Geographic variation in the seed mycobiome of Coastal Douglas-fir (Pseudotsuga menziesii var. menziesii)
By Gillian E. Bergmann
A THESIS
Submitted to Oregon State University Honors College
In partial fulfillment of the requirements for the degree of
Honors Baccalaureate of Science in BioResource Research, Sustainable Ecosystems (Honors Scholar)
Presented May 24, 2019 Commencement June 2019
AN ABSTRACT OF THE THESIS OF
Gillian E. Bergmann for the degree of Honors Baccalaureate of Science in BioResource Research presented on May 24, 2019. Title: Geographic variation in the seed mycobiome of Coastal Douglas-fir (Pseudotsuga menziesii var. menziesii).
Abstract Approval: ______Posy E. Busby
Seeds are an essential component of plant life histories, and seed endophytes have the potential to influence germination, seedling establishment and development. That said, seed endophytes are a relatively new area of study, both in the factors that influence which taxa are present and how these microbes alter plant function. The objectives of my thesis were to characterize the fungal endophytes present in native and introduced populations of Coastal Douglas-fir
(Pseudotsuga menziesii var. menziesii) seeds, and to test whether some of these endophytes affect seedling survival and growth in response to drought. Using culture-based techniques, endophytes were isolated from eight native populations of Douglas-fir seeds in the United States and from three introduced populations in New Zealand. All seeds had zero or one fungal endophyte; total endophyte isolation frequency was 5.3% in the United States populations and
9.2% in the New Zealand populations. These results are consistent with previous work documenting a bottleneck in the plant microbiome at the seed stage. Based on DNA sequence data (ITS), the dominant taxa present in the sampled seed populations were Trichoderma spp. and Sydowia polyspora. Endophyte community composition differed among US seed provenances; future work could further investigate how these communities vary along environmental and plant genetic gradients. To test the hypothesis that endophytes confer drought tolerance, Douglas fir seedlings were inoculated with one of two isolates of seed-borne
Trichoderma spp., or sterile water for controls, and grown under drought conditions. Drought reduced the survival of seedlings (i.e., increasing the time to death compared to un-inoculated controls); however, inoculation with endophytes did not significantly alter this result. Further study is needed to more fully characterize the functional roles of seed endophytes in Douglas-fir response to abiotic stresses, with applications in mitigating plant stress due to climate change.
KEY WORDS: Ascomycota, endophytes, Primary Symbiont Hypothesis, provenance, Pseudotsuga menziesii, Sydowia polyspora, Trichoderma, maternal transmission
Corresponding email address: [email protected]
©Copyright by Gillian E. Bergmann May 24, 2019 All Rights Reserved
Geographic variation in the seed mycobiome of Coastal Douglas-fir (Pseudotsuga menziesii var. menziesii)
By Gillian E. Bergmann
A THESIS
Submitted to Oregon State University Honors College
In partial fulfillment of the requirements for the degree of
Honors Baccalaureate of Science in BioResource Research, Sustainable Ecosystems (Honors Scholar)
Presented May 24, 2019 Commencement June 2019
Honors Baccalaureate of Science in BioResource Research project of Gillian E. Bergmann presented on May 24, 2019
APPROVED:
Posy E. Busby, Mentor, representing Department of Botany and Plant Pathology
Joseph W. Spatafora, Secondary Mentor, representing Department of Botany and Plant Pathology
Katharine Field, Committee Member, representing BioResource Research Interdisciplinary Program
Toni Doolen, Dean, Oregon State University Honors College
I understand that my project will become part of the permanent collection of Oregon State University, Honors College. My signature below authorizes release of my project to any reader upon request.
Gillian E. Bergmann, Author
INTRODUCTION Plant-associated microbes are pivotal for their effects on plant survival and function, and one life stage where they could be especially important is in seeds. Of course, the primary purpose of seeds is the reproduction of plant species. Seeds provide population stability through their high genetic variability, and their ability to survive harsh environmental conditions through dormancy
(Fenner and Thompson 2005). Seeds are also major agents of dispersal, which can benefit plants through reducing competition between parents and offspring, reducing density-dependent risks of pathogens and predators, and allowing species to colonize new areas (Willson and Traveset
2000). Given their importance, it is critical to note that seed germination and early seedling establishment represent a significant bottleneck in the plant life cycle (Leck et al. 2008), when young plants are vulnerable to biotic and abiotic stresses, such as pathogens, predators, and drought (Bever et al. 2015). Seed-associated microbes have been known to improve plant development at this stage (e.g. Puente et al. 2009), so understanding how seed-associated microbes contribute to seed survival and fitness is of great interest.
One microbial community of particular importance is the fungal endophyte community.
Endophytes, defined as microbes (fungi, bacteria, archaea, protists) that live inside plant tissues without causing disease (Rodriguez et al. 2009, Hardoim et al. 2015), are of increasing interest given their effects on plant survival and fitness. While many fungal endophytes are thought to be saprotrophs or latent pathogens, some taxa have been found to modify plant resistance to disease
(Busby et al. 2016a, 2016b), herbivory (Saikkonen et al. 1998), drought (Hamilton and Bauerle
2012), and soil pollution (Regvar et al. 2010, Naik 2017). Additionally, some studies have shown that endophytes can alter nutrient acquisition (Christian et al. 2019) and fecundity (Wagner et al.
2014). Given the benefits that endophytes confer to their host plants, a major research goal in basic and applied plant sciences is to evaluate the potential to integrate endophytes into sustainable agriculture (Busby et al. 2017). Seed endophytes could be particularly vital in this area because some of them are vertically transmitted from parent to offspring (Nelson 2018), transferring endophyte effects between generations (Rosenberg et al. 2009) with potential legacy effects later in life (Aleklett and Hart 2013). However, for the vast majority of plants, we know close to nothing about the abundance and distribution of fungi in seeds, and the function of those fungi (Nelson 2018).
Coastal Douglas-fir (Pseudotsuga menziesii var. menziesii) is a common tree species in the Pacific Northwest United States, and is a major timber and nursery plant domestically (Watts et al. 2015) and internationally (ie Europe and New Zealand; Maclaren 2009, Eilmann et al.
2013). This species is ecologically critical as an early seral species in forest succession (Uchytil
1991), and is one of the first to regenerate after wildfire events (Agee 1991). P. menziesii var. menziesii also effectively sequesters carbon (Watts et al. 2015), and provides habitat for a variety of plants and wildlife over its long lifespan (Uchytil 1991). In industry, P. menziesii var. menziesii is a highly productive timber crop for its quick growth and strong wood (Uchytil 1991,
Watts et al. 2015), and it is one of the most commonly used species in Christmas tree production
(Kruckenbuerg and Chalker-Scott 1982).
Because of its importance in forest ecosystems and plantations, there is growing concern about the impacts of drought on the species due to the climate crisis (Stewart 2015, Watts et al.
2015). Under drought conditions, Pseudotsuga menziesii seedlings experience declines in photosynthesis rates (Zavitkowski and Ferrell 1968), reduced growth (Khan et al. 1996) and xylem cavitation (Kavanagh et al. 1999). Moreover, drought events are projected to become more frequent, prolonged and severe in the future (Weiskittel et al. 2012, Watts et al. 2015), posing a major threat to the survival and productivity of this species. While it is known that certain provenances of P. menziesii var. menziesii are more drought tolerant than others (St Clair and Howe 2007, Eilmann et al. 2013), there is a need to find new tools and seed sources to help land users manage and protect this species against drought (Watts et al. 2015).
While there has been some study of the foliar (e.g. Daniels 2017) and root (e.g. Hoff et al.
2004) endophyte communities of Pseudotsuga menziesii, their seed endophytes are still largely unknown. So far, only one study, published over 50 years ago, has done a cursory examination of the fungal endophytes of Pseudotsuga menziesii (Bloomberg 1966). This study reported that endophytes were present in Pseudotsuga menziesii seeds, and that there were some differences in the taxa between seed lots sampled (Bloomberg 1966). However, this study only qualitatively examined two seed lots from British Columbia, and endophyte identifications were made based on morphology. As such, a large-scale characterization effort of Pseudotsuga menziesii seed endophytes and their potential effects with molecular methods has yet to be done.
Given this lack of knowledge, this exploratory study aimed to characterize the fungal endophytes of P. menziesii var. menziesii seeds using culture-based methods and Sanger sequencing, and to experimentally test several of these endophytes for effects on seedling drought response. The goal of this study was to address three major questions: 1) What endophytes are present in P. menziesii var. menziesii seeds from native and introduced ranges, 2) do some of these seed endophytes alter P. menziesii var. menziesii survival and growth under drought conditions, and 3) does seed provenance alter the presence and drought tolerance effects of these endophytes? To characterize fungal endophytes, I sampled a total of eleven P. menziesii var. menziesii seed populations from the United States and New Zealand. I expected to observe reduced species richness and isolation frequency of fungal endophytes based on the Primary Symbiont
Hypothesis (Newcombe et al. 2018). Using a mix of quantitative and qualitative analysis, I examined endophyte community composition for differences across seed provenances. I hypothesized that seed endophyte community composition would differ based on seed provenance, both within P. menziesii var. menziesii’s native range in the United States, and between the native range and an introduced range in New Zealand.
To test potential drought tolerance effects, I conducted an experiment on seedlings from one of the characterized populations. In this experiment, I inoculated seedlings with different seed-borne Trichoderma spp. isolates and grew them under both ambient and drought watering conditions to test endophyte effect on plant mortality, stress and growth. Through this experiment, my hypotheses were: 1) that seed-associated Trichoderma isolates would alter seedling response to drought conditions, and 2) that the Trichoderma isolate from a drier seed provenance would confer greater drought tolerance than the Trichoderma isolate from a wetter seed provenance consistent with habitat adapted symbiosis (Rodriguez et al. 2008).
MATERIALS AND METHODS
Sampling of Pseudotsuga menziesii seeds.- In the United States, Pseudotsuga menziesii var. menziesii seeds were selected from eight seed zones spread along a latitudinal gradient from northern Washington to Central California (FIG. 1, TABLE 1). Populations were selected opportunistically due to their geographic variability across the native range of P. menziesii var. menziesii (Uchytil 1991), and were provided by Mike Gerdes from Silvaseed Company Foresters. Cones were harvested from the ground in wild forests within a five to ten-mile radius at each zone, within elevations of 0 to 1500 feet (Gerdes, personal communication). Cones were checked for recent pollination prior to harvest, and seeds were prepared for storage through drying, removal from cones, dewinging and removal of debris (Gerdes, personal communication). Processed seeds were placed in cold storage and kept there for several months to several years before being provided for this study (Gerdes, personal communication).
For sampling of introduced populations of P. menziesii var. FIGURE 1. Map of seed menziesii in New Zealand, seeds were used from three lines grown population sampled in the USA, adapted from a distribution in an orchard in Amberley, Canterbury (TABLE 1). Seeds were map of P. menziesii by Little (1971). The green area represents the range of P. provided by Shaf van Ballekom of Proseed New Zealand Limited. menziesii var. menziesii, and orange points represent the The seed lines sampled represented populations that were zones sampled. introduced to New Zealand in 1959 from 44 provenances across Washington, Oregon, and
California, and were grown in Amberley and Waikuku orchards after introduction (Proseed NZ
2019; van Ballekom, personal communication). These seed populations were sampled opportunistically to represent the variation in provenance from the United States populations, as well as a history of cultivation in an introduced range. Seeds used in this study were harvested in
2011 from cones located on branches 2.5-3 meters above the ground (van Ballekom, personal communication). Following harvest, cones were air and kiln-dried, and seeds were then extracted and stored at 4℃ (van Ballekom, personal communication). Seeds were assessed for viability every two years following harvest (van Ballekom, personal communication).
Table 1. Summary of seed populations sampled in the United States and New Zealand. Population ID Country of origin Seed zone Locale DF_CB United States 011 Clallam Bay, Washington DF_TL United States 652 Trout Lake, Washington DF_HR United States 661 Hood River, Oregon DF_Wm United States 251 Willamina, Oregon DF_Gl United States 491 Glide, Oregon DF_CJ United States 512 Cave Junction, Oregon DF_PC United States 371 Pollard Corral, California DF_CA United States 095 Mendocino County, California NZ_WA New Zealand N/A Amberley, Canterbury NZ_OR New Zealand N/A Amberley, Canterbury NZ_Cal New Zealand N/A Amberley, Canterbury
Preparation of seeds for endophyte isolation.- Prior to fungal isolation, both United States and
New Zealand seeds were stratified at 4°C for four weeks following the protocol described by
Mujic (2015). Stratification was performed to better ensure emergence of endophytes, and seeds were turned every week to prevent fungal contamination. After stratification, 100 seeds per population were sterilized in aseptic conditions using ethanol (95%) with TWEEN 80 (0.01%) for 10 seconds, hydrogen peroxide (30%) or sodium hypochlorite (0.5%) for 2 minutes (for
United States and New Zealand seeds, respectively), ethanol (70%) for 2 minutes and sterilized deionized water for 1 minute. Sterilization was conducted to limit presence of microbial contaminants on the seed surface. Seeds were gently agitated in each solution and allowed to dry for ten minutes following the soak in sterilized distilled water. Once dry, New Zealand seeds were cut in half to improve endophyte emergence rates. All seeds were plated onto media and incubated at room temperature in ambient light for 1-3 weeks, and emerging endophytes were sub-cultured onto fresh media. United States seeds were plated on potato dextrose agar (PDA; potato extract 4g/L, dextrose 20g/L, agar 15g/L), and New Zealand seeds were plated on malt yeast extract (MYE; malt extract 10g/L, yeast extract 1g/L, agar 20g/L) agar amended with the antibiotics chlortetracyline hydrochloride (50mg/L) and streptomycin sulphate (250 mg/L). Media types were selected for culturing a wide array of fungal taxa (Atlas 2010). Sub-cultured endophytes were plated on PDA and MYE media for United States and New Zealand isolates respectively. Sterilization of seed samples was confirmed by rolling seeds on the media above, and by plating sterilized distilled water from the soaking protocol onto media for New Zealand populations. A total of 20 sterilization plates were made (8 United States, 12 New Zealand) and tested under room temperature and ambient light for emergence of fungal and bacterial contaminants. All United States isolates were archived in sterile water for potential use in future studies.
