The Pennsylvania State University

The Graduate School

Intercollege Graduate Program of Plant Biology

THE ALLOTETRAPLOID EVOLUTIONARY ORIGIN

OF ANNUAL BLUEGRASS

A Dissertation in

Plant Biology

by

Qing Mao

© 2014 Qing Mao

Submitted in Partial Fulfillment of the Requirements for the Degree of

Doctor of Philosophy

August 2014

The dissertation of Qing Mao was reviewed and approved* by the following:

David R.Huff Professor of Turfgrass Breeding & Genetics Dissertation Advisor Chair of Committee

Majid Foolad Professor of Plant Genetics

John Kaminski Associate Professor of Turfgrass Management

Dawn Luthe Professor of Plant Stress Biology

Gabriele Monshausen Assistant Professor of Biology

Teh-hui Kao Distinguished Professor of Biochemistry and Molecular Biology Chair of Intercollege Graduate Degree Program in Plant Biology

*Signatures are on file in the Graduate School

iii ABSTRACT

Poa annua L., or annual bluegrass, is an agronomically and ecologically important grass species. It is morphologically highly variable, representing a continuum from annual to perennial types. In order to explain the wide distribution and variability in

Poa annua, efforts have been made to discover its evolutionary origin ever since the

1930s; however, no definitive conclusions have been made. Our phylogenetic analysis using nuclear and chloroplast gene sequences is the first to confirm that Poa annua

(2n=4x=28) is an allotetraploid between an annual grass species Poa infirma Kunth.

(2n=2x=14) and a perennial grass species Poa supina Schrad. (2n=2x=14), with the former serving as the maternal parent. Our data also suggest a recent origin of Poa annua, and possibly multiple crosses between the parental species led to the present day

Poa annua. Previous phylogenetic studies have suggested that the genomes of Poa infirma and Poa supina are very divergent, representing the largest genetic distance between species within the genus Poa. By analyzing meiotic chromosome pairing data in amphihaploid Poa annua published by Hovin, we were able to determine that the genomes of Poa infirma and Poa supina indeed are very distinct, and we designated them

II and SS, making the genomic constitution of Poa annua IISS.

Prior to the present study, the biggest controversy on the origin of Poa annua was that its karyotype did not match the combination of the two putative parents Poa infirma and Poa supina. With the two parental species confirmed with DNA sequencing data, it could now be concluded that chromosomal rearrangements must have occurred during the evolutionary origin of Poa annua. In order to explore the extent and patterns of

iv chromosomal rearrangements in Poa annua, fluorescent in situ hybridization was performed to compare rDNA loci in Poa annua and its parents. Our data show variations of genomic rDNA loci between Poa annua and its parents, and among different Poa annua individuals, suggesting that not only did chromosomal rearrangements occur in

Poa annua, but also genomic variation exists within this species.

Small RNAs play a wide range of regulatory roles in plant development and are associated with polyploid evolution. Four small RNA profiles were generated from young seedlings of Poa infirma, Poa supina, perennial-type Poa annua and annual-type Poa annua. Analyses showed that the four profiles are highly similar in terms of small RNA length distribution, miRNA families and expression levels, indicating that the morphological and life history variation observed 1) between the two types of Poa annua, and 2) among allotetraploid Poa annua and the two diploid parental species are not attributable to the small RNAs examined. However, the profiles generated from this study could serve as a baseline for future work.

In summary, the discoveries from this thesis work enhanced our understanding of the phenotypic variability and incredible adaptability of Poa annua, and provided insights into plant polyploid evolution.

v TABLE OF CONTENTS

LIST OF FIGURES ...... vii!

LIST OF TABLES ...... x!

ACKNOWLEDGEMENTS ...... xii!

Chapter 1 Introduction ...... 1!

Poa annua L...... 1! Morphology of Poa annua ...... 1! Wide distribution of Poa annua ...... 3! Utility of Poa annua in turf ...... 4! Origin of Poa annua ...... 6! Polyploid Evolution ...... 7! Plant polyploidy ...... 7! Genetic and epigenetic changes in polyploids ...... 8! Mechanism of polyploid effects ...... 10! Small RNA in polyploid evolution ...... 11! Objectives of research ...... 13! References ...... 15!

Chapter 2 The evolutionary origin of Poa annua L...... 20!

Abstract ...... 21! Background ...... 22! Materials and Methods ...... 25! Plant material ...... 25! Flow cytometry ...... 26! DNA extraction ...... 27! DNA amplification, cloning and sequencing ...... 28! Sequence alignment and phylogenetic analyses ...... 29! Results ...... 30! Species comparisons of Poa infirma, Poa supina, and Poa annua ...... 30! Phylogenetic analyses of nuclear genes trx and CDO504 ...... 31! Phylogenetic analyses of chloroplast genes trnTLF and ndhF ...... 32! Genetic distances among Poa infirma, Poa supina, and Poa annua ...... 33! Statistical parsimony network analyses ...... 34! Discussion ...... 36! The origin of Poa annua ...... 36! Genomic designation of Poa infirma and Poa supina ...... 37! Chromosomal rearrangements in Poa annua ...... 39! Acknowledgements ...... 41! References ...... 42!

vi Chapter 3 Chromosomal rearrangements in Poa annua ...... 60!

Background ...... 60! Materials and Methods ...... 61! Plant materials ...... 61! Chromosome preparations ...... 62! FISH experiment ...... 62! Results ...... 64! FISH with 5S rDNA probes ...... 64! FISH with 45S rDNA probes ...... 64! Discussion ...... 65! Acknowledgement ...... 66! References ...... 67!

Chapter 4 Characterizing small RNA profiles of allotetraploid Poa annua L. and its diploid parents ...... 73!

Abstract ...... 74! Background ...... 76! Results ...... 80! Small RNA sequencing of Poa annua and its parental species ...... 80! Length distribution of redundant small RNAs ...... 80! Length distribution of unique sequences ...... 82! Identification of conserved miRNA in Poa annua and its parental species .. 84! Conservation levels of identified conserved miRNAs ...... 86! Novel miRNA prediction ...... 87! Material and Methods ...... 89! Plant material and RNA isolation ...... 89! Small RNA library construction and sequencing ...... 90! Raw sequence data processing ...... 90! Statistical analyses of length distribution ...... 91! Conserved miRNA identification ...... 92! Novel miRNA prediction ...... 92! Discussion ...... 93! References ...... 97!

Chapter 5 Summary and future perspectives ...... 124!

Summary ...... 124! Future perspectives ...... 126! Chromosomal rearrangements in Poa annua ...... 126! Further small RNA studies of Poa annua ...... 127! Reference ...... 129!

vii LIST OF FIGURES

Figure 2-1. PCR amplification of nuclear sequence trx from four individuals of Poa annua (Pa) (lanes 2-5), four individuals of Poa infirma (Pi) (lanes 6-9), and four individuals of Poa supina (Ps) (lanes 10-13). Lane 14: negative control with no DNA template in the PCR reaction. Lane M = molecular size ladder. bp = base pair...... 53

Figure 2-2. Maximum parsimony trees for nuclear sequences CDO504 (A) and trx (B) and chloroplast sequences trnTLF (C) and ndhF (D)...... 55

Figure 2-3. Statistical parsimony network analysis of nuclear sequences CDO504 (A) and trx (B), and the chloroplast sequence trnTLF (C). Individual haplotypes of Poa annua are represented by shaded squares, Poa infirma by white circles, and Poa supina by black circles...... 57

Figure 2-4. Scale of c-values (frequency of chiasma per chromosome arm) depicting genomic designations of various grass species following Wang (1989, 1992)...... 58

Figure 2-5. Schematic representation of the origin of Poa annua including the genomic designations of Poa infirma, Poa supina, and Poa annua...... 59

Figure 3-1. Representation of karyotipic changes in Poa annua. Summarized from (Nannfeldt, 1937) and (Koshy, 1968)...... 69

Figure 3-2. Scheme of fluorescent in situ hybridization (FISH) experiment...... 70

Figure 3-3. FISH localization of 5S rDNA loci (red) on chromosomes (blue) of Poa annua and its parental species. (A) Two telomeric loci were detected in Poa infirma. (B) Two centromeric loci were detected in Poa supina. (C) Four loci were detected in Poa annua...... 71

Figure 3-4. FISH localization of 45S rDNA loci (red) on chromosomes (blue) of Poa annua and its parental species. (A) Two loci were detected in Poa infirma. (B) Two loci were detected in Poa supina. (C & D) For the two different Poa annua individuals, one showed two centromeric loci and the other showed three telomeric loci...... 72

Figure 4-1. Length distributions of redundant 18-30nt small RNA sequences from each library. Each panel represents three biological replicates from the same profile. A. Poa infirma replicates I1, I2, and I3; B. Poa supina replicates S1, S2, and S3; C. Perennial-type Poa annua replicates P1, P2, and P3; D. Annual-type Poa annua replicates A1, A2 and A3...... 102

viii Figure 4-2. Length distributions of redundant 18-30nt small RNA sequences averaged from the replicates within each profile: Poa infirma (I), Poa supina (S), perennial-type Poa annua (P), and annual-type Poa annua (A). Error bars: standard errors...... 103

Figure 4-3. Length distributions of unique 18-30nt small RNA sequences from each library. Each panel represents three biological replicates from the same profile. A. Poa infirma replicates I1, I2, and I3; B. Poa supina replicates S1, S2, and S3; C. Perennial-type Poa annua replicates P1, P2, and P3; D. Annual-type Poa annua replicates A1, A2 and A3...... 104

Figure 4-4. Length distributions of unique 18-30nt small RNA sequences averaged from the replicates within each profile: Poa infirma (I), Poa supina (S), perennial-type Poa annua (P), and annual-type Poa annua (A). Error bars: standard errors...... 105

Figure 4-5. Number of identified microRNA members in each conserved microRNA family for the four profiles: Poa infirma (I), Poa supina (S), perennial-type Poa annua (P), and annual-type Poa annua (A)...... 106

Figure 4-6. Expression levels of conserved microRNA families in the four profiles, expressed as per million reads: Poa infirma (I), Poa supina (S), perennial-type Poa annua (P), and annual-type Poa annua (A). Error bars: standard errors...... 107

Figure 4-7. Venn diagram representing the relationship of conserved microRNA sequences that were identified from the four profiles...... 108

Figure 4-8. Categorization of conserved microRNA sequences based on reference genomes for each profile...... 109

Figure 4-9. Venn diagram representing the relationship of novel microRNA sequences that were predicted from the four profiles...... 110

Figure 4-10. Categorization of novel microRNA sequences based on reference genomes for each profile...... 111

Figure 4-11. Categorization of microRNA sequences identified/predicted from all four profiles combined based on reference genomes. A. Conserved microRNAs; B. Novel microRNAs...... 112

Figure 4-12. Phylogenetic relationship between Poa annua, its parental species, and the three model plant species utilized as reference genomes for conserved and novel microRNA identification in this study. A. Known relationship adapted from NBCI Taxonomy (http://www.ncbi.nlm.nih.gov/taxonomy); B.

ix Phylogenetic tree generated based on conserved microRNA identification or novel microRNA predictions from current study...... 113

Additional file 4-1. Redundancy level of 18-30nt small RNAs at each length class for the four profiles: Poa infirma (I), Poa supina (S), perennial-type Poa annua (P), and annual-type Poa annua (A). Error bars: standard errors...... 114

x

LIST OF TABLES

Table 2-1. DNA sequences of the two nuclear loci (CDO504 and trx) and the two chloroplast loci (ndhF and trnTLF) examined in the present study. GenBank accession numbers in bold represent sequences generated from the present study...... 47

Table 2-2. Comparison of Poa infirma, Poa supina, and Poa annua for various traits and characteristics...... 50

Table 2-3. Mean net genetic distances (K; lower diagonal) and associated standard errors (upper diagonal italics) between orthologs from the allotetraploid Poa annua and the diploids Poa supina and Poa infirma for the two nuclear DNA sequences (CDO504 and trx) and the two chloroplast DNA sequences (trnTLF and ndhF). Mean distances of corresponding parental orthologs are in bold. Means and standard errors were calculated using the Jukes-Cantor model in MEGA4...... 51

Table 2-4. Mean and range of c-values for different amphihaploid accessions of Poa annua derived from cytological data of Hovin (1958). Each accession was grown and examined under different environmental conditions (2 to 6 environments per accession) and the number of rod versus ring bivalents were recorded. The total number of pollen mother cells (PMCs) examined per accession was pooled across environments. C-values (frequency of chiasma per chromosome arm) were calculated following Wang (1992) as the number of chiasma divided by twice the base number of chromosomes (i.e. 2 x 7 = 14)...... 52

Table 4-1. Sequencing data preprocessing summary for the three biological replicate samples from Poa infirma, Poa supina, and the perennial and annual types of Poa annua...... 100

Table 4-2. Cramér’s V statistic for small RNA length distributions. (I: Poa infirma. S: Poa supina. P: Perennial Type Poa annua. A: Annual Type Poa annua)...... 101

Additional file 4- 2. List of conserved microRNAs identified from the four profiles Poa infirma, Poa supina, and the perennial and annual types of Poa annua. For each conserved microRNA, mean and standard error of normalized expression is presented within each profile. Color indicates the reference genome from which each conserved microRNA was identified. For each profile, column “Mean” colored yellow represents Brachypodium

xi distachyon reference genome, orange represents Arabidopsis thaliana reference genome, and blue represents both Brachypodium and Arabidopsis reference genomes; column “SE” colored green represents Oryza sativa reference genome...... 115

Additional file 4-3. List of novel microRNAs predicted from the four profiles Poa infirma, Poa supina, and the perennial and annual types of Poa annua...... 120

xii

ACKNOWLEDGEMENTS

First and foremost, I would like to express my deepest gratitude to my advisor Dr.

David Huff for his constant support and guidance. I feel very lucky to have worked with someone who is always positive and encouraging. He has always been patient with me and gave me tremendous flexibility to pursue my interest in turfgrass molecular biology.

I would also like to express my sincere appreciation to my thesis committee members, Dr. Dawn Luthe, Dr. Majid Foolad, Dr. Gaby Monshausen, and Dr. John

Kaminski for their insight and help. Their advice for my research and future career cleared my doubts during difficult times of my Ph.D study. I owe my special thanks to

Dr. Teh-hui Kao for recruiting me into the prestigious Plant Biology program, and for supporting me through graduate school.

I want to thank my friends and family for their love and support. Their company has made the past six years filled with wonderful memories.

1

Chapter 1

Introduction

Poa annua L.

Morphology of Poa annua

Poa annua, or annual bluegrass, is a turfgrass species well known for its close association with human activities. Taxonomically, it belongs to the genus Poa L.

(bluegrass) within the grass family Poaceae. Poa annua, as with all bluegrasses, is morphologically characterized by folded vernation, “train-track” midribs on the adaxial leaf surface and boat-shaped leaf tips. In addition, Poa annua has membranous ligules and absent auricles at the junction between leaf sheath and blade (Tutin, 1957; Mitich,

1998; Turgeon, 2004). The inflorescence is panicle-shaped, with hermaphrodite florets, although the apical floret of each spikelet is usually female (Tutin, 1957). Poa annua is primarily self-pollinated, and Tutin (1957) has also observed cleistogamy and vivipary; however, cross-pollination happens and the outcrossing rate is estimated to be 0 to 15% in nature (Ellis, 1973).

Despite the name Poa annua, the species contains both annual and perennial types, and displays a wide range of life-history variations between these two types (Law et al., 1977). The annual type, referred to by Law et al. (1977) as opportunist populations, behaves as a winter annual, and is generally characterized by light green color, bunch-

2 type growth habit, and coarse texture. It utilizes the r-strategy with rapid germination, flowering throughout the growing season and producing plenty of seeds (Law et al.,

1977; Johnson, 1995; Huff, 2006). The perennial type, on the other hand, is more prostrate and sometimes has a stoloniferous growth habit, with finer texture, a more restricted flowering period (typically late spring) and less seed production (Law et al.,

1977; Huff, 2006).

Due to the extensive morphological variations exhibited within the same species, it has been and still is a challenge for scientists to categorize the annual and perennial types of Poa annua. The two types were first recognized as varieties Poa annua var. annua L. and Poa annua var. reptans Hausskn., then as two subspecies Poa annua ssp. annua Timm an Poa annua ssp. reptans [Hausskn.] Timm, and later as two forms Poa annua f. annua L. and Poa annua f. reptans [Hausskn.] T. Koyama (Huff, 2003). Some researchers even considered “the two types are quite distinct morphologically and are worthy of defining as two separate species” (Johnson, 1995). The main challenges with categorizing annual and perennial types of Poa annua are: 1) rather than having two distinct types, the species displays a continuum between the two extremes (Johnson,

1995); 2) it is common to observe both types within a single plant, and somatic reversion from perennial type to annual type has been observed once environmental stress

(mowing) is removed (La Mantia, 2009).

3 Wide distribution of Poa annua

Poa annua has long been considered a noxious weed in various environments, and is one of the most ubiquitous plant species throughout the world. It is distributed widely in the temperate regions (Tutin, 1957), found on mountainous areas on the equator

(Hemp, 2008), and has recently attracted a lot of public attention by invading into and becoming the most widely distributed alien species in the most isolated environment on earth, sub-Antarctic islands and Antarctic mainland (Chwedorzewska, 2008; Olech &

Chwedorzewska, 2011; Molina-Montenegro et al., 2012). Poa annua, though not intentionally planted, is found in lawns, gardens, paths, pavements, pastures, trails, and many other environments (Mitich, 1998). It is worth mentioning that although Poa annua makes its way into various environments as a weed, it does not displace other plants, but behaves as a opportunistic colonizer (Law et al., 1977; Mitich, 1998). The strong colonizing ability of Poa annua is attributed to its remarkable phenotypic variability, fast germination and growth rate, large number of seed production, tolerance of soil compaction and high survival rate when uprooted (Tutin, 1957; Hutchinson & Seymour,

1982; Mitich, 1998). Poa annua is a species closely associated with humans, and its wide spread across the world is also attributable to human activities. It is frequently found in urban and suburban areas, and humans often serve as the carrier of seeds for their initial occurrence in remote areas, such as Alaskan trails (Bella, 2011) and Antarctica (Frenot et al., 2001; Chwedorzewska, 2008; Chwedorzewska & Bednarek, 2012).

Poa annua, in addition to being capable of invading into new environment, is most remarkable in its adaptability to specific conditions, which makes it “noxious”. The

4 ability of Poa annua to adjust to its environmental conditions is perhaps best demonstrated by its phenotypic variation on different areas on the same golf course. One way of measuring perenniality is by counting the number of daughter tillers of an individual plant at the time it flowers, and a recent study measured the perenniality of

Poa annua weeds collected from the roughs, fairways and putting greens from a golf course. Poa annua plants from the roughs (typically mowed at 1 to 1.5 inches) produced one to three daughter tillers at time of anthesis; those from fairways (typically mowed at

0.5 inch) were shorter in plant statue and produced four to eight daughter tillers; and those from the greens (typically mowed at 0.1-0.15 inch) were very dwarf plants and produced more than nine daughter tillers (Huff, 2006). This shows how Poa annua could finely tune its growth habit and morphology to adjust to the specific growing environment.

Utility of Poa annua in turf

Poa annua has a unique position in the turf industry. In many cases, it is a weed to be eliminated. Turf managers have spent decades trying to battle with the occurrence of Poa annua in managed turf areas. The presence of Poa annua, especially the annual weedy types, with its light green color, around-the-year seed production, low resistance to extreme temperatures and diseases breaks the uniform look in turf. The most significant economic impact of Poa annua is probably in high maintenance turfgrass areas, such as golf courses. A lot of research has been conducted to study the ecology of

Poa annua when it invades creeping bentgrass golf course putting greens (Lush,

5 1988a,b), as well as searching for effective methods of eliminating Poa annua (Mcelroy et al., 2004; Henry et al., 2012). Despite the efforts from both academic research and industrial inputs, the arms race between turf managers and Poa annua is still an ongoing process.

In addition to being a noxious weed, certain types of Poa annua possess high turf qualities, making this species a unique component of the turf industry. An extreme of the perennial type Poa annua named the “greens-type” serves as a valuable and desirable turfgrass in that it is extremely dwarf in statue, with fine texture and form highly dense turf surfaces, which are all desirable turfgrass qualities. The US Open, one of the most prestigious golf events is often played on putting greens composed of Poa annua (Huff,

1998), and some of the most elite golf courses are featured with Poa annua greens, such as the Pebble Beach Golf Link in California and Oakmont Country Club in Pennsylvania.

It is believed that the greens-type Poa annua evolved from annual weedy types when they first invaded putting greens as seeds, and after decades of close mowing and other intense management practices by the superintendents, these individuals adapted to the environment by altering their morphology to form these greens type grasses (Huff, 2003).

In some extreme cases, the selection pressure favoring dwarf plants is so intense that dihaploid Poa annua with only 14 chromosomes, half the number of chromosomes in natural populations, is created on the greens (Hovin, 1958; Huff, 2003).

Because of the high turf quality these greens type Poa annua possess, there has been a number of breeding programs in academic institutions for a commercial greens type cultivar (Hovin, 1957; Youngner, 1959; Johnson et al., 1993).To date, only one commercially available cultivar has been released by the University of Minnesota (Cook,

6 2008), and has not been successful on the market. Currently, research and breeding program at the Pennsylvania State University led by Dr. David Huff has a wide collection of greens type germplasm, and after two decades of breeding has produced populations with improved turf quality (Huff, 1998, 2006), higher resistance to diseases (Aamlid et al., 2009; Bertrand et al., 2011), and enhanced tolerance to abiotic stresses (Dai et al.,

2008; Dionne et al., 2010). There still are a few difficulties to be overcome before these high turf quality greens type Poa annua cultivars can be released for the seed market, with the most challenging problem being the instability of the greens type phenotype

(Huff, 2003, 2006). After several generations of seed production, some of the progeny plants lose the greens type phenotype, resulting in annual weedy individuals (La Mantia,

2009; La Mantia & Huff, 2011).

Origin of Poa annua

Poa annua is a tetraploid with 28 chromosomes (2n = 4x = 28), and attempts have been made to identify its origin since the 1930s, and a few theories have been proposed.

It was proposed to be an autotetraploid from whole genome doubling of Poa infirma

Kunth. (syn. Poa exilis (Tomm.) Murb.) by Litardière (1939, in (Tutin, 1957)), and was more recently proposed to be an allotetraploid between Poa supina Schard. and Poa trivialis L. (Pietsch, 1989). The most widely accepted theory is that Poa annua is an allotetraploid between Poa supina and Poa infirma, first proposed by Nannfeldt based on their morphology (Nannfeldt, 1937), and was further supported by Tutin’s work in morphological measurements and cytological studies (Tutin, 1952, 1957). Doubt was cast

7 on Nannfeldt’s theory when a detailed karyotypic study performed by Koshy demonstrated that the karyotype of Poa annua did not resemble the addition of those from the two putative parents Poa supina and Poa infirma (Koshy, 1968). At the time,

Koshy concluded that either only one of the putative parental species was correct and a third unknown species served as the other parent for Poa annua, or the chromosome structure has undergone significant changes in Poa annua since its origin. Since then, several studies have added more evidence in accordance with Poa infirma and Poa supina being the parents of Poa annua, but none has been able to exclude Koshy’s alternative hypothesis that a third species was involved (Darmancy & Gasquez, 1997;

Heide, 2001). Therefore, it is of interest for the present research to determine the genomic constitution of Poa annua, in order to better understand its genetics.

Polyploid Evolution

Plant polyploidy

Polyploid species have multiple sets of chromosomes originated either from the same progenitor (autopolyploid) or from combinations of different progenitors

(allopolyploid). Polyploidy plays an important role in speciation and evolution in plants

(Adams & Wendel, 2005; Otto, 2007; Ainouche & Jenszewski, 2010). Recent studies discovered that genome doubling events have occurred through the evolution of many plant lineages; even the “diploid” Arabidopsis with a small genome size has undergone at least one round of genome doubling event and is in fact a paleopolyploid (Adams &

8 Wendel, 2005). The polyploids not only show phenotypes of the parents, intermediate between the parental types, but also novel phenotypes that exceed parental features

(Chen, 2007) and expanded range of adaptation, adding to the biodiversity of ecosystems

(Adams & Wendel, 2005; Hegarty & Hiscock, 2008). A lot of agriculturally important crops are polyploids, such as wheat, corn, cotton, etc.; it is thus of practical significance to understand mechanisms involved in the origin and evolution of polyploids.

Genetic and epigenetic changes in polyploids

The process of allopolyploid formation includes the “merge” of different sets of genomes and the subsequent whole genome doubling. One of the challenges that the newly formed polyploid has to overcome is the existence of different genomes, duplicated genes and regulatory pathways within the same organism (Chen, 2010). The change of genomic constitution in polyploids is believed to cause “genomic shock” in polyploids, leading to a series of genetic and epigenetic changes (Chen, 2007), and these changes make polyploids exhibit “hybrid vigor” when compared to their diploid parental species (Chen, 2010). In addition to natural polyploids, the use of synthetic polyploids has enabled researchers to study both immediate and long-term effects of polyploidy in plants.

