisms of alternative pre-messenger RNA splicing. Annu Rev Biochem. 72, 291-336. Boukovinas, I., C. Papadaki, P. Mendez, M. Taron, D. Mavroudis, A. Koutsopoulos, M. Sanchez-Ronco, J. J. Sanchez, M. Trypaki, E. Staphopoulos, V. Georgoulias, R. Rosell and J. Souglakos (2008) Tumor BRCA1, RRM1 and RRM2 mRNA expression levels and clinical response to first-line gemcitabine plus docetaxel in non-small-cell lung cancer patients. PLoS One. 3, e3695. Boulton, S. J., J. S. Martin, J. Polanowska, D. E. Hill, A. Gartner and M. Vidal (2004) BRCA1/BARD1 orthologs required for DNA repair in Caenorhabditis elegans. Curr Biol. 14, 33-9. Brose, M. S., T. R. Rebbeck, K. A. Calzone, J. E. Stopfer, K. L. Nathanson and B. L. Weber (2002) Cancer risk estimates for BRCA1 mutation carriers identified in a risk evaluation program. J Natl Cancer Inst. 94, 1365-72. Brzovic, P. S., J. E. Meza, M. C. King and R. E. Klevit (2001a) BRCA1 RING domain cancer-predisposing mutations. Structural consequences and effects on protein-protein interactions. J Biol Chem. 276, 41399-406. Brzovic, P. S., P. Rajagopal, D. W. Hoyt, M. C. King and R. E. Klevit (2001b) Structure of a BRCA1-BARD1 heterodimeric RING-RING complex. Nature structural biology. 8, 833-7.
95 Caceres, J. F. and A. R. Kornblihtt (2002) Alternative splicing: multiple control mechanisms and involvement in human disease. Trends Genet. 18, 186-93. Caldecott, K. W., J. D. Tucker, L. H. Stanker and L. H. Thompson (1995) Characterization of the XRCC1-DNA ligase III complex in vitro and its absence from mutant hamster cells. Nucleic Acids Res. 23, 4836-43. Capasso, M., M. Devoto, C. Hou, S. Asgharzadeh, J. T. Glessner, E. F. Attiyeh, Y. P. Mosse, C. Kim, S. J. Diskin, K. A. Cole, K. Bosse, M. Diamond, M. Laudenslager, C. Winter, J. P. Bradfield, R. H. Scott, J. Jagannathan, M. Garris, C. McConville, W. B. London, R. C. Seeger, S. F. Grant, H. Li, N. Rahman, E. Rappaport, H. Hakonarson and J. M. Maris (2009) Common variations in BARD1 influence susceptibility to high-risk neuroblastoma. Nat Genet. 41, 718-723. Chen, A., F. E. Kleiman, J. L. Manley, T. Ouchi and Z. Q. Pan (2002) Autoubiquitination of the BRCA1*BARD1 RING ubiquitin ligase. J Biol Chem. 277, 22085-92. Chen, G. G., Q. Zeng and G. M. Tse (2008) Estrogen and its receptors in cancer. Med Res Rev. 28, 954-74. Chiba, N. and J. D. Parvin (2002) The BRCA1 and BARD1 association with the RNA polymerase II holoenzyme. Cancer research. 62, 4222-8. Chlebowski, R. T., J. Wactawski-Wende, C. Ritenbaugh, F. A. Hubbell, J. Ascensao, R. J. Rodabough, C. A. Rosenberg, V. M. Taylor, R. Harris, C. Chen, L. L. Adams-Campbell and E. White (2004) Estrogen plus progestin and colorectal cancer in postmenopausal women. N Engl J Med. 350, 991-1004. Clarke, P. R. and H. S. Sanderson (2006) A mitotic role for BRCA1/BARD1 in tumor suppression? Cell. 127, 453-5. Conneely, O. M., B. M. Jericevic and J. P. Lydon (2003) Progesterone receptors in mammary gland development and tumorigenesis. J Mammary Gland Biol Neoplasia. 8, 205-14. De Brakeleer, S., J. De Greve, R. Loris, N. Janin, W. Lissens, E. Sermijn and E. Teugels (2010) Cancer predisposing missense and protein truncating BARD1 mutations in non-BRCA1 or BRCA2 breast cancer families. Hum Mutat. De Siervi, A., P. De Luca, J. S. Byun, L. J. Di, T. Fufa, C. M. Haggerty, E. Vazquez, C. Moiola, D. L. Longo and K. Gardner Transcriptional autoregulation by BRCA1. Cancer Res. 70, 532-42. Dechend, R., F. Hirano, K. Lehmann, V. Heissmeyer, S. Ansieau, F. G. Wulczyn, C. Scheidereit and A. Leutz (1999) The Bcl-3 oncoprotein acts as a bridging factor between NF-kappaB/Rel and nuclear co-regulators. Oncogene. 18, 3316-23. Deshaies, R. J. and C. A. Joazeiro (2009) RING domain E3 ubiquitin ligases. Annu Rev Biochem. 78, 399-434. Devereux, T. R., J. A. Taylor and J. C. Barrett (1996) Molecular mechanisms of lung cancer. Interaction of environmental and genetic factors. Giles F. Filley Lecture. Chest. 109, 14S-19S. Dizin, E. and I. Irminger-Finger (2010) Negative feedback loop of BRCA1-BARD1 ubiquitin ligase on estrogen receptor alpha stability and activity antagonized by cancer-associated isoform of BARD1. Int J Biochem Cell Biol. Dong, Y., M. A. Hakimi, X. Chen, E. Kumaraswamy, N. S. Cooch, A. K. Godwin and R.