Molecular characterization of endophyte isolates.- Once pure endophyte sub-cultures had grown sufficient amounts of vegetative mycelium, genomic DNA was extracted using the Sigma
Extract-n-Amp kit (Sigma-Aldrich, Missouri, USA) for United States isolates, and a Chelex 100 buffer (5%, Bio-Rad Laboratories) method for New Zealand isolates (Hill et al., 2017; Brookes, unpublished). After extraction, ITS1-F (CTTGGTCATTTAGAGGAAGTAA; Gardes and Bruns
1993) and LR3 (CCGTGTTTCAAGACGGG; Vilgalys 2018) primers were used for United
States isolates, and ITS4 (TCCTCCGCTTATTGATATGC; White et al. 1990) and ITS5
(GGAAGTAAAAGTCGTAACAAGG; White et al. 1990) primers were used for New Zealand isolates to amplify the internal transcribed spacer (ITS) region (Schoch et al. 2012). The PCR reaction was 50 uL in volume for United States isolates and 25 uL in volume for New Zealand isolates and, including 2 uL of genomic DNA for all isolates. PCR products were visualized using gel electrophoresis. PCR products producing a visible band were sent for Sanger sequencing. Raw sequence reads were cleaned with SeqTrace (Stucky 2012), and the final reads were used to estimate taxonomic identity with query results on the GenBank
(https://blast.ncbi.nlm.nih.gov/Blast.cgi) and UNITE (Kõljalg et al. 2005; http:// unite.ut.ee/index.php) databases. Identifications were based on the consensus of the top 5-7 results from both databases. Isolates were identified to species if the dominant taxon queries were at 97% identity or above, and genus if the dominant taxon queries were at 93% identity or above (Tedersoo et al. 2014). Isolates with no taxon queries at the species or genus level were identified to the taxonomic level of the main query result. Following identification, taxa were assigned to functional guilds and morphotypes using FUNGuild (Nguyen et al. 2016; http://www.stbates.org/guilds/app.php).
Analysis of endophyte community composition data.- Statistical analysis and data visualization were performed using R 3.5.2 (R Core Team 2016, GGPLOT2 package). To determine if there was an association between seed provenance and endophyte community composition, chi-square tests for equal proportions were conducted using the prop.test function in the MOSAIC package (Pruim et al. 2019). Endophyte community composition was assessed at the seed population level based on two metrics: total endophyte frequency, and frequency of any common taxa. Frequency was defined as the number of times an endophyte was isolated out of the total number of seeds cultured per population. Statistical analysis was conducted solely on the United States populations due to differences in the isolation and DNA extraction methods between the United States and New Zealand populations.
In addition to statistical analysis of endophytes within the United States populations, the endophyte communities of the United States and New Zealand were qualitatively compared for similarities and differences in the taxa characterized, and for genetic similarities and differences in taxa isolated in both ranges. To assess genetic variation of common taxa, sequences were aligned and trimmed in Geneious Pro 11. RAxML-HPC2 XSEDE on the Cipres Science Gateway (Miller et al. 2010) was used to compute a maximum likelihood tree for the aligned sequences.
Drought experiment.- To investigate the potential effect of fungal seed endophytes on seedling survival and development under drought stress, an inoculation experiment was conducted on 70 seedlings from the DF_PC (Pollard Corral, California) seed population. This seed population was selected because of observations of good germination rates during the characterization study.
Two isolates of Trichoderma spp. were used as inoculum sources in this experiment because of the use of various Trichoderma species in drought tolerance for other plant hosts (Bae et al.
2009, Mastouri et al. 2010, Shukla et al. 2012). Isolates were found in Washington and
California, and were selected to test for habitat adaptation of drought effects.
Germinated seedlings were randomly assigned to one of three inoculation treatments: an endophyte free control, CB42s (Trichoderma koningii, herein N. Trich), or PC42 (Trichoderma citrinoviride, herein S. Trich). First, seeds were surface sterilized in aseptic conditions using sodium hypochlorite (10%) for two minutes, ethanol (70%) for two minutes, and sterile water for one minute. After drying for ten minutes, seeds were plated on sterile filter paper and wetted with sterile water. Seed plates were stored under ambient light and temperature conditions for 2-
3 weeks to allow for germination. Germination and early development was observed when a seedling had fully emerged and the seed coat had been shed.
Endophyte inoculation was applied to seedlings by wetting with 2 mL of spore slurry diluted to 1,000,000 spores/mL using a hemocytometer, and control plants were incubated with sterile water. After incubation in inoculum for 24 hours, seedlings were planted in sterile
Sunshine® All-Purpose Potting Mix in a growth chamber with light, humidity and temperature controls. Endophyte-inoculated seedlings were inoculated at the roots with an additional 8mL of spore slurry diluted to 10,000 spores/mL (Ridout, personal communication). Seedlings were established for 1 week with 8 mL of water applied twice per week. After the establishment period, seedlings were randomly assigned to two watering treatments: watering with 8 mL twice per week to simulate non-drought conditions, and watering with 4 mL twice per week to simulate drought conditions. All seedling treatment groups are summarized in TABLE 2. Seedlings were watered following these two conditions for ten weeks, and plant mortality, height, needle count and percent tissue senescence were recorded on a weekly basis. Percent needle senescence was measured by examining the amount of yellowed or desiccated needle tissue out of total needle area. Seedling mortality was determined when all plant tissue was yellowed and desiccated
(Shirley and Meuli 1939). At the end of the ten weeks, surviving seedlings were destructively sampled to collect dry biomass data.
TABLE 2. Summary of treatment groups for developmental drought experiment. Treatment name Drought Endophyte Number of plants E-Dr No No 10 E+Dr Yes No 13 CB-Dr No CB42 (Northern Trichoderma) 12 CB+Dr Yes CB42 (Norther Trichoderma) 11 PC-Dr No PC42 (Southern Trichoderma) 12 PC+Dr Yes PC42 (Southern Trichoderma) 12
Analysis of drought experiment data.- Statistical analysis and data visualization were performed using R 3.5.2 (R Core Team 2016, packages GGPLOT2). For mortality data, a
Mantel-Cox log rank test was conducted. Mantel-Cox tests were conducted using the
SURVIVAL (Therneau and Lumley 2019) and SURVMINER packages (Kassambara et al.
2018). Plants that survived the duration of the experiment were right-censored in this analysis.
Pairwise Mantel-Cox tests were conducted post hoc to evaluate the specific effects of the two endophyte treatments on seedling survival in drought and non-drought conditions. For the five- week time point, linear regression analysis was conducted on change in height and percent needle senescence using endophyte and drought treatments as predictors. A poisson generalized linear model was constructed for change in needle count using endophyte and drought treatments as predictors. The poisson linear model family was selected post hoc based on evaluation of data Q-
Q plots under linear regression models. For the ten-week time point, Kruskal-Wallis one-way analysis of variance tests were conducted on change in height, needle count, percent senescence, and final biomass for non-drought treatment groups. Drought treatment groups were excluded from these tests because of lack of replication due to seedling mortality.
RESULTS
Fungal endophyte composition of P. menziesii seeds.- In the United States populations, fungal endophytes were obtained from 43 of the 795 seeds (5.3% total frequency). Total frequency of endophytes from each seed provenance ranged from 0% to 27%, and all seeds either had zero or one endophyte. All isolates were sequenced successfully. All fungal endophytes isolated were classified in the phylum Ascomycota by GenBank and UNITE, and represented four orders
(Helotiales, Hypocreales, Dothidiales, Pleosporales), six genera and eleven species (TABLE 4).
Three isolates could not be identified beyond the family level. The genera Trichoderma and
Sydowia were the most abundant across populations, representing 44% and 42% of the fungal isolates respectively (TABLE 4).
In the New Zealand populations, 55 fungal endophytes were isolated from 600 seed halves
(9.2% total frequency) across the three seed lines studied. Total endophyte frequency per line ranged from 0% in the California line to 20% in the Washington line, and all seeds had either zero or one endophyte. 50 isolates were successfully identified by Sanger sequencing. Fungal isolates were classified into the phylum Ascomycota by GenBank and UNITE, and represented three orders (Hypocreales, Dothideales, Eurotiales), four genera, and four species (TABLE 4).
One isolate identified to Melampsora sp. was removed from further analysis because it was likely a contaminant. The species Sydowia polyspora was the most abundant across seed lines, representing 91% of the fungal reads (TABLE 4). Full sequence results for United States and
New Zealand isolates are available in supplemental Appendices A and B.
FUNGuild classification identified Sydowia polyspora and Rhizosphaera kalkhoffii as facultative yeasts (Tedersoo et al. 2014), and the rest of identified taxa were categorized as filamentous microfungi (Tedersoo et al. 2014, Sterkenburg et al. 2015) (TABLE 4). Isolates identified to the Rhytismataceae family were categorized as yeast-like based on observation. The majority of the isolated taxa were assigned with the saprotroph guild (Tedersoo et al. 2014,
Sterkenburg et al. 2015), except for Trichoderma citrinoviride (endophyte) (Martínez-Medina et al. 2014) and Trichothecium roseum (plant pathogen) (Wright et al. 2007) (TABLE 4).
TABLE 4. Fungal taxa isolated and identified using Sanger sequencing, including information on seed source, morphology, guild, and relative abundance. United States New Zealand
Taxon Seed Morphology Guild Relative Taxon Seed Morphology Guild Relative Source Abundanc Source Abundance e Sydowia PC Facultative Saprotroph 41.8% Sydowia OR, Facultative Saprotroph 91.8% polyspora yeast polyspora WA yeast
Trichoderma PC Microfungus Endophyte 6.98% Aspergillus OR Microfungus Saprotroph 4.08% citrinoviride pseudoglaucus
Trichoderma CA, Microfungus Saprotroph 6.98% Trichoderma OR Microfungus Saprotroph 2.04% koningii CB, TL harzianum Unknown PC Facultative N/A 6.98% Rhizophaera WA Facultative Saprotroph 2.04% Rhytismataceae yeast kalkhoffii yeast spp. Moellerodiscus HR Microfungus Saprotroph 2.33% pinicola
Rutstroemia HR Microfungus Saprotroph 2.33% longipes
Trichoderma CB Microfungus Saprotroph 2.33% atroviride
Trichoderma CB Microfungus Saprotroph 2.33% paraviridescen s Trichoderma CB Microfungus Saprotroph 2.33% polysporum
Trichoderma CB, PC Microfungus Saprotroph 2.33% viridescens
Trichothecium CA Microfungus Plant 2.33% roseum Pathogen Analysis of endophyte community composition.- There was a significant association between
seed provenance and total endophyte frequency (FIG. 3(a); X2 = 108.46, p <2.2x10-16),
frequency of Sydowia polyspora (FIG. 3(b); X2 = 128.9, p <2.2x10-16), and frequency of
Trichoderma spp. (FIG. 3(c); X2 = 44.801, p = 1.495x10-7).
Eleven species were isolated from United States populations, and four species were
isolated from New Zealand populations (FIG. 4 (a)). Sydowia polyspora was found in high
relative abundance in both ranges (FIG. 4(a)). RAxML phylogeny divided Sydowia polyspora
isolates into one clade containing New Zealand isolates and two clades containing United States
isolates (FIG. 4(b)). United States and New Zealand isolates were genetically distinct from each
other due to three mutations in the ITS region.
(a) (b) (c)
FIGURE 3. Maps of seed provenances sampled and their respective total endophyte frequency (a), frequency of Sydowia polyspora (b), and frequency of Trichoderma spp. (c). Each point on the map represents the seed zone location, and the size of each point represents the frequency of total and specific endophytes for that population.
(a)
(b)
FIGURE 4. Comparison of species diversity and taxon-specific genetic variation between United States and New Zealand populations. (a) shows the species isolated in each country and their relative abundances. (b) shows the RAxML phylogenetic tree of Sydowia polyspora isolates from each country. Drought tolerance experiment.- Endophyte and drought treatment had some association with seedling mortality (FIG. 5, p = 0.079); however, drought (S.FIG. 1, post hoc Pairwise Mantel
Cox: p = 0.0069) rather than endophyte treatment was the major contributor to reduction in seedling survival (post hoc Pairwise Mantel-Cox: p = 0.38; N. Trich: p = 0.21; S. Trich: p =
0.42). Drought impacted needle count, with fewer needles recorded on seedlings inoculated with southern Trichoderma (Table 5, S.FIG. 2).
FIGURE 5. Distribution of time until death data for seedlings across endophyte and drought treatment groups. Seedlings that survived to the end of the experiment are included in this figure as points where time until death is ten weeks. These seedlings were censored in survival analysis.
TABLE 5. Results of linear and generalized linear modeling for plant growth and stress at five weeks. P- values <0.05 are shown in bold. Change in height Predictor Estimate Std. Error Z-value P-value (Intercept) 0.657143 0.227346 2.890 0.00735 N. Trich -0.282143 0.377011 -0.748 0.46048 S. Trich -0.115476 0.334645 -0.345 0.73262 Drought 0.057143 0.321516 0.178 0.86022 N.Trich:Drought 0.007143 0.568366 0.013 0.99006 S.Trich:Drought 0.28143 0.495490 0.569 0.57361 Change in needle count Predictor Estimate Std. Error Z-value P-value (Intercept) 0.8267 0.2500 3.307 0.000944 N. Trich 0.5596 0.3536 1.583 0.113460 S. Trich 0.4726 0.3286 1.438 0.150323 Drought 1.3545 0.2804 4.831 1.36x10-6 N.Trich:Drought -1.5712 0.6484 -2.423 0.15387 S.Trich:Drought -2.0477 0.4610 -4.441 8.93x10-6 Change in percent tissue senescence Predictor Estimate Std. Error Z-value P-value (Intercept) -0.09178 1.25189 -0.073 0.942 N. Trich -0.24909 2.07603 -0.120 0.905 S. Trich -1.40876 1.84273 -0.764 0.451 Drought -0.81218 1.77044 -0.459 0.650 N.Trich:Drought 0.91145 3.12973 0.291 0.773 S.Trich:Drought 2.49580 2.72843 0.915 0.368
DISCUSSION
Efficacy of culture-based characterization.- This study represents one of the first major forays into the identity and ecological role of fungal seed endophytes in Pseudotsuga menziesii var. menziesii. During the characterization work, a total of 98 endophytes were isolated across eleven seed populations in the United States and New Zealand. Of the endophytes isolated, the major taxa identified were Trichoderma spp. and Sydowia polyspora, and most of the fungi identified were categorized as saprotrophs.
My study used culture-based methods for seed populations in the United States and New
Zealand. This type of study has benefits and limitations in examining endophyte communities, and findings from these studies can be compared with those found in culture-independent methods. While culture-based studies are inexpensive and produce observable results, they may not accurately represent what’s present in the seed tissues. Some fungal endophytes may not grow out on media at all, while others only grow on certain kinds of media (Kirk et al. 2004).
Within the context of this study, two different kinds of media were used across the different countries. As such, some endophytes that emerged onto PDA in the United States populations may not have been able to grown out on MYE in New Zealand, and vice versa. This may have contributed to the differences in species richness and abundances between the two countries.
Future seed endophyte work in this system should include culture-independent high-throughput sequencing, which can provide more quantitative results and detect endophytes that may not emerge in culture (Nilsson et al. 2018).