Rapid genomic evolution has been observed in newly formed polyploids, including genomic instability and chromosomal rearrangement. For example, within five generations of synthetic allopolyploids of Brassica, extensive genomic changes were detected using RFLP (restriction fragment length polymorphism), such as loss of parental

9 bands or appearance of novel bands (Song et al., 1995). More interestingly, progenies derived from the same F2 hybrid had different RFLP patterns, accompanied with variation in plant morphological traits (Song et al., 1995). Similar genomic structure changes were reported in wheat (Han et al., 2003), Tragopogon (Lim et al., 2008), and

Arabidopsis (Pontes et al., 2004).

In addition to genetic alterations, another challenge that newly formed polyploids face is the presence of duplicated copies of all genes, and the regulation of homeologous gene expression. The gene expression level within the polyploid could be additive (equal to the mid-parent value), or non-additive (higher or lower than the mid-parent value)

(Chen, 2010). Another aspect of homeologous gene expression pattern in polyploid is the ratio of parental specific copy expressed, which may be non-preferential (1:1) or show parental dominance (Doyle et al., 2008). In newly synthesized allotetraploid Arabidopsis,

>90% of the transcriptome showed additive expression (Wang et al., 2006). In addition, the polyploid exhibits strong dominance of the male parent Arabidopsis arenosa over the female parent Arabidopsis thaliana (Wang et al., 2006). A number of studies on allopolyploid cotton (Gossypoium) demonstrated that some homeologous genes were equally expressed, and some showed biased silencing or expression toward either parental copy. Remarkably, a number of homeologous genes even showed reciprocal preferential expression in different tissues or developmental stages (Adams et al., 2003,

2004; Chaudhary et al., 2009). Such complex and regulated expression patterns of homeologous genes were observed in other polyploids, such as wheat (Bottley et al.,

2006), Spartina (Ainouche et al., 2009; Chelaifa et al., 2010), and Arabidopsis (Comai et al., 2000).

10 Mechanism of polyploid effects

The mechanism for the rapid genetic and gene expression changes in polyploids is likely a complicated “cross talk” between parental genomes. Genetic changes observed in polyploids include DNA sequence elimination and gene translocation, and these changes could have resulted from activation of transposable elements (TE), and/or homeologous

DNA recombination (Soltis & Soltis, 1999; Adams & Wendel, 2005; Hegarty & Hiscock,

2008). Insertion and transposition of TE can change DNA sequences in the genome, and it has been shown in maize that Ac/Ds elements are able to induce major chromosomal rearrangements (Zhang et al., 2009). It is uncommon, however, to observe immediate burst of TE transposition in newly formed polyploids (Parisod et al., 2010). It is possible that the activation of TE is restricted to certain classes, as observed in resynthesized tobacco (Petit et al., 2010). Another potential mechanism for genomic structural change is homeologous recombination, resulting in translocation of DNA across parental genomes (Hegarty & Hiscock, 2008; Gaeta & Pires, 2010). Not all newly formed polyploids undergo genomic structure changes. For example, in cotton (Adams et al.,

2003) and Spartina (Ainouche et al., 2009), the polyploids are found to have stable genomes and show additive of parental genomes.

In terms of the biased silencing of duplicated genes, it is believed that epigenetic regulations are the main underlying mechanism, such as cytosine methylation, histone modification, and probably higher levels of chromatin structural changes are involved as well (Adams et al., 2004; Adams & Wendel, 2005). It is possible that the regulation on expression of certain genes, such as transcription factors, can lead to the regulation of

11 hundreds of downstream genes. Epigenetic regulations are assumed to be rapid and reversible, making the polyploids capable of adjusting gene expression under potentially a wider range of environmental conditions (Chen, 2007). In addition to epigenetic mechanisms, the presence of cis and trans acting elements from two different genomes within the hybrid or polyploid can create new and more complex combinations for gene expression regulations.

It is difficult to find a “universal” mechanism for polyploid evolution, as the genetic and epigenetic changes observed in different polyploid species can be quite variable. The changes may occur immediate following the polyploidization or present as long-term effects, and they may be highly regulated or be random processes, and vary upon the species, environmental conditions, and even specific genes being studied.

Small RNA in polyploid evolution

Small RNAs are 20-30 nucleotide non-coding RNAs that play a wide range of regulatory roles in both plants and animals. Two major groups of small RNAs are microRNAs (miRNAs) and small interfering RNAs (siRNAs) (Carthew & Sontheimer,

2009). In plants, 20-24nt mature miRNAs are processed from endogenous single strand

RNA precursors by DICER-LIKE proteins, and are then incorporated with

ARGONAUTE (AGO) proteins into RNA-induced silencing complex (RISC) to perform regulatory functions. MiRNAs play a wide range of regulatory roles in plant growth and development by suppressing target messenger RNAs (mRNAs) by complementary sequence binding, leading to cleavage of the target mRNA (Carthew & Sontheimer,

12 2009). A key feature of miRNA is that their sequences are usually conserved between different plant species (Bartel, 2004). siRNAs, on the other hand, originate from double strand RNA (dsRNA) precursors and are also incorporated into RISCs to suppress target expression. The genomic loci of siRNA transcripts are often associated with transposons and repeat regions, and a single dsRNA precursor can give rise to multiple mature siRNAs, making siRNA sequences highly divergent. It is commonly found that siRNAs are auto-silencing, meaning that siRNAs silence the expression of the same loci where the siRNAs originated from (Bartel, 2004). In addition to the posttranscriptional silencing pathways like miRNAs, siRNA also inhibit target expression by direct interaction with the genome through histone modification or DNA methylation (Bartel, 2004).

In polyploids, it is proposed that miRNAs mediate differential gene expression, while siRNAs are responsible for genome stability (Ha et al., 2009; Ng et al., 2012). In both natural and resynthesized Arabidopsis allotetraploids, many miRNAs show non- additive expression when compared to the mid-parent value, and such variation in miRNA expression can lead to variation in target gene expression (Ha et al., 2009). In addition, although many miRNA are highly conserved, sequence variances and potentially function specification can exist between parental species; when the different miRNAs are combined into the same polyploid, a more complicated regulatory network is formed. Moreover, within the polyploid, miRNAs may show target preference towards mRNAs from one parent, leading to biased degradation of homeologous targets, as shown in Arabidopsis (Ha et al., 2009).

Expression of siRNAs from transposons and repetitive sequence loci maintains the silencing of these regions and thus the stability of the genome (Ng et al., 2012). When

13 small RNA profiles were compared between newly formed allohexaploid wheat

(BBAADD) and the two parents BBAA and DD, it was found that TE associated 24-nt siRNAs were downregulated in the polyploid comparing to the mid-parent value (Kenan-

Eichler et al., 2011). Such downregulation of siRNAs can result in activation of transposons and genetic changes in the polyploids.

Objectives of research

Poa annua is an important component in various ecosystems, and is a long term

“frienemy” to the turf industry. Despite decades of research on its evolutionary origin, it still remains an uncertainty. In order to better understand this species, as well as to facilitate the greens-type Poa annua breeding program at Penn State University, the first objective of this dissertation is to examine the basic genetics of Poa annua. The controversy in determining the origin of Poa annua arose when Koshy (Koshy, 1968) observed potential chromosomal rearrangements. Such phenomena have been reported in a number of polyploid plant species (Song et al., 1995; Pontes et al., 2004) in recent studies. With the origin of Poa annua clarified, the second objective of this dissertation is therefore to identify these potential chromosomal rearrangements in Poa annua by comparing its genome to those of its parental species. Small RNAs play profound regulatory roles in plant development, and are also believed to participate in polyploid evolution. Therefore, the third objective is to generate and compare small RNA profiles of both annual and perennial types of Poa annua, as well as the two diploid progenitors.

The goal of this research is to study the genetics and evolution of the polyploid Poa

14 annua in an effort to provide some insights into explaining its phenotypic variation and adaptability, and also enhance our understanding of mechanisms involved with plant polyploid evolution.

15 References

Aamlid TS, Landschoot PJ, Huff DR. 2009. Tolerance to simulated ice encasement and Microdochium nivale in USA selections of greens-type Poa annua. Acta Agriculturae Scandinavica, Section B - Plant Soil Science 59: 170–178. Adams KL, Cronn R, Percifield R, Wendel JF. 2003. Genes duplicated by polyploidy show unequal contributions to the transcriptome and organ-specific reciprocal silencing. Proceedings of the National Academy of Sciences of the United States of America 100: 4649–4654. Adams KL, Percifield R, Wendel JF. 2004. Organ-specific silencing of duplicated genes in a newly synthesized cotton allotetraploid. Genetics 168: 2217–2226. Adams KL, Wendel JF. 2005. Polyploidy and genome evolution in plants. Current opinion in plant biology 8: 135–141. Ainouche ML, Fortune PM, Salmon A, Parisod C, Grandbastien M-A, Fukunaga K, Ricou M, Misset M-T. 2009. Hybridization , polyploidy and invasion: lessons from Spartina (Poaceae). Biological Invasions 11: 1159–1173. Ainouche ML, Jenszewski E. 2010. Focus on polyploidy. New Phytologist 186: 1–4. Bartel DP. 2004. MicroRNAs!: genomics, biogenesis, mechanism, and function. Cell 116: 281–297. Bella EM. 2011. Invasion prediction on Alaska trails: distribution, habitat, and trail use. Invasive Plant Science and Management 4: 296–305. Bertrand A, Castonguay Y, Azaiez A, Hsiang T, Dionne J. 2011. Cold-induced responses in annual bluegrass genotypes with differential resistance to pink snow mold (Microdochium nivale). Plant science 180: 111–119. Bottley A, Xia GM, Koebner RMD. 2006. Homoeologous gene silencing in hexaploid wheat. The Plant journal 47: 897–906. Carthew RW, Sontheimer EJ. 2009. Origins and mechanisms of miRNAs and siRNAs. Cell 136: 642–655. Chaudhary B, Flagel L, Stupar RM, Udall JA, Verma N, Springer NM, Wendel JF. 2009. Reciprocal silencing, transcriptional bias and functional divergence of homeologs in polyploid cotton (Gossypium). Genetics 182: 503–517. Chelaifa H, Monnier A, Ainouche M. 2010. Transcriptomic changes following recent natural hybridization and allopolyploidy in the salt marsh species Spartina x townsendii and Spartina anglica (Poaceae). New Phytologist 186: 161–174. Chen ZJ. 2007. Genetic and epigenetic mechanisms for gene expression and phenotypic variation in plant polyploids. Annual review of plant biology 58: 377–406. Chen ZJ. 2010. Molecular mechanisms of polyploidy and hybrid vigor. Trends in plant science 15: 57–71.

16 Chwedorzewska KJ. 2008. Poa annua L. in Antarctic: searching for the source of introduction. Polar Biology 31: 263–268. Chwedorzewska KJ, Bednarek PT. 2012. Genetic and epigenetic variation in a cosmopolitan grass Poa annua from Antarctic and Polish populations. Polish polar research 33: 63–80. Comai L, Tyagi AP, Winter K, Holmes-Davis R, Reynolds SH, Stevens Y, Byers B. 2000. Phenotypic instability and rapid gene silencing in newly formed Arabidopsis allotetraploids. The Plant cell 12: 1551–1567. Cook T. 2008. Annual bluegrass, Poa annua L. Dai J, Schlossberg MJ, Huff DR. 2008. Salinity tolerance of 33 greens-type Poa annua experimental lines. Crop Science 48: 1187–1192. Darmancy H, Gasquez J. 1997. Spontaneous hybridization of the putative ancestors of the allotetraploid Poa annua. New Phytologist 136: 497–501. Dionne J, Rochefort S, Huff DR, Desjardins Y, Bertrand A, Castonguay Y. 2010. Variability for freezing tolerance among 42 ecotypes of green-type annual bluegrass. Crop Science 50: 321–336. Doyle JJ, Flagel LE, Paterson AH, Rapp RA, Soltis DE, Soltis PS, Wendel JF. 2008. Evolutionary genetics of genome merger and doubling in plants. Annual review of genetics 42: 443–461. Ellis WM. 1973. The breeding system and variation in populations of Poa annua L . Evolution 27: 656–662. Frenot Y, Gloaguen J., Massé L, Lebouvier M. 2001. Human activities, ecosystem disturbance and plant invasions in subantarctic Crozet, Kerguelen and Amsterdam Islands. Biological Conservation 101: 33–50. Gaeta RT, Pires JC. 2010. Homoeologous recombination in allopolyploids: the polyploid ratchet. New Phytologist 186: 18–28. Ha M, Lu J, Tian L, Ramachandran V, Kasschau KD, Chapman EJ, Carrington JC, Chen X, Wang X-J, Chen ZJ. 2009. Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids. Proceedings of the National Academy of Sciences of the United States of America 106: 17835–17840. Han FP, Fedak G, Ouellet T, Liu B. 2003. Rapid genomic changes in interspecific and intergeneric hybrids and allopolyploids of Triticeae. Genome 46: 716–723. Hegarty MJ, Hiscock SJ. 2008. Genomic clues to the evolutionary success of polyploid plants. Current biology 18: R435–444. Heide OM. 2001. Flowering responses of contrasting ecotypes of Poa annua and their putative ancestors Poa infirma and Poa supina. Annals of Botany 87: 795–804. Hemp A. 2008. Introduced plants on Kilimanjaro: tourism and its impact. Plant Ecology 197: 17–29.

17 Henry GM, Brosnan JT, Breeden GK, Cooper T, Beck LL, Straw CM. 2012. Indaziflam programs for weed control in overseeded bermudagrass turf. HortTechnology 22: 774–777. Hovin AW. 1957. Variations in annual bluegrass. The golf course reporter 25: 18–19. Hovin AW. 1958. Meiotic chromosome pairing in amphihaploid Poa annua L. American Journal of Botany 45: 131–138. Huff DR. 1998. The case for Poa annua on golf course greens. Golf Course Management: 54–56. Huff DR. 2003. Annual bluegrass (Poa annua L.). In: Casler MD, Duncan RR, eds. Turfgrass biology, genetics, and breeding. Hoboken, New Jersy: John Wiley and Sons, 39–51. Huff DR. 2006. Developing annual bluegrass cultivars for putting greens. USGA turfgrass and environment research: 73–77. Hutchinson CS, Seymour GB. 1982. Poa annua L. Journal of ecology 70: 887–901. Johnson PG. 1995. Genetics and physiology of flowering in Poa annua L. Johnson PG, Ruemmele BA, Velguth P, White DB, Ascher PO. 1993. An overview of Poa annua L. reproductive biology. International turfgrass society research journal 7: 798–804. Kenan-Eichler M, Leshkowitz D, Tal L, Noor E, Melamed-Bessudo C, Feldman M, Levy AA. 2011. Wheat hybridization and polyploidization results in deregulation of small RNAs. Genetics 188: 263–272. Koshy TK. 1968. Evolutionary origin of Poa annua L. in the light of karyotypic studies. Genome 10: 112–118. Law R, Bradshaw AD, Putwain PD. 1977. Life-history variation in Poa annua. Evolution 31: 233–246. Lim KY, Soltis DE, Soltis PS, Tate J, Matyasek R, Srubarova H, Kovarik A, Pires JC, Xiong Z, Leitch AR. 2008. Rapid chromosome evolution in recently formed polyploids in Tragopogon (Asteraceae). PloS one 3: e3353. Lush WM. 1988a. Biology of Poa annua in a temperate zone golf putting green (Agrostis stolonifera/Poa annua) I. The above-ground population. Journal of applied ecology 25: 977–988. Lush WM. 1988b. Biology of Poa annua in a temperate zone golf putting green (Agrostis stolonifera/Poa annua) II. The seed bank. Journal of applied ecology 25: 989–997. La Mantia JM. 2009. Genomic analysis of life history traits, disease resistance and evolutionary origins of the greens-type Poa annua L. La Mantia JM, Huff DR. 2011. Instability of the greens-type phenotype in Poa annua L. Crop Science 51: 1784–1792.

18 Mcelroy JS, Walker RH, Wehtje GR, van Santen E. 2004. Annual bluegrass (Poa annua) populations exhibit variation in germination response to temperature , photoperiod , and fenarimol. Weed Science 52: 47–52. Mitich LW. 1998. Annual bluegrass (Poa annua L.). Weed Technology 12: 414–416. Molina-Montenegro MA, Carrasco-Urra F, Rodrigo C, Convey P, Valladares F, Gianoli E. 2012. Occurrence of the non-native annual bluegrass on the Antarctic mainland and its negative effects on native plants. Conservation biology 26: 717– 723. Nannfeldt JA. 1937. The chromosome numbers of Poa sect. Ochlopoa A. & Gr. and their taxonomical significance. Botaniska Notiser: 238–254. Ng DW-K, Lu J, Chen ZJ. 2012. Big roles for small RNAs in polyploidy, hybrid vigor, and hybrid incompatibility. Current opinion in plant biology 15: 154–61. Olech M, Chwedorzewska K. 2011. The first appearance and establishment of an alien vascular plant in natural habitats on the forefield of a retreating galcier in Antarctica. Antarctic Science 23: 153–154. Otto SP. 2007. The evolutionary consequences of polyploidy. Cell 131: 452–462. Parisod C, Alix K, Just J, Petit M, Sarilar V, Mhiri C, Ainouche M, Chalhoub B, Grandbastien M-A. 2010. Impact of transposable elements on the organization and function of allopolyploid genomes. New Phytologist: 37–45. Petit M, Guidat C, Daniel J, Denis E, Montoriol E, Bui QT, Lim KY, Kovarik A, Leitch AR, Grandbastien M-A, et al. 2010. Mobilization of retrotransposons in synthetic allotetraploid tobacco. New Phytologist 186: 135–147. Pietsch R. 1989. Poa supina (Schrad.) und seine bedeutung für sport-und gebrauchsrasen. (Poa supina and its value for sports and amenity turf). Zeitschrift Fur Vegetationstechnik 12: 21–24. Pontes O, Neves N, Silva M, Lewis MS, Madlung A, Comai L, Viegas W, Pikaard CS. 2004. Chromosomal locus rearrangements are a rapid response to formation of the allotetraploid Arabidopsis suecica genome. Proceedings of the National Academy of Sciences of the United States of America 101: 18240–18245. Soltis DE, Soltis PS. 1999. Polyploidy: recurrent formation and genome evolution. Trends in ecology & evolution 14: 348–352. Song K, Lu P, Tang K, Osborn TC. 1995. Rapid genome change in synthetic polyploids of Brassica and its implications for polyploid evolution. Proceedings of the National Academy of Sciences of the United States of America 92: 7719–7723. Turgeon AJ. 2004. Turfgrass Management. Upper Saddle River, New Jersey: Prentice Hall. Tutin TG. 1952. Origin of Poa annua L. Nature 169: 160. Tutin TG. 1957. A contribution to the experimental taxonomy of Poa annua L. Watsonia 4: 1–10.

19 Wang J, Tian L, Lee H-S, Wei NE, Jiang H, Watson B, Madlung A, Osborn TC, Doerge RW, Comai L, et al. 2006. Genomewide nonadditive gene regulation in Arabidopsis allotetraploids. Genetics 172: 507–517. Youngner VB. 1959. Ecological Studies on Poa annua in Turfgrasses. Grass and Forage Science 14: 233–237. Zhang J, Yu C, Pulletikurti V, Lamb J, Danilova T, Weber DF, Birchler J, Peterson T. 2009. Alternative Ac/Ds transposition induces major chromosomal rearrangements in maize. Genes & Development 23: 755–765.

20

Chapter 2

The evolutionary origin of Poa annua L.

Qing Mao and David R. Huff*

Dept. Crop and Soil Sciences, Pennsylvania State University, University Park, PA 16802.

*Corresponding author ([email protected]).

Keywords: Poa infirma, Poa supina, allotetraploid, phylogenetic, statistical parsimony network analysis, genomic designation.

Note 1: This manuscript was previously published as Qing Mao and David R. Huff (2012) Crop Science 52: 1910-1922. doi: 10.2135/cropsci2012.01.0016. Reprinted with permission. Note 2: The reference format has been adjusted to maintain a consistent style for this dissertation.

21 Abstract

Poa annua L. is one of the world’s most widely distributed plant species and is ecologically and economically important both as a weed and as a forage and turfgrass.

Determining the evolutionary origin of Poa annua would provide valuable insight into understanding its wide distribution and extreme phenotypic variability. The objective of the present study is to use single copy nuclear DNA sequences trx and CDO504 and chloroplast sequences ndhF and trnTLF to discern the evolutionary origin of Poa annua from all other possible origins. Here we show that the homeologous nuclear DNA sequences present within Poa annua are inseparable from their respective orthologs within Poa supina and Poa infirma and therefore could not have been contributed by any other Poa species. We confirm that Poa infirma served as the maternal parent and provide evidence that at least two interspecific hybridizations gave rise to Poa annua.

Our data also suggest that the polyploid origin of Poa annua would be considered recent on an evolutionary time scale. Once the parental species of Poa annua have been identified, we were able to re-examine previously published cytological data and present evidence for the genomic designations of Poa infirma as II and Poa supina as SS, making the genomic constitution of the allotetraploid Poa annua as IISS. The results of this research place new emphasis on chromosomal rearrangements that likely took place during the evolution origin of Poa annua.

22 Background

Poa annua L. is one of the most ubiquitous and enigmatic plant species in the world. Commonly known as annual bluegrass in the Americas, annual meadowgrass in

Europe, and wintergrass in Australasia, Poa annua can be found growing in remote subarctic meadows at over 69o N latitude (Heide, 2001), on subantarctic islands as far south as 60o S latitude (Frenot et al., 1999; Chwedorzewska, 2008; Shaw et al., 2010), and on Mount Kilimanjaro located near the equator at 3o S (Hemp, 2008). Its occurrence is often associated with human activities and it can become common in arable lands, meadows, pastures, gardens, lawns, sports fields, and urban landscapes and pavements in temperate climates world-wide (Tutin, 1957; Godefroid & Koedam, 2007; Melander et al., 2009; Huff, 2010). Generally in these agricultural and urban systems, Poa annua is considered an invasive weed and is among the top ten weed species researched in seed bank and emergence studies (Gardarin et al., 2009). On the other hand, Poa annua is also an ecologically important food source for many organisms including earthworms (Curry

& Schmidt, 2007), migratory waterfowl (Best & Arcese, 2009), and numerous arthropods

(Hutchinson & Seymour, 1982), making it an important component of the ecosystem

(Marshall et al., 2003; Storkey, 2006; Makowski et al., 2007). For humans, Poa annua also has many important uses including the prevention of soil erosion and nitrogen loss in

Japan (Mihara, 2006), as a component of rural road surfaces in China (Cao et al., 2006), and as an economically important pasture grass for sheep and cattle owing to its low herbivore defense and high feeding value (Massey et al., 2007). As a species, Poa annua is morphologically highly variable and displays a continuum between an annual growth

23 habit form, Poa annua L. f. annua Timm., and a more perennial form, Poa annua L. f. reptans (Hausskn.) T. Koyama; this latter form has become an economically important component of the golf industry world-wide (Huff, 2003, 2010). Law (Law et al., 1977) utilized the extreme variation in Poa annua growth habit to demonstrate basic principles of life-history characteristics and hence, Poa annua has also served as a model organism for research in population ecology (van Groenendael et al., 1994; Demetrius et al., 2006) and rhizosphere ecology (Kardol et al., 2007). Thus, Poa annua is both a noxious, invasive weed species to be controlled and a valuable plant species in terms of biodiversity and human utility. Whether our aim is to eradicate or to utilize Poa annua, a better understanding of its basic biology should be useful (Beard et al., 1978).

Determining the evolutionary origin of Poa annua would provide greater insight into understanding its extreme morphological variability and extensive adaptability.

Several different origins have been proposed for this species. Originally, Litardière

(1939; in Tutin, 1957) proposed an autopolyploid origin from a genomic doubling of Poa infirma Kunth. [syn. Poa exilis (Tomm.) Murb.], while more recently Pietsch (Pietsch,

1989) proposed an allotetraploid origin between Poa supina Schard. and Poa trivialis L..

Nannfeldt (Nannfeldt, 1937) was the first to propose an allotetraploid origin for Poa annua between the species Poa supina and Poa infirma. He observed that “Poa annua occupies an exactly intermediate position” between Poa supina and Poa infirma in terms of morphology and cytology. Tutin (Tutin, 1952, 1957) further supported Nannfeldt’s theory through morphological measurements and cytological investigation of hybrid progeny between Poa annua and either parental species and between the parental species themselves. In addition, Tutin (Tutin, 1957) suggested that the extreme morphological

24 variability and extensive distribution and adaptability of Poa annua most likely resulted from multiple hybridizations with presumably Poa supina serving as the female parent.

At odds with Nannfeldt’s theory is the highly detailed karyotypic investigation by Koshy

(Koshy, 1968) which interestingly casts doubt on Poa infirma and Poa supina as the two parental species of Poa annua. Koshy (Koshy, 1968) demonstrated that the karyotype of

Poa annua did not correspond to the expected karyotype based on those of the two putative parents and thus concluded that either 1) extensive structural modification had occurred to the chromosomes of Poa annua since its origin or, 2) that one of the parents

(either Poa supina or Poa infirma) was correct but that the second parental set of chromosomes was contributed by an unknown, and perhaps extinct, species. Subsequent studies on the evolutionary origin of Poa annua, including the inheritance of isozyme patterns in hybrid progeny between Poa supina and Poa infirma (Darmancy & Gasquez,

1997) and daylength and vernalization flowering requirements of all three species (Heide,

2001), provide additional evidence for the allotetraploid origin of Poa annua from the two putative parents Poa supina and Poa infirma. However, neither study was able to dispute Koshy’s (Koshy, 1968) assertion that one of the two parents of Poa annua represents an unknown species.