96 Shiekhattar (2003) Regulation of BRCC, a holoenzyme complex containing BRCA1 and BRCA2, by a signalosome-like subunit and its role in DNA repair. Mol Cell. 12, 1087-99. Eakin, C. M., M. J. Maccoss, G. L. Finney and R. E. Klevit (2007) Estrogen receptor alpha is a putative substrate for the BRCA1 ubiquitin ligase. Proc Natl Acad Sci U S A. 104, 5794-9. Easton, D. F., D. Ford and D. T. Bishop (1995) Breast and ovarian cancer incidence in BRCA1-mutation carriers. Breast Cancer Linkage Consortium. Am J Hum Genet. 56, 265-71. Edwards, R. A., M. S. Lee, S. E. Tsutakawa, R. S. Williams, I. Nazeer, F. E. Kleiman, J. A. Tainer and J. N. Glover (2008) The BARD1 C-terminal domain structure and interactions with polyadenylation factor CstF-50. Biochemistry. 47, 11446-56. Fabbro, M., J. A. Rodriguez, R. Baer and B. R. Henderson (2002) BARD1 induces BRCA1 intranuclear foci formation by increasing RING-dependent BRCA1 nuclear import and inhibiting BRCA1 nuclear export. The Journal of biological chemistry. 277, 21315-24. Fackenthal, J. D. and L. A. Godley (2008) Aberrant RNA splicing and its functional consequences in cancer cells. Dis Model Mech. 1, 37-42. Feki, A., C. E. Jefford, P. Berardi, J. Y. Wu, L. Cartier, K. H. Krause and I. Irminger-Finger (2005) BARD1 induces apoptosis by catalysing phosphorylation of p53 by DNA-damage response kinase. Oncogene. 24, 3726-36. Feki, A., C. E. Jefford, P. Durand, J. Harb, H. Lucas, K. H. Krause and I. Irminger-Finger (2004) BARD1 expression during spermatogenesis is associated with apoptosis and hormonally regulated. Biol Reprod. 71, 1614-24. Figueredo, A., M. E. Coombes and S. Mukherjee (2008) Adjuvant therapy for completely resected stage II colon cancer. Cochrane Database Syst Rev, CD005390. Fong, K. M., Y. Sekido, A. F. Gazdar and J. D. Minna (2003) Lung cancer. 9: Molecular biology of lung cancer: clinical implications. Thorax. 58, 892-900. Ganesan, S., D. P. Silver, R. Drapkin, R. Greenberg, J. Feunteun and D. M. Livingston (2004) Association of BRCA1 with the inactive X chromosome and XIST RNA. Philos Trans R Soc Lond B Biol Sci. 359, 123-8. Ganesan, S., D. P. Silver, R. A. Greenberg, D. Avni, R. Drapkin, A. Miron, S. C. Mok, V. Randrianarison, S. Brodie, J. Salstrom, T. P. Rasmussen, A. Klimke, C. Marrese, Y. Marahrens, C. X. Deng, J. Feunteun and D. M. Livingston (2002) BRCA1 supports XIST RNA concentration on the inactive X chromosome. Cell. 111, 393-405. Garcia-Patino, E., B. Gomendio, M. Lleonart, J. M. Silva, J. M. Garcia, M. Provencio, R. Cubedo, P. Espana, S. Ramon y Cajal and F. Bonilla (1998) Loss of heterozygosity in the region including the BRCA1 gene on 17q in colon cancer. Cancer Genet Cytogenet. 104, 119-23. Gautier, F., I. Irminger-Finger, M. Gregoire, K. Meflah and J. Harb (2000) Identification of an apoptotic cleavage product of BARD1 as an autoantigen: a potential factor in the antitumoral response mediated by apoptotic bodies. Cancer research. 60, 6895-900. Ghimenti, C., E. Sensi, S. Presciuttini, I. M. Brunetti, P. Conte, G. Bevilacqua and M. A. Caligo (2002) Germline mutations of the BRCA1-associated ring domain (BARD1)
97 gene in breast and breast/ovarian families negative for BRCA1 and BRCA2 alterations. Genes Chromosomes Cancer. 33, 235-42. Gilmore, T. D. (2006) Introduction to NF-kappaB: players, pathways, perspectives. Oncogene. 25, 6680-4. Glover, J. N., R. S. Williams and M. S. Lee (2004) Interactions between BRCT repeats and phosphoproteins: tangled up in two. Trends in biochemical sciences. 29, 579-85. Gorringe, K. L., D. Y. Choong, J. E. Visvader, G. J. Lindeman and I. G. Campbell (2008) BARD1 variants are not associated with breast cancer risk in Australian familial breast cancer. Breast Cancer Res Treat. 