An Integrated Data Analysis Approach to Characterize Genes Highly Expressed in Hepatocellular Carcinoma
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Analyses of Allele-Specific Gene Expression in Highly Divergent
ARTICLES Analyses of allele-specific gene expression in highly divergent mouse crosses identifies pervasive allelic imbalance James J Crowley1,10, Vasyl Zhabotynsky1,10, Wei Sun1,2,10, Shunping Huang3, Isa Kemal Pakatci3, Yunjung Kim1, Jeremy R Wang3, Andrew P Morgan1,4,5, John D Calaway1,4,5, David L Aylor1,9, Zaining Yun1, Timothy A Bell1,4,5, Ryan J Buus1,4,5, Mark E Calaway1,4,5, John P Didion1,4,5, Terry J Gooch1,4,5, Stephanie D Hansen1,4,5, Nashiya N Robinson1,4,5, Ginger D Shaw1,4,5, Jason S Spence1, Corey R Quackenbush1, Cordelia J Barrick1, Randal J Nonneman1, Kyungsu Kim2, James Xenakis2, Yuying Xie1, William Valdar1,4, Alan B Lenarcic1, Wei Wang3,9, Catherine E Welsh3, Chen-Ping Fu3, Zhaojun Zhang3, James Holt3, Zhishan Guo3, David W Threadgill6, Lisa M Tarantino7, Darla R Miller1,4,5, Fei Zou2,11, Leonard McMillan3,11, Patrick F Sullivan1,5,7,8,11 & Fernando Pardo-Manuel de Villena1,4,5,11 Complex human traits are influenced by variation in regulatory DNA through mechanisms that are not fully understood. Because regulatory elements are conserved between humans and mice, a thorough annotation of cis regulatory variants in mice could aid in further characterizing these mechanisms. Here we provide a detailed portrait of mouse gene expression across multiple tissues in a three-way diallel. Greater than 80% of mouse genes have cis regulatory variation. Effects from these variants influence complex traits and usually extend to the human ortholog. Further, we estimate that at least one in every thousand SNPs creates a cis regulatory effect. -
Prioritization and Evaluation of Depression Candidate Genes by Combining Multidimensional Data Resources
Prioritization and Evaluation of Depression Candidate Genes by Combining Multidimensional Data Resources Chung-Feng Kao1, Yu-Sheng Fang2, Zhongming Zhao3, Po-Hsiu Kuo1,2,4* 1 Department of Public Health and Institute of Epidemiology and Preventive Medicine, College of Public Health, National Taiwan University, Taipei, Taiwan, 2 Institute of Clinical Medicine, School of Medicine, National Cheng-Kung University, Tainan, Taiwan, 3 Departments of Biomedical Informatics and Psychiatry, Vanderbilt University School of Medicine, Nashville, Tennessee, United States of America, 4 Research Center for Genes, Environment and Human Health, National Taiwan University, Taipei, Taiwan Abstract Background: Large scale and individual genetic studies have suggested numerous susceptible genes for depression in the past decade without conclusive results. There is a strong need to review and integrate multi-dimensional data for follow up validation. The present study aimed to apply prioritization procedures to build-up an evidence-based candidate genes dataset for depression. Methods: Depression candidate genes were collected in human and animal studies across various data resources. Each gene was scored according to its magnitude of evidence related to depression and was multiplied by a source-specific weight to form a combined score measure. All genes were evaluated through a prioritization system to obtain an optimal weight matrix to rank their relative importance with depression using the combined scores. The resulting candidate gene list for depression (DEPgenes) was further evaluated by a genome-wide association (GWA) dataset and microarray gene expression in human tissues. Results: A total of 5,055 candidate genes (4,850 genes from human and 387 genes from animal studies with 182 being overlapped) were included from seven data sources. -
SPATA33 Localizes Calcineurin to the Mitochondria and Regulates Sperm Motility in Mice