Poa is the largest genus within the grass family Poacea and is characterized as being highly reticulated(Soreng, 1990; Gillespie et al., 2008; Soreng et al., 2010). Poa annua is a member of the Poa subgenus Ochlopoa (Ascherson & Graebner) Hylander section Micrantherae Stapf [syn. section Ochlopoa (Ascherson & Graebner) H. Schloz], which has repeatedly been shown to be monophyletic within the genus Poa based on morphology (Nannfeldt, 1937; Tutin, 1957) and molecular genetic markers (Soreng,

25 1990; Gillespie & Soreng, 2005; Gillespie et al., 2008). DNA sequence diversity has been shown to be increasingly useful for phylogenetic analysis within Poa (Davis &

Soreng, 2007; Gillespie et al., 2008; Soreng et al., 2010). Specifically, the single-copy nuclear DNA sequences trx and CDO504 and chloroplast sequences ndhF and trnTLF have been demonstrated to be particularly well suited (Patterson et al., 2005). Several phylogenetic analyses within Poa have included Poa annua and one but not both of the putative parental species (Gillespie & Soreng, 2005; Patterson et al., 2005; Gillespie et al., 2008). A recent phylogenetic analysis by Soreng et al. (Soreng et al., 2010) using trnTLF plastid sequences and ITS nuclear sequences included all three species and showed an extremely close cytoplasmic relationship between Poa annua and Poa infirma and an equally close nuclear relationship between Poa annua and Poa supina but they were not able to demonstrate a nuclear component within Poa annua corresponding to

Poa infirma.

The objective of the present study is to use single copy nuclear DNA sequences trx and CDO504 and chloroplast sequences ndhF and trnTLF (Patterson et al., 2005) to discern the evolutionary origin of Poa annua from all other possible origins.

Materials and Methods

Plant material

Seeds of Poa infirma (kindly provided by S. Fei, Iowa State University) and Poa supina (collected by D.R. Huff) were germinated on moist filter paper in petri dishes at

26 22-25°C in the dark. Seedlings were then transplanted into greenhouse potting soil

(Promix, Premier Horticulture, Inc., Quakertown, PA, USA). Seeds of Poa annua

(obtained by D.R. Huff) from 10 different regions, including Arizona, California,

Maryland, New York, Pennsylvania, Quebec, Scotland, Sweden, Washington and Wales, were germinated and transplanted into greenhouse potting soil. A composite of Poa annua plants was selected at random from these 10 regional collections, and designated as “greenhouse composite”. All three species were grown in the greenhouse (27°C high;

17°C low) under natural day length.

Flow cytometry

Flow cytometry was performed with a method modified from Doležel et al.

(Doležel et al., 2007). Young, fully expanded leaves weighing 100 mg were collected and finely chopped in petri dishes containing 1 ml of freshly made chopping buffer (per liter:

2.46 g MgSO4, 3.7 g KCl, 1.2 g Hepes, pH adjusted to 8.0 with 1 N KOH, 1.0 g

Dithiothreitol, 2.5 ml Triton X-100) [modified from (Costich et al., 1991)]. Chopping buffer containing leaf nuclei was filtered through 30 µm nylon mesh into test tubes. Each tube was centrifuged at 200 g for 5 min and nuclei pellet was resuspended in 500 µl of fresh chopping buffer with the addition of 12 mg/L of RNAse and 100 mg/L propidium iodide. Tubes were incubated at 37°C for 15 min, after which, 4 µl of chicken erythrocyte nuclei (CEN) singlets (Biosure®, Grass Valley, CA) (2C DNA known as content 2.5 pg) was added into each tube, serving as an internal control for each sample. Samples were analyzed at 488 nm with a Coulter Epics XL-MCL flow cytometer (Beckman-Coulter

27 Inc., Miami, FL). For each sample, the plant nuclear 2C DNA content, measured in picograms, was determined by the equation: plant 2C DNA content = (plant sample peak mean / CEN peak mean) x CEN 2C DNA content

A total of ten samples from each species were run on two different days to calculate mean 2C DNA content for each species.

DNA extraction

DNA was extracted from four randomly selected individuals of Poa infirma, Poa supina, and the greenhouse composite of Poa annua. Total DNA was extracted with a modified CTAB method (Doyle & Doyle, 1990). Fresh leaf tissue was collected and ground in liquid nitrogen. CTAB solution (1.5 M NaCl, 100 mM Tris-HCl pH 8.0, 20 mM EDTA, 1% CTAB, 1% β-mercaptoethanol) of 900 µl was added into each sample, mixed by vortexing and incubated at 65°C for 60 min, while inverting the tubes every 10 min. Chloroform:isoamylalcohol (24:1) of 500 µl was added, and the tubes were inverted continuously for 5 min and then centrifuged at 13,000 rpm for 10 min. The supernatant was transferred into a new tube containing 600 µl ice-cold isopropanol, kept on ice for 1 hr, and then centrifuged at 13,000 rpm for 15 min. The DNA pellet was washed with 70% ethanol and dissolved with 200 µL TE buffer (10 mM Tris-HCl pH 8.0, 0.1 mM EDTA).

28 DNA amplification, cloning and sequencing

PCR reactions of the two nuclear genes trx and CDO504 and the two chloroplast genes ndhF and trnTLF were performed with an Applied Biosystems 2720 Thermal

Cycler (Applied Biosystems, Foster City, California) using the same conditions as described in Patterson et al. (2005). PCR products were then gel purified using a Promega

Gel and PCR Clean-up Kit (Promega, Madison, Wisconsin). PCR reactions were performed using the DNA templates from each of the four individuals from each species, and the four PCR reactions for each species were pooled, and subsequently cloned with a

TOPO TA Cloning Kit (Invitrogen, Carlsbad, California). Single colonies were picked and screened for correct insertions by PCR. Plasmids were extracted using a Purelink

Plasmid Miniprep Kit (Invitrogen, Carlsbad, California) and sequenced at Penn State

Genomics Core Facility (University Park, PA) using primers M13U and M13Rev.

The trx (thioredoxin-like) nuclear gene was partially amplified using primers

Trx2F (5’- CNTATCCNCAACTCATGTTCTT) and Trx2R (5’-

CGGATGTCCCATGTTGAGC) (Patterson et al., 2005). The CDO504 nuclear gene was amplified using primers CDO504F1 (5’- CCGATGCTATGGCACAAGGT) and

CDO504R1 (5’- CGGTGCTGGTGAAGAGAACT) (Patterson et al., 2005). The 3’ end of the chloroplast ndhF gene was amplified using primers ndhF-F1318 (5’-

GGATTAACYGCATTTTATATGTTTCG) and ndhF-R2110 (5’-

CCCCCTAYATATTTGATACCTTCTCC) (Olmstead & Sweere, 1994; Patterson et al.,

2005). The chloroplast DNA region between trnT and trnF, including trnTL spacer, trnL gene and trnLF spacer, was amplified using primers “a” (5’- CATTACAAATGCGATG-

29 CTCT) and “f” (5’- ATTTGAACTGGTGACACGAG) (Taberlet et al., 1991; Patterson et al., 2005). In addition, sequences of the chloroplast gene trnTLF were obtained from two individuals of each of the ten regional collections of Poa annua. The trnTLF primers “c”

(5’- CGAAATCGGTAGACGCTACG) and “d” (5’- GGGGATAGAGGGGACTTGA-

AC) (Taberlet et al., 1991) were also used for sequencing when necessary.

Sequence alignment and phylogenetic analyses

DNA sequences used for phylogenetic analyses are listed in Table 2-1. ClustalW of MEGA4 (Tamura et al., 2007) was used to align sequences with parameters as follows: Gap Opening Penalty 15, Gap Extension Penalty 6.66 and Transition Weight

0.9. Gaps were removed from the alignments. Akaike Information Criterion (AIC) of

Modeltest3.7 (Posada & Crandall, 1998) was used to select the best-fit model of evolution for each of these genes for phylogenetic analyses. The estimated optimal models were utilized to construct maximum parsimony (MP) and maximum likelihood

(ML) trees using PAUP 4.0b10 (Swofford, 2003). Heuristic searches were performed with random addition of sequences and tree bisection-reconnection (TBR) branch- swapping. 10,000 and 500 replications were run for MP and ML, respectively. If multiple trees were inferred as the most parsimonious, the one having the same structure as the

ML tree was selected to be presented in this paper. To estimate the support of the branches, MP bootstrap (Felsenstein, 1985) was conducted using PAUP4.0b10

(Swofford, 2003) with 10,000 replicates, each consisting of 10 random-addition-sequence heuristic searches, with TBR branch-swapping on and the multree option off. Mean net

30 genetic distances among Poa infirma, Poa supina, and Poa annua sequences were calculated with MEGA4 (Tamura et al., 2007) using the Jukes-Cantor model. Statistical parsimony network analyses were performed on sequences of Poa infirma, Poa supina, and Poa annua with TCS1.21 (Clement et al., 2000). Gaps were removed before analysis, and confidence intervals were set to be 95%.

Results

Species comparisons of Poa infirma, Poa supina, and Poa annua

For most morphological, phenological, and life history characteristics, the greenhouse composite of Poa annua was found to possess a wide range of values that overlapped those of Poa infirma and Poa supina (Table 2-2). Of all the traits examined, anther length and DNA content were the most reliable for distinguishing among the three species. Anther lengths presented here are in agreement with previous measurements of the three species by Tutin (Tutin, 1957). Chromosome number was also observed to be reflective of the known ploidy levels (Table 2-2). In contrast, DNA content of all three species reported here are different from those reported by Bennett (Bennett, 1972) within the plant DNA C-values Database (http://data.kew.org/cvalues/). DNA content of Poa infirma was found to be substantially higher than Poa supina, while Poa annua was found to be approximately additive of the DNA contents of Poa infirma and Poa supina.

31 Phylogenetic analyses of nuclear genes trx and CDO504

Poa annua was observed to generate two different sized PCR products when using trx primers whereas, Poa infirma and Poa supina each generated only a single product (Fig. 2-1). The sizes of the two nuclear trx products amplified in tetraploid Poa annua corresponded to the same sized fragments amplified in either of the diploid species: Poa infirma (smaller fragment) and Poa supina (larger fragment) (Fig. 2-1).

Similarly, PCR amplification of the nuclear DNA sequence CDO504 displayed two distinctly different amplicon products from Poa annua while only a single amplicon was produced for each of the two diploid species, Poa infirma and Poa supina. Differences between the two Poa annua CDO504 amplicons were less noticeable in terms of fragment size but were distinctly different in DNA sequence.

The two CDO504 sequences (a and b) cloned from Poa annua cleanly separated into two distinct clusters for both maximum parsimony (MP) and maximum likelihood

(ML) phylogenetic analyses; of which, only the MP tree is presented (Fig. 2-2). One of the Poa annua CDO504 sequences (sequence-b) tightly clustered with CDO504 sequences derived from Poa infirma while the other (sequence-a) tightly clustered with

CDO504 sequences derived from Poa supina (Fig. 2-2). CDO504 sequences from the distantly related species of Poa bulbosa, Poa alpina and Poa ligulata were found to be intermediate in genetic distance between Poa annua and Poa trivialis sequences when the grass species Phalaris arundinacea was used as the tree root (Fig. 2-2). A similar phylogenetic tree structure was observed for the nuclear DNA sequence trx (Fig. 2-2).

One of the two Poa annua trx sequences (sequence-b, the smaller of the two in Fig. 2-1)

32 was observed to tightly cluster with trx sequences obtained from Poa infirma; whereas, the other (sequence a, the larger of the two in Fig. 2-1) tightly clustered with trx sequences from Poa supina (Fig. 2-2). The trx sequences from distantly related species

Poa bulbosa, Poa alpina, and Poa ligulata were also found to be intermediate in genetic distance between Poa annua and Poa trivialis sequences when the grass species Phalaris arundinacea was used as the tree root (Fig. 2-2).

The distinctly different homeologs of nuclear DNA sequences CDO504 and trx from Poa annua were each found to be nested within the corresponding sequences of either Poa infirma or Poa supina (Fig. 2-2). These results suggest that the distinctly different forms of nuclear DNA sequences from Poa annua are orthologous to those corresponding sequences from either Poa infirma or Poa supina, and the nested properties of those orthologs provide evidence that Poa infirma and Poa supina were the parental species that gave rise to Poa annua (Doyle & Egan, 2010).

Phylogenetic analyses of chloroplast genes trnTLF and ndhF

Amplification of the two chloroplast sequences, trnTLF and ndhF, each yielded only a single product from each species Poa annua, as well as, from either Poa infirma or

Poa supina. Phylogenetic analyses (MP and ML) of the chloroplast sequences trnTLF and ndhF displayed an overall structure similar to the two nuclear sequences, across all

Poa species examined (Fig. 2-2; only MP presented). Chloroplast sequences from the distantly related species of Poa bulbosa, Poa alpina and Poa ligulata were again found to be intermediate in genetic distance between Poa annua and Poa trivialis sequences for

33 both genes when the grass species Phalaris arundinacea was used as the tree root (Fig. 2-

2). The phylogenetic analyses of trnTLF included additional sequences from the

Ochlopoa Section members Poa cookii and Poa flabelata which were found to be more closely related to Poa annua than were sequences from Poa bulbosa, Poa alpina, and

Poa ligulata (Fig. 2-2) and supports similar findings by Gilllespie et al. (Gillespie et al.,

2008). However, unlike the nuclear sequences, Poa annua exhibited only a single chloroplast sequence for both trnTLF and ndhF and each of these Poa annua sequences clustered only with those sequences obtained from Poa infirma (Fig. 2-2). Furthermore, the chloroplast sequences trnTLF and ndhF of Poa annua were observed to be nested within Poa infirma sequences (Fig. 2-2), suggesting that Poa infirma served as the maternal parent in the hybridization event that led to the formation of Poa annua.

Genetic distances among Poa infirma, Poa supina, and Poa annua

To further investigate the orthologous relationships among sequences from Poa infirma, Poa supina, and Poa annua, statistical analyses were performed on genetic distances using MEGA4 (Tamura et al., 2007). For these distance calculations, only those sequences from the three species were included in the alignments. For the two nuclear genes trx and CDO504, the mean net genetic distances between Poa annua sequences and their corresponding parental orthologs were either negative or close to zero (Table 2-

3). For the two chloroplast genes ndhF and trnTLF, the mean net genetic distances between Poa annua sequences and Poa infirma sequences were close to zero. All remaining non-orthologous homologs displayed substantially larger genetic distances

34 (Table 2-3). Those negative or close to zero net genetic distances between the orthologs further confirm that Poa infirma and Poa supina are the parents of Poa annua and that

Poa infirma was the seed bearing parent in the hybridization event(s).

Statistical parsimony network analyses

Statistical parsimony network analysis of the two nuclear genes CDO504 and trx statistically separated sequences into two significantly different (p<0.05) network clusters for each gene; one cluster being sequences of Poa annua “a” and sequences of Poa supina, and the other cluster being sequences of Poa annua “b” and sequences of Poa infirma (Fig. 2-3A&B). Within each orthologous cluster, individual sequences are connected by solid lines representing a single nucleotide change. Small solid black bars represent unsampled haplotypes within the network; sampled haplotypes with identical sequences are contained within unshaded rectangular boxes. The statistical separation of sequences into two distinctly different network clusters further demonstrates the orthologous relationship of Poa annua “a” sequences with Poa supina sequences, and

Poa annua “b” sequences with Poa infirma sequences.

The genomic contribution of the parental species Poa infirma and Poa supina to the genome of Poa annua may have occurred from a single or from multiple hybridization events. Our network analysis results indicated that at least two independent hybridization events have contributed to the evolution of Poa annua. In other words, for each nuclear gene, and each parental species, two pathways were observed to govern the contribution of parental species sequences to the hybrid species Poa annua. For instance,

35 the CDO504 “a” sequences in Poa annua could have originated from either Poa supina

2x-3 pathway or Poa supina 2x-1 pathway. The CDO504 “b” sequences in Poa annua could have originated from either Poa infirma 2x-2, -5, -6, -8 pathway or Poa infirma 2x-

3, -4 pathway. Similarly, the trx “a” sequences in Poa annua could have originated from either Poa supina 2x-2 pathway or Poa supina 2x-3 pathway. The trx “b” sequences in

Poa annua could have originated from either Poa infirma 2x-4 pathway or Poa infirma

2x-1 pathway.

Network analysis of the chloroplast sequence trnTLF exhibited a statistically significant (p<0.05) separation of the Poa infirma and Poa annua sequence cluster from the Poa supina sequence cluster (Poa supina cluster not shown) (Fig. 2-3C). The structure of the Poa infirma and Poa annua sequence cluster also showed the potential for two independent chloroplast contribution pathways from Poa infirma to Poa annua; namely, Poa infirma 2x-4 pathway or Poa infirma 2x-1, -2, -3 pathway (Fig. 2-3C). The trnTLF Poa infirma 2x-4 sequence appears to be associated with a group of Poa annua sequences comprising Asia, western North America, and northeastern North America.

Sequences Poa infirma 2x-1, -2, or -3 appear to be associated with Poa annua sequences originating from the British Isles, Scandinavia, east coast of North America, and west coast of North America. Despite these observed associations, no clear phylogeographical structure was discernible. For example, the two Poa annua California (CA) sequences were further separated from each other than either was from the Poa annua China (CHN) sequence. The same relationship was observed for the two Poa annua Wales (WAL) sequences compared to the China (CHN) sequence. This lack of support for distinct phylogeographical structure in Poa annua trnTLF sequences may be the result of a small

36 sample size, the self-pollination breeding system of Poa annua (Koshy, 1969), a high rate of migration caused by human activities, or a combination of these factors.

Results from ndhF gene network analysis were not shown due to the limited data and the resulting lack of resolution.

Discussion

The origin of Poa annua

The results of the present study demonstrate that the diploid species Poa infirma and Poa supina served as the parents for the allotetraploid Poa annua, with Poa infirma contributing the plastid genome and both Poa infirma and Poa supina contributing to the nuclear genome. Therefore, our results support and confirm the hypothesized origin of

Poa annua proposed by Nannfeldt (Nannfeldt, 1937) and Tutin (Tutin, 1952, 1957), including multiple hybrid origins, with the exception that it was Poa infirma, and not Poa supina, that served as the female parent participating in the multiple hybrid origins. The fact that Poa infirma was found to serve as the female parent of Poa annua in the present study is confirmation of the same result first observed by Soreng et al. (Soreng et al.,

2010).

The nested properties of sequences in the phylogenetic trees, the low-value of net genetic distances among orthologous sequences, and the clustering of the identical sequences within network analyses all indicate a present day origin of Poa annua (Doyle

& Egan, 2010). The problem of assigning a specific date for the origin of the

37 hybridization event(s) is complicated by several factors including multiple origins and the coalescent effect (Doyle & Egan, 2010). The hybridization that led to the formation of

Poa annua is likely to have occurred in Western Europe during the Quaternary glaciation period as first proposed by Tutin (Tutin, 1957) and possibly as recent as the Würm glacial stage which ended approximately 10,000 years ago in western Europe (Hobbs, 1946;

Clayton et al., 2006). The hybridization event likely occurred as the glaciers moved Poa supina from the Alps closer to the Mediterranean regions where Poa infirma inhabits and both parental species probably experienced genetic bottlenecks during that process.

Given the recent origin of Poa annua, it seems remarkable to us how quickly it has expanded its range to become one of the most widely distributed plant species in the world, while the range of its parents remain relativity restricted. Further studies are needed to explain Poa annua’s remarkable ability to adapt to new environments.

Genomic designation of Poa infirma and Poa supina

Genome similarity between parental species is capable of being assessed by examining chromosome pairing in amphihaploids of polyploid species. Now that we are certain that Poa infirma and Poa supina are the two parental species of Poa annua, we can re-analyze previously published cytological data of Poa annua amphihapoids to give us more insights into the genomes of the two parental species. Hovin (Hovin, 1958) examined bivalent chromosome pairing in four accessions of Poa annua amphihapoids grown under six different environmental conditions (Table 2-4). He examined over 1,645 pollen mother cells and observed an average of 1.8 rod bivalents per cell with an overall

38 range of 0 to 4 rod bivalents per cell. Hovin (Hovin, 1958) did not observe any ring bivalent chromosome structures in the amphihaploids but regularly observed such structures in tetraploid Poa annua. Following Wang (Wang, 1989, 1992), we have calculated that Hovin’s (1958) observations correspond to a c-value, or the frequency of chiasma per chromosome arm, of 0.13 (Table 2-4). According to Wang (Wang, 1989,

1992), the genomes of corresponding amphihaploid hybrids within the grass tribe

Tritaceae are considered the same genome if c > 0.5 and are designated distinct genomes if c < 0.5. With a measured c-value of 0.13 in the Poa annua amphihaploids, the two genomes that comprise Poa annua, namely Poa infirma and Poa supina, should be considered as separate and distinct genomes (Fig. 2-4). Soreng et al. (Soreng et al., 2010) also noted a large separation between Poa infirma and Poa supina within their phylogenetic tree remarking that the branch length between these two species was the longest observed within their analysis of the Poa genus. In addition, the cytological analyses of Nannfeldt (Nannfeldt, 1937) and Tutin (Tutin, 1952, 1957) involving triploid hybrids between Poa infirma x Poa annua and between Poa supina x Poa annua reported the occurrence of only 7 bivalents and 7 univalents and did not report any multivalent formations, further indicating the distinctiveness of the parental genomes. Given these results along with those of the present study, we have designated the genomes of Poa infirma as II and Poa supina as SS making the genomic constitution of the allotetraploid

Poa annua as IISS (Fig. 2-5).

39 Chromosomal rearrangements in Poa annua

The present study rejects Koshy’s (Koshy, 1968) hypothesis that the evolutionary origin of Poa annua involved an unknown, and perhaps extinct, species. Our results demonstrate that Poa annua DNA sequences were not significantly different from the corresponding orthologs present in either Poa infirma or Poa supina. Thus, if an unknown, or perhaps extinct, species had served as one of the parents of Poa annua as postulated by Koshy (Koshy, 1968), then its DNA sequences would also not be significantly different from either Poa infirma or Poa supina, making this “unknown” species indistinguishable from one of these two species. Therefore, our results conclude that Poa infirma and Poa supina are the parental diploid species of allotetraploid Poa annua.

Future work may now focus on explaining Koshy’s (Koshy, 1968) alternative hypothesis that extensive karyotypic modification has occurred in Poa annua since its origin. Chromosomal rearrangements have been observed in other polyploid plant species

(Volkov et al., 1999; Ozkan et al., 2001; Pontes et al., 2004; Lim et al., 2007). It has been shown in hybrid Poa jemtlandica with the genomic in situ hybridization (GISH) technique that chromosomal rearrangements can occur in allopolyploid Poa species

(Brysting et al., 2000). It is not clear, however, what regulatory mechanisms control chromosomal rearrangements in polyploids. It has been shown that homeologous recombination (Gaeta & Pires, 2010; Koh et al., 2010) and/or an increased activity of transposable elements (Parisod et al., 2010; Petit et al., 2010) may be responsible for chromosomal rearrangements in polyploids. In addition, we speculate that chromosomal

40 rearrangements that occur during polyploid evolution might also involve epigenetic mechanisms.

Recently, the phenotypic instability of a dwarf-type Poa annua has been suggested to result from an epigenetic mechanism (La Mantia & Huff, 2011). Thus, if chromosomal rearrangements in Poa annua are also associated with increased epigenetic activity as a result of polyploid formation then studying the underlying cause of chromosomal rearrangements may help to further explain the wide distribution of Poa annua compared to its parental species. Artificial hybrids between Poa supina and Poa infirma have been made in separate studies and neither has shown differences between the reciprocal crosses, in terms of morphology and isozyme patterns (Tutin, 1957;

Darmancy & Gasquez, 1997). It has long been thought that Poa supina served as the maternal parent based on the flowering structures of the two parental species (Tutin,

1957). However, molecular phylogenetics has always identified Poa infirma as the maternal parent of Poa annua [(Soreng et al., 2010) and current study] using a wide range of accessions from across the world. It has been suggested that chromosomal rearrangements during the formation of allopolyploids might be preferentially affected by either the maternal or paternal parental species (Doyle et al., 2008). If such differential effects occur in Poa annua, it may help explain why Poa infirma seems to be the preferred female parent and possibly give a basis for any potential epigenetic activities associated with a fitness advantage. We propose using fluorescent in situ hybridization

(FISH) and GISH to further characterize chromosomal rearrangements in Poa annua compared to its parents, to help explain Poa annua’s high variability, wide distribution, and strong colonizing ability.

41 Acknowledgements

This work was funded by the United States Golf Association (USGA), the

Pennsylvania Turfgrass Council (PTC), and Hatch Project PA 4401.