111, 505-9. Gorski, J. J., R. D. Kennedy, A. M. Hosey and D. P. Harkin (2009) The complex relationship between BRCA1 and ERalpha in hereditary breast cancer. Clin Cancer Res. 15, 1514-8. Goto, Y., K. Shinjo, Y. Kondo, L. Shen, M. Toyota, H. Suzuki, W. Gao, B. An, M. Fujii, H. Murakami, H. Osada, T. Taniguchi, N. Usami, M. Kondo, Y. Hasegawa, K. Shimokata, K. Matsuo, T. Hida, N. Fujimoto, T. Kishimoto, J. P. Issa and Y. Sekido (2009) Epigenetic profiles distinguish malignant pleural mesothelioma from lung adenocarcinoma. Cancer Res. 69, 9073-82. Gowen, L. C., B. L. Johnson, A. M. Latour, K. K. Sulik and B. H. Koller (1996) Brca1 deficiency results in early embryonic lethality characterized by neuroepithelial abnormalities. Nat Genet. 12, 191-4. Hakem, R., J. L. de la Pompa, C. Sirard, R. Mo, M. Woo, A. Hakem, A. Wakeham, J. Potter, A. Reitmair, F. Billia, E. Firpo, C. C. Hui, J. Roberts, J. Rossant and T. W. Mak (1996) The tumor suppressor gene Brca1 is required for embryonic cellular proliferation in the mouse. Cell. 85, 1009-23. Han, M. K., Y. H. Oh, J. Kang, Y. P. Kim, S. Seo, J. Kim, K. Park and H. S. Kim (2009) Protein profiling in human sera for identification of potential lung cancer biomarkers using antibody microarray. Proteomics. 9, 5544-52. Han, P., Q. Li and Y. X. Zhu (2008) Mutation of Arabidopsis BARD1 causes meristem defects by failing to confine WUSCHEL expression to the organizing center. Plant Cell. 20, 1482-93. Hashizume, R., M. Fukuda, I. Maeda, H. Nishikawa, D. Oyake, Y. Yabuki, H. Ogata and T. Ohta (2001) The RING heterodimer BRCA1-BARD1 is a ubiquitin ligase inactivated by a breast cancer-derived mutation. J Biol Chem. 276, 14537-40. Hayami, R., K. Sato, W. Wu, T. Nishikawa, J. Hiroi, R. Ohtani-Kaneko, M. Fukuda and T. Ohta (2005) Down-regulation of BRCA1-BARD1 ubiquitin ligase by CDK2. Cancer research. 65, 6-10. He, C., F. Zhou, Z. Zuo, H. Cheng and R. Zhou (2009) A global view of cancer-specific transcript variants by subtractive transcriptome-wide analysis. PLoS One. 4, e4732. Henderson, B. R. (2005) Regulation of BRCA1, BRCA2 and BARD1 intracellular trafficking. Bioessays. 27, 884-93. Herbst, R. S., J. V. Heymach and S. M. Lippman (2008) Lung cancer. N Engl J Med. 359, 1367-80. Hewitson, P., P. Glasziou, L. Irwig, B. Towler and E. Watson (2007) Screening for colorectal cancer using the faecal occult blood test, Hemoccult. Cochrane Database
98 Syst Rev, CD001216. Hsu, L. C. and R. L. White (1998) BRCA1 is associated with the centrosome during mitosis. Proc Natl Acad Sci U S A. 95, 12983-8. Huo, X., Z. Hu, X. Zhai, Y. Wang, S. Wang, X. Wang, J. Qin, W. Chen, G. Jin, J. Liu, J. Gao, Q. Wei and H. Shen (2007) Common non-synonymous polymorphisms in the BRCA1 Associated RING Domain (BARD1) gene are associated with breast cancer susceptibility: a case-control analysis. Breast Cancer Res Treat. 102, 329-37. Huyton, T., P. A. Bates, X. Zhang, M. J. Sternberg and P. S. Freemont (2000) The BRCA1 C-terminal domain: structure and function. Mutation research. 460, 319-32. Irminger-Finger, I. (2009) BARD1, a possible biomarker for breast and ovarian cancer. Gynecol Oncol. Irminger-Finger, I. and C. E. Jefford (2006) Is there more to BARD1 than BRCA1? Nat Rev Cancer. 6, 382-91. Irminger-Finger, I. and W. C. Leung (2002) BRCA1-dependent and independent functions of BARD1. The international journal of biochemistry & cell biology. 34, 582-7. Irminger-Finger, I., W. C. Leung, J. Li, M. Dubois-Dauphin, J. Harb, A. Feki, C. E. Jefford, J. V. Soriano, M. Jaconi, R. Montesano and K. H. Krause (2001) Identification of BARD1 as mediator between proapoptotic stress and p53-dependent apoptosis. Molecular cell. 8, 1255-66. Irminger-Finger, I., J. V. Soriano, G. Vaudan, R. Montesano and A. P. Sappino (1998) In vitro repression of Brca1-associated RING domain gene, Bard1, induces phenotypic changes in mammary epithelial cells. J Cell Biol. 143, 1329-39. Ishitobi, M., Y. Miyoshi, S. Hasegawa, C. Egawa, Y. Tamaki, M. Monden and S. Noguchi (2003) Mutational analysis of BARD1 in familial breast cancer patients in Japan. Cancer Lett. 200, 1-7. Itahana, K., K. P. Bhat, A. Jin, Y. Itahana, D. Hawke, R. Kobayashi and Y. Zhang (2003) Tumor suppressor ARF degrades B23, a nucleolar protein involved in ribosome biogenesis and cell proliferation. Mol Cell. 12, 1151-64. Jakubowska, A., C. Cybulski, A. Szymanska, T. Huzarski, T. Byrski, J. Gronwald, T. Debniak, B. Gorski, E. Kowalska, S. A. Narod and J. Lubinski (2008) BARD1 and breast cancer in Poland. Breast Cancer Res Treat. 