Furthermore, this study relied upon opportunistic sampling of P. menziesii var. menziesii seed populations from different sources in the United States and New Zealand. This opportunistic sampling resulted in differences in the types of seeds sampled between the ranges of interest, as well as creating limitations on sampling control. Within the United States populations, seeds were sourced from the ground in wild forests without record of specific sampling location. As such, the genetic diversity and specific environmental conditions could not be controlled for. Additionally, sampling from the ground potentially introduces horizontally transmitted endophytes from the soil, limiting what inferences can be made about the identified isolates as vertically transmitted endophytes. Within the New Zealand populations, seeds were sampled from three lines in a cultivated orchard. As such, while the lines were similar to the
United States populations genetically, they were enriched for certain genotypes and grown in one specific environment. Future work could look to sample New Zealand P. menziesii seeds from plantations in multiple regions around the country, or wilding conifer forests so that populations are more equivalent between countries. Finally, differences in the methods of surface sterilization, culturing and DNA extraction between the United States and New Zealand may account for differences in frequency of total endophytes and specific taxa. Notably, different kinds of media were used for endophyte isolation between the two countries, and New Zealand seeds were cut in half prior to plating.
This could have contributed to the different total endophyte frequencies between countries and the taxa that were observed. Future work using consistent culturing methods between countries or culture-independent methods could better control for these potential confounding factors.
Overall, this culture-based work addressed fundamental ecological questions about fungal seed endophytes that can be explored further with different techniques and greater scope.
Pseudotsuga menziesii seed endophyte frequency aligns with proposed bottleneck in the plant microbiome.- In my U.S. populations, 5.3% of the seeds contained an endophyte, ranging from 0% to 27% by population. 9.2% of seeds in my New Zealand populations contained an endophyte, ranging from 0% to 20% by population. These endophyte frequencies are quite low compared to endophyte communities in P. menziesii foliar (e.g. Daniels 2017) and root
(Bergmann, unpublished) tissues, and either zero or one endophyte was isolated per seed. These low endophyte frequencies and binary isolation pattern are consistent with a bottleneck in the plant microbiome at the seed stage that was hypothesized by Newcombe et al. (2018). In this study, the authors examined the seed endophytes of 98 different plant species using culture-based methods, and found that the frequency of one endophyte ranged from 0 to 79% depending on the plant species, and that presence of two endophytes per seed was uncommon (Newcombe et al.
2018). Furthermore, the low frequency and binary nature of endophyte isolation in this study is consistent with results found in Centaurea stoebe (Raghavendra et al. 2013), Atriplex canescens
(Lucero et al. 2011) and Pinus monticola (Ganley and Newcombe 2006). This low endophyte abundance may be due to a variety of hypothesized factors, including incomplete vertical transmission from the parent plants (Afkhami and Rudgers 2008), strong plant defenses in the seeds (Stamp 2003), or exclusionary interactions between taxa in the seed tissues (Raghavendra et al. 2013). Alternatively, the nature of the sampling and characterization methods could be contributing to the low frequencies observed here. Specifically, the seed populations sampled were kept in cold storage for months to years before use in this study, and endophytes were characterized using culture-based methods. Consequently, the low endophyte frequencies observed here may be due to declines in fungus viability during cold storage, or incompatibility with the media used. Future work could use a mix of culture-based and high-throughput sequencing methods on freshly harvested seeds to better elucidate the factors involved in low endophyte frequency in P. menziesii seeds, both for fungi and other microbes (e.g. bacteria;
Hatwal 2019).
Endophyte community composition of Pseudotsuga menziesii seed populations.- I found a significant association between seed provenance and frequency of total endophytes, Trichoderma spp. and Sydowia polyspora (FIG. 3). Specifically, total endophyte frequency was higher in some
Washington and California populations and lower in Oregon populations (FIG. 3(a)), which was also observed for species richness (S.FIG. 3). Sydowia polyspora was present only in one
California population (FIG. 3(b)), while Trichoderma spp. was present in all populations where endophytes occurred (FIG. 3(c)). My findings indicate that seed provenance may play a role in structuring endophyte communities in seeds, as was hypothesized, and that structuring may have taxon-specific effects. The association between seed provenance and endophyte community composition was first postulated by Klaedtke et al. (2016), and is consistent with findings of community structuring across geographic distributions in other plant species and tissues (U’Ren et al. 2012, Coleman-Derr et al. 2016, Bowman and Arnold 2018). The roles of host genotype and local environment in assembly of endophytic communities are of interest in plant microbiome studies (Busby et al. 2017), and the mechanisms of endophyte community assembly at the seed level are still largely unknown (Shade et al. 2017, Nelson 2018). Future study in the
P. menziesii var. menziesii system could examine how seed endophyte communities vary along specific environmental or genetic gradients to begin to parse out these factors in community assembly. In addition to examining different genotypes of P. menziesii var. menziesii, this variety could be compared with Rocky Mountain Douglas-fir (P. menziesii var. glauca) to examine differences across endophyte communities across largely different populations and environments. Common garden experiments could be a useful method for these studies, and some are already underway in P. menziesii (Gervers, personal communication).
I found that New Zealand seeds had lower endophyte species richness than United States seeds (FIG. 4(a)). The observed decline in species richness from P. menziesii var. menziesii’s native range to an introduced range may be due to genetic enrichment in the New Zealand population for specific genotypes, a founder effect on the fungi that co-migrated with the host, a change in host environment, or competition with fungi native to New Zealand. Alternatively, this decline in diversity could be due to the concentration of the New Zealand seed populations within a single orchard. Given the differences in harvest and endophyte isolation methods between the two countries, however, it is difficult to determine if this decline in richness is due to method or other factors. Future work involving culture-independent methods and common gardens across P. menziesii var. menziesii ranges should be used to address this endophyte biogeography question. In addition to the observed species richness decline, the comparison of United States and
New Zealand seed endophytes showed that Sydowia polyspora was a dominant species in both ranges (FIG. 4(a)). Phylogenetic analysis of Sydowia polyspora isolates from the United States and New Zealand showed that there were genetically distinct groups of this fungus between native and introduced ranges (FIG. 4(b)). This could suggest that Sydowia polyspora had been introduced with P. menziesii var. menziesii and had become genetically distinct since that time.
Alternatively, Sydowia polyspora could be ubiquitous and already present in both ranges. Future phylogenetic studies involving the sequencing of additional genes in Sydowia polyspora should be conducted to further explore the biogeography of this species in native and introduced ranges of P. menziesii var. menziesii.
Questions remain as to why Sydowia polyspora was so common in both ranges of P. menziesii var. menziesii. This species was categorized as a saprotrophic, facultative yeast in
FUNGuild, and has been described as a foliar endophyte or latent pathogen in P. menziesii
(Hansen and Tainter 2018) and other members of the Pinaceae family (Smerlis 1970, Talgø et al.
2010, Ridout and Newcombe 2018). Additionally, Ridout and Newcombe (2018) found that
Sydowia polyspora isolated from Pinus ponderosa foliage significantly reduced seed germination rates in this host. That said, P. menziesii seeds were also inoculated with S. polyspora in this study, and their germination rates were not significantly affected (Ridout and Newcombe 2018).
Similarly, S. polyspora was not found to significantly cause dieback or necrosis in seedlings of
Abies alba (Jankowiak et al. 2016). What these studies suggest is that S. polyspora may be pathogenic to seeds and seedlings, but more germination and pathogenicity tests would need to be conducted in P. menziesii for a more definite conclusion. Given that plant pathogens are often vertically transmitted in other species (e.g. Munkvold 2009), Sydowia polyspora should be examined further to understand its colonization mechanisms, any antagonism with plant defenses, potential pathogenicity and additional functions in seeds.
Drought experiment shows limited effects of Trichoderma on seedling drought response.-
My drought experiment represents one of the first examinations of endophyte-mediated drought tolerance in a conifer species. I found that endophyte treatment had no significant effect on seedling mortality and stress (FIG. 5, TABLE 5). These results did not support the hypothesis that Trichoderma inoculation would significantly alter seedling survival under drought conditions. However, there was a general trend that endophyte treatment improved seedling survival under drought conditions. Since this trend was only observed in drought plants, it is possible that Trichoderma is only beneficial under stressful conditions, which has been observed with other microbial communities (e.g. mycorrhizae, Smith and Read 2010). These findings align with studies on the effects of Trichoderma inoculation on seedling survival under drought conditions in other plants. For example, a study by Bae et al. (2009) found that inoculation of
Theobroma cacao seedlings with a strain of Trichoderma hamatum delayed the onset of drought stress in terms of photosynthetic activity and stomatal conductance. Similarly, experiments in rice and tomato inoculated with Fusarium culmorum showed improved plant survival under drought conditions (Rodriguez et al. 2008). Given that the sample size of each treatment group was 10-15 plants, large scale experiments should be conducted to evaluate if the general trends observed here still hold.
In addition to effects on seedling survival, I found that the southern Trichoderma isolate
(PC42, Trichoderma citrinoviride) had significantly reduced needle growth at five weeks in interaction with drought (TABLE 5). This finding supports my hypothesis that Trichoderma inoculation would alter seedling growth under drought conditions, and that an isolate from a drier seed source would have a greater effect. However, this effect was observed in the log space of the Poisson Generalized Linear Model, and may not represent a real endophyte effect on the seedlings. Overall, this indicates that the experimental hypotheses about Trichoderma effects on seedling growth are not supported. These findings are in contrast with studies on the effects of
Trichoderma inoculation on seedling growth under drought conditions. For example, a study by
Mastouri et al. (2010) found that inoculation of tomato seeds with Trichoderma harzianum improved germination rate and early growth under drought and other abiotic stresses.
Additionally, Trichoderma inoculum is often used commercially with the intention of improved plant growth and control against phytopathogens (Woo et al. 2014). Given the complex effects that drought has on plants (Farooq et al. 2009), more experiments will be needed to test the effects of Trichoderma and other seed endophytes on the various manifestations of drought stress. Additionally, use of repeated measures analysis (von Ende 2001) could give a more complete picture of how drought and endophyte treatment affect seedling growth and tissue stress over time.
Applicability of drought experiment results in the field.- Based on the results of this drought experiment, there are ongoing questions regarding their relevance in plantation and forest settings. First, the timing of the drought event emulated in this experiment may not be representative of how P. menziesii var. menziesii seedlings are exposed to drought in the field.
Seedlings in this experiment were about a month old at onset of the drought treatment, whereas seedlings in forests and plantations are several months old to several years old when first exposed to drought (Ferrell and Woodard 1966). As such, plant age may have been a factor in the drought stress observed here, and future experiments should likely work with older seedlings to get more representative data. In addition to considerations about plant age, questions can also be posed about how accurate the inoculation method and growth chamber conditions are to microbial and environmental conditions in P. menziesii var. menziesii forests and plantations. In this experiment, seedlings were inoculated with a single isolate of Trichoderma spp. In the field, however, P. menziesii var. menziesii will be inoculated with consortia of endophytes from horizontally and vertically transmitted sources, and interactions between consortia members are directly involved in mediation of plant phenotypes (Busby et al. 2017). As such, future experiments should examine the effects of endophyte communities on P. menziesii seedling drought response as opposed to individual taxa. Furthermore, drought events in the field consist of a combination of heat and water stresses, and so the temperature-controlled environment of the growth chamber used here may not reflect actual drought conditions. Future experiments on endophyte-mediated drought tolerance in P. menziesii var. menziesii will need to account to these multiple facets of drought stress. Overall, though, these experiments provide a foundation for studying endophyte-mediated drought tolerance in P. menziesii var. menziesii, and future work using seed endophytes for P. menziesii var. menziesii drought response should be conducted to account for the environmental and microbial conditions in plantation management, forest conservation and restoration efforts.
CONCLUSIONS
This work represents one of the first exploratory forays into the community composition and effects of fungal endophytes of Pseudotsuga menziesii seeds, and opens the doors for more in- depth study in the future. Notably, the endophyte characterization conducted here aligned with the hypothesized bottleneck in the plant microbiome, and indicated a need for further study on specific provenance effects in the assembly of seed microbiomes across geographic ranges.
Moreover, I found a non-significant trend suggesting that seed-borne Trichoderma may enhance seedling survival under drought conditions. With more understanding of endophyte-mediated drought tolerance in P. menziesii seedlings, there is potential to harness plant microbiomes in managing and conserving this critical plant species under the global climate crisis.
ACKNOWLEDGEMENTS
I thank Mike Gerdes of Silvaseed Company Foresters and Shaf van Ballekom of Proseed New
Zealand for providing seeds from the selected Douglas-fir populations, and for sharing information about their seed harvesting methods. I thank Dr. Posy Busby and Ph.D. student
Edward Barge for their mentorship throughout this project, and Dr. Helen Whelan at the Bio-
Protection Research Centre for mentoring the New Zealand culture work. Additionally, I thank
Dr. Joseph Spatafora and Dr. Kate Field for serving on my thesis committee, and Dr. Travis
Glare and Dr. John Hampton at the BioProtection Research Centre for supervising my research placement in New Zealand. I thank the following members of the Busby laboratory group for their help in data collection, analysis and experimental design: Dr. Devin Leopold, Dr. Lucas
Nebert, Ph.D. student Kyle Gervers, Shikhar Hatwal and Sabrina Heitmann. I thank Daniel
Hodges M.S. in the Oregon State University Department of Statistics for his assistance in statistical analysis. I thank BioResource Research advisor Wanda Crannell for her assistance in searching for a project mentor, guidance on presentation of this work, and overall support of my academic work. Finally, I wish to thank my friends and family for their ongoing interest and support in my academic endeavors. Funding for this project was provided by the Cascade
Mycological Society and the Mycological Society of America. Funding for the New Zealand study abroad program was provided by the Benjamin E. Gilman International Scholarship program and the Oregon State University Honors College Experiential Learning Award.
LITERATURE CITED Bergmann, G. unpublished. Characterizing the fungal seed endophytes of New Zealand’s Douglas-fir (Pseudotsuga menziesii) forests. Hill R, Cummings N, Whelan H. 2017. Isolation and characterisation of fungal partners in the Pinus radiata root microbiome. Bio-Protection Research Centre report BIO-T016, Lincoln, New Zealand. Gerdes, M. 2019. Phone interview. Gervers, K. 2019. In-person interview. Hatwal, S. 2019. Bacterial endophytes of Douglas-fir and their potential to confer drought tolerance. OSU BioResource Research undergraduate thesis. Available at ScholarsArchive@OSU. Ridout, M. 2018. Email interview. van Ballekom, S. 2019. Email interview. Afkhami ME, Rudgers JA. 2008. Symbiosis Lost: Imperfect Vertical Transmission of Fungal Endophytes in Grasses. Am Nat. 172:405–416, doi:10.1086/589893.
Agee JK (University of W. 1991. Fire history of Douglas-fir forests in the Pacific Northwest. USDA For Serv Gen Tech Rep PNW-GTR - Pac Northwest Res Stn USA.