SPATA33 localizes calcineurin to the mitochondria and regulates sperm motility in mice Haruhiko Miyataa, Seiya Ouraa,b, Akane Morohoshia,c, Keisuke Shimadaa, Daisuke Mashikoa,1, Yuki Oyamaa,b, Yuki Kanedaa,b, Takafumi Matsumuraa,2, Ferheen Abbasia,3, and Masahito Ikawaa,b,c,d,4 aResearch Institute for Microbial Diseases, Osaka University, Osaka 5650871, Japan; bGraduate School of Pharmaceutical Sciences, Osaka University, Osaka 5650871, Japan; cGraduate School of Medicine, Osaka University, Osaka 5650871, Japan; and dThe Institute of Medical Science, The University of Tokyo, Tokyo 1088639, Japan Edited by Mariana F. Wolfner, Cornell University, Ithaca, NY, and approved July 27, 2021 (received for review April 8, 2021) Calcineurin is a calcium-dependent phosphatase that plays roles in calcineurin can be a target for reversible and rapidly acting male a variety of biological processes including immune responses. In sper- contraceptives (5). However, it is challenging to develop molecules matozoa, there is a testis-enriched calcineurin composed of PPP3CC and that specifically inhibit sperm calcineurin and not somatic calci- PPP3R2 (sperm calcineurin) that is essential for sperm motility and male neurin because of sequence similarities (82% amino acid identity fertility. Because sperm calcineurin has been proposed as a target for between human PPP3CA and PPP3CC and 85% amino acid reversible male contraceptives, identifying proteins that interact with identity between human PPP3R1 and PPP3R2). Therefore, identi- sperm calcineurin widens the choice for developing specific inhibitors. fying proteins that interact with sperm calcineurin widens the choice Here, by screening the calcineurin-interacting PxIxIT consensus motif of inhibitors that target the sperm calcineurin pathway. in silico and analyzing the function of candidate proteins through the The PxIxIT motif is a conserved sequence found in generation of gene-modified mice, we discovered that SPATA33 inter- calcineurin-binding proteins (8, 9). -
Transcriptional Regulation of RKIP in Prostate Cancer Progression
Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Sciences Transcriptional Regulation of RKIP in Prostate Cancer Progression Submitted by: Sandra Marie Beach In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Sciences Examination Committee Major Advisor: Kam Yeung, Ph.D. Academic William Maltese, Ph.D. Advisory Committee: Sonia Najjar, Ph.D. Han-Fei Ding, M.D., Ph.D. Manohar Ratnam, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: May 16, 2007 Transcriptional Regulation of RKIP in Prostate Cancer Progression Sandra Beach University of Toledo ACKNOWLDEGMENTS I thank my major advisor, Dr. Kam Yeung, for the opportunity to pursue my degree in his laboratory. I am also indebted to my advisory committee members past and present, Drs. Sonia Najjar, Han-Fei Ding, Manohar Ratnam, James Trempe, and Douglas Pittman for generously and judiciously guiding my studies and sharing reagents and equipment. I owe extended thanks to Dr. William Maltese as a committee member and chairman of my department for supporting my degree progress. The entire Department of Biochemistry and Cancer Biology has been most kind and helpful to me. Drs. Roy Collaco and Hong-Juan Cui have shared their excellent technical and practical advice with me throughout my studies. I thank members of the Yeung laboratory, Dr. Sungdae Park, Hui Hui Tang, Miranda Yeung for their support and collegiality. The data mining studies herein would not have been possible without the helpful advice of Dr. Robert Trumbly. I am also grateful for the exceptional assistance and shared microarray data of Dr. -
Identification and Characterization of TPRKB Dependency in TP53 Deficient Cancers
Identification and Characterization of TPRKB Dependency in TP53 Deficient Cancers. by Kelly Kennaley A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Molecular and Cellular Pathology) in the University of Michigan 2019 Doctoral Committee: Associate Professor Zaneta Nikolovska-Coleska, Co-Chair Adjunct Associate Professor Scott A. Tomlins, Co-Chair Associate Professor Eric R. Fearon Associate Professor Alexey I. Nesvizhskii Kelly R. Kennaley [email protected] ORCID iD: 0000-0003-2439-9020 © Kelly R. Kennaley 2019 Acknowledgements I have immeasurable gratitude for the unwavering support and guidance I received throughout my dissertation. First and foremost, I would like to thank my thesis advisor and mentor