107, 119-22. Jasin, M. (2002) Homologous repair of DNA damage and tumorigenesis: the BRCA connection. Oncogene. 21, 8981-93. Jefford, C. E., A. Feki, J. Harb, K. H. Krause and I. Irminger-Finger (2004) Nuclear-cytoplasmic translocation of BARD1 is linked to its apoptotic activity. Oncogene. 23, 3509-20. Jensen, D. E., M. Proctor, S. T. Marquis, H. P. Gardner, S. I. Ha, L. A. Chodosh, A. M. Ishov, N. Tommerup, H. Vissing, Y. Sekido, J. Minna, A. Borodovsky, D. C. Schultz, K. D. Wilkinson, G. G. Maul, N. Barlev, S. L. Berger, G. C. Prendergast and F. J. Rauscher, 3rd (1998) BAP1: a novel ubiquitin hydrolase which binds to the BRCA1 RING finger and enhances BRCA1-mediated cell growth suppression. Oncogene. 16, 1097-112. Jin, Y., X. L. Xu, M. C. Yang, F. Wei, T. C. Ayi, A. M. Bowcock and R. Baer (1997) Cell cycle-dependent colocalization of BARD1 and BRCA1 proteins in discrete nuclear
99 domains. Proceedings of the National Academy of Sciences of the United States of America. 94, 12075-80. Johnatty, S. E., J. Beesley, X. Chen, J. L. Hopper, M. C. Southey, G. G. Giles, D. E. Goldgar, G. Chenevix-Trench and A. B. Spurdle (2009) The BARD1 Cys557Ser polymorphism and breast cancer risk: an Australian case-control and family analysis. Breast Cancer Res Treat. 115, 145-50. Joukov, V., J. Chen, E. A. Fox, J. B. Green and D. M. Livingston (2001) Functional communication between endogenous BRCA1 and its partner, BARD1, during Xenopus laevis development. Proceedings of the National Academy of Sciences of the United States of America. 98, 12078-83. Joukov, V., A. C. Groen, T. Prokhorova, R. Gerson, E. White, A. Rodriguez, J. C. Walter and D. M. Livingston (2006) The BRCA1/BARD1 heterodimer modulates ran-dependent mitotic spindle assembly. Cell. 127, 539-52. Kadouri, L., A. Hubert, Y. Rotenberg, T. Hamburger, M. Sagi, C. Nechushtan, D. Abeliovich and T. Peretz (2007) Cancer risks in carriers of the BRCA1/2 Ashkenazi founder mutations. J Med Genet. 44, 467-71. Karppinen, S. M., R. B. Barkardottir, K. Backenhorn, T. Sydenham, K. Syrjakoski, J. Schleutker, T. Ikonen, K. Pylkas, K. Rapakko, H. Erkko, G. Johannesdottir, A. M. Gerdes, M. Thomassen, B. A. Agnarsson, M. Grip, A. Kallioniemi, J. Kere, L. A. Aaltonen, A. Arason, P. Moller, T. A. Kruse, A. Borg and R. Winqvist (2006) Nordic collaborative study of the BARD1 Cys557Ser allele in 3956 patients with cancer: enrichment in familial BRCA1/BRCA2 mutation-negative breast cancer but not in other malignancies. J Med Genet. 43, 856-62. Karppinen, S. M., K. Heikkinen, K. Rapakko and R. Winqvist (2004) Mutation screening of the BARD1 gene: evidence for involvement of the Cys557Ser allele in hereditary susceptibility to breast cancer. Journal of medical genetics. 41, e114. Kirchhoff, T., J. M. Satagopan, N. D. Kauff, H. Huang, P. Kolachana, C. Palmer, H. Rapaport, K. Nafa, N. A. Ellis and K. Offit (2004) Frequency of BRCA1 and BRCA2 mutations in unselected Ashkenazi Jewish patients with colorectal cancer. J Natl Cancer Inst. 96, 68-70. Kleiman, F. E. and J. L. Manley (1999) Functional interaction of BRCA1-associated BARD1 with polyadenylation factor CstF-50. Science. 285, 1576-9. Kleiman, F. E. and J. L. Manley (2001) The BARD1-CstF-50 interaction links mRNA 3' end formation to DNA damage and tumor suppression. Cell. 104, 743-53. Kleiman, F. E., F. Wu-Baer, D. Fonseca, S. Kaneko, R. Baer and J. L. Manley (2005) BRCA1/BARD1 inhibition of mRNA 3' processing involves targeted degradation of RNA polymerase II. Genes Dev. 19, 1227-37. Kohno, T., A. Otsuka, L. Girard, M. Sato, R. Iwakawa, H. Ogiwara, M. Sanchez-Cespedes, J. D. Minna and J. Yokota A catalog of genes homozygously deleted in human lung cancer and the candidacy of PTPRD as a tumor suppressor gene. Genes Chromosomes Cancer. Lafarge, S. and M. H. Montane (2003) Characterization of Arabidopsis thaliana ortholog of the human breast cancer susceptibility gene 1: AtBRCA1, strongly induced by gamma rays. Nucleic Acids Res. 31, 1148-55.