Aleklett K, Hart M. 2013. The root microbiota—a fingerprint in the soil? Plant Soil. 370:671–686, doi:10.1007/s11104-013-1647-7.
Atlas RM. 2010. Handbook of Microbiological Media. CRC Press.
Bae H, Sicher RC, Kim MS, Kim S-H, Strem MD, Melnick RL, Bailey BA. 2009. The beneficial endophyte Trichoderma hamatum isolate DIS 219b promotes growth and delays the onset of the drought response in Theobroma cacao. J Exp Bot. 60:3279–3295, doi:10.1093/jxb/erp165.
Bever JD, Mangan SA, Alexander HM. 2015. Maintenance of Plant Species Diversity by Pathogens. Annu Rev Ecol Evol Syst. 46:305–325, doi:10.1146/annurev-ecolsys-112414-054306.
Bloomberg WJ. 1966. THE OCCURRENCE OF ENDOPHYTIC FUNGI IN DOUGLAS-FIR SEEDLINGS AND SEED. Can J Bot. 44:413–420, doi:10.1139/b66-050.
Bowman EA, Arnold AE. 2018. Distributions of ectomycorrhizal and foliar endophytic fungal communities associated with Pinus ponderosa along a spatially constrained elevation gradient. Am J Bot. doi:10.1002/ajb2.1072.
Busby PE, Catherine Aime M, Newcombe G. 2012. Foliar pathogens of Populus angustifolia are consistent with a hypothesis of Beringian migration into North America. Fungal Biol. 116:792–801, doi:10.1016/j.funbio.2012.04.012.
Busby PE, Peay KG, Newcombe G. 2016a. Common foliar fungi of Populus trichocarpa modify Melampsora rust disease severity. New Phytol. 209:1681–1692, doi:10.1111/nph.13742.
Busby PE, Ridout M, Newcombe G. 2016b. Fungal endophytes: modifiers of plant disease. Plant Mol Biol. 90:645– 655, doi:10.1007/s11103-015-0412-0. Busby PE, Soman C, Wagner MR, Friesen ML, Kremer J, Bennett A, Morsy M, Eisen JA, Leach JE, Dangl JL. 2017. Research priorities for harnessing plant microbiomes in sustainable agriculture. PLOS Biol. 15:e2001793, doi:10.1371/journal.pbio.2001793.
Christian N, Herre EA, Clay K. 2019. Foliar endophytic fungi alter patterns of nitrogen uptake and distribution in Theobroma cacao. New Phytol. 0, doi:10.1111/nph.15693.
Coleman-Derr D, Desgarennes D, Fonseca-Garcia C, Gross S, Clingenpeel S, Woyke T, North G, Visel A, Partida- Martinez LP, Tringe SG. 2016. Plant compartment and biogeography affect microbiome composition in cultivated and native Agave species. New Phytol. 209:798–811, doi:10.1111/nph.13697.
Daniels H. 2017. Phylogenetic Identification of Pathogenic and Endophytic Fungal Populations in West Coast Douglas-fir (Pseudotsuga menziesii) Foliage.
Eilmann B, Vries SMG de, Ouden J den, Mohren GMJ, Sauren P, Sass-Klaassen U. 2013. Origin matters! Difference in drought tolerance and productivity of coastal Douglas-fir (Pseudotsuga menziesii (Mirb.)) provenances. For Ecol Manag. 302:133–143, doi:10.1016/j.foreco.2013.03.031.
Ende CN von. 2001. Repeated-measures analysis. In: Design and Analysis of Ecological Experiments. pp. 134–157.
Farooq M, Wahid A, Kobayashi N, Fujita D, Basra SMA. 2009. Plant drought stress: effects, mechanisms and management. Agron Sustain Dev. 29:185–212, doi:10.1051/agro:2008021.
Fenner M, Thompson K. 2005. The ecology of seeds. Cambridge, UK; New York: Cambridge University Press.
Ferrell WK, Woodard ES. 1966. Effects of Seed Origin on Drought Resistance of Douglas‐Fir (Pseudotsuga Menziesii) (Mirb.) Franco. Ecology. 47:499–503, doi:10.2307/1932994.
Ganley RJ, Newcombe G. 2006. Fungal endophytes in seeds and needles of Pinus monticola. Mycol Res. 110:318– 327, doi:10.1016/j.mycres.2005.10.005.
Gardes M, Bruns TD. 1993. ITS primers with enhanced specificity for basidiomycetes ‐ application to the identification of mycorrhizae and rusts. Mol Ecol. 2:113–118.
Hamilton CE, Bauerle TL. 2012. A new currency for mutualism? Fungal endophytes alter antioxidant activity in hosts responding to drought. Fungal Divers. 54:39–49, doi:10.1007/s13225-012-0156-y.
Hansen E, Tainter F. 2018. Diseases of Douglas-fir (Pseudotsuga menziesii [Mirb.] Franco).
Hardoim PR, Overbeek LS van, Berg G, Pirttilä AM, Compant S, Campisano A, Döring M, Sessitsch A. 2015. The Hidden World within Plants: Ecological and Evolutionary Considerations for Defining Functioning of Microbial Endophytes. Microbiol Mol Biol Rev. 79:293–320, doi:10.1128/MMBR.00050-14.
Hoff JA, Klopfenstein NB, McDonald GI, Tonn JR, Kim M-S, Zambino PJ, Hessburg PF, Rogers JD, Peever TL, Carris LM. 2004. Fungal endophytes in woody roots of Douglas-fir ( Pseudotsuga menziesii ) and ponderosa pine ( Pinus ponderosa ): Fungal endophytes in woody roots of Douglas-fir and ponderosa pine. For Pathol. 34:255–271, doi:10.1111/j.1439-0329.2004.00367.x.
Jankowiak R, Bilański P, Paluch J, Kołodziej Z. 2016. Fungi associated with dieback of Abies alba seedlings in naturally regenerating forest ecosystems. Fungal Ecol. 24:61–69, doi:10.1016/j.funeco.2016.08.013.
Kassambara A, Kosinski M, Biecek P, Fabian S. 2018. survminer: Drawing Survival Curves using “ggplot2.”
Kavanagh KL, Bond BJ, Aitken SN, Gartner BL, Knowe S. 1999. Shoot and root vulnerability to xylem cavitation in four populations of Douglas-fir seedlings. Tree Physiol. 19:31–37, doi:10.1093/treephys/19.1.31. Khan SR, Rose R, Haase DL, Sabin TE. 1996. Soil water stress: Its effects on phenology, physiology, and morphology of containerized Douglas-fir seedlings. New For. 12:19–39, doi:10.1007/BF00029980.
Kirk JL, Beaudette LA, Hart M, Moutoglis P, Klironomos JN, Lee H, Trevors JT. 2004. Methods of studying soil microbial diversity. J Microbiol Methods. 58:169–188, doi:10.1016/j.mimet.2004.04.006.
Klaedtke S, Jacques M-A, Raggi L, Préveaux A, Bonneau S, Negri V, Chable V, Barret M. 2016. Terroir is a key driver of seed-associated microbial assemblages. Environ Microbiol. 18:1792–1804, doi:10.1111/1462-2920.12977.
Kruckenbuerg AR, Chalker-Scott L. 1982. Gardening With Native Plants Of The Pacific Northwest: An Illustrated Guide. University of Washington Press.
Leck MA, Parker VT, Simpson R, eds. 2008. Seedling ecology and evolution. Cambridge: Cambridge University Press. 514 p.
Lucero ME, Unc A, Cooke P, Dowd S, Sun S. 2011. Endophyte Microbiome Diversity in Micropropagated Atriplex canescens and Atriplex torreyi var griffithsii. PLOS ONE. 6:e17693, doi:10.1371/journal.pone.0017693.
Maclaren JP. 2009. Douglas-fir manual.
Martínez-Medina A, Del Mar Alguacil M, Pascual JA, Van Wees SCM. 2014. Phytohormone Profiles Induced by Trichoderma Isolates Correspond with Their Biocontrol and Plant Growth-Promoting Activity on Melon Plants. J Chem Ecol. 40:804–815, doi:10.1007/s10886-014-0478-1.
Mastouri F, Björkman T, Harman GE. 2010. Seed Treatment with Trichoderma harzianum Alleviates Biotic, Abiotic, and Physiological Stresses in Germinating Seeds and Seedlings. Phytopathology. 100:1213–1221, doi:10.1094/PHYTO-03-10-0091.
Miller MA, Pfeiffer W, Schwartz T. 2010. Creating the CIPRES Science Gateway for inference of large phylogenetic trees. In: 2010 Gateway Computing Environments Workshop (GCE). pp. 1–8.
Mujic AB. 2015. Symbiosis in the Pacific Ring of Fire : evolutionary-biology of Rhizopogon subgenus Villosuli as mutualists of Pseudotsuga [doctoral dissertation].
Munkvold GP. 2009. Seed Pathology Progress in Academia and Industry. Annu Rev Phytopathol. 47:285–311, doi:10.1146/annurev-phyto-080508-081916.
Naik BS. 2017. Fungal endophytes: nature’s tool for bioremediation of toxic pollutants. Curr Sci 00113891. 113:537–539.
Nelson EB. 2018. The seed microbiome: Origins, interactions, and impacts. Plant Soil. 422:7–34, doi:10.1007/s11104-017-3289-7.
Newcombe G, Harding A, Ridout M, Busby PE. 2018. A Hypothetical Bottleneck in the Plant Microbiome. Front Microbiol. 9, doi:10.3389/fmicb.2018.01645.
Nguyen NH, Song Z, Bates ST, Branco S, Tedersoo L, Menke J, Schilling JS, Kennedy PG. 2016. FUNGuild: An open annotation tool for parsing fungal community datasets by ecological guild. Fungal Ecol. 20:241–248, doi:10.1016/j.funeco.2015.06.006.
Nilsson RH, Anslan S, Bahram M, Wurzbacher C, Baldrian P, Tedersoo L. 2018. Mycobiome diversity: high- throughput sequencing and identification of fungi. Nat Rev Microbiol. doi:10.1038/s41579-018-0116-y.
Proseed NZ. 2019. Douglas-fir. Pruim R, Kaplan DT, Horton NJ. 2019. mosaic: Project MOSAIC Statistics and Mathematics Teaching Utilities.
Puente ME, Li CY, Bashan Y. 2009. Endophytic bacteria in cacti seeds can improve the development of cactus seedlings. Environ Exp Bot. 66:402–408, doi:10.1016/j.envexpbot.2009.04.007.
R Core Team. 2016. R: a language and environment for statistical computing.
Raghavendra AKH, Newcombe G, Shipunov A, Baynes M, Tank D. 2013. Exclusionary interactions among diverse fungi infecting developing seeds of Centaurea stoebe. FEMS Microbiol Ecol. 84:143–153, doi:10.1111/1574- 6941.12045.
Regvar M, Likar M, Piltaver A, Kugonič N, Smith JE. 2010. Fungal community structure under goat willows (Salix caprea L.) growing at metal polluted site: the potential of screening in a model phytostabilisation study. Plant Soil. 330:345–356, doi:10.1007/s11104-009-0207-7.
Ridout M, Newcombe G. 2018. Sydowia polyspora is both a Foliar Endophyte and a Preemergent Seed Pathogen in Pinus ponderosa. Plant Dis. 102:640–644, doi:10.1094/PDIS-07-17-1074-RE.
Rodriguez RJ, Henson J, Van Volkenburgh E, Hoy M, Wright L, Beckwith F, Kim Y-O, Redman RS. 2008. Stress tolerance in plants via habitat-adapted symbiosis. ISME J. 2:404–416, doi:10.1038/ismej.2007.106.
Rodriguez RJ, White Jr JF, Arnold AE, Redman RS. 2009. Fungal endophytes: diversity and functional roles. New Phytol. 182:314–330, doi:10.1111/j.1469-8137.2009.02773.x.
Rosenberg E, Sharon G, Zilber‐Rosenberg I. 2009. The hologenome theory of evolution contains Lamarckian aspects within a Darwinian framework. Environ Microbiol. 11:2959–2962, doi:10.1111/j.1462-2920.2009.01995.x.
Saikkonen K, Faeth SH, Helander M, Sullivan TJ. 1998. Fungal Endophytes: A Continuum of Interactions with Host Plants. Annu Rev Ecol Syst. 29:319–343.
Schoch CL, Seifert KA, Huhndorf S, Robert V, Spouge JL, Levesque CA, Chen W, Fungal Barcoding Consortium, Fungal Barcoding Consortium Author List, Bolchacova E, Voigt K, Crous PW, Miller AN, Wingfield MJ, Aime MC, An K-D, Bai F-Y, Barreto RW, Begerow D, Bergeron M-J, Blackwell M, Boekhout T, Bogale M, Boonyuen N, Burgaz AR, Buyck B, Cai L, Cai Q, Cardinali G, et al. 2012. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proc Natl Acad Sci. 109:6241–6246, doi:10.1073/pnas.1117018109.
Shade A, Jacques M-A, Barret M. 2017. Ecological patterns of seed microbiome diversity, transmission, and assembly. Curr Opin Microbiol. 37:15–22, doi:10.1016/j.mib.2017.03.010.
Shirley HL, Meuli LJ. 1939. Influence of moisture supply on drought resistance of conifers. Jour Agr Res. 59:1–21.
Shukla N, Awasthi RP, Rawat L, Kumar J. 2012. Biochemical and physiological responses of rice (Oryza sativa L.) as influenced by Trichoderma harzianum under drought stress. Plant Physiol Biochem. 54:78–88, doi:10.1016/j.plaphy.2012.02.001.
Smerlis E. 1970. Notes on Sydowia polyspora. Can J Bot. 48:1613–1615, doi:10.1139/b70-238.
Smith SE, Read DJ. 2010. Mycorrhizal symbiosis. Academic press.
St Clair J, Howe GT. 2007. Genetic maladaptation of coastal Douglas-fir seedlings to future climates. Glob Change Biol. 13:1441–1454, doi:10.1111/j.1365-2486.2007.01385.x.
Stamp N. 2003. Out Of The Quagmire Of Plant Defense Hypotheses. Q Rev Biol. 78:23–55, doi:10.1086/367580. Sterkenburg E, Bahr A, Brandström Durling M, Clemmensen KE, Lindahl BD. 2015. Changes in fungal communities along a boreal forest soil fertility gradient. New Phytol. 207:1145–1158, doi:10.1111/nph.13426.
Stewart M. 2015. Drought hits Douglas-fir trees hard | Oregon State University Extension Service | Gardening.
Stucky BJ. 2012. SeqTrace: A Graphical Tool for Rapidly Processing DNA Sequencing Chromatograms. J Biomol Tech JBT. 23:90–93, doi:10.7171/jbt.12-2303-004.