42 References

Beard JB, Rieke PE, Turgeon AJ, Vargas JM. 1978. Annual bluegrass (Poa annua L.) Description, adaptation, culture and control research report 352. East Lansing. Bennett MD. 1972. Nuclear DNA content and minimum generation time in herbaceous plants. Proceedings of the Royal Soceity of London. Series B, Biological Sciences 181: 109–135. Best RJ, Arcese P. 2009. Exotic herbivores directly facilitate the exotic grasses they graze: mechanisms for an unexpected positive feedback between invaders. Oecologia 159: 139–150. Brysting AK, Holst-Jensen A, Leitch I. 2000. Genomic origin and organization of the hybrid Poa jemtlandica (Poaceae) verified by genomic in situ hybridization and chloroplast DNA sequences. Annals of Botany 85: 439–445. Cao CS, Chen L, Gao W, Chen Y, Yan M. 2006. Impact of planting grass on terrene roads to avoid soil erosion. Landscape and Urban Planning 78: 205–216. Chwedorzewska KJ. 2008. Poa annua L. in Antarctic: searching for the source of introduction. Polar Biology 31: 263–268. Clayton L, Attig JW, Mickelson DM, Johnson MD, Syverson KM. 2006. Glaciation of Wisconsin. Educational Series 36 (3rd edition). Clement M, Posada D, Crandall KA. 2000. TCS: a computer program to estimate gene genealogies. Molecular Ecology 9: 1657–1659. Costich DE, Meagher TR, Yurkow EJ. 1991. A rapid means of sex identification in Silene latifolia by use of flow cytometry. Plant Molecular Biology Reporter 9: 359– 370. Curry JP, Schmidt O. 2007. The feeding ecology of earthworms – A review. Pedobiologia 50: 463–477. Darmancy H, Gasquez J. 1997. Spontaneous hybridization of the putative ancestors of the allotetraploid Poa annua. New Phytologist 136: 497–501. Davis JI, Soreng RJ. 2007. A preliminary phylogenetic analysis of the grass subfamily Pooideae (Poaceae), with attention to structural features of the plastid and nuclear genomes, including an intron loss in GBSSI. Aliso 23: 335–348. Demetrius L, Kowald A, Ziehe M. 2006. Critique of directionality theory. Proceedings of the Royal Society B: Biological Sciences 273: 1183–1186. Doležel J, Greilhuber J, Suda J. 2007. Estimation of nuclear DNA content in plants using flow cytometry. Nature protocols 2: 2233–2244. Doyle JJ, Doyle JL. 1990. A rapid total DNA preparation procedure for fresh plant tissue authors. Focus 12: 13–15.

43 Doyle JJ, Egan AN. 2010. Dating the origins of polyploidy events. New Phytologist 186: 73–85. Doyle JJ, Flagel LE, Paterson AH, Rapp RA, Soltis DE, Soltis PS, Wendel JF. 2008. Evolutionary genetics of genome merger and doubling in plants. Annual review of genetics 42: 443–461. Felsenstein J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39: 783–791. Frenot Y, Aubry M, Misset MT, Gloaguen JC, Gourret JP, Lebouvier M. 1999. Phenotypic plasticity and genetic diversity in Poa annua L. (Poaceae) at Crozet and Kerguelen Islands (subantarctic). Polar Biology 22: 302–310. Gaeta RT, Pires JC. 2010. Homoeologous recombination in allopolyploids: the polyploid ratchet. New Phytologist 186: 18–28. Gardarin A, Dürr C, Colbach N. 2009. Which model species for weed seedbank and emergence studies? A review. Weed Research 49: 117–130. Gillespie LJ, Soreng RJ. 2005. A phylogenetic analysis of the bluegrass genus Poa based on cpDNA restriction site data. Systematic Botany 30: 84–105. Gillespie LJ, Soreng RJ, Bull RD, Jacobs SWL, Refulio-rodriguez NF. 2008. Phylogenetic relationships in subtribe Poinae (Poaceae , Poeae) based on nuclear ITS and plastid trnT–trnL–trnF sequences. Botany 86: 938–967. Godefroid S, Koedam N. 2007. Urban plant species patterns are highly driven by density and function of built-up areas. Landscape Ecology 22: 1227–1239. Van Groenendael J, Kroon H de, Kalisz S, Tuljapurkar S. 1994. Loop analysis: evaluating life history pathways in population projection matrices. Ecology 75: 2410–2415. Heide OM. 2001. Flowering responses of contrasting ecotypes of Poa annua and their putative ancestors Poa infirma and Poa supina. Annals of Botany 87: 795–804. Hemp A. 2008. Introduced plants on Kilimanjaro: tourism and its impact. Plant Ecology 197: 17–29. Hobbs WH. 1946. The Eurasian continental glacier of the late Pleistocene. Science 104: 105–106. Hovin AW. 1958. Meiotic chromosome pairing in amphihaploid Poa annua L. American Journal of Botany 45: 131–138. Huff DR. 2003. Annual bluegrass (Poa annua L.). In: Casler MD, Duncan RR, eds. Turfgrass biology, genetics, and breeding. Hoboken, New Jersy: John Wiley and Sons, 39–51. Huff DR. 2010. Bluegrasses. In: Boller B, Posselt UK, Veronesi F, eds. Fodder Crops and Amenity Grasses (Handbook of Plant Breeding). Springer Science, 345–379. Hutchinson CS, Seymour GB. 1982. Poa annua L. Journal of ecology 70: 887–901.

44 Kardol P, Cornips NJ, van Kempen MML, Bakx-Schotman JMT, van der Putten WH. 2007. Microbe-mediated plant-soil feedback causes historical contingency effects in plant community assembly. Ecological Monographs 77: 147–162. Koh J, Soltis PS, Soltis DE. 2010. Homeolog loss and expression changes in natural populations of the recently and repeatedly formed allotetraploid Tragopogon mirus (Asteraceae). BMC genomics 11: 97. Koshy TK. 1968. Evolutionary origin of Poa annua L. in the light of karyotypic studies. Genome 10: 112–118. Koshy TK. 1969. Breeding systems in annual bluegrass, Poa annua L. Crop Science 9: 40–43. Law R, Bradshaw AD, Putwain PD. 1977. Life-history variation in Poa annua. Evolution 31: 233–246. Lim KY, Kovarik A, Matyasek R, Chase MW, Clarkson JJ, Grandbastien MA, Leitch AR. 2007. Sequence of events leading to near-complete genome turnover in allopolyploid Nicotiana within five million years. New Phytologist 175: 756–763. Makowski D, Dore T, Gasquez J, Munier-Jolain N. 2007. Modelling land use strategies to optimise crop production and protection of ecologically important weed species. Weed Research 47: 202–211. La Mantia JM, Huff DR. 2011. Instability of the greens-type phenotype in Poa annua L. Crop Science 51: 1784–1792. Marshall EJP, Brown VK, Boatman ND, Lutman PJW, Squire GR, Ward LK. 2003. The role of weeds in supporting biological diversity within crop fields. Weed Research 43: 77–89. Massey FP, Ennos AR, Hartley SE. 2007. Grasses and the resource availability hypothesis: the importance of silica-based defences. Journal of Ecology 95: 414– 424. Melander B, Holst N, Grundy AC, Kempenaar C, Riemens MM, Verschwele A, Hansson D. 2009. Weed occurrence on pavements in five North European towns. Weed Research 49: 516–525. Mihara M. 2006. The effect of natural weed buffers on soil and nitrogen losses in Japan. Catena 65: 265–271. Nannfeldt JA. 1937. The chromosome numbers of Poa sect. Ochlopoa A. & Gr. and their taxonomical significance. Botaniska Notiser: 238–254. Olmstead RG, Sweere JA. 1994. Combining data in phylogenetic systematics: an empirical approach using three molecular data sets in the Solanaceae. Systematic Biology 43: 467–481. Ozkan H, Levy AA, Feldman M. 2001. Allopolyploidy-induced rapid genome evolution in the wheat (Aegilops–Triticum) group. The Plant cell 13: 1735–1747.

45 Parisod C, Alix K, Just J, Petit M, Sarilar V, Mhiri C, Ainouche M, Chalhoub B, Grandbastien M-A. 2010. Impact of transposable elements on the organization and function of allopolyploid genomes. New Phytologist: 37–45. Patterson JT, Larson SR, Johnson PG. 2005. Genome relationships in polyploid Poa pratensis and other Poa species inferred from phylogenetic analysis of nuclear and chloroplast DNA sequences. Genome 48: 76–87. Petit M, Guidat C, Daniel J, Denis E, Montoriol E, Bui QT, Lim KY, Kovarik A, Leitch AR, Grandbastien M-A, et al. 2010. Mobilization of retrotransposons in synthetic allotetraploid tobacco. New Phytologist 186: 135–147. Pietsch R. 1989. Poa supina (Schrad.) und seine bedeutung für sport-und gebrauchsrasen. (Poa supina and its value for sports and amenity turf). Zeitschrift Fur Vegetationstechnik 12: 21–24. Pontes O, Neves N, Silva M, Lewis MS, Madlung A, Comai L, Viegas W, Pikaard CS. 2004. Chromosomal locus rearrangements are a rapid response to formation of the allotetraploid Arabidopsis suecica genome. Proceedings of the National Academy of Sciences of the United States of America 101: 18240–18245. Posada D, Crandall KA. 1998. Modeltest: testing the model of DNA substitution. Bioinformatics 14: 817–818. Shaw JD, Spear D, Greve M, Chown SL. 2010. Taxonomic homogenization and differentiation across Southern Ocean Islands differ among insects and vascular plants. Journal of Biogeography 37: 217–228. Soreng RJ. 1990. Chloroplast-DNA phylogenetics and biogeography in a reticulating group: study in Poa (Poaceae). American Journal of Botany 77: 1383–1400. Soreng RJ, Bull RD, Gillespie LJ. 2010. Phylogeny and reticulation in Poa based on plastid trnTLF and nrITS sequences with attention to diploids. In: Seberg, Petersen, Barfod, Davis, eds. Diversity, Phylogeny, and Evolution in the Monocotyledons. Denmark: Aarhus University Press, 619–643. Storkey J. 2006. A functional group approach to the management of UK arable weeds to support biological diversity. Weed Research 46: 513–522. Swofford DL. 2003. PAUP*. Phylogenetic analysis using parsimony (*and Other Methods) Version 4. Sinauer Associates. Taberlet P, Gielly L, Pautou G, Bouvet J. 1991. Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant molecular biology 17: 1105– 1109. Tamura K, Dudley J, Nei M, Kumar S. 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular biology and evolution 24: 1596–1599. Tutin TG. 1952. Origin of Poa annua L. Nature 169: 160.

46 Tutin TG. 1957. A contribution to the experimental taxonomy of Poa annua L. Watsonia 4: 1–10. Volkov RA, Borisjuk N V, Panchuk II, Schweizer D, Hemleben V. 1999. Elimination and rearrangement of parental rDNA in the allotetraploid Nicotiana tabacum. Molecular biology and evolution 16: 311–320. Wang RR-C. 1989. An assessment of genome analysis based on chromosome pairing in hybrids of perennial Triticeae. Genome 32: 179–189. Wang RR-C. 1992. Genome relationships in the perennial Triticeae based on diploid hybrids and beyond. Hereditas 116: 133–136.

47

Table 2-1. DNA sequences of the two nuclear loci (CDO504 and trx) and the two chloroplast loci (ndhF and trnTLF) examined in the present study. GenBank accession numbers in bold represent sequences generated from the present study.

CDO504 trx ndhF trnTLF ID GenBank No. ID GenBank No. ID GenBank No. ID Origin GenBank No. Poa annua L. a1 JN030917 a1 JN030896 1 JN030939 AZ1 Arizona JN030949 a2 JN030918 a2 JN030897 2 JN030940 AZ2 Arizona JN030950

a3 AY589205 a3 JN030898 3 JN030941 CA1 California JN030951

b1 JN030919 a4 JN030899 4 AY589095 CA2 California JN030952

b2 JN030920 a5 JN030900 MD1 Maryland JN030953

b3 JN030921 a6 JN030901 MD2 Maryland JN030954

b4 JN030922 a7 AY589270 NY1 New York JN030955

b5 JN030923 b1 JN030902 NY2 New York JN030956

b6 JN030924 b2 JN030903 PA1 Pennsylvania JN030957

b7 JN030925 b3 JN030904 PA2 Pennsylvania JN030958

b8 JN030926 b4 JN030905 QC1 Quebec JN030959

b9 JN030927 b5 AY589271 QC2 Quebec JN030960

b10 JN030928 SCT1 Scottland JN030961

b11 AY589206 SCT2 Scottland JN030962

SWE1 Sweden JN030963

SWE2 Sweden JN030964

WA1 Washington JN030965

WA2 Washington JN030966

WAL1 Wales JN030967

48

WAL2 Wales JN030968

ghs JN030969

1 AY589123

2 Canada DQ353983

3 China EU792452

Poa infirma Kunth. 1 JN030929 1 JN030906 1 JN030942 1 Spain JN030970 2 JN030930 2 JN030907 2 JN030943 2 Spain JN030971 3 JN030931 3 JN030908 3 JN030944 3 Spain JN030972 4 JN030932 4 JN030909 4 Spain GQ324427 5 JN030933 5 JN030910 6 JN030934 7 JN030935 8 JN030936

Poa supina Schrad. 1 JN030937 1 JN030911 1 JN030945 1 Germany JN030973 2 JN030938 2 JN030912 2 JN030946 2 Germany JN030974 3 AY589204 3 JN030913 3 JN030947 3 AY589147 4 JN030914 4 JN030948 4 DQ353984 5 JN030915 5 AY589096 6 JN030916 7 AY589269

Poa alpina L. a AY589202 a AY589258 1 AY589097 1 AY589122 b AY589203 b AY589266 2 DQ786861 2 DQ353986 3 DQ353985

Poa bulbosa L. a AY589209 a AY589253 AY589098 1 AY589127 b AY589210 b AY589267 2 GQ324404 c AY589212 c AY589268

Poa cookii (Hook. 1 EU792454

49 f.) Hook. f. 2 EU792455

Poa flabellata (Lam.) 1 DQ353982 Raspail 2 EU792453

Poa trivialis L. AY589170 AY589265 AY589119 AY589148

Poa hybrida Gaudin. AY589162 AY589281 AY589109 AY589130

Poa ligulata Boiss. AY589201 AY589254 AY589099 AY589134

Puccinellia glaucescens AY589120 1 AY589141 (Phil.) Parodi 2 DQ353960

Phalaris arundinacea L. AY589219 AY589291 AY589121 AY589138

50

Table 2-2. Comparison of Poa infirma, Poa supina, and Poa annua for various traits and characteristics.

Life Growth Vernalization Inflorescence Anther Chromosome 2C Species history habit requirement† branching length number¶ DNA (mm) ‡, § content (pg) ‡, #

Poa infirma annual bunch-type none multiple 0.42 14 diploid 2.52 (±0.066) (±0.06)

Poa supina perennial stoloniferous required single 1.64 14 diploid 1.49 (±0.119) (±0.08)

Poa annua variable variable variable 1-2 0.86 28 tetraploid 3.88 (±0.115) (±0.18)

† Darmency and Gasquez, 1997; Heide, 2001.

‡ ± Std. Deviation.

§ N = 40 for Poa infirma, 36 for Poa supina, and 76 for Poa annua.

¶ Nannfeldt, 1937 and current study.

# N = 10 for each species.

51 Table 2-3. Mean net genetic distances (K; lower diagonal) and associated standard errors (upper diagonal italics) between orthologs from the allotetraploid Poa annua and the diploids Poa supina and Poa infirma for the two nuclear DNA sequences (CDO504 and trx) and the two chloroplast DNA sequences (trnTLF and ndhF). Mean distances of corresponding parental orthologs are in bold. Means and standard errors were calculated using the Jukes-Cantor model in MEGA4.

Nuclear sequences: CDO504 P. annua-a P. annua-b P. infirma P. supina P. annua-a - 0.01295 0.01294 0.00036 P. annua-b 0.09994 - 0.00005 0.01294 P. infirma 0.09973 (-0.00007) - 0.01293 P. supina (-0.00051) 0.10027 0.10002 -

trx P. annua-a P. annua-b P. infirma P. supina P. annua-a - 0.01760 0.01760 0.00028 P. annua-b 0.14232 - 0.00015 0.01782 P. infirma 0.14241 (-0.00016) - 0.01783 P. supina 0.00034 0.14385 0.14393 -

Chloroplast sequences: trnTLF P. annua P. infirma P. supina P. annua - 0.00030 0.00313 P. infirma 0. 00031 - 0.00309 P. supina 0.01392 0.01388 -

ndhF P. annua P. infirma P. supina P. annua - 0.00000 0.00441 P. infirma 0.00000 - 0.00442 P. supina 0.01585 0.01587 -

52 Table 2-4. Mean and range of c-values for different amphihaploid accessions of Poa annua derived from cytological data of Hovin (1958). Each accession was grown and examined under different environmental conditions (2 to 6 environments per accession) and the number of rod versus ring bivalents were recorded. The total number of pollen mother cells (PMCs) examined per accession was pooled across environments. C-values (frequency of chiasma per chromosome arm) were calculated following Wang (1992) as the number of chiasma divided by twice the base number of chromosomes (i.e. 2 x 7 = 14).

Amphihaploid Accessions 1 2 3 4 Overall

Mean c-value 0.16 0.15 0.04 0.14 0.13

Range of c- 0.12-0.21 0.12-0.19 0.03-0.06 0.12-0.17 0.03-0.21 values

Number of 622 540 264 219 1,645 PMCs

! 53 !

!

! ! ! M!! Pa! !Pa! !Pa!! Pa!! Pi! Pi! Pi! Pi! Ps! Ps! Ps! Ps! (2CTL)! ! bp! 676! ! ! 517! ! 460! 396! ! !

!

Figure 2-1. PCR amplification of nuclear sequence trx from four individuals of Poa annua (Pa) (lanes 2-5), four individuals of Poa infirma (Pi) (lanes 6-9), and four individuals of Poa supina (Ps) (lanes 10-13). Lane 14: negative control with no DNA template in the PCR reaction. Lane M = molecular size ladder. bp = base pair.

54

Poa annua b1 ! Poa annua a1 Poa annua b2 ! Poa annua a3 Poa annua b3 Poa annua a4 A Poa annua b4 ! B Poa annua a6 CDO504 Poa annua b5 ! trx Poa supina 1 (nuclear) Poa annua b6 (nuclear) Poa supina 2 Poa annua b7 ! Poa supina 3 Poa annua b8 ! Poa supina 4 !!64! Poa annua b9 ! 100! Poa supina 5 Poa annua b10 Poa supina 6 Poa annua b11 !!!!!!!!!!!!!! Poa supina 7 Poa infirma 1 ! Poa annua a2 Poa infirma 2 Poa annua a5 !100! Poa infirma 4 ! 67! Poa annua a7 Poa infirma 5 ! Poa annua b1 Poa infirma 6 ! !!62! Poa annua b2 Poa infirma 7 Poa infirma 1 100! Poa ifnirma 8 ! Poa annua b3 Poa infirma 3 ! 100! Poa annua b4 Poa annua a1 67! Poa annua b5 Poa annua a2 ! Poa infirma 2 100! Poa annua a3 ! Poa infirma 3 Poa supina 1 ! Poa infirma 4 Poa supina 2 Poa infirma 5 Poa supina 3 ! 99! Poa alpina 2 91! Poa alpina 1 88! Poa bulbosa 2 97! ! Poa ligulata 84! Poa bulbosa 3 !!!55! Poa alpina 2 ! 100! Poa alpina 1 100! Poa bulbosa 1 ! 95! Poa bulbosa 1 Poa bulbosa 2 Poa ligulata Poa bulbosa 3 ! Poa trivialis Poa trivialis ! Poa hybrida Poa hybrida ! Phalaris arundinacea Phalaris arundinacea ! 5 5 ! !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

! ! ! ! ! ! ! !!!!!!!!!!!!!! ! ! ! ! ! ! ! 55 ! ! ! ! ! ! ! ! ! Poa annua ghs Poa annua 1 ! Poa annua 2 ! Poa annua 3 !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Poa infirma 1 Poa infirma 2 C 70! Poa infirma 3 D 99! trnTLF 62! Poa infirma 4 ndhF Poa annua 1 Poa supina 1 Poa annua 2 (chloroplast) Poa supina 2 (chloroplast) Poa annua 3 67! 94! Poa supina 3 Poa annua 4 94! Poa supina 4 Poa infirma 1 92! Poa cookii1 Poa infirma 2 99! Poa cookii2 Poa infirma 3 99! Poa flabelata 1 Poa supina 2 98! Poa flabelata 2 Poa supina 1 99! Poa alpina 1 Poa supina 3 84! Poa alpina 2 Poa supina 4 99! 59! Poa alpina 3 Poa supina 5 100! Poa bulbosa 1 Poa alpina 1 72! Poa bulbosa 2 82! Poa alpina 2 88! Poa ligulata Poa bulbosa 70! 78! Poa trivialis Poa ligulata Poa hybrida 92! Poa trivialis Puccinellia glaucescens 1 Poa hybrida Puccinellia glaucescens 2 Puccinellia glaucescens Phalaris arundinacea Phalaris arundinacea

5 2

Figure 2-2. Maximum parsimony trees for nuclear sequences CDO504 (A) and trx (B) and chloroplast sequences trnTLF (C) and ndhF (D).

56

! A - CDO504 4x$b2! 4x$b3! 4x$b9! ! 4x$b8! 4x$b1! 4x$b4! 4x$b6! ! 4x$a2! 4x$a1! 4x$b5! 4x$b10! ! ! ! 2x#1$ 4x$a3! 2x#3$ 4x$b7! 2x$2! 2x$5! 2x$6! 2x$8! ! 2x#2$ ! 4x$b11! 2x$1! ! 2x$7! ! ! 2x$3! ! 2x$4! B - trx 4x$a2! ! ! ! 4x$a4! 4x$b4! 4x$b1! 4x$a3! 4x$a1! 4x$b2! ! 4x$a7! 4x$a5! ! ! 4x$a6! 2x#2$ 4x$b5! 2x$4! 2x$1! ! 4x$b3! ! ! 2x#3$ ! 2x#1$ 2x#4$ 2x#6$ 2x#7$ 2x#5$ 2x$2! 2x$3! 2x$5! ! ! !

57

! ! ! C - trnTLF !!CA1! WAL1! !!NY1! ! !!CA2! ! ! !SCT1! WAL2! !!AZ1! !!!!1! !!PA1! !!PA2! ! ! ! !!ghs! !!AZ2! !QC1! !QC2! !MD1! !MD2! !!NY2! ! ! !WA1! !WA2! !CHN! !!CAN! !SCT2! SWE1! SWE2!

2x14! 2x13! 2x12!

2x11!

Figure 2-3. Statistical parsimony network analysis of nuclear sequences CDO504 (A) and trx (B), and the chloroplast sequence trnTLF (C). Individual haplotypes of Poa annua are represented by shaded squares, Poa infirma by white circles, and Poa supina by black circles.

58

1.0! 0.98! Diploid!Hordeum(bulbosum(HbHb! ! !

0.!82! Lolium(perenne(x!Lolium(multiflorum(LpLm! Same!genome! !

0.5 0.!40! Triticum(monococcum(x!Triticum(tauschii(AD! ! 0.!32! Triticum! (speltoides(x!Triticum(monococcum(AB! ! Different!genomes! ! 0.!15! Genera(Critesion(vs(Thinopyrum(! JH( ! 0.(13( !Poa$infirma$x(Poa$supina( 0.0! ( (

Figure 2-4. Scale of c-values (frequency of chiasma per chromosome arm) depicting genomic designations of various grass species following Wang (1989, 1992).

59

! !

! ! ! Female!parent! Male!parent! ! Poa!infirma!!!x!!!Poa!supina!

! (II)!!! (SS)!!! ! ! ! Amphihaploid!

! (IS)!!! ! Whole!genome! ! doubling! ! ! Poa!annua!

! (IISS)!!! ! !

Figure 2-5. Schematic representation of the origin of Poa annua including the genomic designations of Poa infirma, Poa supina, and Poa annua.

60

Chapter 3

Chromosomal rearrangements in Poa annua

Background

Polyploidy plays an important and widespread role in plant speciation and evolution (Soltis & Soltis, 1999; Adams & Wendel, 2005). Polyploidy increases genetic and phenotypic complexity, and has profound impacts on biodiversity of ecosystems

(Ainouche & Jenszewski, 2010). Recent studies on polyploid plant species have revealed that polyploid, especially allopolyploid formation is not simple additive effects, but induces a wide range of unexpected effects, including genomic and gene expression changes, activation of transposable elements, and epigenetic changes (Doyle et al., 2008).

Genomic changes following polyploidization were first observed in synthesized allopolyploid Brassica (Song et al., 1995), and later in Arabidopsis (Pontes et al., 2004),

Nicotiana (Lim et al., 2007; Koukalova et al., 2010), and wheat (Han et al., 2003).

Poa annua (2n=4x=28) is an ecologically and economically important turfgrass species with its origin elucidated as a recently evolved allotetraploid between two diploid species Poa infirma (2n=2x= 14) and Poa supina (2n=2x=14) (Mao & Huff, 2012). A detailed karyotypic investigation performed by Koshy found that the chromosome structure of Poa annua did not match the addition of these two parental species (Koshy,

1968). According to the karyotype description of Poa infirma and Poa supina by

Nannfeldt (Nannfeldt, 1937), these two parental species have very similar genomic

61 structure, and each has two pairs of large chromosomes, one pair of medium sized chromosomes and four pairs of small chromosomes. Koshy’s study discovered that the observed karyotype of Poa annua was different from expected; it had only two pairs of large chromosomes, and the smallest chromosome in Poa annua does not have any counterpart in either parent (Koshy, 1968) (Figure 3-1). These findings show that extensive chromosomal rearrangements must have occurred during the polyploid origin and/or evolution of Poa annua.