100 Laufer, M., S. V. Nandula, A. P. Modi, S. Wang, M. Jasin, V. V. Murty, T. Ludwig and R. Baer (2007) Structural requirements for the BARD1 tumor suppressor in chromosomal stability and homology-directed DNA repair. J Biol Chem. 282, 34325-33. Laux, T., K. F. Mayer, J. Berger and G. Jurgens (1996) The WUSCHEL gene is required for shoot and floral meristem integrity in Arabidopsis. Development. 122, 87-96. Le Corre, L., C. Vissac-Sabatier, N. Chalabi, Y. J. Bignon, A. Daver, A. Chassevent and D. J. Bernard-Gallon (2005) Quantitative analysis of BRCA1, BRCA2 and Hmsh2 mRNA expression in colorectal Lieberkuhnien adenocarcinomas and matched normal mucosa: relationship with cellular proliferation. Anticancer Res. 25, 2009-16. Li, F. (2005) Role of survivin and its splice variants in tumorigenesis. Br J Cancer. 92, 212-6. Li, L., M. Cohen, J. Wu, M. H. Sow, B. Nikolic, P. Bischof and I. Irminger-Finger (2007a) Identification of BARD1 splice-isoforms involved in human trophoblast invasion. Int J Biochem Cell Biol. 39, 1659-72. Li, L., S. Ryser, E. Dizin, D. Pils, M. Krainer, C. E. Jefford, F. Bertoni, R. Zeillinger and I. Irminger-Finger (2007b) Oncogenic BARD1 isoforms expressed in gynecological cancers. Cancer Res. 67, 11876-85. Lin, K. M., C. A. Ternent, D. R. Adams, A. G. Thorson, G. J. Blatchford, M. A. Christensen, P. Watson and H. T. Lynch (1999) Colorectal cancer in hereditary breast cancer kindreds. Dis Colon Rectum. 42, 1041-5. Lingle, W. L., S. L. Barrett, V. C. Negron, A. B. D'Assoro, K. Boeneman, W. Liu, C. M. Whitehead, C. Reynolds and J. L. Salisbury (2002) Centrosome amplification drives chromosomal instability in breast tumor development. Proc Natl Acad Sci U S A. 99, 1978-83. Liu, C. Y., A. Flesken-Nikitin, S. Li, Y. Zeng and W. H. Lee (1996) Inactivation of the mouse Brca1 gene leads to failure in the morphogenesis of the egg cylinder in early postimplantation development. Genes Dev. 10, 1835-43. Ljungquist, S., K. Kenne, L. Olsson and M. Sandstrom (1994) Altered DNA ligase III activity in the CHO EM9 mutant. Mutation research. 314, 177-86. Lombardi, G., E. Falaschi, C. Di Cristofano, A. G. Naccarato, E. Sensi, P. Aretini, M. Roncella, G. Bevilacqua and M. A. Caligo (2007) Identification of novel alternatively spliced BRCA1-associated RING domain (BARD1) messenger RNAs in human peripheral blood lymphocytes and in sporadic breast cancer tissues. Genes Chromosomes Cancer. 46, 791-5. Lou, Z., K. Minter-Dykhouse and J. Chen (2005) BRCA1 participates in DNA decatenation. Nat Struct Mol Biol. 12, 589-93. Ludwig, T., D. L. Chapman, V. E. Papaioannou and A. Efstratiadis (1997) Targeted mutations of breast cancer susceptibility gene homologs in mice: lethal phenotypes of Brca1, Brca2, Brca1/Brca2, Brca1/p53, and Brca2/p53 nullizygous embryos. Genes Dev. 11, 1226-41. Lynch, H. T., T. Smyrk and J. Lynch (1997) An update of HNPCC (Lynch syndrome). Cancer Genet Cytogenet. 93, 84-99.
101 Lynch, T. J., D. W. Bell, R. Sordella, S. Gurubhagavatula, R. A. Okimoto, B. W. Brannigan, P. L. Harris, S. M. Haserlat, J. G. Supko, F. G. Haluska, D. N. Louis, D. C. Christiani, J. Settleman and D. A. Haber (2004) Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib. N Engl J Med. 350, 2129-39. Mallery, D. L., C. J. Vandenberg and K. Hiom (2002) Activation of the E3 ligase function of the BRCA1/BARD1 complex by polyubiquitin chains. EMBO J. 21, 6755-62. Markowitz, S. D. and M. M. Bertagnolli (2009) Molecular origins of cancer: Molecular basis of colorectal cancer. N Engl J Med. 361, 2449-60. Matlin, A. J., F. Clark and C. W. Smith (2005) Understanding alternative splicing: towards a cellular code. Nat Rev Mol Cell Biol. 6, 386-98. McCarthy, E. E., J. T. Celebi, R. Baer and T. Ludwig (2003) Loss of Bard1, the heterodimeric partner of the Brca1 tumor suppressor, results in early embryonic lethality and chromosomal instability. Mol Cell Biol. 23, 5056-63. Meza, J. E., P. S. Brzovic, M. C. King and R. E. Klevit (1999) Mapping the functional domains of BRCA1. Interaction of the ring finger domains of BRCA1 and BARD1. The Journal of biological chemistry. 