Talgø V, Chastagner G, Thomsen IM, Cech T, Riley K, Lange K, Klemsdal SS, Stensvand A. 2010. Sydowia polyspora associated with current season needle necrosis (CSNN) on true fir (Abies spp.). Fungal Biol. 114:545– 554, doi:10.1016/j.funbio.2010.04.005.
Tedersoo L, Bahram M, Polme S, Koljalg U, Yorou NS, Wijesundera R, Ruiz LV, Vasco-Palacios AM, Thu PQ, Suija A, Smith ME, Sharp C, Saluveer E, Saitta A, Rosas M, Riit T, Ratkowsky D, Pritsch K, Poldmaa K, Piepenbring M, Phosri C, Peterson M, Parts K, Partel K, Otsing E, Nouhra E, Njouonkou AL, Nilsson RH, Morgado LN, et al. 2014. Global diversity and geography of soil fungi. Science. 346:1256688–1256688, doi:10.1126/science.1256688.
Therneau TM, Lumley T. 2019. survival: Survival Analysis.
Uchytil RJ. 1991. Pseudotsuga menziesii var. menziesii.
U’Ren JM, Lutzoni F, Miadlikowska J, Laetsch AD, Arnold AE. 2012. Host and geographic structure of endophytic and endolichenic fungi at a continental scale. Am J Bot. 99:898–914, doi:10.3732/ajb.1100459.
Vilgalys R. 2018. Conserved primer sequences for PCR amplification and sequencing from nuclear ribosomal RNA.
Wagner MR, Lundberg DS, Coleman-Derr D, Tringe SG, Dangl JL, Mitchell-Olds T. 2014. Natural soil microbes alter flowering phenology and the intensity of selection on flowering time in a wild Arabidopsis relative. Ecol Lett. 17:717–726, doi:10.1111/ele.12276.
Watts A, Bansal S, Harrington C, St. Clair B. 2015. Predicting Douglas-Fir’s Response to a Warming Climate. Sci Find. 1–6.
Weiskittel AR, Crookston NL, Rehfeldt GE. 2012. Projected future suitable habitat and productivity of Douglas-fir in western North America. Schweiz Z Forstwes. 163:70–78, doi:10.3188/szf.2012.0070.
White TJ, Bruns T, Lee S, Taylor JL. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protoc Guide Methods Appl. 18:315–322.
Willson MF, Traveset A. 2000. The Ecology of Seed Dispersal. In: Seeds: The Ecology of Regeneration in Plant Communities. CABI. p. 26.
Woo SL, Ruocco M, Vinale F, Nigro M, Marra R, Lombardi N, Pascale A, Lanzuise S, Manganiello G, Lorito M. 2014. Trichoderma-based Products and their Widespread Use in Agriculture. Open Mycol J. 8:71–126, doi:10.2174/1874437001408010071.
Wright ER, Pizzingrilli P, Caligaris MV, Cabral D. 2007. Rose Dieback Caused by Trichothecium roseum in Argentina. Plant Dis. 91:631–631, doi:10.1094/PDIS-91-5-0631C.
Zavitkowski J, Ferrell WK. 1968. Effect of Drought upon Rates of Photosynthesis, Respiration, and Transpiration of Seedlings of Two Ecotypes of Douglas-Fir. Bot Gaz. 129:346–350, doi:10.1086/336455.
Supplementary Materials
SUPPLEMENTARY FIGURE 1. Kaplan-Meier estimator curve of plant survival based on watering treatment.
SUPPLEMENTARY FIGURE 2. Distribution of new needle growth across drought and endophyte treatments at the 5-week time point.
SUPPLEMENTARY FIGURE 3. Variation in species richness across seed provenances in the United States. Appendix A. Sequencing results from seed endophyte sampling in United States Data summary Genbank UNITE Isolate Morphotype species by consensus Taxonomy Sequence Seq length query description accession max score % identity Accession source accession query description max score evalue CA1s white to green, fuzzy Trichoderma koningii Ascomycota, Pezizomycotina, Sordariomycetes,ATTACCGAGTTTACAACTCCCAAACCCAATGTGAACCATACCAAACTGTTGCCTCGGCGGGGTCACGCCCCGGGTGCGTCGCAGCCCCGGAACCAGGCGCCCGCCGGAGGGACCAACCAAACTCTTTCTGTAGTCCCCTCGCGGACGTTATTTCTTACAGCTCTGAGCAAAAATTCAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGGAACCCCTAAGACGGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCATGCGCAGTAGTTTGCACAACTCGCACCGGGAGCGCGGCGCGTCCACGTCCGTAAAACACCCAACTTCTGAAATG Hypocreomycetidae,520 Trichoderma Hypocreales,koningii MH930456.1isolate Hypocreaceae EFA 139.2 internal961 transcribed100% spacerSubmitted 1, partial bysequence; Anguin et 5.8S al. ribosomal2018,Z79628 isolated RNA fromTrichoderma gene soil and in internal Spain koningii transcribed939 spacer 2, complete0 sequence; and large subunit ribosomal RNA gene, partial sequence Trichoderma koningii MH862585.1strain CBS 457.96 internal961 transcribed100% spacerSubmitted 1, partial sequence;by Vu et al. 5.8S 2017, ribosomalX93983 isolated RNA fromTrichoderma gene, pure complete culture koningii sequence; in Netherlands 939and internal transcribed0 spacer 2, partial sequence Trichoderma sp. isolateMH284004.1 yi1147_1 small subunit961 ribosomal100% RNA gene,Submitted partial sequence;by Zhou and internal Li 2018LT707589 transcribedTrichoderma spacer 1, 5.8S koningii ribosomal RNA939 gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Trichoderma sp. isolateMH283993.1 yi1711_1 small subunit961 ribosomal100% RNA gene,Submitted partial sequence;by Zhou and internal Li 2018LN589969 transcribedTrichoderma spacer 1, 5.8S ribosomal RNA939 gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Trichoderma sp. isolateMH283979.1 yi1710_1 small subunit961 ribosomal100% RNA gene,Submitted partial sequence;by Zhou and internal Li 2018KY788329 transcribedTrichoderma spacer 1, 5.8S koningii ribosomal RNA939 gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence CA6s pink, fuzzy to granular Trichothecium roseum Ascomycota, Pezizomycotina, Sordariomycetes,AGAGTTAACAAAACAACTCCCAACCCTTTGTGAACCTTACCTACCGTTGCTTCGGCGGACCGCCCCGGGCGCTGCGTGCCCCGGACCCAAGGCGCCCGCCGGGGACCACACGAACCCTGTTTAACAAACATGTGTATCCTCTGAGCGAGCCGAAAGGCAACAAAACAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGGGCCCCCCCCTTTTCCCCTCGCGGGGGAGGGGGCGGGCCCGGCGTTGGGGCCCAGGCGTCCTCCAAGGGCGCCTGTCCCCGAAACCCAGTGGCGGCCTCGCCGCTGCCTCCTCCGCGTAGTAGCACAAACCTCGCGGGCGGAAGGCGGGCGCGGCCACGCCGTAAACCCCAAACTTTTACCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCAT Hypocreomycetidae,566 Trichothecium Hypocreales roseumMH856757.1 strain CBS 566.50 1035small subunit ribosomal99% Submitted RNA gene, partialby Vu etsequence; al. 2017,KT758800 internal isolated transcribed inTrichothecium Ontario, spacer Canada roseum1, 5.8S ribosomal1007 RNA gene,0 and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Fungal sp. isolate HLUP201700015MH511566.1 internal1035 transcribed spacer99% 1, partialSubmitted sequence; by Xu 5.8S 2018, ribosomal isolatedKT192192 RNA from gene soilTrichothecium and in China internal transcribed spacer1007 2, complete0.00E+00 sequence; and large subunit ribosomal RNA gene, partial sequence Trichothecium roseumMF161110.1 strain UT-Tr internal1035 transcribed99% spacer 1,Submitted partial sequence; by Nasehi 5.8S andribosomal Javan-NikkhahKR559032 RNA gene Trichothecium and2017, internal isolated roseumtranscribed in Iran 1007spacer 2, complete0.00E+00 sequence; and large subunit ribosomal RNA gene, partial sequence Trichothecium roseumKY610499.1 strain JU-P03 18S 1035ribosomal RNA99% gene, partialSubmitted sequence; by Yin internal et al. transcribed 2017,KP317992 isolated spacer fromTrichothecium 1, 5.8S Jujube ribosomal fruit roseum in RNA China gene,1007 and internal0.00E+00 transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Trichothecium roseumKY610498.1 strain JU-P01 28S 1035ribosomal RNA99% gene, partialSubmitted sequence; by Yin internal et al. transcribed 2017,KF897865 isolated spacer fromTrichothecium 1, 5.8S Jujube ribosomal fruit roseum in RNA China gene,1007 and internal0.00E+00 transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
CB3s white to green, fuzzy Trichoderma viridescens Ascomycota, Pezizomycotina, Sordariomycetes,TACCGAGTTTACAACTCCCAAACCCAATGTGAACCATACCAAACTGTTGCCTCGGCGGGGTCACGCCCCGGGTGCGTCGCAGCCCCGGAACCAGGCGCCCGCCGGAGGGACCAACCAAACTCTTTCTGTAGTCCCCTCGCGGACGTTATTTCTTACAGCTCTGAGCAAAAATTCAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGTCCGGCGTTGGGGATCGGGAACCCCTAAGACGGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCATGCGCAGTAGTTTGCACAACTCGCACCGGGAGCGCGGCGCGTCCACGTCCGTAAAACACCCAACTTCTGAAATG Hypocreomycetidae,518 Trichoderma Hypocreales,paraviridescensMH861204.1 Hypocreaceae strain CBS 274.79957 small subunit100% ribosomalSubmitted RNA bygene, Vu partialet al. 2017,sequence;X93984 isolated internal inTrichoderma Austria transcribed koningii spacer 1, 5.8S935 ribosomal RNA0 gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Trichoderma viridescensMH855595.1 strain CBS 433.34957 internal transcribed100% spacerSubmitted 1, partial by Vusequence; et al. 2017, 5.8SMF928756 ribosomal isolated in RNATrichoderma United gene, Kingdom complete viridescens sequence;935 and internal0 transcribed spacer 2, partial sequence Trichoderma trixiae strainMF782828.1 35415DRJ 18S ribosomal957 RNA100% gene, partialSubmitted sequence; by Jankowiakinternal transcribed andKY764900 Bilanski spacer 2017,Trichoderma 1, 5.8S isolated ribosomal viridescens from RNA Fagus gene, 935sylvatica and internal in Poland transcribed0 spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Trichoderma olivascensMF782826.1 strain 35515DRJ 18S957 ribosomal100% RNA gene,Submitted partial sequence; by Jankowiak internal and transcribedKY764889 Bilanski spacer 2017,Trichoderma 1, isolated 5.8S ribosomal viridescens from Fagus RNA 935gene,sylvatica and ininternal Poland0 transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Fungal sp. isolate PdlM-Isolate-12C4-MAAAC-24MH411226.1 957 internal100% transcribedSubmitted spacer 1, by partial Slimen sequence; et al. 2018KY764878 5.8S ribosomalTrichoderma RNA gene viridescens and internal 935transcribed spacer0 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence CB8s white to green, fuzzy Trichoderma viridescens Ascomycota, Pezizomycotina, Sordariomycetes,TACCGAGTTTACAACTCCCAAACCCAATGTGAACCATACCAAACTGTTGCCTCGGCGGGGTCACGCCCCGGGTGCGTCGCAGCCCCGGAACCAGGCGCCCGCCGGAGGGACCAACCAAACTCTTTCTGTAGTCCCCTCGCGGACGTTATTTCTTACAGCTCTGAGCAAAAATTCAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGTCCGGCGTTGGGGATCGGGAACCCCTAAGACGGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCATGCGCAGTAGTTTGCACAACTCGCACCGGGAGCGCGGCGCGTCCACGTCCGTAAAACACCCAACTTCTGAAATG Hypocreomycetidae,518 Trichoderma Hypocreales,paraviridescensMH861204.1 Hypocreaceae strain CBS 274.79957 small subunit100% ribosomalSubmitted RNA bygene, Vu partialet al. 2017,sequence;X93984 isolated internal inTrichoderma Austria transcribed koningii spacer 1, 5.8S935 ribosomal RNA0 gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Trichoderma viridescensMH855595.1 strain CBS 433.34957 internal transcribed100% spacerSubmitted 1, partial by Vusequence; et al. 2017, 5.8SMF928756 ribosomal isolated in RNATrichoderma United gene, Kingdom complete viridescens sequence;935 and internal0 transcribed spacer 2, partial sequence Trichoderma trixiae strainMF782828.1 35415DRJ 18S ribosomal957 RNA100% gene, partialSubmitted sequence; by Jankowiakinternal transcribed andKY764900 Bilanski spacer 2017,Trichoderma 1, 5.8S isolated ribosomal viridescens from RNA Fagus gene, 935sylvatica and internal in Poland transcribed0 spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Trichoderma olivascensMF782826.1 strain 35515DRJ 18S957 ribosomal100% RNA gene,Submitted partial sequence; by Jankowiak internal and transcribedKY764889 Bilanski spacer 2017,Trichoderma 1, isolated 5.8S ribosomal viridescens from Fagus RNA 935gene,sylvatica and ininternal Poland0 transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Fungal sp. isolate PdlM-Isolate-12C4-MAAAC-24MH411226.1 957 internal100% transcribedSubmitted spacer 1, by partial Slimen sequence; et al. 2018KY764878 5.8S ribosomalTrichoderma RNA gene viridescens and internal 935transcribed spacer0 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence CB12s white to green, fuzzy Trichoderma viridescens Ascomycota, Pezizomycotina, Sordariomycetes,TTACCGAGTTTACAACTCCCAAACCCAATGTGAACCATACCAAACTGTTGCCTCGGCGGGGTCACGCCCCGGGTGCGTCGCAGCCCCGGAACCAGGCGCCCGCCGGAGGGACCAACCAAACTCTTTCTGTAGTCCCCTCGCGGACGTTATTTCTTACAGCTCTGAGCAAAAATTCAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGTCCGGCGTTGGGGATCGGGAACCCCTAAGACGGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCATGCGCAGTAGTTTGCACAACTCGCACCGGGAGCGCGGCGCGTCCACGTCCGTAAAACACCCAACTTCTGAAATG Hypocreomycetidae,519 Trichoderma Hypocreales,paraviridescensMH861204.1 Hypocreaceae strain CBS 274.79959 small subunit100% ribosomalSubmitted RNA bygene, Vu partialet al. 2017,sequence;X93984 isolated internal inTrichoderma Austria transcribed koningii spacer 1, 5.8S937 ribosomal RNA0 gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Trichoderma viridescensMH855595.1 strain CBS 433.34959 internal transcribed100% spacerSubmitted 1, partial by Vusequence; et al. 2017, 5.8SMF928756 ribosomal isolated in