Dr. Scott Tomlins for entrusting me with a challenging, interesting, and impactful project. He taught me how to drive a project forward through set-backs, ask the important questions, and always consider the impact of my work. I’m truly appreciative for his commitment to ensuring that I would get the most from my graduate education. I am also grateful to the many members of the Tomlins lab that made it the supportive, collaborative, and educational environment that it was. I would like to give special thanks to those I’ve worked closely with on this project, particularly Dr. Moloy Goswami for his mentorship, Lei Lucy Wang, Dr. Sumin Han, and undergraduate students Bhavneet Singh, Travis Weiss, and Myles Barlow. I am also grateful for the support of my thesis committee, Dr. Eric Fearon, Dr. Alexey Nesvizhskii, and my co-mentor Dr. Zaneta Nikolovska-Coleska, who have offered guidance and critical evaluation since project inception. -
Identification of Novel Biomarkers and Candidate Small Molecule Drugs in Non-Small-Cell Lung Cancer by Integrated Microarray Analysis
OncoTargets and Therapy Dovepress open access to scientific and medical research Open Access Full Text Article ORIGINAL RESEARCH Identification of novel biomarkers and candidate small molecule drugs in non-small-cell lung cancer by integrated microarray analysis This article was published in the following Dove Press journal: OncoTargets and Therapy Qiong Wu1,2,* Background: Non-small-cell lung cancer (NSCLC) remains the leading cause of cancer Bo Zhang1,2,* morbidity and mortality worldwide. In the present study, we identified novel biomarkers Yidan Sun3 associated with the pathogenesis of NSCLC aiming to provide new diagnostic and therapeu- Ran Xu1 tic approaches for NSCLC. Xinyi Hu4 Methods: The microarray datasets of GSE18842, GSE30219, GSE31210, GSE32863 and Shiqi Ren4 GSE40791 from Gene Expression Omnibus database were downloaded. The differential Qianqian Ma5 expressed genes (DEGs) between NSCLC and normal samples were identified by limma Chen Chen6 package. The construction of protein–protein interaction (PPI) network, module analysis and Jian Shu7 enrichment analysis were performed using bioinformatics tools. The expression and prog- Fuwei Qi7 nostic values of hub genes were validated by GEPIA database and real-time quantitative fi Ting He7 PCR. Based on these DEGs, the candidate small molecules for NSCLC were identi ed by the CMap database. Wei Wang2 Results: A total of 408 overlapping DEGs including 109 up-regulated and 296 down- Ziheng Wang2 regulated genes were identified; 300 nodes and 1283 interactions were obtained from the 1 Medical School of Nantong University, PPI network. The most significant biological process and pathway enrichment of DEGs were Nantong 226001, People’s Republic of China; 2The Hand Surgery Research Center, response to wounding and cell adhesion molecules, respectively. -
Genomic and Expression Profiling of Chromosome 17 in Breast Cancer Reveals Complex Patterns of Alterations and Novel Candidate Genes
[CANCER RESEARCH 64, 6453–6460, September 15, 2004] Genomic and Expression Profiling of Chromosome 17 in Breast Cancer Reveals Complex Patterns of Alterations and Novel Candidate Genes Be´atrice Orsetti,1 Me´lanie Nugoli,1 Nathalie Cervera,1 Laurence Lasorsa,1 Paul Chuchana,1 Lisa Ursule,1 Catherine Nguyen,2 Richard Redon,3 Stanislas du Manoir,3 Carmen Rodriguez,1 and Charles Theillet1 1Ge´notypes et Phe´notypes Tumoraux, EMI229 INSERM/Universite´ Montpellier I, Montpellier, France; 2ERM 206 INSERM/Universite´ Aix-Marseille 2, Parc Scientifique de Luminy, Marseille cedex, France; and 3IGBMC, U596 INSERM/Universite´Louis Pasteur, Parc d’Innovation, Illkirch cedex, France ABSTRACT 17q12-q21 corresponding to the amplification of ERBB2 and collinear genes, and a large region at 17q23 (5, 6). A number of new candidate Chromosome 17 is severely rearranged in breast cancer. Whereas the oncogenes have been identified, among which GRB7 and TOP2A at short arm undergoes frequent losses, the long arm harbors complex 17q21 or RP6SKB1, TBX2, PPM1D, and MUL at 17q23 have drawn combinations of gains and losses. In