274, 5659-65. Miki, Y., J. Swensen, D. Shattuck-Eidens, P. A. Futreal, K. Harshman, S. Tavtigian, Q. Liu, C. Cochran, L. M. Bennett, W. Ding and et al. (1994) A strong candidate for the breast and ovarian cancer susceptibility gene BRCA1. Science. 266, 66-71. Mohamad, H. B. and J. P. Apffelstaedt (2008) Counseling for male BRCA mutation carriers: a review. Breast. 17, 441-50. Mosavi, L. K., T. J. Cammett, D. C. Desrosiers and Z. Y. Peng (2004) The ankyrin repeat as molecular architecture for protein recognition. Protein Sci. 13, 1435-48. Muller, R., L. Borghi, D. Kwiatkowska, P. Laufs and R. Simon (2006) Dynamic and compensatory responses of Arabidopsis shoot and floral meristems to CLV3 signaling. Plant Cell. 18, 1188-98. Niell, B. L., G. Rennert, J. D. Bonner, R. Almog, L. P. Tomsho and S. B. Gruber (2004) BRCA1 and BRCA2 founder mutations and the risk of colorectal cancer. J Natl Cancer Inst. 96, 15-21. Nishikawa, H., S. Ooka, K. Sato, K. Arima, J. Okamoto, R. E. Klevit, M. Fukuda and T. Ohta (2004) Mass spectrometric and mutational analyses reveal Lys-6-linked polyubiquitin chains catalyzed by BRCA1-BARD1 ubiquitin ligase. J Biol Chem. 279, 3916-24. Nishikawa, H., W. Wu, A. Koike, R. Kojima, H. Gomi, M. Fukuda and T. Ohta (2009) BRCA1-associated protein 1 interferes with BRCA1/BARD1 RING heterodimer activity. Cancer Res. 69, 111-9. Okuda, M., H. F. Horn, P. Tarapore, Y. Tokuyama, A. G. Smulian, P. K. Chan, E. S. Knudsen, I. A. Hofmann, J. D. Snyder, K. E. Bove and K. Fukasawa (2000) Nucleophosmin/B23 is a target of CDK2/cyclin E in centrosome duplication. Cell. 103, 127-40. Paez, J. G., P. A. Janne, J. C. Lee, S. Tracy, H. Greulich, S. Gabriel, P. Herman, F. J. Kaye, N. Lindeman, T. J. Boggon, K. Naoki, H. Sasaki, Y. Fujii, M. J. Eck, W. R. Sellers, B. E. Johnson and M. Meyerson (2004) EGFR mutations in lung cancer: correlation
102 with clinical response to gefitinib therapy. Science. 304, 1497-500. Pajares, M. J., T. Ezponda, R. Catena, A. Calvo, R. Pio and L. M. Montuenga (2007) Alternative splicing: an emerging topic in molecular and clinical oncology. Lancet Oncol. 8, 349-57. Pettigrew, C. A., J. D. French, J. M. Saunus, S. L. Edwards, A. V. Sauer, C. E. Smart, T. Lundstrom, C. Wiesner, A. B. Spurdle, J. A. Rothnagel and M. A. Brown (2010) Identification and functional analysis of novel BRCA1 transcripts, including mouse Brca1-Iris and human pseudo-BRCA1. Breast Cancer Res Treat. 119, 239-47. Pihan, G. A., J. Wallace, Y. Zhou and S. J. Doxsey (2003) Centrosome abnormalities and chromosome instability occur together in pre-invasive carcinomas. Cancer Res. 63, 1398-404. Pio, R. and L. M. Montuenga (2009) Alternative splicing in lung cancer. J Thorac Oncol. 4, 674-8. Planchard, D., Y. Loriot, A. Goubar, F. Commo and J. C. Soria (2009) Differential expression of biomarkers in men and women. Semin Oncol. 36, 553-65. Rahman, N. and M. R. Stratton (1998) The genetics of breast cancer susceptibility. Annu Rev Genet. 32, 95-121. Raz, D. J., J. A. Zell, S. H. Ou, D. R. Gandara, H. Anton-Culver and D. M. Jablons (2007) Natural history of stage I non-small cell lung cancer: implications for early detection. Chest. 132, 193-9. Redente, E. F., L. D. Dwyer-Nield, B. S. Barrett, D. W. Riches and A. M. Malkinson (2009) Lung tumor growth is stimulated in IFN-gamma-/- mice and inhibited in IL-4Ralpha-/- mice. Anticancer Res. 29, 5095-101. Reguart, N., A. F. Cardona, E. Carrasco, P. Gomez, M. Taron and R. Rosell (2008) BRCA1: a new genomic marker for non-small-cell lung cancer. Clin Lung Cancer. 9, 331-9. Ren, B., H. Cam, Y. Takahashi, T. Volkert, J. Terragni, R. A. Young and B. D. Dynlacht (2002) E2F integrates cell cycle progression with DNA repair, replication, and G(2)/M checkpoints. Genes Dev. 16, 245-56. Rodriguez, J. A., S. Schuchner, W. W. Au, M. Fabbro and B. R. Henderson (2004) Nuclear-cytoplasmic shuttling of BARD1 contributes to its proapoptotic activity and is regulated by dimerization with BRCA1. Oncogene. 