RNATrichoderma United gene, Kingdom complete viridescens sequence;937 and internal0 transcribed spacer 2, partial sequence Trichoderma trixiae strainMF782828.1 35415DRJ 18S ribosomal959 RNA100% gene, partialSubmitted sequence; by Jankowiakinternal transcribed andKY764900 Bilanski spacer 2017,Trichoderma 1, 5.8S isolated ribosomal viridescens from RNA Fagus gene, 937sylvatica and internal in Poland transcribed0 spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Trichoderma olivascensMF782826.1 strain 35515DRJ 18S959 ribosomal100% RNA gene,Submitted partial sequence; by Jankowiak internal and transcribedKY764889 Bilanski spacer 2017,Trichoderma 1, isolated 5.8S ribosomal viridescens from Fagus RNA 937gene,sylvatica and ininternal Poland0 transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Fungal sp. isolate PdlM-Isolate-12C4-MAAAC-24MH411226.1 959 internal100% transcribedSubmitted spacer 1, by partial Slimen sequence; et al. 2018KY764878 5.8S ribosomalTrichoderma RNA gene viridescens and internal 937transcribed spacer0 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence CB16s white to green, fuzzy Trichoderma viridescens Ascomycota, Pezizomycotina, Sordariomycetes,CATTACCGAGTTTACAACTCCCAAACCCAATGTGAACCATACCAAACTGTTGCCTCGGCGGGGTCACGCCCCGGGTGCGTCGCAGCCCCGGAACCAGGCGCCCGCCGGAGGGACCAACCAAACTCTTTCTGTAGTCCCCTCGCGGACGTTATTTCTTACAGCTCTGAGCAAAAATTCAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGTCCGGCGTTGGGGATCGGGAACCCCTAAGACGGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCATGCGCAGTAGTTTGCACAACTCGCACCGGGAGCGCGGCGCGTCCACGTCCGTAAAACACCCAACTTCTGAAATG Hypocreomycetidae,521 Trichoderma Hypocreales,paraviridescensMH861204.1 Hypocreaceae strain CBS 274.79963 small subunit100% ribosomalSubmitted RNA bygene, Vu partialet al. 2017,sequence;X93984 isolated internal inTrichoderma Austria transcribed koningii spacer 1, 5.8S940 ribosomal RNA0 gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Trichoderma viridescensMH855595.1 strain CBS 433.34963 internal transcribed100% spacerSubmitted 1, partial by Vusequence; et al. 2017, 5.8SMF928756 ribosomal isolated in RNATrichoderma United gene, Kingdom complete viridescens sequence;940 and internal0 transcribed spacer 2, partial sequence Trichoderma trixiae strainMF782828.1 35415DRJ 18S ribosomal963 RNA100% gene, partialSubmitted sequence; by Jankowiakinternal transcribed andKY764900 Bilanski spacer 2017,Trichoderma 1, 5.8S isolated ribosomal viridescens from RNA Fagus gene, 940sylvatica and internal in Poland transcribed0 spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Trichoderma olivascensMF782826.1 strain 35515DRJ 18S963 ribosomal100% RNA gene,Submitted partial sequence; by Jankowiak internal and transcribedKY764889 Bilanski spacer 2017,Trichoderma 1, isolated 5.8S ribosomal viridescens from Fagus RNA 940gene,sylvatica and ininternal Poland0 transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Fungal sp. isolate PdlM-Isolate-12C4-MAAAC-24MH411226.1 963 internal100% transcribedSubmitted spacer 1, by partial Slimen sequence; et al. 2018KY764878 5.8S ribosomalTrichoderma RNA gene viridescens and internal 940transcribed spacer0 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence CB19s white to green, fuzzy Trichoderma viridescens Ascomycota, Pezizomycotina, Sordariomycetes,TTACCGAGTTTACAACTCCCAAACCCAATGTGAACCATACCAAACTGTTGCCTCGGCGGGGTCACGCCCCGGGTGCGTCGCAGCCCCGGAACCAGGCGCCCGCCGGAGGGACCAACCAAACTCTTTCTGTAGTCCCCTCGCGGACGTTATTTCTTACAGCTCTGAGCAAAAATTCAAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGTCCGGCGTTGGGGATCGGGAACCCCTAAGACGGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCATGCGCAGTAGTTTGCACAACTCGCACCGGGAGCGCGGCGCGTCCACGTCCGTAAAACACCCAACTTCTGAAATG Hypocreomycetidae,520 T.harzianum Hypocreales,rRNA genesZ68190.1 and Hypocreaceae ITS1 and ITS2955 DNA (strain 99%CBS 185.69)Submitted by Meyer 1995 Z68190 Trichoderma lixii 933 0 Trichoderma paraviridescensMH861204.1 strain CBS 274.79953 small subunit99% ribosomalSubmitted RNA bygene, Vu partialet al. 2017,sequence;X93984 isolated internal inTrichoderma Austria transcribed koningii spacer 1, 5.8S930 ribosomal RNA0 gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Trichoderma viridescensMH855595.1 strain CBS 433.34953 internal transcribed99% spacerSubmitted 1, partial by Vusequence; et al. 2017, 5.8SMF928756 ribosomal isolated in RNATrichoderma United gene, Kingdom complete viridescens sequence;930 and internal0 transcribed spacer 2, partial sequence Trichoderma trixiae strainMF782828.1 35415DRJ 18S ribosomal953 RNA99% gene, partialSubmitted sequence; by Jankowiakinternal transcribed andKY764900 Bilanski spacer 2017,Trichoderma 1, 5.8S isolated ribosomal viridescens from RNA Fagus gene, 930sylvatica and internal in Poland transcribed0 spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Trichoderma olivascensMF782826.1 strain 35515DRJ 18S953 ribosomal 99%RNA gene,Submitted partial sequence; by Jankowiak internal and transcribedKY764889 Bilanski spacer 2017,Trichoderma 1, isolated 5.8S ribosomal viridescens from Fagus RNA 930gene,sylvatica and ininternal Poland0 transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence CB20s white to green, fuzzy Trichoderma viridescens Ascomycota, Pezizomycotina, Sordariomycetes,TACCGAGTTTACAACTCCCAAACCCAATGTGAACCATACCAAACTGTTGCCTCGGCGGGGTCACGCCCCGGGTGCGTCGCAGCCCCGGAACCAGGCGCCCGCCGGAGGGACCAACCAAACTCTTTCTGTAGTCCCCTCGCGGACGTTATTTCTTACAGCTCTGAGCAAAAATTCAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGTCCGGCGTTGGGGATCGGGAACCCCTAAGACGGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCATGCGCAGTAGTTTGCACAACTCGCACCGGGAGCGCGGCGCGTCCACGTCCGTAAAACACCCAACTTCTGAAATG Hypocreomycetidae,518 Trichoderma Hypocreales,paraviridescensMH861204.1 Hypocreaceae strain CBS 274.79957 small subunit100% ribosomalSubmitted RNA bygene, Vu partialet al. 2017,sequence;X93984 isolated internal inTrichoderma Austria transcribed koningii spacer 1, 5.8S935 ribosomal RNA0 gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Trichoderma viridescensMH855595.1 strain CBS 433.34957 internal transcribed100% spacerSubmitted 1, partial by Vusequence; et al. 2017, 5.8SMF928756 ribosomal isolated in RNATrichoderma United gene, Kingdom complete viridescens sequence;935 and internal0 transcribed spacer 2, partial sequence Trichoderma trixiae strainMF782828.1 35415DRJ 18S ribosomal957 RNA100% gene, partialSubmitted sequence; by Jankowiakinternal transcribed andKY764900 Bilanski spacer 2017,Trichoderma 1, 5.8S isolated ribosomal viridescens from RNA Fagus gene, 935sylvatica and internal in Poland transcribed0 spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Trichoderma olivascensMF782826.1 strain 35515DRJ 18S957 ribosomal100% RNA gene,Submitted partial sequence; by Jankowiak internal and transcribedKY764889 Bilanski spacer 2017,Trichoderma 1, isolated 5.8S ribosomal viridescens from Fagus RNA 935gene,sylvatica and ininternal Poland0 transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Fungal sp. isolate PdlM-Isolate-12C4-MAAAC-24MH411226.1 957 internal100% transcribedSubmitted spacer 1, by partial Slimen sequence; et al. KY7648782018 5.8S ribosomal Trichoderma RNA gene viridescens and internal 935transcribed spacer0 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence CB21s white, fuzzy Trichoderma atroviride Ascomycota, Pezizomycotina, Sordariomycetes,TCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACCATACCAAACTGTTGCCTCGGCGGGGTCACGCCCCGGGTGCGTCGCAGCCCCGGAACCAGGCGCCCGCCGGAGGGACCAACCAAACTCTTTCTGTAGTCCCCTCGCGGACGTTATTTCTTACAGCTCTGAGCAAAAATTCAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGTCCGGCGTTGGGGATCGGGAACCCCTAAGACGGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCATGCGCAGTAGTTTGCACAACTCGCACCGGGAGCGCGGCGCGTCCACGTCCGTAAAACACCCAACTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATA Hypocreomycetidae,628 Trichoderma Hypocreales,trixiae strainMF782828.1 Hypocreaceae35415DRJ 18S 1160ribosomal RNA100% gene, partialSubmitted sequence; by Jankowiakinternal transcribed andHQ115671 Bilanski spacer 2017,Trichoderma 1, 5.8S isolated ribosomal atroviride from RNA Fagus gene,1133 sylvatica and internal in Poland transcribed0 spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Trichoderma olivascensMF782826.1 strain 35515DRJ 18S1160 ribosomal100% RNA gene,Submitted partial sequence; by Jankowiak internal and transcribedGU566274 Bilanski spacer 2017,Trichoderma 1, isolated 5.8S ribosomal paraviridescens from Fagus RNA1133 gene,sylvatica and ininternal Poland0 transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Trichoderma atrovirideHQ115671.1 isolate NG_13 18S1160 ribosomal RNA100% gene, partialSubmitted sequence; by Gorfer internal et transcribedal. FN8128192010, isolated spacer Trichoderma 1,from 5.8S agricultural ribosomal RNAsoil ingene, 1133Austria and internal0 transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Uncultured fungus genomicFN812819.2 DNA containing1160 18S rRNA gene,100% ITS1,Submitted 5.8S rRNA gene,by Qian ITS2, 2010, 28S rRNAisolatedAJ279483 gene, in ChinacloneTrichoderma 3-69 1133 0 Trichoderma sp. 5/97-1AJ279483.1 ITS1, 5.8S rRNA gene1160 and ITS2,100% isolate 5/97-1Submitted by Wirsel 1999, HG936853isolated in GermanyTrichoderma 1128 0 CB24s white to green, fuzzy Trichoderma viridescens Ascomycota, Pezizomycotina, Sordariomycetes,TACCGAGTTTACAACTCCCAAACCCAATGTGAACCATACCAAACTGTTGCCTCGGCGGGGTCACGCCCCGGGTGCGTCGCAGCCCCGGAACCAGGCGCCCGCCGGAGGGACCAACCAAACTCTTTCTGTAGTCCCCTCGCGGACGTTATTTCTTACAGCTCTGAGCAAAAATTCAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGTCCGGCGTTGGGGATCGGGAACCCCTAAGACGGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCATGCGCAGTAGTTTGCACAACTCGCACCGGGAGCGCGGCGCGTCCACGTCCGTAAAACACCCAACTTCTGAAATG Hypocreomycetidae,518 Trichoderma Hypocreales,paraviridescensMH861204.1 Hypocreaceae strain CBS 274.79957 small subunit100% ribosomalSubmitted RNA bygene, Vu partialet al. 2017,sequence;X93984 isolated internal inTrichoderma Austria transcribed koningii spacer 1, 5.8S935 ribosomal RNA0 gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Trichoderma viridescensMH855595.1 strain CBS 433.34957 internal transcribed100% spacerSubmitted 1, partial by Vusequence; et al. 2017, 5.8SMF928756 ribosomal isolated in RNATrichoderma United gene, Kingdom complete viridescens sequence;935 and internal0 transcribed spacer 2, partial sequence Trichoderma trixiae strainMF782828.1 35415DRJ 18S ribosomal957 RNA100% gene, partialSubmitted sequence; by Jankowiakinternal transcribed andKY764900 Bilanski spacer 2017,Trichoderma 1, 5.8S isolated ribosomal viridescens from RNA Fagus gene, 935sylvatica and internal in Poland transcribed0 spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Trichoderma olivascensMF782826.1 strain 35515DRJ 18S957 ribosomal100% RNA gene,Submitted partial sequence; by Jankowiak internal and transcribedKY764889 Bilanski spacer 2017,Trichoderma 1, isolated 5.8S ribosomal viridescens from Fagus RNA 935gene,sylvatica and ininternal Poland0 transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Fungal sp. isolate PdlM-Isolate-12C4-MAAAC-24MH411226.1 957 internal100% transcribedSubmitted spacer 1, by partial Slimen sequence; et al. 2018KY764878 5.8S ribosomalTrichoderma RNA gene viridescens and internal 935transcribed spacer0 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence CB28s white to green, fuzzy Trichoderma viridescens Ascomycota, Pezizomycotina, Sordariomycetes,TTACCGAGTTTACAACTCCCAAACCCAATGTGAACCATACCAAACTGTTGCCTCGGCGGGGTCACGCCCCGGGTGCGTCGCAGCCCCGGAACCAGGCGCCCGCCGGAGGGACCAACCAAACTCTTTCTGTAGTCCCCTCGCGGACGTTATTTCTTACAGCTCTGAGCAAAAATTCAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGTCCGGCGTTGGGGATCGGGAACCCCTAAGACGGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCATGCGCAGTAGTTTGCACAACTCGCACCGGGAGCGCGGCGCGTCCACGTCCGTAAAACACCCAACTTCTGAAATG Hypocreomycetidae,519 Trichoderma Hypocreales,paraviridescensMH861204.1 Hypocreaceae strain CBS 274.79959 small subunit100% ribosomalSubmitted RNA bygene, Vu partialet al. 2017,sequence;X93984 isolated internal inTrichoderma Austria transcribed koningii spacer 1, 5.8S937 ribosomal RNA0 gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Trichoderma viridescensMH855595.1 strain CBS 433.34959 internal transcribed100% spacerSubmitted 1, partial by Vusequence; et al. 2017, 5.8SMF928756 ribosomal isolated in RNATrichoderma United gene, Kingdom complete viridescens sequence;937 and internal0 transcribed spacer 2, partial sequence Trichoderma trixiae strainMF782828.1 35415DRJ 18S ribosomal959 RNA100% gene, partialSubmitted