Fluorescent in situ hybridization (FISH) is a technique that helps characterizing chromosomal specificity and genomic organization by detecting sequence-specific DNA loci. A number of recent studies using FISH with ribosomal DNA (rDNA) probes have provided valuable information on polyploid genome evolution. Loss, translocation and rearrangements of parental rDNA in polyploids have been observed in Arabidopsis

(Pontes et al., 2004), Oryza (Chung et al., 2008), and Tragopogon (Lim et al., 2008). The aim of this study is to detect rDNA loci associated chromosomal rearrangements in Poa annua, in an effort to enhance our understanding of the underlying mechanism for the evolution of this species.

Materials and Methods

Plant materials

Seeds of Poa infirma (kindly provided by S. Fei, Iowa State University), Poa supina, and Poa annua (both collected by D.R. Huff) were germinated on moist filter

62 paper in petri dishes at 22-25°C in the dark. Seedlings were then transplanted into greenhouse potting soil (Promix, Premier Horticulture, Inc., Quakertown, PA, USA). All three species were grown in the greenhouse (27°C high; 17°C low) under natural day length.

Chromosome preparations

Root tips were collected and washed with cold H2O, treated with 8- hydroxyquinoline at 4°C for 2-4 hrs in dark, and washed again and kept in ice cold H2O for overnight. They were then fixed in 3:1 (v/v) ethanol: glacial acetic acid for at least 3 days. An optional enzymatic digestion was applied to some root tips right before chromosome preparation, by incubating them in enzyme solution (4% cellulase + 2% pectinase) at 37°C for 1-2 hrs, and washed with cold H2O before adding cold fixative solution again. Chromosome spreads were made using a squashed method in 45% acetic acid. After a brief quality check of the slides, they were flash frozen in liquid nitrogen, cover slips removed and dehydrated with a 70%, 95% and 100% ethanol series, and kept at room temperature (around 20°C).

FISH experiment

Plasmids with either 5S or 45S rDNA insertions were kindly provided by Dr.

Wenli Zhang from University of Wisconsin. The rDNA probes were labeled with

63 Digoxigenin-11-dUTP using DIG-Nick Translation Mix (Roche Applied Science,

Penzberg, Germany).

For in situ hybridization, the chromosome spread on slides were denatured in 70% deionized formamide in 2 x SSC (saline-sodium citrate) buffer at 80°C for 90s, and immediately immersed in ice cold 70%, 95% and 100% ethanol and air dried. The hybridization mixture consisted of 50% deionized formamide, 2 x SSC, 10% dextran sulfate and labeled DNA probe, and was heated for 5-10 min at 90°C to denature the probe before applying to the slides. The hybridization was then kept in a moist chamber at 37°C for overnight. The slides were then washed in 2 x SSC for 5 min at room temperature, for 10 min at 42°C, and then in 1 x PBS (phosphate buffered saline) for 5 min at room temperature.

For probe detection, anti-digoxigenin-rhodamine (Roche Applied Science,

Penzberg, Germany) was applied to the slides and incubated at 37°C for 30 min, followed by three 5 min washes with 1 x TNT, and another 5 min wash in 1 x PBS. The chromosomes were counterstained with DAPI (VECTASHIELD Mounting Medium with

DAPI by Vector Laboratories, Burlingame, CA). Images were taken at Huck Microscopy and Cytometry Facility (University Park, PA) with a fluorescent microscope Olympus

BX61, and were analyzed using ImageJ (http://imagej.nih.gov/ij/index.html). A brief scheme of FISH experiment is illustrated in Figure 3-2.

64 Results

FISH with 5S rDNA probes

Two 5S rDNA loci near telomere region of the chromosomes were detected in

Poa infirma (Figure 3-3 A). In Poa supina, there were also two loci detected, and one of them could be localized to the pericentrometric region of a mid-sized chromosome, while the exact position of the other locus remains unclear (Figure 3-3 B). In Poa annua, four loci were detected, indicating the there is no loss or gain of 5S rDNA. Among these four loci, the position of two loci could be clearly identified; one was at the telomeric region similar to Poa infirma and another was near centromeric region similar to Poa supina

(Figure 3-3 C), both could correspond to a parental contribution. Therefore, with this data, number or location change of 5S rDNA loci in Poa annua was not found.

FISH with 45S rDNA probes

With 45S rDNA probes, the two diploid species Poa infirma and Poa supina each had two loci in the genome (Figure 3-4 A&B). However, good metaphase chromosome spreads from these two species to identify the exact chromosomal position of these loci were not obtained. For one Poa annua individual sampled, two centromeric 45S rDNA were observed (Figure 3-4 C). Interestingly, in another Poa annua individual, three telomeric loci could be pinpointed (Figure 3-4 D). A few conclusions can thus be made based on the 45S rDNA FISH results. Neither Poa annua individual shown here has four loci, the expected number given each parent had two loci, so there must have been gene

65 loss associated with 45S rDNA loci in Poa annua. Between the two Poa annua individuals, the number and position of 45S rDNA loci are different, indicating genomic variation within this species.

Discussion

Genomic changes and chromosomal rearrangements have been reported in a number of polyploid plant species, but the pattern, extent and underlying mechanism are not well understood, and potentially vary greatly among different species. FISH is a useful technique in that it allows locus specific comparison between polyploids and their progenitors. In this study, with 5S rDNA as probe, we found that the number and chromosomal position of 5S rDNA loci in Poa annua did not contradict to the additive pattern of its parental species. With 45S rDNA probes, however, we found that both the number and location of these loci changed when comparing Poa annua to its parents, and when comparing different individuals of Poa annua.

In the future, a more extensive and genome-wide characterization of chromosomal rearrangements in Poa annua may be achieved with the use of multi-color

FISH or genomic in situ hybridization (GISH). For example, different DNA probes can be labeled with different combinations of conjugates, and get simultaneously detected in the same cell. The relative position of multiple probes could greatly enhance our ability to distinguish different chromosomes. GISH, with total genomic DNA from one parental species as the probes could identify the parental-specific contribution in the polyploid. It has already been successfully used in another allopolyploid within the genus Poa and

66 revealed intergenomic translocations in the species Poa jemtlandica (Brysting et al.,

2000).

Gene losses in polyploids have been shown to be sometimes parental biased

(Skalická et al., 2005; Doyle et al., 2008). When probe sequences, such as rDNA sequences are divergent in the two parental species, it is then possible to generate parental specific probes and the homeologous loci can be distinguished within the polyploid. In a recent study on allotetraploid Arabidopsis suecica, multi-color FISH using parental species specific probes of pericentromeric repeats, 45S rRNA gene and 5S rDNA was conducted, and the researchers were able to demonstrate detailed loss, gain, intra- and inter-genomic translocation of rDNA loci (Pontes et al., 2004).

Acknowledgement

I am thankful to Dr. Jiming Jiang and his lab at Department of Horticulture,

University of Wisconsin-Madison, for their FISH technique instruction during their 2010

PCTW workshop and their generous technical assistance afterwards.

67 References

Adams KL, Wendel JF. 2005. Polyploidy and genome evolution in plants. Current opinion in plant biology 8: 135–141. Ainouche ML, Jenszewski E. 2010. Focus on polyploidy. New Phytologist 186: 1–4. Brysting AK, Holst-Jensen A, Leitch I. 2000. Genomic origin and organization of the hybrid Poa jemtlandica (Poaceae) verified by genomic in situ hybridization and chloroplast DNA sequences. Annals of Botany 85: 439–445. Chung M-C, Lee Y-I, Cheng Y-Y, Chou Y-J, Lu C-F. 2008. Chromosomal polymorphism of ribosomal genes in the genus Oryza. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik 116: 745–753. Doyle JJ, Flagel LE, Paterson AH, Rapp RA, Soltis DE, Soltis PS, Wendel JF. 2008. Evolutionary genetics of genome merger and doubling in plants. Annual review of genetics 42: 443–461. Han FP, Fedak G, Ouellet T, Liu B. 2003. Rapid genomic changes in interspecific and intergeneric hybrids and allopolyploids of Triticeae. Genome 46: 716–723. Koshy TK. 1968. Evolutionary origin of Poa annua L. in the light of karyotypic studies. Genome 10: 112–118. Koukalova B, Moraes AP, Renny-byfield S, Matyasek R, Leitch AR, Kovarik A. 2010. Fall and rise of satellite repeats in allopolyploids of Nicotiana over c. 5 million years. New Phytologist 186: 148–160. Lim KY, Kovarik A, Matyasek R, Chase MW, Clarkson JJ, Grandbastien MA, Leitch AR. 2007. Sequence of events leading to near-complete genome turnover in allopolyploid Nicotiana within five million years. New Phytologist 175: 756–763. Lim KY, Soltis DE, Soltis PS, Tate J, Matyasek R, Srubarova H, Kovarik A, Pires JC, Xiong Z, Leitch AR. 2008. Rapid chromosome evolution in recently formed polyploids in Tragopogon (Asteraceae). PloS one 3: e3353. Mao Q, Huff DR. 2012. The evolutionary origin of Poa annua L. Crop Science 52: 1910–1922. Nannfeldt JA. 1937. The chromosome numbers of Poa sect. Ochlopoa A. & Gr. and their taxonomical significance. Botaniska Notiser: 238–254. Pontes O, Neves N, Silva M, Lewis MS, Madlung A, Comai L, Viegas W, Pikaard CS. 2004. Chromosomal locus rearrangements are a rapid response to formation of the allotetraploid Arabidopsis suecica genome. Proceedings of the National Academy of Sciences of the United States of America 101: 18240–18245. Skalická K, Lim KY, Matyasek R, Matzke M, Leitch AR, Kovarik A. 2005. Preferential elimination of repeated DNA sequences from the paternal, Nicotiana

68 tomentosiformis genome donor of a synthetic, allotetraploid tobacco. New phytologist 166: 291–303. Soltis DE, Soltis PS. 1999. Polyploidy: recurrent formation and genome evolution. Trends in ecology & evolution 14: 348–352. Song K, Lu P, Tang K, Osborn TC. 1995. Rapid genome change in synthetic polyploids of Brassica and its implications for polyploid evolution. Proceedings of the National Academy of Sciences of the United States of America 92: 7719–7723.

69

Female!parent! Male!parent! Poa$infirma! !X! Poa$supina!

Amphihaploid!Poa$annua!

Whole!Genome! Doubling! Allotetraploid$Poa$annua!

Expected! Karyotype:!

Observed! Karyotype:!

Figure 3-1. Representation of karyotipic changes in Poa annua. Summarized from (Nannfeldt, 1937) and (Koshy, 1968). Boxes enclosing chromosomes represent differences of chromosome structure between expected and observed karyotypes of Poa annua according to Koshy, 1968.

70

DNA"Probe" Mito3c"Metaphase" Labeling" Chromosomes" Fluorescent"Dye" Conjugated"An3bodies"

Y" Y" Y" Y" Y" Y" Y" Y" Y"

Y" Y" Y" Y" Y" Y" Y" Y" Y" Hybridiza3on"

Stringent"Wash"

Figure 3-2. Scheme of fluorescent in situ hybridization (FISH) experiment.

71

A" B" C"

Poa$infirma$ Poa$supina$ Poa$annua$

Figure 3-3. FISH localization of 5S rDNA loci (red) on chromosomes (blue) of Poa annua and its parental species. (A) Two telomeric loci were detected in Poa infirma. (B) Two centromeric loci were detected in Poa supina. (C) Four loci were detected in Poa annua.

72

A" B"

Poa$infirma$ Poa$supina$

C" D"

Poa$annua$ Poa$annua$

Figure 3-4. FISH localization of 45S rDNA loci (red) on chromosomes (blue) of Poa annua and its parental species. (A) Two loci were detected in Poa infirma. (B) Two loci were detected in Poa supina. (C & D) For the two different Poa annua individuals, one showed two centromeric loci and the other showed three telomeric loci.

73

Chapter 4

Characterizing small RNA profiles of allotetraploid Poa annua L. and its diploid parents

Qing Mao 1, 2 and David R. Huff 1, 2 *

1. Intercollege Graduate Degree Program in Plant Biology, Huck Institute of Life

Sciences, Pennsylvania State University, University Park, PA 16802

2. Department of Plant Science, Pennsylvania State University, University Park, PA

16802

* Corresponding author [email protected]

Note 1: This manuscript has been submitted to BMC Plant Biology. Reprinted with permission. Note 2: The reference format has been adjusted to maintain a consistent style for this dissertation.

74 Abstract

Background:

The allotetraploid origin of an ecologically and economically important species Poa annua L. has only recently been confirmed. A role for small RNAs has been implicated for polyploid evolution. This study was designed to examine the small RNA profiles of

Poa annua and its diploid parental species. Four profiles, Poa infirma, Poa supina, perennial-type Poa annua and annual-type Poa annua were analyzed using three biological replicates representing each profile, resulting in a total of twelve libraries.

Results:

A total of 20,920,659 18-30nt small RNA sequences were obtained from the twelve libraries. 18-30nt small RNA length distributions were compared between biological replicates within each profile, as well as between profiles. Both redundant and unique small RNA length distributions were similar among the four profiles (Cramer’s V < 0.05 for overall profile comparison). A total of 121 conserved microRNAs (miRNAs) belonging to 27 families were identified from the four profiles, and specific patterns in expression levels of these miRNA families were not observed when comparing between these profiles. A total of 79 novel miRNAs were predicted using reference genomes from three model plant species. It was interesting to find that the perennial-type and annual- type Poa annua displayed very similar small RNA profiles, despite their morphological and life history differences. In addition, the small RNA profiles of tetraploid Poa annua were very similar to its diploid parental species as well. The incorporation of biological

75 replicates in our study helped to increase our confidence in the results of our data analyses.

Conclusions:

This is the first report of small RNA profiles in tetraploid Poa annua and its diploid parental species. Although no differences were attributable to the polyploid nature of Poa annua, this study does provide a baseline of small RNA profiles for future research. In order to gain a better understanding of the extraordinary adaptability of Poa annua, future research may focus on examining small RNA profiles from different developmental stages, different environmental stresses, and possibly different agronomical management practices.

Keywords: Poa annua, Poa infirma, Poa supina, biological replicates, polyploid evolution, miRNA, siRNA

76 Background

Poa annua L., commonly known as annual bluegrass, is one of the most widely distributed plant species around the world with both ecological and agricultural importance. It is considered an invasive weed in various ecosystems, including urban and agricultural environments throughout the temperate region (Tutin, 1957; Huff, 2010), near the equator on Mount Kilimanjaro (Hemp, 2008), and has recently caught attention of the general public by its appearance and spread in one of the most isolated ecosystems: subantarctic islands and Antarctic Mainland (Chwedorzewska, 2008; Olech &

Chwedorzewska, 2011; Chown et al., 2012; Molina-Montenegro et al., 2012). One of the attributes that makes Poa annua remarkable is its morphological variability, representing both perennial and annual types (La Mantia & Huff, 2011). While Poa annua is considered a noxious weed for agricultural and urban systems (Gardarin et al., 2009), an extreme of the perennial types called the “greens-type” is economically valuable for the turf industry by providing high quality putting surfaces on golf courses world-wide (Huff,

2003, 2010), and breeding efforts are being made to produce commercial cultivars of these greens-type Poa annua (Dai et al., 2009; Dionne et al., 2010; La Mantia & Huff,

2011).

Partly contributing to the extraordinary variability and adaptability of Poa annua is its genetic diversity. By studying its evolutionary origin, we have recently confirmed that Poa annua is an allotetraploid (2n=4X=28 chromosomes; genome designation IISS) hybrid between the diploid female parent Poa infirma Kunth. [syn. Poa exilis (Tomm.)

Murb.] (2n=2X=14; II) and the diploid male parent Poa supina Schard. (2n=2X=14; SS)

77 (Mao & Huff, 2012). Poa infirma is an annual grass with a short life span, and is naturally distributed in the Mediterranean region of Western Europe. Poa supina, on the other hand, is a perennial grass and is naturally distributed in the mountainous areas of

Central and Northern Europe (Tutin, 1957). It is remarkable, given the restricted distribution of the two parental species that Poa annua has managed to spread throughout the world within a relatively short period of time since its origin, which likely occurred during the last glaciation (Tutin, 1957; Mao & Huff, 2012). It has been shown that the karyotype of Poa annua has undergone intensive rearrangement since its origin (Koshy,

1968; Mao & Huff, 2012), and that the genomes of the two parental species Poa infirma and Poa supina are very distinct despite phylogenetically being in the same Section

Micrantherae Stapf [syn. section Ochlopoa (Ascherson & Graebner) H. Schloz] within the Poa genus (Hovin, 1958; Wang, 1989; Soreng et al., 2010; Mao & Huff, 2012).

Various studies have proposed that small RNAs, primarily miRNAs and small interfering

RNAs (siRNAs), may be associated with polyploid evolution processes (Doyle et al.,

2008; Chen, 2010; Kenan-Eichler et al., 2011; Barber et al., 2012), and therefore it is important to study and make comparisons between the small RNA profiles of Poa annua and its parental species.

Small RNAs are a group of 20-30nt noncoding RNA molecules performing a wide range of regulatory functions in eukaryotes (Carthew & Sontheimer, 2009). Two major categories of small RNAs include miRNAs and siRNAs. Both miRNAs and siRNAs function by incorporating into RNA-induced silencing complexes to repress target expression, with targets recognized by complementary base pairing to the respective small RNA sequences (Bartel, 2004; Axtell, 2008; Carthew & Sontheimer,

78 2009). However, several major distinctions between miRNA and siRNA exist. First, miRNAs are processed from endogenous single-strand hairpin precursors that are transcribed from genomic regions distinct from their targets, while siRNAs are processed from endogenous or exogenous double-strand RNA precursors of various origins, and commonly silence the expression of the same loci where the siRNAs originated from

(Bartel, 2004; Carthew & Sontheimer, 2009; Castel & Martienssen, 2013). Second, miRNAs repress target expression by posttranscriptional pathways. In plants, miRNAs recognize their target mRNAs by nearly perfect complementary binding and lead to cleavage of the mRNA. In animals, with less perfect base pairing, the miRNAs bind to

3’UTR of the target mRNA and more frequently lead to translational repression rather than direct cleavage of the mRNA (Carrington & Ambros, 2003; Bartel, 2004; Carthew

& Sontheimer, 2009). siRNAs, on the other hand, not only repress target expression by posttranscriptional pathways like miRNAs, but also directly repress target expression by interacting with the genome through histone methylation or DNA methylation (Bartel,

2004; Carthew & Sontheimer, 2009; Malone & Hannon, 2009; Castel & Martienssen,

2013).

In plants, miRNAs regulate a wide range of developmental processes, including leaf development, root radial patterning, floral development, and hormonal responses

(Kidner & Martienssen, 2005; Jones-Rhoades et al., 2006; Voinnet, 2009). It has been found that the more conserved miRNAs generally perform fundamental regulatory roles, and are expressed in abundant amounts (Axtell, 2008). In addition to these conserved miRNAs, there are also species-specific novel miRNAs, which are thought to have recently evolved, and are generally expressed in lower abundance (Axtell, 2008). The

79 recent availability of next generation sequencing (NGS) such as Roche 454, ABI SOLiD, and various Illumina platforms has significantly accelerated the process of discovery of new miRNAs. These high-throughput sequencing platforms have made it possible to identify not only the abundant conserved miRNAs, but also presumably non-conserved and lowly expressed miRNAs. A number of studies have been performed to generate miRNA profiles in various plant species with the aid of the NGS techniques, such as

Arabidopsis thaliana (Rajagopalan et al., 2006), Oryza sativa (Sunkar et al., 2008; Morin et al., 2008), Brachypodium distachyon (Zhang et al., 2009; Unver & Budak, 2009), Zea mays (Li et al., 2013; Liu et al., 2013), and in species whose genomes are not fully sequenced, such as Stevia rebaudiana (Mandhan et al., 2012) and Olea europaea (Yanik et al., 2013).

The aim of this research is to examine small RNA profiles of two types of tetraploid Poa annua: perennial-type and annual-type, and to compare them to its two diploid parental species Poa infirma and Poa supina. Each profile is generated from three biological replicates to gain a higher confidence level. For the four profiles combined, a total of 121 conserved miRNAs belonging to 27 families were identified and 79 novel miRNAs were predicted.

80 Results

Small RNA sequencing of Poa annua and its parental species

In order to compare small RNA profiles from tetraploid Poa annua and its diploid parental species, we sampled three individuals to represent each of the following profiles:

(1) Poa infirma (I1, I2, and I3), (2) Poa supina (S1, S2, and S3), (3) perennial-type Poa annua (P1, P2, and P3), and (4) annual-type Poa annua (A1, A2, and A3). A total of twelve small RNA libraries (one for each sampled individual plant) were constructed. A total of 166,462,798 raw reads were generated from the twelve libraries. After removing low quality reads, 159,921,935 reads were kept, of which 20,920,659 were in the length range of 18-30nt. Among the 12 libraries, the number of 18-30nt sequences ranged from

965,588 to 2,407,333 (Table 4-1).

Length distribution of redundant small RNAs

In general, the small RNA length distributions were similar among the four profiles, with highest frequencies at 19nt, 21-22nt and 24nt (Figure 4-1). One observable difference among the four profiles was an overabundance at 19nt in Poa infirma, with a corresponding reduction in 21nt and 24nt, compared to the other profiles. Overall, within each profile the length distribution of 18-30nt sequences was similar among replicates; however, some variations were observed among replicates as well. Within each profile, the replicates exhibited an overall Cramér’s V below 0.1 for each profile, indicating independence among replicates (Table 4-2A). Compared to perennial-type Poa annua

81 (Cramér’s V = 0.037; Table 4-2A), more variation was observed among the replicates of the annua-type Poa annua samples (Cramér’s V = 0.097; Table 4-2A), especially between replicates A2 and A3, representing the highest pairwise Cramér’s V (0.167) among all small RNA libraries (Table 4-2C). Considering that our sequencing depth was not exhaustive, the observed variations could be due to random sampling effects during the sequencing process, varying levels of sequencing depth between samples, and/or, to some extent, the natural variations of small RNA expression existing within these species among different genotypes.

The average length distribution was calculated from the three replicates to represent each profile (Figure 4-2). At the 19nt peak, we observed significant differences between the parental species, Poa infirma and Poa supina (t-test p-value = 0.0017), with the two Poa annua profiles being intermediate. No significant differences in frequency were observed for the miRNA peak (21-22nt) among the four profiles. For the siRNA peak at 24nt, a significant difference was observed between Poa infirma and perennial- type Poa annua (t-test p-value = 0.0247), with means of Poa supina and annual-type Poa annua higher in frequency, but having larger standard errors. Overall, the length distributions of the four profiles showed independence (Cramér’s V = 0.048; Table 4-

2B). When pairwise comparisons were made between profiles, the resulting Cramér’s V ranged from 0.037 to 0.099, with Poa infirma vs. Poa supina having the highest value and perennial vs. annual type Poa annua having the lowest value (Table 4-2B). The highest Cramér’s V for pairwise comparisons between libraries from different profiles was between Poa infirma replicate I2 vs. annual-type Poa annua replicate A2 (0.163),

82 which was only slightly lower than the highest value observed of 0.167 for replicates A2 vs. A3 (Table 4-2C).

Length distribution of unique sequences

Unique small RNA sequences obtained from each of the twelve libraries ranged from 295,293 to 613,043 (Table 4-1). The length distributions of these unique sequences were, for the most part, similar among replicates within each of the four profiles (Figure

4-3). Each profile showed a prominent peak at 24nt, with a relatively minor shoulder at

21-23nt. When compared with each other, the three replicates from each profile exhibited similar distributions, although variations existed to varying extents. Similar to the length distribution of redundant reads, the three replicates of perennial-type Poa annua (P1, P2, and P3) represented the highest overall independence (Cramér’s V = 0.023), while the replicates of annual-type Poa annua (A1, A2, and A3) exhibited the highest overall variability (Cramér’s V = 0.125) (Table 4-2A). The highest value of Cramér’s V calculated from pairwise comparisons between libraries within the same profiles was between two replicates of annual-type Poa annua A2 and A3 (0.211) (Table 4-2C).

Similar to the treatment with redundant sequences, an average unique sequence length distribution was calculated from the three replicates for each profile (Figure 4-4).

The dominant 24nt long unique sequences accounted for 36.28% in Poa infirma, 39.15% in Poa supina, 38.54% in perennial-type Poa annua, and 43.80% in annual-type Poa annua. Following the dominant 24nt unique sequences, the minor shoulder of 21nt, 22nt, and 23nt represented 8.18%, 7.66%, and 7.51% each in Poa infirma, 9.27%, 8.59%, and

83 8.43% each in Poa supina, 8.11%, 7.62%, and 7.51% each in perennial-type Poa annua, and 8.02%, 7.34%, and 7.54% each in annual-type Poa annua. When comparing the unique small RNA length distribution of all four profiles, the overall Cramér’s V (0.041) was almost the same as for redundant reads (0.048) (Table 4-2B). However, the profile pairwise values for unique reads ranged from 0.025 to 0.084, with the lowest being Poa infirma vs. perennial-type Poa annua, and the highest being Poa infirma vs. annual-type

Poa annua (Table 4-2B). When pairwise comparisons were performed among all 12 unique libraries, the highest Cramér’s V was generated between Poa supina replicate S3 vs. annual-type Poa annua replicate A2 (Cramér’s V = 0.217) (Table 4-2C).