23, 1809-20. Rosell, R., M. Skrzypski, E. Jassem, M. Taron, R. Bartolucci, J. J. Sanchez, P. Mendez, I. Chaib, L. Perez-Roca, A. Szymanowska, W. Rzyman, F. Puma, G. Kobierska-Gulida, R. Farabi and J. Jassem (2007) BRCA1: a novel prognostic factor in resected non-small-cell lung cancer. PLoS One. 2, e1129. Rudmik, L. R. and A. M. Magliocco (2005) Molecular mechanisms of hepatic metastasis in colorectal cancer. J Surg Oncol. 92, 347-59. Ruffner, H., C. A. Joazeiro, D. Hemmati, T. Hunter and I. M. Verma (2001) Cancer-predisposing mutations within the RING domain of BRCA1: loss of ubiquitin protein ligase activity and protection from radiation hypersensitivity. Proc Natl Acad Sci U S A. 98, 5134-9. Russo, A., V. Calo, L. Bruno, S. Rizzo, V. Bazan and G. Di Fede (2009) Hereditary ovarian cancer. Crit Rev Oncol Hematol. 69, 28-44. Ryser, S., E. Dizin, C. E. Jefford, B. Delaval, S. Gagos, A. Christodoulidou, K. H. Krause,
103 D. Birnbaum and I. Irminger-Finger (2009) Distinct roles of BARD1 isoforms in mitosis: full-length BARD1 mediates Aurora B degradation, cancer-associated BARD1beta scaffolds Aurora B and BRCA2. Cancer Res. 69, 1125-34. Sato, K., R. Hayami, W. Wu, T. Nishikawa, H. Nishikawa, Y. Okuda, H. Ogata, M. Fukuda and T. Ohta (2004) Nucleophosmin/B23 is a candidate substrate for the BRCA1-BARD1 ubiquitin ligase. J Biol Chem. 279, 30919-22. Sauer, M. K. and I. L. Andrulis (2005) Identification and characterization of missense alterations in the BRCA1 associated RING domain (BARD1) gene in breast and ovarian cancer. J Med Genet. 42, 633-8. Schoof, H., M. Lenhard, A. Haecker, K. F. Mayer, G. Jurgens and T. Laux (2000) The stem cell population of Arabidopsis shoot meristems in maintained by a regulatory loop between the CLAVATA and WUSCHEL genes. Cell. 100, 635-44. Schuchner, S., V. Tembe, J. A. Rodriguez and B. R. Henderson (2005) Nuclear targeting and cell cycle regulatory function of human BARD1. The Journal of biological chemistry. 280, 8855-61. Scully, R., J. Chen, R. L. Ochs, K. Keegan, M. Hoekstra, J. Feunteun and D. M. Livingston (1997a) Dynamic changes of BRCA1 subnuclear location and phosphorylation state are initiated by DNA damage. Cell. 90, 425-35. Scully, R., J. Chen, A. Plug, Y. Xiao, D. Weaver, J. Feunteun, T. Ashley and D. M. Livingston (1997b) Association of BRCA1 with Rad51 in mitotic and meiotic cells. Cell. 88, 265-75. Silver, D. P., S. D. Dimitrov, J. Feunteun, R. Gelman, R. Drapkin, S. D. Lu, E. Shestakova, S. Velmurugan, N. Denunzio, S. Dragomir, J. Mar, X. Liu, S. Rottenberg, J. Jonkers, S. Ganesan and D. M. Livingston (2007) Further evidence for BRCA1 communication with the inactive X chromosome. Cell. 128, 991-1002. Simons, A. M., A. A. Horwitz, L. M. Starita, K. Griffin, R. S. Williams, J. N. Glover and J. D. Parvin (2006) BRCA1 DNA-binding activity is stimulated by BARD1. Cancer Res. 66, 2012-8. Skotheim, R. I. and M. Nees (2007) Alternative splicing in cancer: noise, functional, or systematic? Int J Biochem Cell Biol. 39, 1432-49. Stacey, S. N., P. Sulem, O. T. Johannsson, A. Helgason, J. Gudmundsson, J. P. Kostic, K. Kristjansson, T. Jonsdottir, H. Sigurdsson, J. Hrafnkelsson, J. Johannsson, T. Sveinsson, G. Myrdal, H. N. Grimsson, J. T. Bergthorsson, L. T. Amundadottir, J. R. Gulcher, U. Thorsteinsdottir, A. Kong and K. Stefansson (2006) The BARD1 Cys557Ser variant and breast cancer risk in Iceland. PLoS Med. 3, e217. Starita, L. M., A. A. Horwitz, M. C. Keogh, C. Ishioka, J. D. Parvin and N. Chiba (2005) BRCA1/BARD1 ubiquitinate phosphorylated RNA polymerase II. J Biol Chem. 280, 24498-505. Starita, L. M., Y. Machida, S. Sankaran, J. E. Elias, K. Griffin, B. P. Schlegel, S. P. Gygi and J. D. Parvin (2004) BRCA1-dependent ubiquitination of gamma-tubulin regulates centrosome number. Mol Cell Biol. 24, 8457-66. Stark, J. M., A. J. Pierce, J. Oh, A. Pastink and M. Jasin (2004) Genetic steps of mammalian homologous repair with distinct mutagenic consequences. Mol Cell Biol. 24, 9305-16.