sequence; by Jankowiakinternal transcribed andKY764900 Bilanski spacer 2017,Trichoderma 1, 5.8S isolated ribosomal viridescens from RNA Fagus gene, 937sylvatica and internal in Poland transcribed0 spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Trichoderma olivascensMF782826.1 strain 35515DRJ 18S959 ribosomal100% RNA gene,Submitted partial sequence; by Jankowiak internal and transcribedKY764889 Bilanski spacer 2017,Trichoderma 1, isolated 5.8S ribosomal viridescens from Fagus RNA 937gene,sylvatica and ininternal Poland0 transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Fungal sp. isolate PdlM-Isolate-12C4-MAAAC-24MH411226.1 959 internal100% transcribedSubmitted spacer 1, by partial Slimen sequence; et al. 2018KY764878 5.8S ribosomalTrichoderma RNA gene viridescens and internal 937transcribed spacer0 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence CB34s white to beige Trichoderma polysporum Ascomycota, Pezizomycotina, Sordariomycetes,CATTACCGAGTTTACAACTCCCAAACCCCTATGTGAACGTTACCAAAATGTTGCCTCGGCGGGGAATTTATTCATGCCCCGGGCGCGTCGCAGCCCCGGACCAAGGCGCCCGCCGGAGGACCAACCAAAACTCTTTTGTATGTCCCTCGCGGACTTTTATAATTCTGAACCATCTCGGCGCCCCTTGCGGGCGTTTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGTACGGCGTTGGGGATCGGCCCTTTACGGGGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCATCGGGAGCGCGGCGCGTCCACGTCCGTAAAACACCCAACTTCTGAAATG Hypocreomycetidae,534 Trichoderma Hypocreales,citrinum LC206604.1gene Hypocreaceae for ITS1, 5.8S 987rRNA, ITS2 and100% 28S rRNA,Submitted partial and by complete Hosoya 2016,sequence,KP174753 isolated isolate: fromTrichoderma FC-3700 Fagus crenate polysporum root tissue964 in Japan 0 Trichoderma polysporumKP174753.1 isolate JS27 18S987 ribosomal RNA100% gene, partialSubmitted sequence; by Sugano internal et transcribed al. KJ7833032014, isolatedspacerTrichoderma 1, in 5.8S Finland ribosomal polysporum RNA gene,964 and internal 0transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Trichoderma polysporumKJ783303.1 isolate 8147 18S987 ribosomal RNA100% gene, partialSubmitted sequence; by Zhu internal and Zhuang transcribedDQ914690 2014, spacer isolatedTrichoderma 1, 5.8S in Chinaribosomal polysporum RNA gene,964 and internal0 transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Hypocrea pachybasioidesAB517619.1 genes for 18S rRNA,987 ITS1, 5.8S100% rRNA, ITS2,Submitted 28S rRNA, by partial Nonaka and and complete MasumaAB517619 sequence, 2009Trichoderma strain: FKI-4452 polysporum 964 0 Hypocrea pachybasioidesDQ914690.1 18S ribosomal RNA987 gene, partial100% sequence;Submitted internal by transcribed Platas et spaceral. 2006LC064918 1, 5.8S ribosomalFungi RNA gene, and internal957 transcribed 0spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Trichoderma polysporumMH862407.1 strain CBS 337.93981 internal transcribed99% spacerSubmitted 1, partial by Vu sequence; et al. 2017, 5.8SKY750524 isolatedribosomal in TrichodermaRNA Canada gene, complete polysporum sequence;957 and internal0 transcribed spacer 2, partial sequence CB42s white, fuzzy Trichoderma koningii Ascomycota, Pezizomycotina, Sordariomycetes,AATGTGAACCATACCAAACTGTTGCCTCGGCGGGGTCACGCCCCGGGTGCGTCGCAGCCCCGGAACCAGGCGCCCGCCGGAGGGACCAACCAAACTCTTTCTGTAGTCCCCTCGCGGACGTTATTTCTTACAGCTCTGTGACAAAATTCAAAATGAATCAAAACTTTCAACAACGGATAGCTTGGTTCTGGCATTCTATGAAAAGCACCGAAATTGGATATTAGTGTGATTGCAAATCGAGACATTCATTCTTTGCCGCTTTGCCCCCGCCAATATTCTGGGGCGTGTTGTCAAAGCATCATT Hypocreomycetidae,303 Uncultured Trichoderma Hypocreales,KY582424.1 clone Hypocreaceae 6F small subunit359 ribosomal88% RNA gene,Submitted partial sequence;by Mashigo internal and JX320056Adeleke transcribed 2017,Fungi spacer isolated 1, 5.8S from ribosomal coal mine RNA356 soil gene, and6.00E-97 internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Uncultured fungus cloneJX320056.1 034A2351 18S ribosomal355 RNA 88%gene, partialSubmitted sequence; by internalDavinic transcribedet al. 2012,Z95923 spacer isolated Trichoderma1, complete from soil sequence; peterseniiin USA and 3545.8S ribosomal2.00E-96 RNA gene, partial sequence Trichoderma erinaceumMH864279.1 strain CBS 126393353 internal transcribed89% spacerSubmitted 1, partial by Vu sequence; et al. 2017, 5.8S isolatedZ79628 ribosomal in Sri RNATrichoderma Lanka gene and koningii internal transcribed354 spacer2.00E-96 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Trichoderma koningii 18SKP340234.1 ribosomal RNA gene,353 partial sequence;89% Submittedinternal transcribed by Tlapal spacer Bolanos 1 andX93984 et 5.8Sal. 2015, ribosomalTrichoderma isolated RNA in gene, koningii Mexico complete354 sequence; and2.00E-96 internal transcribed spacer 2, partial sequence Uncultured fungus cloneJX320795.1 034A3096 18S ribosomal353 RNA 93%gene, partialSubmitted sequence; by Davinicinternal et transcribed al. 2012,X93983 isolated spacer Trichodermafrom1, complete soil in USA sequence; koningii and 3545.8S ribosomal2.00E-96 RNA gene, partial sequence Uncultured TrichodermaHQ875398.1 clone M6 18S ribosomal353 RNA gene,89% partialSubmitted sequence; by internalXu et al. transcribed2011, MF928757isolated spacer from 1,Trichoderma soil 5.8S in ribosomalChina viridescens RNA gene,354 and internal2.00E-96 transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
HR1s white, fuzzy Trichoderma viridescens Ascomycota, Pezizomycotina, Sordariomycetes,TTACCGAGTTTACAACTCCCAAACCCAATGTGAACCATACCAAACTGTTGCCTCGGCGGGGTCACGCCCCGGGTGCGTCGCAGCCCCGGAACCAGGCGCCCGCCGGAGGGACCAACCAAACTCTTTCTGTAGTCCCCTCGCGGACGTTATTTCTTACAGCTCTGAGCAAAAATTCAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGTCCGGCGTTGGGGATCGGGAACCCCTAAGACGGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCATGCGCAGTAGTTTGCACAACTCGCACCGGGAGCGCGGCGCGTCCACGTCCGTAAAACACCCAACTTCTGAAATG Hypocreomycetidae,519 Trichoderma Hypocreales,paraviridescensMH861204.1 Hypocreaceae strain CBS 274.79959 small subunit100% ribosomalSubmitted RNA bygene, Vu partialet al. 2017,sequence;X93984 isolated internal inTrichoderma Austria transcribed koningii spacer 1, 5.8S937 ribosomal RNA0 gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Trichoderma viridescensMH855595.1 strain CBS 433.34959 internal transcribed100% spacerSubmitted 1, partial by Vusequence; et al. 2017, 5.8SMF928756 ribosomal isolated in RNATrichoderma United gene, Kingdom complete viridescens sequence;937 and internal0 transcribed spacer 2, partial sequence Trichoderma trixiae strainMF782828.1 35415DRJ 18S ribosomal959 RNA100% gene, partialSubmitted sequence; by Jankowiakinternal transcribed andKY764900 Bilanski spacer 2017,Trichoderma 1, 5.8S isolated ribosomal viridescens from RNA Fagus gene, 937sylvatica and internal in Poland transcribed0 spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Trichoderma olivascensMF782826.1 strain 35515DRJ 18S959 ribosomal100% RNA gene,Submitted partial sequence; by Jankowiak internal and transcribedKY764889 Bilanski spacer 2017,Trichoderma 1, isolated 5.8S ribosomal viridescens from Fagus RNA 937gene,sylvatica and ininternal Poland0 transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Fungal sp. isolate PdlM-Isolate-12C4-MAAAC-24MH411226.1 959 internal100% transcribedSubmitted spacer 1, by partial Slimen sequence; et al. 2018KY764878 5.8S ribosomalTrichoderma RNA gene viridescens and internal 937transcribed spacer0 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence HR23 white to gray, cloudy Rutstroemia longipes Ascomycota, Pezizomycotina, Leotiomycetes,TTGCACCCTCCTCCGAGGGGAGCCCCCGCGACTGTAAACAAGGGGCTTAGCAGGTAGCTCTCGCAGCTGCAACACGATCGAATTGCGGGGACGTCCTAAAGTTCGACGGTACCAACTTGGGGGGGAAACCCCCCGAGGGCCCGCGCCGTGATGGCGTGGGGTGGTGAGAATCCGTCGAAATGTCACAATGGACCATCCGCAGCGAAGCCCCTAACGGCCTTGGGCCCACGGGGAACGTTCACAGACTAAGTGGTTGTGGGTTGGGGCCTCTTCAGGCCCCGCCTAAGATATAGTCGGGCCGCCAGGGAAATCTGGCGGGGTGTTTCGCACACTGTAACCGTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGAGTTCATGCCCTTCGGGGTAGACCTCCCACCCTTGTGTATTATTACCTTGTTGCTTTGGCGGTGCCGCGCGGCTTCGGCCGCGCCTTGGGCTCTCGAGCCTGAGCGTGCCCGCCAGAGGAAACCCAAACTCTGAATATTTTTGTCGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTATTGAGCCCCGCCAGCGATGGCGGGCTCCAAAATCAGTGGCGGCGCCGCTGGGTCCTGAGCGTAGTAATTCTCTCGCTACAGGGTCCCCGCGTGCTCCTGCCAAAACCTTTTTTATAAAATTCTATGG Leotiomycetidae,850 Martininia Helotiales, panamaensis RutstroemiaceaeMH856219.1 strain CBS 207.47885 small subunit87% ribosomalSubmitted RNA gene, by partial Vu et al.sequence; 2017, KU747686isolated internal in transcribedPanamaFungi spacer 1, 5.8S ribosomal913 RNA gene,0 and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Ascomycota sp. 10689GQ996578.1 18S ribosomal RNA867 gene, partial 99%sequence;Submitted internal transcribed by Klemsdal spacer and KC2831201, Talgo 5.8S ribosomal 2009, Helotiales isolated RNA gene, from and Abies internal sp. 897in transcribed Norway spacer0 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Fungal sp. strain F0862KU747686.1 18S ribosomal RNA856 gene, partial86% sequence;Submitted internal transcribed by Del Olmo-Ruiz spacerAB926079 1, and 5.8S Arnold ribosomal Moellerodiscus 2016, RNA isolated gene, and from internal Tectaria892 transcribed incise frond spacer0 in 2,Panama complete sequence; and 28S ribosomal RNA gene, partial sequence Rutstroemia longipes genesAB926073.1 for 18S rRNA,843 ITS 1, 5.8S rRNA,86% ITS 2,Submitted and 28S rRNA, by Hosoya partial and and complete AB926078Zhao 2014, sequence, Moellerodiscusisolated culture_collection: from Daphniphyllum TNS:F-40097892 macropodum0 in Japan Rutstroemia longipes genesAB926106.1 for 18S rRNA,837 ITS 1, 5.8S rRNA,85% ITS 2,Submitted and 28S rRNA, by Hosoya partial and and complete ZhaoAB926073 2014, sequence, Rutstroemiaisolated culture_collection: in Japan longipes TNS:F-40160892 0 Rutstroemia longipes genesAB926082.1 for 18S rRNA,837 ITS 1, 5.8S rRNA,85% ITS 2,Submitted and 28S rRNA, by Hosoya partial and and Zhao completeAB926106 2014, sequence, isolated Rutstroemia from culture_collection: Daphniphyllum longipes TNS:F-40082 macropodum888 in Japan0 HR32 white to gray, cloudy Moellerodiscus pinicola Ascomycota, Pezizomycotina, Leotiomycetes,CCTTTGCACCCTCCTCCGAGGGGAGCCCCCGCGACTGTAAACAAGGGGCTTAGCAGGTAGCTCTCGCAGCTGCAACACGATCGAATTGCGGGGACGTCCTAAAGTTCGACGGTACCAACTTGGGGGGGAAACCCCCCGAGGGCCCGCGCCGTGATGGCGTGGGGTGGTGAGAATCCGTCGAAATGGCACAATGGACCATCCGCAGCGAAGCCCCTAACGGCCTTGGGCCCACGGGGAACGTTCACAGACTAAGTGGTTGTGGGTTGGGGCCTCTTCAGGCCCCGCCTAAGATATAGTCGGGCCGCCAGGGAAATCTGGCGGGGCGTTTCGCACACTGCAACCGTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGAGTTCATGCCCTTCGGGGTAGACCTCCCACCCTTGTGTATTATTACCTTGTTGCTTTGGCGGTGCCGCGCGGCTTCGGCCGCGCCTTGGGCTCTCGAGCCTGAGCGTGCCCGCCAGAGGAAACCCAAACTCCGAATATTTTTGTCGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTATTGAGCCCCGCCAGCGATGGCGGGCTCTAAAATCAGTGGCGGCGCCGCTGGGTCCTGAGCGTAGTAATTCTCTCGCTACAGGGTCCCCGCGTGCTTCTGCCAAAACCTTTTTTATAAAATTCTATGG Leotiomycetidae,853 Martininia Helotiales, panamaensis Sclerotiniaceae,MH856219.1 strain CBS 207.47880 small subunit86% ribosomalSubmitted RNA gene, by partial Vu et al.sequence; 2017, isolatedKU747686 internal in transcribedPanamaFungi spacer 1, 5.8S ribosomal906 RNA gene,0 and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Ascomycota sp. 10689GQ996578.1 18S ribosomal RNA872 gene, partial 99%sequence;Submitted internal transcribed by Klemsdal spacer and KC2831201, Talgo 5.8S ribosomal 2009, Helotiales isolated RNA gene, from and Abies internal sp. 902in transcribed Norway spacer0 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Fungal sp. strain F0862KU747686.1 18S ribosomal RNA850 gene, partial86% sequence;Submitted internal transcribed by Del Olmo-Ruiz spacerAB926079 1, and 5.8S Arnold ribosomal Moellerodiscus 2016, RNA isolated gene, and from internal Tectaria897 transcribed incise frond spacer0 in 2,Panama complete sequence; and 28S ribosomal RNA gene, partial sequence Moellerodiscus pinicolaAB926079.1 genes for 18S rRNA,843 ITS 1, 5.8S 85%rRNA, ITS Submitted2, and 28S byrRNA, Hosoya partial and and ZhaoAB926078 complete 2014, isolated sequence, Moellerodiscus from culture_collection: Pinus densiflora in TNS:F-40118897 Japan 0 Moellerodiscus pinicolaAB926078.1 genes for 18S rRNA,843 ITS 1, 5.8S 85%rRNA, ITS Submitted2, and 28S byrRNA, Hosoya partial and and ZhaoAB926073 complete 2014, isolated sequence, Rutstroemia from culture_collection: Pinus longipes densiflora in TNS:F-40115886 Japan 0 Rutstroemia longipes genesAB926073.1 for 18S rRNA,826 ITS 1, 5.8S rRNA,85% ITS 2,Submitted and 28S rRNA, by Hosoya partial and and complete AB926106Zhao 2014, sequence, Rutstroemiaisolated culture_collection: from longipes Daphniphyllum TNS:F-40097881 macropodum in Japan