Comparing the distribution of redundant sequences to unique sequences shows that the small RNA sequences were not equally redundant across the different length classes (Additional file 4-1). For all profiles, the 24nt long sequences had the lowest redundancy, with 1.907 in Poa infirma, 1.619 in Poa supina, 1.691 in perennial-type Poa annua, and 1.669 in annual-type Poa annua. This result indicates that not only are the

24nt long sequences abundant in the small RNA population, they also have large numbers of variants as well. Interestingly, even though Poa infirma, and both types of Poa annua showed a distribution peak at 19nt in the redundant sequence profiles (Figure 4-2), none had a high representation of 19nt unique sequence (Figure 4-4). Except for Poa supina, the highest redundancies in all other profiles occur at 19nt, with 11.806 in Poa infirma,

7.987 in perennial-type Poa annua, and 9.047 in annual-type Poa annua. This explains why the 19nt peaks observed in redundant sequences of Poa infirma and both types of

Poa annua were absent in their respective unique sequence distributions. Therefore,

84 abundance was not due to large numbers of variants of 19nt sequences but rather to the higher expression level of these relatively low-variable sequences.

Identification of conserved miRNA in Poa annua and its parental species

For miRNA identification, sequences of each library were filtered to include only

18-24nt, and t/rRNA sequences were removed, obtaining a range of 512,236 to 1,340,119 reads from the twelve libraries (Table 4-1). The remaining sequences from each library were compared to known plant miRNAs in miRBase v19 (“miRBase: the microRNA database”) using miRPROF (Stocks et al., 2012). A total of 102 conserved miRNAs belonging to 26 families were predicted from Poa infirma, a total of 88 conserved miRNAs belonging to 24 families were predicted from Poa supina, a total of 94 conserved miRNAs belonging to 26 families were predicted from perennial-type Poa annua, and a total of 102 conserved miRNAs from 27 families were predicted from annual-type Poa annua (Figure 4-5). Twenty-three out of a total of 27 families had representative members in all four profiles; for the remaining 4 families, miR172, miR1318, and miR1432 were identified from all profiles except Poa supina, and miR408 was only identified from Poa supina and annual-type Poa annua. The number of miRNA sequence variants varied from 1 to 25 within different miRNA families, and miR156, miR166 and miR396 showed the highest numbers of variants in all four profiles. The number of variants within each miRNA family were similar among the four profiles, with miR159 showing the largest difference, with 9 variants in Poa infirma, 5 variants in Poa supina, and 6 each in perennial-type and annual-type Poa annua.

85 If we assume that the sequencing process is perfectly random, the abundance of each sequence represents its relative expression level. Additional file 4-2 lists the average abundance of all the identified conserved miRNA sequences in the four profiles. The average expression level of each miRNA family was calculated by summing up the abundance of all variants within the family and plotted in Figure 6. For all profiles, miR166 had the highest expression level, followed by miR156, miR168, and miR396.

For some miRNA families, all profiles had similar expression levels in terms of magnitude. Meanwhile, differences in expression levels can be observed as well. For example, Poa infirma has a higher expression level of miR162 compared to all other profiles, and in miR164, Poa supina and annual-type Poa annua had higher levels of expression than the other two profiles (Figure 4-6). It is interesting to see that within Poa annua, the perennial-type and annual-type had very similar miRNA families and number of variants within each family, but showed significantly different levels of expression for

4 out of the 26 miRNA families. In addition, the two types of Poa annua did not necessarily represent intermediate expression profiles of their parental species.

Out of the 27 conserved miRNA families identified, 9 families showed a two-fold or greater expression level difference among the four profiles. However, the maximum expression of these 9 families did not exceed normalized 542 reads per million and thus, were all of low expression. For the highly expressed miRNA families (normalized read

>1000 per million), some significant expression differences were observed, but none reached a greater than two-fold difference among the profiles. We did not observe any consistent patterns of expression between Poa annua and its parents across the 27 families.

86 Variants from the same miRNA family are not expressed uniformly at all the same levels. It is noteworthy that expression levels of specific variants were consistent between replicates of the same profile within each miRNA family. For example, one variant of miR166 “TCGGACCAGGCTTCATTCCCC” had a normalized expression level of 60500, 50200, and 53900 reads per million in libraries I1, I2, and I3; while another variant of miR166 “TCGGACCAGGCTTCATTCCC” had a normalized expression level of 510, 416, and 439 reads per million in the same three libraries. Thus, in each profile, it was typical that expression levels of some variants were consistently more dominant than others within the same miRNA family.

Conservation levels of identified conserved miRNAs

The 121 conserved miRNA sequences were categorized by profile, and presented in a Venn diagram (Figure 4-7). The majority (72) of these miRNAs were identified from all four profiles and 20 were identified from only one of the profiles, with the rest shared by two or three profiles. Out of the 20 single profile specific sequences, Poa infirma had

9, Poa supina had 4, perennial-type Poa annua had 1, and annual-type Poa annua had 6

(Figure 4-7). When comparing both types of Poa annua with either parent, they appeared to overlap more with their female parent Poa infirma than with the male parent Poa supina. The two types of Poa annua shared 12 miRNA sequences with the female parent

Poa infirma that were not identified in Poa supina; whereas, they shared only 3 sequences with Poa supina that were not identified in Poa infirma.

87 To get an estimation of how conserved the identified miRNAs are compared to model plant species, three additional miRProf (Stocks et al., 2012) analyses were run for each profile. For each of these analyses, a reference genome of Arabidopsis thaliana,

Brachypodium distachyon, or Oryza sativa was added as another input in addition to miRBase 19 (“miRBase: the microRNA database”) for the conserved miRNA prediction by miRProf . In these cases, only sequences that matched the reference genome were kept for identification. The resulting lists of miRNAs were compared to the miRBase-only run, and the sequences were color-coded (Additional file 4-2) and categorized into Venn diagrams (Figure 4-8). All four profiles showed similar patterns. For each profile, there were 13-16 sequences not shared with any of these model plants. On the other hand, in each profile, 35-42 miRNAs were predicted from all three reference genomes, indicating that these are highly conserved sequences shared between monocots and dicots. Another major category (32-38 in each profile) included miRNAs that would map to

Brachypodium and Oryza genomes, but not to Arabidopsis genome. These miRNAs may represent ones that are common in monocots but not dicots. These diagrams suggest that when analyzing sequencing data from species with unknown or limited genomic information, choosing a reference genome of a closely related species serves as a better reference than a more distantly related species.

Novel miRNA prediction

Due to the lack of genomic information of Poa annua and its parental species, reference genomes from Arabidopsis thaliana, Brachypodium distachyon, and Oryza

88 sativa were used for novel miRNA prediction using miRCat of srnaWorkbench (Stocks et al., 2012). The prediction was based on potential stemloop structure that may be formed from the pre-miRNA and the stability of such structure calculated by MFE (minimum free energy). From the four profiles, a total of 79 novel miRNAs were predicted, including 38 from Poa infirma, 42 from Poa supina, 40 from perennial-type Poa annua, and 39 from annual-type Poa annua (Additional file 4-3). Similar to our analyses of conserved miRNAs, we categorized these novel miRNAs by their presence within each profile (Figure 4-9). It was quite surprising to find that many of these predicted miRNA sequences were not shared among the four profiles. Out of the 79 predicted novel miRNA sequences, only 14 were shared by all four profiles, and 37 sequences were predicted from only one profile: 11 from Poa infirma, 12 from Poa supina, and 7 each from the two types of Poa annua.

These 79 novel miRNAs were further categorized, for each profile, according to which genomes they were predicted (Figure 4-10). The results suggest that the four profiles behaved similarly, in that Brachypodium distachyon genome supplied the most predictions, with the Oryza sativa genome providing the second most predictions, and

Arabidopsis thaliana providing the least number of predictions. If we look at the four profiles combined, the predicted novel miRNA sequences could be categorized in a Venn diagram (Figure 4-11B). Overall, 49 of the novel miRNAs were predicted from

Brachypodium distachyon genome, 32 were predicted from Oryza sativa genome, and 11 were predicted from Arabidopsis thaliana genome. Only a small number of the novel miRNAs were predicted from two or more genomes. For example, 7 were predicted from

89 Brachypodium distachyon or Oryza sativa genomes, and only 1 novel miRNA was predicted from all three genomes.

Material and Methods

Plant material and RNA isolation

Seeds of Poa infirma (kindly provided by S. Fei, Iowa State University) and Poa supina (collected by D.R. Huff) were germinated on moist filter paper in petri dishes. A perennial-type of Poa annua (obtained by D.R. Huff from Washington, USA) and an annual-type of Poa annua (obtained by D.R. Huff from Scotland) were also germinated.

Seedlings were then transferred into greenhouse potting soil (Promix, Premier

Horticulture Inc., Quakertown, PA, USA). All plants were grown under greenhouse condition (27°C high; 17°C low) under natural day length.

A total of twelve seedlings, three each from the two types of Poa annua

(perennial-type and annual-type), and the two diploid parental species Poa infirma and

Poa supina were harvested at the five-leave stage. Total RNA was extracted from the shoot tissue using mirVana RNA Isolation Kit (Ambion, CA, USA) following the protocol. RNA quality was checked with Bioanalyzer (Agilent Technologies, USA) at the

Pennsylvania State University Genomics Core Facility, University Park, PA.

90 Small RNA library construction and sequencing

RNA samples were sent to the DNA Fore Facility at the University of Missouri,

Columbia, MO, USA, for preparation of the small RNA libraries and sequencing.

Libraries were prepared using Illumina’s small RNA Truseq Kit (Illumina, CA, USA).

One library was constructed for each seedling, resulting in three biological replicates for each of the four profiles: Poa infirma (I1, I2, and I3), Poa supina (S1, S2, and S3), perennial-type Poa annua (P1, P2, and P3), and annual-type Poa annua (A1, A2, and

A3). All twelve libraries were pooled into one lane for single-ended small RNA sequencing using HiSeq 2000 (Illumina, CA, USA).

Raw sequence data processing

Raw sequence data in FASTQ format were first filtered to remove low quality reads. Reads that were marked with N in FASTQ designation were filtered out using fastq_illumina_filter (http://cancan.cshl.edu/labmembers/gordon/fastq_illumina_filter/).

Afterwards, reads with at least 90% nucleotides having a quality score of 20 and above were kept using fastx_quality_filter (http://hannonlab.cshl.edu/fastx_toolkit/index.html).

Adaptors were removed using fastx_clipper

(http://hannonlab.cshl.edu/fastx_toolkit/index.html): 3’ adaptors were removed with at least 10-nucleotide match, and the minimum length kept was 18nt. Resulting sequences of 18-30nt long were analyzed for redundant and unique size distributions for each library. The abundance of each sequence was then normalized to the remaining reads and represented as reads per million within each library. Normalized length distributions were

91 calculated using Module 1 of shortran (Gupta et al., 2012). Averages from the three biological replicates were used to represent characteristics of each profile.

To represent the level of sequence redundancy in each profile, the following steps were performed: (1) for each library, an average redundancy level for each sequence length class (18-30nt) was calculated by dividing the redundant read count by unique read count; (2) for each profile, an average redundancy level for each length was calculated using the three replicates.

Statistical analyses of length distribution

Statistical analyses were preformed to estimate the effect size of small RNA length distributions from different libraries. Cramér’s V was calculated as:

! Cramér’s V = ! !(!!!)

Where !! is derived from Pearson’s chi-square test, N is the sample size, and k is the smaller of the number of rows (number of libraries or profiles depending on the analyses performed) and columns (number of length classes). The values of Cramér’s V range from 0 to 1, with lower values indicating stronger independence between length distributions of libraries or profiles (Cramér, 1999).

To estimate independence among replicates from the same profile, Cramér’s V was calculated with normalized 18-30nt small RNA length distributions for each profile.

In addition, with each profile represented by the average of its three replicates, Cramér’s

V was also calculated to compare between profiles.

92 Conserved miRNA identification

Conserved miRNAs were identified using the miRProf tool from UEA sRNA workbench (Stocks et al., 2012). Sequence files were first converted from FASTQ format into FASTA. Only 18-24nt sequences were used for miRNA prediction, and t/rRNA sequences were filtered out using the Filter tool from sRNA workbench (Stocks et al.,

2012). The remaining sequences were used as input for miRProf. For identification of conserved miRNAs, miRBase 19 (“miRBase: the microRNA database”) plant sequences were used as reference, and a maximum of 2 mismatches were allowed, with all other parameters kept as default. To maintain a higher confidence level of our identification, only sequences that had at least three normalized reads from each biological replicate were kept to represent the corresponding profile. In order to estimate how conserved these identified miRNA sequences were, after running miRProf with the above parameters, three additional rounds were run for each library with reference genomes from one of the following: Brachypodium distachyon (http://brachypodium.org), Oryza sativa (http://plants.ensembl.org/index.html), or Arabidopsis thaliana

(http://plants.ensembl.org/index.html).

Novel miRNA prediction

For novel miRNA prediction, the miRCat tool from sRNA workbench (Stocks et al., 2012) was used. Size 18-24nt reads without t/rRNA were used as input with miRBase

19 (“miRBase: the microRNA database”) as known miRNA database. The prediction was based on alignment of small RNA reads to a reference genome and by predicting

93 potential miRNA precursor hairpins using a MFE (minimum free energy) algorithm

(Moxon et al., 2008). Due to the lack of reference genomes of Poa annua and its parental species, the analyses were performed three times using three different reference genomes from model plants Brachypodium distachyon (http://brachypodium.org), Oryza sativa

(http://plants.ensembl.org/index.html), or Arabidopsis thaliana

(http://plants.ensembl.org/index.html) for each library. For each round of analysis, within each profile, only sequences predicted from at least two replicates were kept to represent the profile.

Discussion

In this study, we generated the first small RNA profiles for perennial and annual types of allotetraploid Poa annua, and the two diploid parental species Poa infirma and

Poa supina. Although Poa infirma and Poa supina have very distinct genomes (II vs. SS)

(Mao & Huff, 2012) and have exhibited the largest observed phylogenetic distance among Poa species examined (Soreng et al., 2010), their small RNA profiles were very similar, in terms of small RNA length distribution, and representation and expression levels in miRNA families. Despite the morphological and life history differences between perennial-type and annual-type Poa annua, they also exhibited very similar small RNA profiles, and were not strikingly different from their diploid parental species.

Polyploid evolution involves substantial genetic changes (Doyle et al., 2008;

Chen, 2010). Small RNAs have been proposed to play an important role in polyploid evolution (Ng et al., 2012). Kenan-Eichler et al. reported a decrease of 24nt small RNA

94 (siRNAs) in newly synthesized polyploid wheat (Kenan-Eichler et al., 2011), when compared to its parents, leading to activation of transposable elements and potential destabilization of newly synthesized polyploid genomes. In this study, we did not observe a significant reduction in the expression of 24nt small RNA (primarily siRNAs) when comparing either type of polyploid Poa annua to the mid-level of the two parental species (Figure 4-2). The differences between our results and Kenan-Eichler et al.

(Kenan-Eichler et al., 2011) may have resulted from a number of factors: 1) the siRNA reduction observed in wheat was in newly synthesized polyploids, while our samples of

Poa annua were mature polyploids whose genomes may have stabilized since its origin;

2) we used an average from three biological replicates to represent each profile, therefore potential extreme effects were eliminated; 3) the reduction of siRNA in Poa annua may be restricted to a certain class of siRNAs rather than the overall expression level of 24nt sequences; 4) in the case of Poa annua, mechanisms other than siRNA may have played more prominent roles in its polyploid evolution.

Our study incorporated biological replicates for each profile. This enabled us to have some assessment on the repeatability of our results, and to estimate independence among different individual genotypes within each profile. Some variations were observed between replicates indicating that natural variations of small RNA expression exist and obtaining an average profile may provide a better representation compared to a single sequence run. In terms of small RNA length distributions, our replicates exhibited overall independence within each profile, with Cramér's V below 0.1 for redundant sequences and below 0.15 for unique sequences (Table 4-2A). In both cases, annual-type Poa annua had the highest Cramér's V value, corresponding to the highest variation among

95 replicates. Taking an average from the replicates to represent each profile, rather than randomly picking one individual helped us to make fair comparisons between profiles.

For example, Cramér's V calculated with profile data between the unique sequence length distributions of Poa infirma (I) and annual-type Poa annua (A) was 0.084 (Table 4-2B).

However, if we had randomly picked one individual from each profile to make the comparison, the resulting Cramér's V could have been 0.020 (I2 vs. A3) or 0.210 (I3 vs.

A2) (Table 4-2C), a ten-fold difference that clearly may have led to very different conclusions.

Conserved miRNAs were identified from all four profiles with miRBase

(“miRBase: the microRNA database”), and we further validated them using reference genomes from model plant species with different phylogenetic distances to Poa, including Brachypodium distachyon, Oryza sativa, and Arabidospsis thaliana (Figure 4-

12A). In addition, due to the lack of genomic information from Poa annua and the two parental species, the same reference genomes were utilized for novel miRNA predictions, as well. Using these data sets, we generated two phylogenetic trees, based on the number of shared miRNAs in the case of conserved miRNAs, or the number of predicted miRNAs in the case of novel miRNAs. For both conserved and novel miRNAs combined from all four profiles, we obtained identical tree structures, in which Poa was more closely related to Brachypodium and Oryza, and more distantly related to Arabidopsis

(Figure 4-12B). It was interesting that we were able to reproduce a phylogenetic relationship that was similar to the known phylogenetic relationship using a limited number of miRNA predictions.

96 The small RNA profiles that we have obtained are captures at a specific time point (five-leaf seedling stage) for a specific type of tissue (leaves). Small RNA expressions could change under different environmental conditions (Unver & Budak,

2009), and this study provides a baseline small RNA profile for Poa annua and its parental species for future studies. The differences in small RNA profiles between perennial grasses, Poa supina and perennial-type Poa annua, and annual grasses, Poa infirma and annual-type Poa annua, might only be expressed during more mature growing stages than the seedling stage, or only in meristematic tissue, rather than the leaves. The extraordinary adaptability of Poa annua, compared to its parental species, might lie in how it responses to stress, and might only be induced by certain biotic and/or abiotic factors, or by management practices such as close mowing. Lastly, the genomic shock during the polyploid origin of Poa annua might have been stabilized in mature polyploids, and therefore in order to gain more insights into small RNA’s role in the poyploid evolution of Poa annua, crosses need to be made between Poa supina and Poa infirma, so that comparisons could be made between the F1 hybrid, newly synthesized polyploids, and the parental species.

97 References

Axtell MJ. 2008. Evolution of microRNAs and their targets: are all microRNAs biologically relevant? Biochimica et biophysica acta 1779: 725–734. Barber WT, Zhang W, Win H, Varala KK, Dorweiler JE, Hudson ME, Moose SP. 2012. Repeat associated small RNAs vary among parents and following hybridization in maize. Proceedings of the National Academy of Sciences of the United States of America 109: 10444–10449. Bartel DP. 2004. MicroRNAs!: genomics, biogenesis, mechanism, and function. Cell 116: 281–297. Carrington JC, Ambros V. 2003. Role of microRNAs in plant and animal development. Science (New York, N.Y.) 301: 336–338. Carthew RW, Sontheimer EJ. 2009. Origins and mechanisms of miRNAs and siRNAs. Cell 136: 642–655. Castel SE, Martienssen RA. 2013. RNA interference in the nucleus: roles for small RNAs in transcription, epigenetics and beyond. Nature reviews. Genetics 14: 100– 112. Chen ZJ. 2010. Molecular mechanisms of polyploidy and hybrid vigor. Trends in plant science 15: 57–71. Chown SL, Huiskes AHL, Gremmen NJM, Lee JE, Terauds A, Crosbie K, Frenot Y, Hughes KA, Imura S, Kiefer K, et al. 2012. Continent-wide risk assessment for the establishment of nonindigenous species in Antarctica. Proceedings of the National Academy of Sciences of the United States of America 109: 4938–4943. Chwedorzewska KJ. 2008. Poa annua L. in Antarctic: searching for the source of introduction. Polar Biology 31: 263–268. Cramér H. 1999. Mathematical methods of statistics. Princeton: Princeton University Press. Dai J, Huff DR, Schlossberg MJ. 2009. Salinity effects on seed germination and vegetative growth of greens-type Poa annua relative to other cool-season turfgrass species. Crop Science 49: 696–703. Dionne J, Rochefort S, Huff DR, Desjardins Y, Bertrand A, Castonguay Y. 2010. Variability for freezing tolerance among 42 ecotypes of green-type annual bluegrass. Crop Science 50: 321–336. Doyle JJ, Flagel LE, Paterson AH, Rapp RA, Soltis DE, Soltis PS, Wendel JF. 2008. Evolutionary genetics of genome merger and doubling in plants. Annual review of genetics 42: 443–461. Gardarin A, Dürr C, Colbach N. 2009. Which model species for weed seedbank and emergence studies? A review. Weed Research 49: 117–130.

98 Gupta V, Markmann K, Pedersen CNS, Stougaard J, Andersen SU. 2012. shortran: a pipeline for small RNA-seq data analysis. Bioinformatics 28: 2698–2700. Hemp A. 2008. Introduced plants on Kilimanjaro: tourism and its impact. Plant Ecology 197: 17–29. Hovin AW. 1958. Meiotic chromosome pairing in amphihaploid Poa annua L. American Journal of Botany 45: 131–138. Huff DR. 2003. Annual bluegrass (Poa annua L.). In: Casler MD, Duncan RR, eds. Turfgrass biology, genetics, and breeding. Hoboken, New Jersy: John Wiley and Sons, 39–51. Huff DR. 2010. Bluegrasses. In: Boller B, Posselt UK, Veronesi F, eds. Fodder Crops and Amenity Grasses (Handbook of Plant Breeding). Springer Science, 345–379. Jones-Rhoades MW, Bartel DP, Bartel B. 2006. MicroRNAs and their regulatory roles in plants. Annual review of plant biology 57: 19–53. Kenan-Eichler M, Leshkowitz D, Tal L, Noor E, Melamed-Bessudo C, Feldman M, Levy AA. 2011. Wheat hybridization and polyploidization results in deregulation of small RNAs. Genetics 188: 263–272. Kidner CA, Martienssen RA. 2005. The developmental role of microRNA in plants. Current opinion in plant biology 8: 38–44. Koshy TK. 1968. Evolutionary origin of Poa annua L. in the light of karyotypic studies. Genome 10: 112–118. Li D, Wang L, Liu X, Cui D, Chen T, Zhang H, Jiang C, Xu C, Li P, Li S, et al. 2013. Deep sequencing of maize small RNAs reveals a diverse set of microRNA in dry and imbibed seeds. PloS one 8: e55107. Liu P, Yan K, Lei Y-X, Xu R, Zhang Y-M, Yang G-D, Huang J-G, Wu C-A, Zheng C-C. 2013. Transcript profiling of microRNAs during the early development of the maize brace root via Solexa sequencing. Genomics 101: 149–156. Malone CD, Hannon GJ. 2009. Small RNAs as guardians of the genome. Cell 136: 656–668. Mandhan V, Kaur J, Singh K. 2012. smRNAome profiling to identify conserved and novel microRNAs in Stevia rebaudiana Bertoni. BMC plant biology 12: 197. La Mantia JM, Huff DR. 2011. Instability of the greens-type phenotype in Poa annua L. Crop Science 51: 1784–1792. Mao Q, Huff DR. 2012. The evolutionary origin of Poa annua L. Crop Science 52: 1910–1922. miRBase: the microRNA database. Molina-Montenegro MA, Carrasco-Urra F, Rodrigo C, Convey P, Valladares F, Gianoli E. 2012. Occurrence of the non-native annual bluegrass on the Antarctic mainland and its negative effects on native plants. Conservation biology 26: 717– 723.

99 Morin RD, Aksay G, Dolgosheina E, Ebhardt HA, Magrini V, Mardis ER, Sahinalp SC, Unrau PJ. 2008. Comparative analysis of the small RNA transcriptomes of Pinus contorta and Oryza sativa. Genome research 18: 571–584. Moxon S, Schwach F, Dalmay T, Maclean D, Studholme DJ, Moulton V. 2008. A toolkit for analysing large-scale plant small RNA datasets. Bioinformatics (Oxford, England) 24: 2252–2253. Ng DW-K, Lu J, Chen ZJ. 2012. Big roles for small RNAs in polyploidy, hybrid vigor, and hybrid incompatibility. Current opinion in plant biology 15: 154–161. Olech M, Chwedorzewska K. 2011. The first appearance and establishment of an alien vascular plant in natural habitats on the forefield of a retreating galcier in Antarctica. Antarctic Science 23: 153–154. Rajagopalan R, Vaucheret H, Trejo J, Bartel DP. 2006. A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana. Genes & development 20: 3407– 3425. Soreng RJ, Bull RD, Gillespie LJ. 2010. Phylogeny and reticulation in Poa based on plastid trnTLF and nrITS sequences with attention to diploids. In: Seberg, Petersen, Barfod, Davis, eds. Diversity, Phylogeny, and Evolution in the Monocotyledons. Denmark: Aarhus University Press, 619–643. Stocks MB, Moxon S, Mapleson D, Woolfenden HC, Mohorianu I, Folkes L, Schwach F, Dalmay T, Moulton V. 2012. The UEA sRNA workbench: a suite of tools for analysing and visualizing next generation sequencing microRNA and small RNA datasets. Bioinformatics (Oxford, England) 28: 2059–2061. Sunkar R, Zhou X, Zheng Y, Zhang W, Zhu J-K. 2008. Identification of novel and candidate miRNAs in rice by high throughput sequencing. BMC plant biology 8: 25. Tutin TG. 1957. A contribution to the experimental taxonomy of Poa annua L. Watsonia 4: 1–10. Unver T, Budak H. 2009. Conserved microRNAs and their targets in model grass species Brachypodium distachyon. Planta 230: 659–669. Voinnet O. 2009. Origin, biogenesis, and activity of plant microRNAs. Cell 136: 669– 687. Wang RR-C. 1989. An assessment of genome analysis based on chromosome pairing in hybrids of perennial Triticeae. Genome 32: 179–189. Yanik H, Turktas M, Dundar E, Hernandez P, Dorado G, Unver T. 2013. Genome- wide identification of alternate bearing-associated microRNAs (miRNAs) in olive (Olea europaea L.). BMC plant biology 13: 10. Zhang J, Xu Y, Huan Q, Chong K. 2009. Deep sequencing of Brachypodium small RNAs at the global genome level identifies microRNAs involved in cold stress response. BMC genomics 10: 449.