104 Sun, P., J. Sehouli, C. Denkert, A. Mustea, D. Konsgen, I. Koch, L. Wei and W. Lichtenegger (2005) Expression of estrogen receptor-related receptors, a subfamily of orphan nuclear receptors, as new tumor biomarkers in ovarian cancer cells. J Mol Med. 83, 457-67. Taron, M., R. Rosell, E. Felip, P. Mendez, J. Souglakos, M. S. Ronco, C. Queralt, J. Majo, J. M. Sanchez, J. J. Sanchez and J. Maestre (2004) BRCA1 mRNA expression levels as an indicator of chemoresistance in lung cancer. Hum Mol Genet. 13, 2443-9. Tembe, V. and B. R. Henderson (2007) BARD1 translocation to mitochondria correlates with Bax oligomerization, loss of mitochondrial membrane potential, and apoptosis. J Biol Chem. 282, 20513-22. Thai, T. H., F. Du, J. T. Tsan, Y. Jin, A. Phung, M. A. Spillman, H. F. Massa, C. Y. Muller, R. Ashfaq, J. M. Mathis, D. S. Miller, B. J. Trask, R. Baer and A. M. Bowcock (1998) Mutations in the BRCA1-associated RING domain (BARD1) gene in primary breast, ovarian and uterine cancers. Human molecular genetics. 7, 195-202. Thakar, A., J. D. Parvin and J. Zlatanova (2010) BRCA1/BARD1 E3 ubiquitin ligase can modify histones H2A and H2B in the nucleosome particle. J Biomol Struct Dyn. 27, 399-406. Thompson, D. and D. F. Easton (2002) Cancer Incidence in BRCA1 mutation carriers. J Natl Cancer Inst. 94, 1358-65. Trauernicht, A. M. and T. G. Boyer (2003) BRCA1 and estrogen signaling in breast cancer. Breast Dis. 18, 11-20. Travis, W. D. (2002) Pathology of lung cancer. Clin Chest Med. 23, 65-81, viii. Travis, W. D., L. B. Travis and S. S. Devesa (1995) Lung cancer. Cancer. 75, 191-202. Tsao, M. S., A. Sakurada, J. C. Cutz, C. Q. Zhu, S. Kamel-Reid, J. Squire, I. Lorimer, T. Zhang, N. Liu, M. Daneshmand, P. Marrano, G. da Cunha Santos, A. Lagarde, F. Richardson, L. Seymour, M. Whitehead, K. Ding, J. Pater and F. A. Shepherd (2005) Erlotinib in lung cancer - molecular and clinical predictors of outcome. N Engl J Med. 353, 133-44. Tsuzuki, M., W. Wu, H. Nishikawa, R. Hayami, D. Oyake, Y. Yabuki, M. Fukuda and T. Ohta (2006) A truncated splice variant of human BARD1 that lacks the RING finger and ankyrin repeats. Cancer Lett. 233, 108-16. Vahteristo, P., K. Syrjakoski, T. Heikkinen, H. Eerola, K. Aittomaki, K. von Smitten, K. Holli, C. Blomqvist, O. P. Kallioniemi and H. Nevanlinna (2006) BARD1 variants Cys557Ser and Val507Met in breast cancer predisposition. Eur J Hum Genet. 14, 167-72. Wang, Q., H. Zhang, S. Guerrette, J. Chen, A. Mazurek, T. Wilson, A. Slupianek, T. Skorski, R. Fishel and M. I. Greene (2001) Adenosine nucleotide modulates the physical interaction between hMSH2 and BRCA1. Oncogene. 20, 4640-9. Williams, R. S. and J. N. Glover (2003) Structural consequences of a cancer-causing BRCA1-BRCT missense mutation. The Journal of biological chemistry. 278, 2630-5. Wooster, R., S. L. Neuhausen, J. Mangion, Y. Quirk, D. Ford, N. Collins, K. Nguyen, S. Seal, T. Tran, D. Averill and et al. (1994) Localization of a breast cancer
105 susceptibility gene, BRCA2, to chromosome 13q12-13. Science. 265, 2088-90. Wu-Baer, F., K. Lagrazon, W. Yuan and R. Baer (2003) The BRCA1/BARD1 heterodimer assembles polyubiquitin chains through an unconventional linkage involving lysine residue K6 of ubiquitin. J Biol Chem. 278, 34743-6. Wu, J. Y., A. T. Vlastos, M. F. Pelte, M. A. Caligo, A. Bianco, K. H. Krause, G. J. Laurent and I. Irminger-Finger (2006) Aberrant expression of BARD1 in breast and ovarian cancers with poor prognosis. International journal of cancer. 118, 1215-26. Wu, L. C., Z. W. Wang, J. T. Tsan, M. A. Spillman, A. Phung, X. L. Xu, M. C. Yang, L. Y. Hwang, A. M. Bowcock and R. Baer (1996) Identification of a RING protein that can interact in vivo with the BRCA1 gene product. Nature genetics. 14, 430-40. Yu, X. and R. Baer (2000) Nuclear localization and cell cycle-specific expression of CtIP, a protein that associates with the BRCA1 tumor suppressor. J Biol Chem. 275, 18541-9. Yu, X., L. C. Wu, A. M. Bowcock, A. Aronheim and R. Baer (1998) The C-terminal (BRCT) domains of BRCA1 interact in vivo with CtIP, a protein implicated in the CtBP pathway of transcriptional repression. J Biol Chem. 273, 25388-92.
106 Appendix 1.
Manuscript submitted to International Journal of Cancer.
BARD1: an independent predictor of survival in non-small cell lung cancer
Yong Qiang Zhang1,2*, Andrea Bianco3*, Alvin M. Malkinson4, Vera Piera Leoni5, Gianni Frau6, Nicolina De Rosa3, Lin Li1#, Renato Versace7, Michel Boulvain8, Geoffrey J. Laurent9, Luigi Atzuri5, Irmgard Irminger-Finger1,2&
1 Molecular Gynecology and Obstetrics Laboratory, Department of Gynecology and Obstetrics, University Hospitals Geneva, Geneva, Switzerland 2 Department of Genetic and Laboratory Medicine, University Hospitals Geneva, Geneva, Switzerland 3 Chair of Respiratory Diseases, Department of Health Sciences, University of Molise, Campobasso, Italy 4 Department of Pharmacological Science, University of Colorado Denver, Aurora, Colorado, USA 5 Department of Toxicology, Oncology and Molecular Pathology Unit, University of Cagliari, Cagliari, Italy 6 Pathology Unit, Binaghi Hospital, ASL 8, Cagliari, Italy 7 Thoracic Surgery Division, Binagli Hospital, ASL 8, Cagliari, Italy 8 Department of Gynecology and Obstetrics, University Hospitals Geneva, Geneva, Switzerland 9 Centre for Respiratory Research, University College London, London, UK
107