this work we present a comprehensive study of quantitative anomalies at chromosome 17 by genomic array- most attention (6–10). Furthermore, DNA microarray studies have comparative genomic hybridization and of associated RNA expression revealed additional candidates, with some located outside current changes by cDNA arrays. We built a genomic array covering the entire regions of gains, thus suggesting the existence of additional amplicons chromosome at an average density of 1 clone per 0.5 Mb, and patterns of on 17q (8, 9). gains and losses were characterized in 30 breast cancer cell lines and 22 Our previous loss of heterozygosity mapping data pointed to the primary tumors. -
Genetic and Genomic Analysis of Hyperlipidemia, Obesity and Diabetes Using (C57BL/6J × TALLYHO/Jngj) F2 Mice
University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Nutrition Publications and Other Works Nutrition 12-19-2010 Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P. Stewart Marshall University Hyoung Y. Kim University of Tennessee - Knoxville, [email protected] Arnold M. Saxton University of Tennessee - Knoxville, [email protected] Jung H. Kim Marshall University Follow this and additional works at: https://trace.tennessee.edu/utk_nutrpubs Part of the Animal Sciences Commons, and the Nutrition Commons Recommended Citation BMC Genomics 2010, 11:713 doi:10.1186/1471-2164-11-713 This Article is brought to you for free and open access by the Nutrition at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Nutrition Publications and Other Works by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. Stewart et al. BMC Genomics 2010, 11:713 http://www.biomedcentral.com/1471-2164/11/713 RESEARCH ARTICLE Open Access Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P Stewart1, Hyoung Yon Kim2, Arnold M Saxton3, Jung Han Kim1* Abstract Background: Type 2 diabetes (T2D) is the most common form of diabetes in humans and is closely associated with dyslipidemia and obesity that magnifies the mortality and morbidity related to T2D. The genetic contribution to human T2D and related metabolic disorders is evident, and mostly follows polygenic inheritance. The TALLYHO/ JngJ (TH) mice are a polygenic model for T2D characterized by obesity, hyperinsulinemia, impaired glucose uptake and tolerance, hyperlipidemia, and hyperglycemia. -
Supplemental Information
Supplemental information Dissection of the genomic structure of the miR-183/96/182 gene. Previously, we showed that the miR-183/96/182 cluster is an intergenic miRNA cluster, located in a ~60-kb interval between the genes encoding nuclear respiratory factor-1 (Nrf1) and ubiquitin-conjugating enzyme E2H (Ube2h) on mouse chr6qA3.3 (1). To start to uncover the genomic structure of the miR- 183/96/182 gene, we first studied genomic features around miR-183/96/182 in the UCSC genome browser (http://genome.UCSC.edu/), and identified two CpG islands 3.4-6.5 kb 5’ of pre-miR-183, the most 5’ miRNA of the cluster (Fig. 1A; Fig. S1 and Seq. S1). A cDNA clone, AK044220, located at 3.2-4.6 kb 5’ to pre-miR-183, encompasses the second CpG island (Fig. 1A; Fig. S1). We hypothesized that this cDNA clone was derived from 5’ exon(s) of the primary transcript of the miR-183/96/182 gene, as CpG islands are often associated with promoters (2). Supporting this hypothesis, multiple expressed sequences detected by gene-trap clones, including clone D016D06 (3, 4), were co-localized with the cDNA clone AK044220 (Fig. 1A; Fig. S1). Clone D016D06, deposited by the German GeneTrap Consortium (GGTC) (http://tikus.gsf.de) (3, 4), was derived from insertion of a retroviral construct, rFlpROSAβgeo in 129S2 ES cells (Fig. 1A and C). The rFlpROSAβgeo construct carries a promoterless reporter gene, the β−geo cassette - an in-frame fusion of the β-galactosidase and neomycin resistance (Neor) gene (5), with a splicing acceptor (SA) immediately upstream, and a polyA signal downstream of the β−geo cassette (Fig. -
Molecular Effects of Isoflavone Supplementation Human Intervention Studies and Quantitative Models for Risk Assessment