100

Table 4-1. Sequencing data preprocessing summary for the three biological replicate samples from Poa infirma, Poa supina, and the perennial and annual types of Poa annua.

Profile Name Poa infirma Poa supina Poa annua-perennial Poa annua-annual Library Rep-I1 Rep-I2 Rep-I3 Rep-S1 Rep-S2 Rep-S3 Rep-P1 Rep-P2 Rep-P3 Rep-A1 Rep-A2 Rep-A3 size 18-30 nt reads 2,407,333 1,847,327 1,420,975 1,693,894 1,449,823 965,588 2,376,520 1,740,376 1,438,929 2,081,287 2,155,218 1,343,389 unique 18-30 nt reads 459,489 406,763 316,945 486,874 417,141 295,293 613,043 463,579 378,574 541,493 603,516 332,747 size 18-24 nt reads 1,728,419 1,248,808 972,592 1,174,259 1,008,644 660,698 1,654,754 1,212,897 998,499 1,501,920 1,637,957 875,155 unique 18-24 nt reads 360,118 294,671 228,709 386,962 332,872 223,954 463,811 352,239 286,394 434,511 508,194 238,391 18-24 nt t/rRNA filtered 1,261,688 943,433 741,838 920,672 769,469 512,236 1,273,890 919,627 747,271 1,155,807 1,340,119 621,539 unique 18-24 nt t/rRNA filtered 344,324 277,961 216,310 371,532 317,055 210,765 443,430 335,290 270,157 416,326 493,503 220,618

101 Table 4-2. Cramér’s V statistic for small RNA length distributions. (I: Poa infirma. S: Poa supina. P: Perennial Type Poa annua. A: Annual Type Poa annua).

A. Among replicates

Cramer's V among the three replicates within each profile I-reps S-reps P-reps A-reps Redundant 0.046 0.047 0.037 0.097 Unique 0.067 0.091 0.023 0.125

B. Between profiles

Cramer's V between profiles I-S I-P I-A S-P S-A P-A Overall Redundant 0.099 0.068 0.087 0.047 0.045 0.037 0.048 Unique 0.062 0.025 0.084 0.045 0.052 0.059 0.041

C. Pairwise between libraries. Lowerleft: redundant libraries. Upper right: unique libraries.

I1 I2 I3 S1 S2 S3 P1 P2 P3 A1 A2 A3 I1 0.100 0.100 0.037 0.030 0.122 0.038 0.038 0.058 0.046 0.112 0.103 I2 0.077 0.009 0.126 0.115 0.084 0.069 0.065 0.045 0.143 0.209 0.020 I3 0.056 0.028 0.128 0.118 0.084 0.070 0.065 0.046 0.143 0.210 0.014 S1 0.138 0.125 0.133 0.024 0.145 0.062 0.066 0.088 0.029 0.087 0.129 S2 0.109 0.096 0.104 0.038 0.126 0.058 0.058 0.076 0.043 0.100 0.119 S3 0.106 0.069 0.082 0.074 0.055 0.111 0.102 0.082 0.160 0.217 0.083 P1 0.106 0.082 0.093 0.062 0.039 0.041 0.014 0.038 0.076 0.143 0.071 P2 0.088 0.069 0.076 0.066 0.038 0.035 0.023 0.028 0.079 0.146 0.067 P3 0.082 0.054 0.063 0.106 0.074 0.068 0.054 0.051 0.103 0.169 0.051 A1 0.096 0.104 0.106 0.063 0.043 0.072 0.044 0.043 0.071 0.069 0.144 A2 0.126 0.163 0.156 0.102 0.099 0.135 0.110 0.108 0.130 0.069 0.211 A3 0.112 0.048 0.071 0.107 0.084 0.056 0.066 0.064 0.059 0.101 0.167

102

0.25" 0.25" A I1" B S1" 0.2" 0.2" I2" S2"

0.15" I3" 0.15" S3" 0.1" 0.1"

0.05" 0.05" Percentage)of)Reads) Percentage)of)Reads)

0" 0" 18" 19" 20" 21" 22" 23" 24" 25" 26" 27" 28" 29" 30" 18" 19" 20" 21" 22" 23" 24" 25" 26" 27" 28" 29" 30" Sequence)Length)(nt)) Sequence)Length)(nt))

0.25" 0.25" C P1" D A1" 0.2" 0.2" P2" A2"

0.15" P3" 0.15" A3" 0.1" 0.1"

0.05" 0.05" Percentage)of)Reads) Percentage)of)Reads)

0" 0" 18" 19" 20" 21" 22" 23" 24" 25" 26" 27" 28" 29" 30" 18" 19" 20" 21" 22" 23" 24" 25" 26" 27" 28" 29" 30" Sequence)Length)(nt)) Sequence)Length)(nt))

Figure 4-1. Length distributions of redundant 18-30nt small RNA sequences from each library. Each panel represents three biological replicates from the same profile. A. Poa infirma replicates I1, I2, and I3; B. Poa supina replicates S1, S2, and S3; C. Perennial-type Poa annua replicates P1, P2, and P3; D. Annual-type Poa annua replicates A1, A2 and A3.

103

0.25#

0.20#

I# S# P# 0.15# A#

0.10# Percdentage*of*Reads*

0.05#

0.00# 18# 19# 20# 21# 22# 23# 24# 25# 26# 27# 28# 29# 30# Sequence*Length*(nt)*

Figure 4-2. Length distributions of redundant 18-30nt small RNA sequences averaged from the replicates within each profile: Poa infirma (I), Poa supina (S), perennial-type Poa annua (P), and annual-type Poa annua (A). Error bars: standard errors.

104

0.6" 0.6" A I1_unique" B S1_unique" 0.5" I2_unique" 0.5" S2_unique"

0.4" I3_unique" 0.4" S3_unique"

0.3" 0.3"

0.2" 0.2"

0.1" 0.1"

0" 0" Percentage)of)Unique)Sequences) Percentage)of)Unique)Sequences) 18" 19" 20" 21" 22" 23" 24" 25" 26" 27" 28" 29" 30" 18" 19" 20" 21" 22" 23" 24" 25" 26" 27" 28" 29" 30" Sequence)Length)(nt)) Sequence)Length)(nt))

0.6" 0.6" C P1_unique" D A1_unique" 0.5" P2_unique" 0.5" A2_unique"

0.4" P3_unique" 0.4" A3_unique"

0.3" 0.3"

0.2" 0.2"

0.1" 0.1"

0" 0" Percentage)of)Unique)Sequences) Percentage)of)Unique)Sequences) 18" 19" 20" 21" 22" 23" 24" 25" 26" 27" 28" 29" 30" 18" 19" 20" 21" 22" 23" 24" 25" 26" 27" 28" 29" 30" Sequence)Length)(nt)) Sequence)Length)(nt))

Figure 4-3. Length distributions of unique 18-30nt small RNA sequences from each library. Each panel represents three biological replicates from the same profile. A. Poa infirma replicates I1, I2, and I3; B. Poa supina replicates S1, S2, and S3; C. Perennial-type Poa annua replicates P1, P2, and P3; D. Annual-type Poa annua replicates A1, A2 and A3.

105

0.6"

0.5"

0.4" I_unique" S_unique"

0.3" P_unique" A_unique" Percentage)of)Reads) 0.2"

0.1"

0" 18" 19" 20" 21" 22" 23" 24" 25" 26" 27" 28" 29" 30" Sequence)Length)(nt))

Figure 4-4. Length distributions of unique 18-30nt small RNA sequences averaged from the replicates within each profile: Poa infirma (I), Poa supina (S), perennial-type Poa annua (P), and annual-type Poa annua (A). Error bars: standard errors.

106

30"

25"

I" 20" S" P" A" 15" Number'of'Members' 10"

5"

0"

mir156"mir159"mir160"mir162"mir164"mir165"mir166"mir167"mir168"mir169"mir171"mir172"mir319"mir390"mir393"mir394"mir395"mir396"mir398"mir399"mir408"mir444"mir528" mir1318"mir1432"mir5054"mir5072" miRNA'Family'

Figure 4-5. Number of identified microRNA members in each conserved microRNA family for the four profiles: Poa infirma (I), Poa supina (S), perennial-type Poa annua (P), and annual-type Poa annua (A).

107

1000000"

100000" I" S" P" 10000" A"

1000"

100" Expression*Level*(per*million*reads)*

10"

1"

mir165" mir171" mir395" mir156"mir159"mir160"mir162"mir164" mir166"mir167"mir168"mir169" mir172"mir319"mir390"mir393"mir394" mir396"mir398"mir399"mir408"mir444"mir528"mir1318"mir1432"mir5054"mir5072" miRNA*Family*

Figure 4-6. Expression levels of conserved microRNA families in the four profiles, expressed as per million reads: Poa infirma (I), Poa supina (S), perennial-type Poa annua (P), and annual-type Poa annua (A). Error bars: standard errors.

108

Poa$annua$$ Poa$supina$ 4" 1" (perennial)* 1" Poa$infirma$ Poa$annua$ 2" 3" (annual)* 3" 9" 1" 6"

72" 1" 1" 12" 4" 1"

Figure 4-7. Venn diagram representing the relationship of conserved microRNA sequences that were identified from the four profiles.

109

A" Poa$infirma$ B" Poa$supina$

"miRBASE" with"" "miRBASE" with"" B."distachyon" 14" B."distachyon" 13" match" genome" match" genome" 2" 2"

0" 37" 0" 33" 42" 35" 3" 3" 3" 2" with"" with"" with"" with"" A."thaliana" 1" O."sa>va" A."thaliana" 0" O."sa>va" genome" genome" genome" genome"

C" Poa$annua-perennial$ D" Poa$annua-annual$

"miRBASE" with"" "miRBASE" with"" B."distachyon" 13" B."distachyon" 16" match" genome" match" genome" 2" 2"

0" 32" 0" 38" 38" 37" 3" 5" 3" 5" with"" with"" with"" with"" A."thaliana" 1" O."sa>va" A."thaliana" 1" O."sa>va" genome" genome" genome" genome"

Figure 4-8. Categorization of conserved microRNA sequences based on reference genomes for each profile.

110

Poa$annua$$ Poa$supina$ 12# 7# (perennial)* 5# Poa$infirma$ Poa$annua$ 2# 2# (annual)* 4# 11# 1# 7#

14# 2# 4# 5# 0# 3#

Figure 4-9. Venn diagram representing the relationship of novel microRNA sequences that were predicted from the four profiles.

111

A" Poa$infirma$ B" Poa$supina$ with## with## B.#distachyon# B.#distachyon# genome# genome# 16# 21#

1# 4# 1# 4# 0# 0# 5# 10# 3# 12# with## with## with## with## A.#thaliana# 2# O.#sa;va# A.#thaliana# 1# O.#sa;va# genome# genome# genome# genome#

C" Poa$annua-perennial$ D" Poa$annua-annual$ with## with## B.#distachyon# B.#distachyon# genome# genome# 18# 18#

1# 4# 2# 2# 1# 0# 5# 9# 3# 12# with## with## with## with## A.#thaliana# 2# O.#sa;va# A.#thaliana# 2# O.#sa;va# genome# genome# genome# genome#

Figure 4-10. Categorization of novel microRNA sequences based on reference genomes for each profile.

112

A.#Conserved# B.#Novel#

with## with## #with#no# B.#distachyon# B.#distachyon# genome# genome# 19# genome# 2# 39#

0# 46# 2# 7# 45# 1# 3# 5# 6# 22# with## with## with## with## A.#thaliana# O.#sa;va# A.#thaliana# 2# O.#sa;va# genome# 1# genome# genome# genome#

Figure 4-11. Categorization of microRNA sequences identified/predicted from all four profiles combined based on reference genomes. A. Conserved microRNAs; B. Novel microRNAs.

113

A"

B"

Figure 4-12. Phylogenetic relationship between Poa annua, its parental species, and the three model plant species utilized as reference genomes for conserved and novel microRNA identification in this study. A. Known relationship adapted from NBCI Taxonomy (http://www.ncbi.nlm.nih.gov/taxonomy); B. Phylogenetic tree generated based on conserved microRNA identification or novel microRNA predictions from current study.

114

16"

14" I" S"

12" P" A"

10"

8" Redundancy)

6"

4"

2"

0" 18" 19" 20" 21" 22" 23" 24" 25" 26" 27" 28" 29" 30" Sequence)Length)(nt))

Additional file 4-1. Redundancy level of 18-30nt small RNAs at each length class for the four profiles: Poa infirma (I), Poa supina (S), perennial-type Poa annua (P), and annual- type Poa annua (A). Error bars: standard errors.

115

Additional file 4- 2. List of conserved microRNAs identified from the four profiles Poa infirma, Poa supina, and the perennial and annual types of Poa annua. For each conserved microRNA, mean and standard error of normalized expression is presented within each profile. Color indicates the reference genome from which each conserved microRNA was identified. For each profile, column “Mean” colored yellow represents Brachypodium distachyon reference genome, orange represents Arabidopsis thaliana reference genome, and blue represents both Brachypodium and Arabidopsis reference genomes; column “SE” colored green represents Oryza sativa reference genome.

miRNA Poa infirma Poa supina Poa annua-perennial Poa annua-annual Sequence Length family Mean SE Mean SE Mean SE Mean SE mir156 ACAGAAGAGAGTGAGCACA 19 4.44 0.66 GCTCACTGCTCTATCTGTCACC 22 16.13 1.6 27.69 3.12 13.2 2.12 23.26 4.39

GCTCACTTCTCTCTCTGTCAGC 22 9.26 0.88 3.57 1.07 12.23 3.69

TGACAGAAGAGAGAGAGCAC 20 13.86 1.16 14.97 2.36 7.53 2.96

TGACAGAAGAGAGCGAGCAC 20 4.88 0.46 9.62 1.22

TGACAGAAGAGAGGGAGCAC 20 25.01 1.72 37.83 9.31 15.73 3.44 18.82 2.2

TGACAGAAGAGAGTGAGCA 19 5.96 1.13 6.65 0.51

TGACAGAAGAGAGTGAGCAC 20 4204.16 119.55 5712.14 533.23 3320.55 491.93 3099.33 173.55

TGACAGAAGAGAGTGAGCACA 21 71.11 2.87 98.42 18.63 41.01 7.81 32.84 4.38

TGACAGAAGAGAGTGAGCACT 21 73.37 5.21 135.24 24.88 103.78 11.15 136.82 6.5

TGACAGAAGAGAGTGAGCAT 20 10.92 2.22 9.42 0.75 4.83 0.2

TGTCAGAAGAGAGTGAGCAC 20 209.82 18.03 257.57 17.9 150.66 18.76 137.11 7.34

TTGACAGAAGAGAGAGAGCAC 21 9.33 0.73

TTGACAGAAGAGAGTGAGCA 20 4.8 0.33

TTGACAGAAGAGAGTGAGCAC 21 2261.87 26.99 1068.56 115.01 1541.71 410.92 1314.75 71.74 mir159 AGCTCCCTTCGATCCAATC 19 7.56 1.63

AGCTCCCTTCGATCCAATCC 20 7.72 0.71

CTTGGATTGAAGGGAGCTCT 20 40.41 2.32 2.15 0.29

TTGGATTGAAGGGAGCTCT 19 33.1 6.59 3.73 0.41

116

TTTGGATTGAAGGGAGCT 18 21.13 1.12 9.04 1.6 12.49 7.92 18.51 3.23

TTTGGATTGAAGGGAGCTC 19 35.4 4.63 26.75 4.59 31.93 2.24 43.06 6.59

TTTGGATTGAAGGGAGCTCT 20 22.68 7.11 32.76 2.74 16.59 7.91 24.13 3.36

TTTGGATTGAAGGGAGCTCTG 21 1697.15 155.02 1397.73 42.36 1801.62 444.73 1826.27 276.41

TTTGGATTGAAGGGAGCTCTT 21 10.12 1.13 13.02 3.45 5.52 3.35 12.77 2.48 mir160 TGCCTGGCTCCCTGAATGCCA 21 14.87 3.5 15.54 2.72 21.6 6.73 22.67 3.5 TGCCTGGCTCCCTGTATGCCA 21 142.02 17.71 166.28 12.55 173.42 13.75 169.79 25.52 mir162 TCGATAAACCTCTGCATCCGG 21 89.72 9.64 46.57 9.03 38.63 4.64 49.18 8.86 mir164 TGGAGAAGCAGGGCACGTGCA 21 36.33 6.84 82.93 9.36 48.01 8.88 90.89 9.1 TGGAGAAGCAGGGCACGTGCT 21 4.34 0.78 mir165 TCGGACCAGGCTTCATCCCCC 21 34.48 4.11 37.02 3.36 38.07 4.18 57.03 8.66 mir166 CGGACCAGGCTTCAATCCCT 20 5.31 1.72 CGGACCAGGCTTCATTCCCC 20 14.54 3.24 43.23 9.9 26.47 13.11 30.28 6.36

CTCGGACCAGGCTTCATTCCC 21 20.5 0.91 22.56 1.7 22.53 7.27 22.61 5.11

GGAATGTTGTCTGGCTCGGGG 21 11.36 1.49 16.18 11.98 16.9 4.48

GGAATGTTGTCTGGTTCAAG 20 9.76 2.09 9.33 3.48 12.27 1.97

GGAATGTTGTCTGGTTCAAGG 21 30.91 4.38 57.77 4.53 50.72 11.84 55.4 2.92

GGACCAGGCTTCATTCCCC 19 3.76 1.01

TCCGGACCAGGCTTCATTCCC 21 137.45 12.56 90.5 13.58 89.18 19.52 88.06 2.35

TCGAACCAGGCTTCATTCCCC 21 9.14 0.75 14.24 2.14 14.17 1.41 19.09 3.61

TCGGACCAGGCTTCAATC 18 20.2 2.86 17.93 1.52 14.39 2.28 30.69 0.77

TCGGACCAGGCTTCAATCC 19 11.35 0.67 12.37 1 7.18 2.04 22.81 3.98

TCGGACCAGGCTTCAATCCC 20 268.51 36.03 306.55 17.62 285.4 47.84 386.48 71.42

TCGGACCAGGCTTCAATCCCT 21 2005.47 166 2000.62 117.29 2160.77 386.18 2857.4 480.6

TCGGACCAGGCTTCATCCCCC 21 34.48 4.11 37.02 3.36 38.07 4.18 57.03 8.66

TCGGACCAGGCTTCATTC 18 81.61 10.14 95.76 27.26 99.66 18.31 167.99 7

TCGGACCAGGCTTCATTCC 19 196.7 10.18 183.26 46.44 267.16 3.07 303.67 3.47

TCGGACCAGGCTTCATTCCC 20 455.48 28.26 355.17 72.21 677.15 114.38 652.55 60.17

TCGGACCAGGCTTCATTCCCC 21 54866.67 3012.38 66266.67 4603.02 79066.67 4523.64 85900 8396.63

TCGGACCAGGCTTCATTCCCCC 22 13.48 4.11 15.62 0.99 31.88 8.4 36.56 1.67

117

TCGGACCAGGCTTCATTCCCG 21 19.47 3.09 15.25 3.73 25.83 1.99 22.69 4.83

TCGGACCAGGCTTCATTCCCT 21 158.53 5.37 182.21 17.91 185.57 11.98 215.51 22.69

TCGGACCAGGCTTCATTCCCTT 22 5.95 1.43 11.18 4.51 13.13 0.36

TCGGACCAGGCTTCATTCCT 20 23.17 1.71 15.98 1.77 19.82 5.72 35.06 1.01

TCGGACCAGGCTTCATTCCTC 21 469.63 44.26 512.73 76.24 531.72 9.74 659.22 47.32

TCGGACCAGGCTTCATTCT 19 53.62 1.5 66.1 17.11 65.95 0.38 113.82 11.3

TCGGACCAGGCTTCATTCTC 20 5.04 0.49

TCTCGGACCAGGCTTCATTCC 21 15.17 0.34 27.25 4.62 31.08 10.12 33.62 2.68 mir167 GATCATGCTGTGCAGTTTCATC 22 3.11 0.56

TGAAGCTGCCAGCATGATC 19 10.4 1.75 5.8 2.08 6.12 0.76

TGAAGCTGCCAGCATGATCT 20 17.86 3.32 5.7 2.03

TGAAGCTGCCAGCATGATCTA 21 11.75 3.05 11.64 2.31 15.6 3.53 12.83 3.99

TGAAGCTGCCAGCATGATCTG 21 502.03 21.34 239.81 16.68 210.04 17.72 337.22 14.48

TGAAGCTGCCAGCATGATCTGA 22 1961.56 107.08 2498.84 392.6 1452 271.75 1040.84 77.54

TGAAGCTGCCAGCATGATCTGG 22 16.6 3.61 8.45 0.37 9.38 2.29 mir168 GCTTGGTGCAGATCGGGAC 19 4.47 0.99 TCGCTTGGTGCAGATCGGG 19 5.4 1.26 9.76 1.89 6.9 1.19

TCGCTTGGTGCAGATCGGGA 20 153.19 3.46 157.66 19.85 153.02 31.45 184.56 23.86

TCGCTTGGTGCAGATCGGGAC 21 10719.08 380.92 10347.14 1081.65 8159 1814.92 9002.66 895.31

TCGCTTGGTGCAGGTCGGGAC 21 4.58 1.01 mir169 CAGCCAAGGATGACTTGCCGG 21 21.19 5.08 24.44 1.64 21.5 4.69 15.79 3.31 GGCGGTCACCTTGGCTAGC 19 111.15 12.63 187.88 27.84 108.32 20.03 156.84 14.84

TAGCCAAGAATGACTTGCCT 20 3.2 0.48

TAGCCAAGGATGACTTGCC 19 11.62 0.93 19.75 8.35 14.99 4.07 17.59 3.42

TAGCCAAGGATGACTTGCCT 20 8.15 1.38 24.58 10.26 12.76 1.11

TAGCCAAGGATGACTTGCCTA 21 5.15 1.74 7.88 1.7

TAGCCAAGGATGACTTGCCTG 21 10.92 2.36 18.14 5.07 11.46 2.43 14.72 3.9 mir171 TGAGCCGAACCAATATCACC 20 16.86 1.73 13.51 5.62 15.9 1.61 TGATTGAGCCGCGCCAATATC 21 25.96 3.86 17.24 2.68 23.96 1.45

118

TGATTGAGCCGTGCCAATATC 21 53.82 4.1 58.93 12.18 54.8 17.33 60.94 10.36 mir172 AGAATCTTGATGATGCTGCAT 21 8.85 3.5 7.66 2.23 7.44 0.77 mir319 AGAGCGTCCTTCAGTCCACTC 21 10.41 1.99 TTGGACTGAAGGGTGCTCCC 20 5.77 0.78 13.8 3.19 10.17 2.11 10.21 2.57

TTGGACTGAAGGGTGCTCCCT 21 87.94 3.14 51.61 15.99 58.93 37.99 54.24 3.72 mir390 AAGCTCAGGAGGGATAGCGCC 21 96.65 7.93 45.71 11.8 108.3 7.13 109.31 8.85 mir393 TCCAAAGGGATCGCATTGAT 20 5.04 0.49 TCCAAAGGGATCGCATTGATC 21 225.7 15.37 243.15 10.89 276.43 13.08 303.1 5.35

TCCAAAGGGATCGCATTGATCT 22 21.67 5.46 12 1.31 41.17 20.38 46.93 3.7

TTCCAAAGGGATCGCATTG 19 4.29 1.08

TTCCAAAGGGATCGCATTGAT 21 578.15 64.02 810.37 62.47 790.31 73.23 887.62 28.21

TTCCAAAGGGATCGCATTGATC 22 15.94 3.01 22.56 2.81 24.02 5.73 23.79 1.79 mir394 TTGGCATTCTGTCCACCTCC 20 74.94 3.81 54.08 11.41 53.62 13.91 64.23 3.13 mir395 TGAAGTGTTTGGGGGAACTC 20 42.62 2.95 120.17 11.3 34.85 22.04 12.02 2.05 mir396 ACAGGCTTTCTTGAACTG 18 937.38 73.16 585.77 50.08 843.05 69.76 934.79 118.58 CACAGGCTTTCTTGAACTG 19 54.69 5.09 41.86 3.21 62.28 6.46 66.47 7.59

TCCACAGGCTTTCTTGAAC 19 161.5 18.7 79.38 7.87 114.37 39.97 162.13 23.02

TCCACAGGCTTTCTTGAACGG 21 17.21 1.74 14.38 3.22 15.86 2.51

TCCACAGGCTTTCTTGAACT 20 857.87 56.82 322.05 27.93 672.85 177.39 979.11 132.5

TCCACAGGCTTTCTTGAACTG 21 8800.21 684.04 6199.76 638.6 8078.23 2159.15 7572.86 792.44

TTCCACAGCTTTCTTGAACT 20 11.35 1.86 8 4.76 10.59 4.53

TTCCACAGCTTTCTTGAACTG 21 28.97 6.54 28.21 5.46 27.95 14.11 22.53 6.07

TTCCACAGCTTTCTTGAACTT 21 2620.38 206.76 876.85 105.59 1765.33 454.55 1699.57 300.45

TTCCACAGGCTTTCTTGAACT 21 1366.17 64.95 mir398 TGTGTTCTCAGGTCGCCCCTG 21 43.36 11.28 112.29 44.37 22.52 7.44 48.28 8.23 mir399 TGCCAAAGGAGAATTGCCCTG 21 32.04 13.14 16.78 5.74 56.69 40.57 13.33 8.65 TGCCAAAGGAGAGTTGCCC 19 2.5 2.25

TGCCAAAGGAGAGTTGCCCTG 21 228.8 98.63 182.76 79.83 483.24 283.49 197.77 14.71 mir408 CTGCACTGCCTCTTCCCTGGC 21 17.57 1.14 7.59 1.26

119

TGCACTGCCTCTTCCCTGGCT 21 10.42 3.08 mir444 TGCAGTTGCTGCCTCAAGCTT 21 4.98 2.11 22.56 2.81 32.08 12.24

TGCAGTTGCTGTCTCAAGCTT 21 60.49 4.27 26.37 2.64 23.34 4.53

TGCAGTTGTTGTCTCAAGCT 20 4.26 0.41

TGCAGTTGTTGTCTCAAGCTT 21 111.32 10.24 98.63 11.25 103.57 5.2 152.88 11.31

TGTTGTCTCAAGCTTGCTGCC 21 200.09 10.02 136.67 14.41 189.39 51.14 267.57 23.67 mir528 CCTGTGCCTGCCTCTTCCATT 21 116.64 44.92 160.98 83.27 49.07 61.2 126.46 28.23 TGGAAGGGGCATGCAGAGGAG 21 26.7 9.83 36.49 14.9 19.61 2.46 mir1318 TCAGGAGAGATGACACCGAC 20 12.94 1.09 14.78 1.11 22.39 0.9 mir1432 ATCAGGAGAGATGACACCGA 20 18.19 5.33 18.62 3.55

ATCAGGAGAGATGACACCGAC 21 11.41 3.61 10.45 0.45

TCAGGAGAGATGACACCGAC 20 12.94 1.09 14.78 1.11 22.39 0.9 mir5054 TCCCCACGGTCGGCGCCA 18 8.32 1.65 11.64 3.88 13.19 3.75 7.71 2.64 mir5072 TTCCCCAGCGGAGTCGCCA 19 5.05 0.69 9.69 1.99 8.74 1.47 7.01 3

120

Additional file 4-3. List of novel microRNAs predicted from the four profiles Poa infirma, Poa supina, and the perennial and annual types of Poa annua.

perennialCtype' annualCtype' ref' Adjusted' Hairpin' Hairpin' Sequence' miRNA*' Poa$infirma$ Poa$supina$ Poa$annua' Poa$annua' genome' MFE' G/C%' Length' 'average' 'SE' average' 'SE' average' SE' average' SE' (AAAA)AAAAAGATTGAGCCGAAT' Bdi' Y' C30.14' 29.46' 112' 32.52% 5.96' 52.29% 38.31' AAGAACATCTAAGGGACTGAGTT( % ' % ' A)' Osa' N' C29.16' 33.73' 83' 2.48% 0.99' AAGAGTAGCGTTGATACACCG(T)' Osa' N' C38.01' 54.73' 201' % ' % 5.99%' 2.31'% ' AAGGATGACTTGCCGGGTATG' Bdi' N' C53.45' 47.18' 142' % ' 197.92% 26.80'% ' % ' AAGTCTGAGACTTGAACCTGGGTG' Bdi' N' C47.57' 52.70' 74' % ' % 8.44%' 3.61'% 9.86%' 2.08' AATCGATCGATAAACCTCTGC' Ath' N' C45.00' 42.39' 92' % 7.77%' 3.52'% ' 4.92% 0.57' 5.52% 1.04' Osa' N' C41.22' 52.63' 171' 7.77% 3.52'% ' 4.92% 0.57' 5.52% 1.04' ACACTTATTTTGAGACGGAGGGAG' ' Bdi' N' C58.41' 39.02' 82' % ' 2.42% 0.18' ACCGGACGGACTGATTCTATAGTT' Bdi' N' C30.13' 53.33' 75' % 2.14%' 0.56'% ' % ' ACTCCATTTCACTTAGGTTG' Bdi' Y' C26.39' 40.16' 122' 8.60% 0.62'% ' % 11.04%' 2.34'% ' ACTGAGACATCCTTTGTTAGACGG' Bdi' N' C47.46' 36.92' 130' % 2.39%' 0.21' % ' AGCCAAGGATGACTTGCCGGC' Bdi' N' C46.34' 47.52' 101' % 15.72%' 1.08' 30.24% 0.96'% 22.25%' 0.50'% ' Osa' N' C46.12' 48.06' 129' 15.72% 1.08' 30.24% 0.96' 22.25% 0.50'% 14.15%' 4.50' AGTATGAGCCCCGTGGACTAGC' ' Bdi' Y' C42.17' 53.26' 92' 940.53% 748.20' ATCTAAGGGACTGAGTTA' Osa' N' C29.16' 33.73' 83' % 6.41%' 1.01'% ' % ' ATCTAAGGGACTGAGTTG' Osa' N' C32.38' 42.86' 84' % 5.59%' 4.19'% 5.52%' 1.17'% ' ATCTTTAGTACCGGTTTGTAACAC' Osa' N' C50.70' 39.53' 86' % ' 16.26% 3.41' 3.64% 0.50'% 6.72%' 1.75' ATGAGCACCTCCGAGAGACTGAGC' Bdi' N' C35.66' 56.58' 76' % ' 38.41% 7.21' 20.69% 1.06' ATGGGTGACACTTTTTATGGATTG' Bdi' N' C47.44' 31.11' 90' % 2.38%' 0.80' % ' ATTAATACTTGGGCTGAT' Osa' Y' C28.37' 38.52' 135' % 18.77%' 4.65'% ' % ' % ' % ' % '

121

ATTGGCGCCGTCTGTGGGAAGAAC' Bdi' N' C39.12' 57.14' 91' 5.89% 0.67' ATTTCCTCTGTCCAACAAAAGATG' Bdi' N' C33.09' 29.63' 162' % ' % ' % 1.87%' 0.30' ATTTCGGAGGTGCTCATAGGGGTA' Osa' N' C31.94' 39.57' 139' % ' % 7.10%' 0.62' % 2.15%' 0.54' CAACAAAGGATGTCTTGACTT' Bdi' N' C44.70' 34.85' 132' % ' 3.58% 0.32'% ' CAGCCAAGGATGACTTGCCGGC' Osa' N' C56.56' 56.67' 90' % 36.76%' 6.24' 67.60% 4.36'% 20.54%' 8.36'% 35.76%' 15.12' CGGTTCCCACAGACGGCGCCA' Bdi' N' C40.00' 54.63' 108' 6.05% 1.47' 7.26% 1.06' 1.97% 0.21' CGTCGTCGGCACGGCCGG' Bdi' N' C78.03' 83.33' 66' 33.12% 25.68' % 58.28%' 2.91' CTGTGCGACTCGACCCGTGCA' Osa' N' C38.00' 56.36' 110' % ' 23.93% 1.12'% ' CTTGGACTGAAGGGTGCTCCCT' Osa' Y' C52.21' 54.46' 213' % ' 115.33% 41.15'% 89.10%' 35.12'% ' GACACGAGTGTGTGGAGCTGGGC % ' % ' C' Bdi' N' C72.91' 54.77' 199' 10.96% 3.16' 5.37% 0.57' GATGTCTCAATTTTGTCT' Bdi' N' C48.89' 30.95' 126' % ' % ' 2.48% 0.74' GCACGATTATTTTGTTGA' Osa' N' C25.41' 36.04' 111' % 16.71%' 0.81'% 7.82%' 1.96'% ' GCCCTCCTTCTAGCGCCA' Bdi' N' C41.59' 63.55' 107' 42.46% 8.50' 13.73% 7.27'% 46.69%' 3.05'% 44.11%' 14.66' GCGCTTGTGCCTGGGCCTGG(G)' Bdi' N' C61.27' 77.45' 102' 2.91% 1.33' GCTGGCTCTGATACCATGT' Osa' N' C37.76' 47.37' 76' 37.74% 24.95'% 36.45%' 7.88'% 64.60%' 15.93'% 112.23%' 23.33' GGAGAGATGGCTGAGTGG(TTGA)' Osa' N' C28.86' 39.24' 79' 43.72% 4.58' 24.19% 2.78' 16.95% 9.17' GGCGTCGTGGTCGCCGGCGGC' Bdi' N' C62.20' 77.97' 118' % ' 2.36% 0.63' GTATGAGCCCCGTGGACTAGC' Bdi' N' C57.89' 54.93' 71' % ' % ' % 122.57%' 38.99' GTCGGACCAGTCTCTCGGAGGTGC' Bdi' Y' C41.41' 54.55' 99' % 3.49%' 1.90'% ' 1.87% 0.30'% ' GTGCCGATTGTGGAGCCTGAGA' Ath' N' C33.19' 46.02' 113' % ' 1.87% 0.30'% ' GTGGTCGTGCCGGAGTGGTTATC' Bdi' N' C37.98' 54.55' 99' % 25.12%' 2.13'% 22.33%' 10.60' 34.33% 4.92'% 25.55%' 14.94' Osa' N' C40.61' 56.12' 98' 25.12% 2.13' 22.33% 10.60' 34.33% 4.92' 25.55% 14.94' GTTCTCCTCAAATCACTTCAGT' ' Bdi' N' C45.30' 43.62' 149' 45.19% 8.53' 14.38% 1.94' Osa' N' C54.47' 44.67' 150' % ' % 2.73%' 0.62' GTTTGACTTTGACTAAACCCAGAA' ' Bdi' N' C43.08' 26.37' 201' % ' % 2.39%' 0.21'% ' TAATAGGGACAGTCGGGGGC' Osa' N' C30.61' 37.72' 114' % ' % ' % 23.52%' 12.29' % ' % ' % '

122

TAATTTAGAACGGAGGGAGTA' Bdi' N' C49.88' 37.21' 86' 4.14% 0.20' 3.22% 0.81' TACTCACTCTGTCCAACAAAAGAT' Bdi' N' C46.87' 32.23' 121' % ' 6.51% 0.01'% ' TAGCCAAGGATGACTTGCC' Bdi' Y' C50.15' 47.79' 136' % 5.62%' 3.93' % 15.79%' 3.83'% 17.59%' 3.41' Ath' N' C45.68' 42.45' 139' % ' 15.79% 3.83' 18.55% 5.68' ' Osa' Y' C54.96' 51.06' 141' % ' % ' 15.79% 3.83' TAGGTGCTTTTGGCTTTTGGC' ' Bdi' N' C44.53' 33.11' 148' % ' % 3.92%' 0.02' % ' TAGTTCTTGTTGATGGAGGCC' Bdi' N' C41.90' 60.34' 116' % ' 3.47% 0.87'% 3.59%' 0.33'% 6.74%' 1.55' TATAACACAAGAGGATTTG' Osa' N' C47.76' 38.82' 170' % 3.63%' 0.48' TCAGGAGAGATGACACCGACA' Bdi' N' C51.37' 52.52' 139' % ' % 28.50%' 2.02'% ' Osa' N' C49.74' 51.30' 115' % ' % ' 28.50% 2.02'% ' TCCACAGGCTTTCTTGAAC' ' Bdi' N' C57.23' 73.85' 130' % 143.18%' 6.45'% 79.39%' 7.87' 137.43% 1.51'% 162.31%' 22.85' Ath' N' C37.40' 54.35' 92' 161.50% 18.70' 79.39% 7.87' 114.37% 23.08' 162.31% 22.85' TCCCCGGCAACGGCGCCA' ' Ath' N' C66.99' 50.89' 169' 33.76% 8.19' 79.59% 21.58' 76.68% 5.27' 47.56% 18.81' TCCTTGGCTACACCTTACTCT' Bdi' N' C45.28' 48.78' 123' 6.94% 1.43' 4.59% 3.02' TCTAAGGGACTGAGTTGC' Osa' N' C32.38' 42.86' 84' % 18.77%' 7.52' % ' TCTCAGTGGTATCATGGTATCAGA' Osa' N' C59.08' 40.23' 87' 2.65% 0.53'% 2.93%' 0.33'% 3.83%' 1.66'% 5.75%' 1.29' TCTTGACAGACCAAAATC' Bdi' N' C26.67' 41.33' 75' 3.63% 0.48' 2.52% 0.16' 3.23% 0.24' TCTTGACCTTGCAAGACCTTT' Osa' N' C32.50' 48.44' 64' % ' 3.64% 0.50' 7.62% 0.16' TGACATCTTTTGTTGGACAGAGG(G % ' % ' )' Bdi' N' C44.29' 36.72' 128' 7.20% 2.67' 4.28% 0.64' 6.64% 0.08' TGACGTAACTGCAGGTGACTT' Bdi' N' C62.99' 54.21' 107' % 4.10%' 0.14' TGAGCCGAACCAATATCACCC' Bdi' N' C51.81' 49.40' 83' 1084.57%799.94'% 292.28%'121.40'% 986.56%'616.13'% 911.58%'411.00' TGCAGCCAAGGATGACTTGCC' Osa' N' C56.00' 50.43' 115' 7.49% 1.94' 7.25% 0.54' TGCCAAAGGAGAGTTGCCC' Osa' N' C51.92' 50.96' 104' % ' % 3.74%' 0.60' TGCTGGAGAAGCAGGGCACGT' Bdi' Y' C67.77' 66.99' 103' % ' % 10.31%' 3.81' % ' Osa' Y' C70.55' 69.72' 109' % ' 10.31% 3.81'% ' % ' TGTGGTAGAAAGAACTATA' ' Bdi' N' C45.41' 29.73' 74' % ' 9.94% 2.18'% ' % ' % ' % ' % '

123

TGTTGACAAACTTGAGACACT' Ath' N' C28.53' 36.27' 102' 3.97% 0.79' TTAATAGGGACAGTCGGGGGC' Osa' N' C30.61' 37.72' 114' % 105.33%' 11.43'% ' % ' TTCCCACAGACGGCGCCA' Ath' N' C35.78' 36.27' 102' % 9.57%' 5.34' 19.26% 9.08'% 11.22%' 4.24'% 19.93%' 9.15' TTCCGTCCAATAAAGAATGTC' Bdi' Y' C45.92' 35.20' 125' 2.42% 0.18' TTGACAAACTTGAGACACT' Ath' N' C28.53' 36.27' 102' % ' % ' % 1.87%' 0.30' TTGAGTGCAGCGTTGATGAAC(C)'' Bdi' N' C68.61' 64.36' 101' % 30.37%' 13.61'% 70.80%' 40.83' 18.68% 4.26'% 209.78%' 87.41' Osa' N' C51.61' 48.21' 112' 30.37% 13.61' 70.80% 40.83' 18.68% 4.26' 209.78% 87.41' TTGCGTCGTTGTGCCTGGGC' ' Ath' N' C45.29' 62.86' 70' 113.02% 89.33' 42.34% 9.15' 5.40% 2.90' 72.59% 19.17' TTGCGTCGTTGTGCCTGGGC(TG)' Osa' N' C46.00' 62.86' 70' 113.02% 89.33' 37.76% 7.00' 11.21% 6.05' 72.59% 19.17' TTGGATTGAAGGGAGCTCT' Ath' N' C42.09' 40.28' 211' 37.76% 8.08' TTGGATTGAAGGGAGCTCT(C)' Bdi' Y' C47.06' 55.40' 213' % ' % ' % 3.10%' 0.12' TTGTCTAGATTCGTATGTATC' Bdi' N' C71.38' 41.54' 130' % 3.97%' 2.37'% ' % ' 10.53% 1.58' TTGTTGTCTGGTTCAAGGTCT' Bdi' N' C47.27' 46.58' 161' 17.45% 5.09'% 7.17%' 1.71'% 13.74%' 4.74' 10.72% 3.91' TTTATCACCGCCTCTTTCTC' Osa' N' C38.01' 54.73' 201' 2.14% 0.56' TTTCCGATGCCTCCCATTCCTA' Bdi' N' C54.70' 48.70' 115' 2.91% 1.33'% ' % ' % ' Osa' N' C45.51' 42.03' 138' 2.91% 1.33'% ' % ' % ' TTTCGCTCCTATCTGACGACC' ' Bdi' N' C28.59' 41.05' 95' % 23.12%' 7.52'% 3.63%' 1.87'% ' TTTCTGATGCCTCCCATTCCTA' Bdi' N' C42.58' 44.53' 128' % 5.95%' 1.43' % ' TTTGGATTGAAGGGAGCTC(T)' Ath' N' C38.46' 42.56' 195' 35.55% 4.63'% 50.42%' 10.50'% 31.93%' 1.29'% 34.06%' 15.47' TTTTGACAAACTTGAGACACT' Bdi' N' C49.23' 36.15' 130' 198.86% 22.82' 47.90% 2.22' 44.48% 18.50' % '

124

Chapter 5

Summary and future perspectives

Summary

This dissertation provides a comprehensive genetic study on the turfgrass species

Poa annua to understand its polyploid evolution and phenotypic variation, using molecular biology, cytology and genomic techniques. Our phylogenetic data showed that

Poa annua is an allotetraploid with two diploid species Poa infirma and Poa supina as the two parental species. The chloroplast DNA sequences from a worldwide collection of

Poa annua all clustered with Poa infirma, showing that Poa infirma was the maternal parent of the hybridization. The genetic distances between Poa annua DNA and the respective orthologs within two parental species indicate a very recent origin of Poa annua, likely during the last glaciation event in south Europe. More detailed network parsimony analyses indicated that at least two interspecific hybridizations between Poa infirma and Poa supina gave rise to the present day Poa annua. We also found that the genomes of Poa infirma and Poa supina are divergent, and we designated them II and

SS, making the genomic constitution of the allotetraploid Poa annua IISS. In accordance with previous karyotypic study performed by Koshy (Koshy, 1968), our FISH study using 5S rDNA and 45S rDNA added to the evidence of chromosomal rearrangements in

Poa annua during its polyploid evolution. Namely, the chromosome structure of Poa

125 annua did not match the combination of its parental species. In addition, we observed that even within the Poa annua species, different individuals may have different rDNA loci, a potential explanation for the wide range of phenotypic variation of this species. The recent availability of next generation sequencing (NGS) platforms enabled us to generate the first small RNA profiles for Poa infirma, Poa supina, perennial-type Poa annua and annual-type Poa annua, putting the genomic study on turfgrass species a bit step forward.

Serving as the baseline profile for future research, the small RNA extracts were collected from leaf tissue of young seedlings. It was not too surprising to find that these four profiles were highly similar in terms of small RNA length distribution, miRNA families and expression. In this NGS study, we incorporated biological replicates to represent each profile, an experimental design that is surprisingly lacking in many current NGS publications.

The extreme phenotypic variation and remarkable adaptability of Poa annua made it one of the most widely distributed plant species in the world. In the turf industry, tremendous amount of efforts are being made trying to eliminate this weed from various environments. Meanwhile, the superb turf quality of the greens-type Poa annua has attracted breeders to generate commercial cultivars for golf course putting greens. This present study provides some insight into understanding the genetics of this species.

Polyploidy has recently been found to be much more profound and widespread than traditionally thought, and is believed to play a significant role in plant speciation and evolution. The allotetraploid Poa annua, with its recent origin and the availability of both diploid parental species, could serve as an ideal model for studying the underlying

126 mechanism of polyploidy. A number of potential studies could be conducted in the future to enhance our understanding of the fascinating species Poa annua.

Future perspectives

Chromosomal rearrangements in Poa annua

Our FISH with rDNA probes showed genomic variations exist within the species of Poa annua. How flexible is Poa annua’s genomic structure? Are the morphological variations within Poa annua attributable to such genomic differences? One way of testing this hypothesis is to perform FISH or GISH on different populations of Poa annua and explore the extent and patterns of gene loci number and position changes. In addition, if parental specific DNA probes can be generated for detection of homeologous loci, we may be able to perform karyotypic comparisons in Poa annua with a much higher resolution. This work could provide a brand new level of genetic explanation for plant phenotypes.

Two independent research groups have reported successful reciprocal crosses between Poa infirma and Poa supina, and described the progenies as showing no striking morphological differences under greenhouse conditions (Tutin, 1957; Darmancy &

Gasquez, 1997). Our data using a world collection of Poa annua have shown that Poa infirma served as the maternal parent for all samples, and we have also provided evidence demonstrating that multiple hybridizations contributed to the origin of Poa annua (Mao

& Huff, 2012). Therefore, it suggests that natural selection only favors Poa annua with

127 Poa infirma cytoplasmic contribution. In the future, if reciprocal crosses between Poa infirma and Poa supina can be generated again, using FISH or GISH experiment, we can compare the parental genomic dominance and extent of genomic shock between the progenies and may be able to explain this parental preference.

Further small RNA studies of Poa annua

The small RNA profiles generated in this study were from the leaf tissue of young seedlings, and our analyses showed that both perennial and annual types of Poa annua exhibited similar profiles when compared to the parental species. This finding was not too surprising considering that at this growing stage, there were not striking phenotypic differences among these grasses. However, it is possible that small RNAs may be involved in determining the phenotypic differences between different types of Poa annua at later developmental stages. Additionally, certain small RNAs may be differentially expressed only in specific tissues or cell types. However, my data can serve as an excellent baseline of small RNA profiles in these species. Therefore, future work may focus on analyzing small RNA expressions in later plant developmental stages or specific tissues of different types of Poa annua.

Poa annua is incredible in its adaptability to environmental stresses, and the responding mechanisms may only be turned on with the presence of specific stresses. For example, it has been demonstrated previously in our lab that the “greens-type” phenotype can be unstable and lost when mowing stress is removed (La Mantia & Huff, 2011). A number of studies have suggested that small RNAs are dynamically regulated in plant

128 responses to stresses (Zhang et al., 2009; Shuai et al., 2013; Li et al., 2013). Therefore, further study may compare the small RNA expression in Poa annua and its parental species in response to stresses such as mowing or traffic. This work may provide more insights into how the polyploid evolution has enabled Poa annua to be more adaptive than both parental species.

129 Reference

Darmancy H, Gasquez J. 1997. Spontaneous hybridization of the putative ancestors of the allotetraploid Poa annua. New Phytologist 136: 497–501. Koshy TK. 1968. Evolutionary origin of Poa annua L. in the light of karyotypic studies. Genome 10: 112–118. Li B, Duan H, Li J, Deng XW, Yin W, Xia X. 2013. Global identification of miRNAs and targets in Populus euphratica under salt stress. Plant molecular biology 81: 525– 539. La Mantia JM, Huff DR. 2011. Instability of the greens-type phenotype in Poa annua L. Crop Science 51: 1784–1792. Mao Q, Huff DR. 2012. The evolutionary origin of Poa annua L. Crop Science 52: 1910–1922. Shuai P, Liang D, Zhang Z, Yin W, Xia X. 2013. Identification of drought-responsive and novel Populus trichocarpa microRNAs by high-throughput sequencing and their targets using degradome analysis. BMC genomics 14: 233. Tutin TG. 1957. A contribution to the experimental taxonomy of Poa annua L. Watsonia 4: 1–10. Zhang J, Xu Y, Huan Q, Chong K. 2009. Deep sequencing of Brachypodium small RNAs at the global genome level identifies microRNAs involved in cold stress response. BMC genomics 10: 449.

VITA

Qing Mao

Education

• Ph.D candidate in Plant Biology, Pennsylvania State University (2008-present) • B.S. in Biology, Peking University, China (2004 - 2008)

Publication

• Qing Mao and David Huff. “The evolutionary origin of Poa annua L.” Crop Science (2012) 52:1910-1922. • Qing Mao and David Huff. “Characterizing small RNA profiles of allotetraploid Poa annua L.and its diploid parents” Submitted to BMC Plant Biology

Honors and Awards

• Member of Gamma Sigma Delta Honor Society of Agriculture • Eva J. Pell Endowed Graduate Student Scholarship, Plant Biology Graduate Program, Penn State University (2012) • Graduate Student Travel Funds, Plant Biology Graduate Program, Penn State University (2012) • College of Agricultural Sciences Competitive Grants Recipient, Penn State University (2011) • 1st place in Division C-5 Graduate Student Oral Presentation Competition, awarded by the Turf Breeders Association. ASA-CSSA-SSSA International Annual Meeting (2011) • Graduate Student Travel Funds, Department of Crop and Soil Sciences, Penn State University (2011) • Graduate Student Travel Award, College of Agricultural Sciences, Penn State University (2011) • Pennsylvania State University Graduate Fellowship (2008) • Virginia S. Shirley Memorial Graduate Scholarship, Penn State University (2008) • Braddock Graduate Scholarship, Penn State University (2008)