Molecular effects of isoflavone supplementation Human intervention studies and quantitative models for risk assessment Vera van der Velpen Thesis committee Promotors Prof. Dr Pieter van ‘t Veer Professor of Nutritional Epidemiology Wageningen University Prof. Dr Evert G. Schouten Emeritus Professor of Epidemiology and Prevention Wageningen University Co-promotors Dr Anouk Geelen Assistant professor, Division of Human Nutrition Wageningen University Dr Lydia A. Afman Assistant professor, Division of Human Nutrition Wageningen University Other members Prof. Dr Jaap Keijer, Wageningen University Dr Hubert P.J.M. Noteborn, Netherlands Food en Consumer Product Safety Authority Prof. Dr Yvonne T. van der Schouw, UMC Utrecht Dr Wendy L. Hall, King’s College London This research was conducted under the auspices of the Graduate School VLAG (Advanced studies in Food Technology, Agrobiotechnology, Nutrition and Health Sciences). Molecular effects of isoflavone supplementation Human intervention studies and quantitative models for risk assessment Vera van der Velpen Thesis submitted in fulfilment of the requirements for the degree of doctor at Wageningen University by the authority of the Rector Magnificus Prof. Dr M.J. Kropff, in the presence of the Thesis Committee appointed by the Academic Board to be defended in public on Friday 20 June 2014 at 13.30 p.m. in the Aula. Vera van der Velpen Molecular effects of isoflavone supplementation: Human intervention studies and quantitative models for risk assessment 154 pages PhD thesis, Wageningen University, Wageningen, NL (2014) With references, with summaries in Dutch and English ISBN: 978-94-6173-952-0 ABSTRact Background: Risk assessment can potentially be improved by closely linked experiments in the disciplines of epidemiology and toxicology. -
Gamma Tubulin (TUBG1) (NM 001070) Human Untagged Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC119462 gamma Tubulin (TUBG1) (NM_001070) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: gamma Tubulin (TUBG1) (NM_001070) Human Untagged Clone Tag: Tag Free Symbol: TUBG1 Synonyms: CDCBM4; GCP-1; TUBG; TUBGCP1 Vector: pCMV6-XL5 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >OriGene ORF within SC119462 sequence for NM_001070 edited (data generated by NextGen Sequencing) ATGCCGAGGGAAATCATCACCCTACAGTTGGGCCAGTGCGGCAATCAGATTGGGTTCGAG TTCTGGAAACAGCTGTGCGCCGAGCATGGTATCAGCCCCGAGGGCATCGTGGAGGAGTTC GCCACCGAGGGCACTGACCGCAAGGACGTCTTTTTCTACCAGGCAGACGATGAGCACTAC ATCCCCCGGGCCGTGCTGCTGGACTTGGAACCCCGGGTGATCCACTCCATCCTCAACTCC CCCTATGCCAAGCTCTACAACCCAGAGAACATCTACCTGTCGGAACATGGAGGAGGAGCT GGCAACAACTGGGCCAGCGGATTCTCCCAGGGAGAAAAGATCCATGAGGACATTTTTGAC ATCATAGACCGGGAGGCAGATGGTAGTGACAGTCTAGAGGGCTTTGTGCTGTGTCACTCC ATTGCTGGGGGGACAGGCTCTGGACTGGGTTCCTACCTCTTAGAACGGCTGAATGACAGG TATCCTAAGAAGCTGGTGCAGACATACTCAGTGTTTCCCAACCAGGACGAGATGAGCGAT GTGGTGGTCCAGCCTTACAATTCACTCCTCACACTCAAGAGGCTGACGCAGAATGCAGAC TGTGTGGTGGTGCTGGACAACACAGCCCTGAACCGGATTGCCACAGACCGCCTGCACATC CAGAACCCATCCTTCTCCCAGATCAACCAGCTGGTGTCTACCATCATGTCAGCCAGCACC ACCACCCTGCGCTACCCTGGCTACATGAACAATGACCTCATCGGCCTCATCGCCTCGCTC ATTCCCACCCCACGGCTCCACTTCCTCATGACCGGCTACACCCCTCTCACTACGGACCAG TCAGTGGCCAGCGTGAGGAAGACCACGGTCCTGGATGTCATGAGGCGGCTGCTGCAGCCC -
Identification of Potential Key Genes and Pathway Linked with Sporadic Creutzfeldt-Jakob Disease Based on Integrated Bioinformatics Analyses
medRxiv preprint doi: https://doi.org/10.1101/2020.12.21.20248688; this version posted December 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Identification of potential key genes and pathway linked with sporadic Creutzfeldt-Jakob disease based on integrated bioinformatics analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. medRxiv preprint doi: https://doi.org/10.1101/2020.12.21.20248688; this version posted December 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Abstract Sporadic Creutzfeldt-Jakob disease (sCJD) is neurodegenerative disease also called prion disease linked with poor prognosis. The aim of the current study was to illuminate the underlying molecular mechanisms of sCJD. The mRNA microarray dataset GSE124571 was downloaded from the Gene Expression Omnibus database. Differentially expressed genes (DEGs) were screened.