PC1s white to green, fuzzy Trichoderma citrinoviride Ascomycota, Pezizomycotina, Sordariomycetes,TTACCGAGTTTACAACTCCCAAACCCAATGTGAACGTTACCAATCTGTTGCCTCGGCGGGATTCTCTGCCCCGGGCGCGTCGCAGCCCCCGGATCCCCATGGCGCCCGCCGGAGGACCCAACTCAAACTCTTTTTTCTCTCCGTCGCGGCCTACGTCGCGGCTCTGTTTTATTTTTTGCTCTGAGCCTTTCTCGGCGACCCTAGCGGGCGTCTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCCCCTCACCGGGCCGCCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCACCGGGAGCGCGGCGCGGCCACAGCCGTAAAACACCCCAAACTCTGAAATG Hypocreomycetidae,552 Trichoderma Hypocreales,citrinovirideMH624144.1 isolateHypocreaceae HZA9 small994 subunit ribosomal99% RNASubmitted gene, partial by Tomah sequence; and Zhang internalZ82907 2018, transcribed isolatedTrichoderma from spacer soil 1,citrinoviride in 5.8S China ribosomal964 RNA gene, and0 internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Trichoderma citrinovirideMH865864.1 strain CBS 130683994 small subunit99% ribosomalSubmitted RNA gene, by Vu partial et al. sequence; 2017, isolatedZ82906 internal in USA transcribedTrichoderma spacer citrinoviride 1, 5.8S ribosomal964 RNA gene,0 and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Trichoderma citrinovirideMH861877.1 strain CBS 258.85994 internal transcribed99% spacerSubmitted 1, partial by Vu sequence; et al. 2017, 5.8S isolatedZ82905 ribosomal in USA TrichodermaRNA gene, complete citrinoviride sequence;964 and internal0 transcribed spacer 2, partial sequence Trichoderma citrinovirideMH602289.1 strain TC XXV internal994 transcribed99% spacerSubmitted 1, partial bysequence; Bohacz 5.8S and ribosomal Kornillowicz-KowalskaZ82903 RNATrichoderma gene and internal2018, citrinoviride isolated transcribed from964 spacer compost 2, complete in0 Poland sequence; and large subunit ribosomal RNA gene, partial sequence Trichoderma citrinovirideMH602287.1 strain TC VIII internal994 transcribed99% spacerSubmitted 1, partial bysequence; Bohacz and5.8S Kornillowicz-Kowalska ribosomalZ48949 RNA Trichodermagene and 2018, internal isolated transcribed from compost964 spacer in 2, Poland complete0 sequence; and large subunit ribosomal RNA gene, partial sequence PC5 melanized Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,TAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACTGCGGAAGGATCATTAAAGAGATAGGGTCTTCACGGCCCGACCTCCAACCCTCTGTTGTTAAAACTACCTTGTTGCTTTGGCGGGACCGTCTCGGTCTCCGAGCGCACTAACCCTCGGGTTGGTGAGCGCCCGCCAGAGTCCAACCAAACTCTTGTATTAAACCAGTCGTCTGAGTATAAAATTTTAATTAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCATCGCTTGGTATTGGGAACGGTCCGTCGAAAGGCGGGCCTTCCTCGAAGACCTCGGCGGGGTTCAACCAACTTCGGGCGTAGTAGAGTTAAATCGAACGTCTCATAAGCTTGGTCGGATCTCATTGCCGTTAAACCTTTAAATTTTCTAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAA 605Dothideomycetidae,Sydowia polyspora Dothideales, strainKY246319.1 LJNL_219 Dotheoriaceae small 1107subunit ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedKF752689 transcribed from PinusFungi spacer yunnanensis 1, 5.8S ribosomal in China 1076RNA gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246321.1 LJNL_288 small 1105subunit ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedJX981459 transcribed from PinusSydowia spacer yunnanensis 1, 5.8S ribosomal in China 1072RNA gene, and0.00E+00 internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246322.1 LJNL_301 small 1101subunit ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedAY253451 transcribed from PinusSydowia spacer yunnanensis polyspora 1, 5.8S ribosomal in China 1058RNA gene, and0.00E+00 internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Fungal sp. MG196Th4L3xKF752689.1 18S ribosomal RNA1101 gene, partial99% sequence;Submitted internal by transcribed Porras-Alfaro spacerAF013228 et 1, al. 5.8S 2013, ribosomal Sydowia isolated RNA polyspora from gene, Tequila and internal hispidissima1058 transcribed leaves0.00E+00 spacer in USA 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246325.1 LJYS_302 small 1098subunit ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedAM901950 transcribed from PinusAscomycota spacer yunnanensis 1, 5.8S ribosomal in China RNA1050 gene, and0.00E+00 internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence PC6 melanized Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,TCATGGCCCGACCTCCAACCCTCTGTTGTTAAAACTACCTTGTTGCTTTGGCGGGACCGTCTCGGTCTCCGAGCGCACTAACCCTCGGGTTGGTGAGCGCCCGCCAGAGTCCAACCAAACTCTTGTATTAAACCAGTCGTCTGAGTATAAAATTTTAATTAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCATCGCTTGGTATTGGGAACGGTCCGTCGAAAGGCGGGCCTTCCTCGAAGACCTCGGCGGGGTTCAACCAACTTCGGGCGTAGTAGAGTTAAATCGAACGTCTTATAAGCTTGGTCGGATCTCATTGCCGTTAAACCTTTAAATTTTCTAGG 487Dothideomycetidae,Sydowia polyspora Dothideales, strainKY246330.1 LJYS_338 Dotheoriaceae small subunit900 ribosomal100% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedMF347890 transcribed from PinusFungi spacer yunnanensis 1, 5.8S ribosomal in China RNA879 gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246329.1 LJYS_328 small subunit900 ribosomal100% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedMF347828 transcribed from PinusFungi spacer yunnanensis 1, 5.8S ribosomal in China RNA879 gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246328.1 LJYS_327 small subunit900 ribosomal100% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedMF347809 transcribed from PinusFungi spacer yunnanensis 1, 5.8S ribosomal in China RNA879 gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246327.1 LJYS_309 small subunit900 ribosomal100% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedMF347797 transcribed from PinusFungi spacer yunnanensis 1, 5.8S ribosomal in China RNA879 gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246326.1 LJYS_308 small subunit900 ribosomal100% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedMF347790 transcribed from PinusFungi spacer yunnanensis 1, 5.8S ribosomal in China RNA879 gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence PC7 melanized Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,GGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAGAGATAGGGTCTTCACGGCCCGACCTCCAACCCTCTGTTGTTAAAACTACCTTGTTGCTTTGGCGGGACCGTCTCGGTCTCCGAGCGCACTAACCCTCGGGTTGGTGAGCGCCCGCCAGAGTCCAACCAAACTCTTGTATTAAACCAGTCGTCTGAGTATAAAATTTTAATTAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCATCGCTTGGTATTGGGAACGGTCCGTCGAAAGGCGGGCCTTCCTCGAAGACCTCGGCGGGGTTCAACCAACTTCGGGCGTAGTAGAGTTAAATCGAACGTCTCATAAGCTTGGTCGGATCTCATTGCCGTTAAACCTTTAAATTTTCTAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGG 620Dothideomycetidae,Sydowia polyspora Dothideales, strainKY246321.1 LJNL_288 Dotheoriaceae small 1129subunit ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedJX981459 transcribed from PinusSydowia spacer yunnanensis 1, 5.8S ribosomal in China 1104RNA gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Rhizosphaera kalkhoffiiJX981459.1 strain WA00000191421129 18S ribosomal99% RNASubmitted gene, partial by sequence;Pawlowska internal andKF752689 Wrzosek transcribedFungi 2012, spacer isolated 1, 5.8S in ribosomal plant tissue1099 RNA in gene, Poland 0.00E+00and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246319.1 LJNL_219 small 1125subunit ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedAF013228 transcribed from PinusSydowia spacer yunnanensis polyspora 1, 5.8S ribosomal in China 1092RNA gene, and0.00E+00 internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Fungal sp. MG196Th4L3xKF752689.1 18S ribosomal RNA1123 gene, partial99% sequence;Submitted internal by transcribed Porras-Alfaro spacerAY253451 et 1, al. 5.8S 2013, ribosomalSydowia isolated RNA polyspora from gene, Tequila and internal hispidissima1079 transcribed leaves0.00E+00 spacer in USA 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Sydowia polyspora strainKY742579.1 GO2-10-4i small1118 subunit ribosomal99% RNASubmitted gene, partial by sequence; Taylor et internalal. AM9019502017, transcribed isolated Ascomycota from spacer pine 1, 5.8Sneedles ribosomal in Scotland1067 RNA gene, and0.00E+00 internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence PC9 melanized Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,TAAAGAGATAGGGTCTTCACGGCCCGACCTCCAACCCTCTGTTGTTAAAACTACCTTGTTGCTTTGGCGGGACCGTCTCGGTCTCCGAGCGCACTAACCCTCGGGTTGGTGAGCGCCCGNCCAGAGTCCAACCAAACTCTTGTATTAAACCAGTCGTCTGAGTATAAAATTTTAANTTAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCATCGCTTGGTATTGGGAACGGTCCGTCGAAAGGCGGGCCTTCCTCGAAGACCTCGGCGGGGTTCAACCAACTTCGGGCGTAGTAGAGTTAAATCGAACGTCTCATAAGCTTGGTCGGATCTCATTGCCGTTAAACCTTTAAATTTTCTAGG 505Dothideomycetidae,Sydowia polyspora Dothideales, strainJX421712.1 ASR_H7_11A Dotheoriaceae 18S920 ribosomal RNA99% gene, Submittedpartial sequence; by Sanz internal et al. transcribed 2012,JX421712 isolated spacerSydowia from 1 and Pinus polyspora 5.8S sylvestnis ribosomal inRNA Spain895 gene, complete0 sequence; and internal transcribed spacer 2, partial sequence Ascomycota sp. strainMG190402.1 A39 internal transcribed917 spacer 1,99% partial sequence;Submitted 5.8S by ribosomalMueller 2017, RNAJN944640 geneisolated and frominternalSydowia Picea transcribed polyspora babies stumpspacer 2,in 890completeFinland sequence;0 and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246323.1 LJNL_313 small subunit915 ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedAY465454 transcribed from PinusHormonema spacer yunnanensis 1, 5.8S ribosomal in China RNA890 gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246322.1 LJNL_301 small subunit915 ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedMF347890 transcribed from PinusFungi spacer yunnanensis 1, 5.8S ribosomal in China RNA886 gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246321.1 LJNL_288 small subunit915 ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedMF347828 transcribed from PinusFungi spacer yunnanensis 1, 5.8S ribosomal in China RNA886 gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence PC11 melanized Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,TCTTCACGGCCCGACCTCCAACCCTCTGTTGTTAAAACTACCTTGTTGCTTTGGCGGGACCGTCTCGGTCTCCGAGCGCACTAACCCTCGGGTTGGTGAGCGCCCGCCAGAGTCCAACCAAACTCTTGTATTAAACCAGTCGTCTGAGTATAAAATTTTAATTAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCATCGCTTGGTATTGGGAACGGTCCGTCGAAAGGCGGGCCTTCCTCGAAGACCTCGGCGGGGTTCAACCAACTTCGGNNGTAGTAGAGTTAAATCGAACGTCTCATAAGCTTGGTCGGATCTCATTGCCGTTAAACCTTTAAATTTTCTAGG 490Dothideomycetidae,Ascomycota sp. Dothideales, strainMG190402.1 A39 Dotheoriaceaeinternal transcribed898 spacer 1,99% partial sequence;Submitted 5.8S by ribosomalMueller 2017, RNA JX421712 geneisolated and frominternalSydowia Picea transcribed polyspora babies stumpspacer 2,in 877completeFinland sequence;0 and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainJX421712.1 ASR_H7_11A 18S898 ribosomal RNA99% gene, Submittedpartial sequence; by Sanz internal et al. transcribed 2012,MF347764 isolated spacerFungi from 1 and Pinus 5.8S sylvestnis ribosomal inRNA Spain872 gene, complete0 sequence; and internal transcribed spacer 2, partial sequence Sydowia polyspora strainKY246323.1 LJNL_313 small subunit893 ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedMF347753 transcribed from PinusFungi spacer yunnanensis 1, 5.8S ribosomal in China RNA872 gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246322.1 LJNL_301 small subunit893 ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedN944640 transcribed from PinusSydowia spacer yunnanensis polyspora 1, 5.8S ribosomal in China RNA872 gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246321.1 LJNL_288 small subunit893 ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedAY465454 transcribed from PinusHormonema spacer yunnanensis 1, 5.8S ribosomal in China RNA872 gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence PC12 melanized Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,TTCACGGCCCGACCTCCAACCCTCTGTTGTTAAAACTACCTTGTTGCTTTGGCGGGACCGTCTCGGTCTCCGAGCGCACTAACCCTCGGGTTGGTGAGCGCCCGCCAGAGTCCAACCAAACTCTTGTATTAAACCAGTCGTCTGAGTATAAAATTTTAATTAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCATCGCTTGGTATTGGGAACGGTCCGTCGAAAGGCGGGCCTTCCTCGAAGACCTCGGCGGGGTTCAACCAACTTCGGGCGTAGTAGAGTTAAATCGAACGTCTCATAAGCTTGGTCGGATCTCATTGCCGTTAAACCTTTAAATTTTCTAGG 488Dothideomycetidae,Ascomycota sp. Dothideales, strainMG190402.1 A39 Dotheoriaceaeinternal transcribed902 spacer 1,100% partial sequence;Submitted 5.8S by ribosomalMueller 2017, RNAJX421712 geneisolated and frominternalSydowia Picea transcribed polyspora babies stumpspacer 2,in 881completeFinland sequence;0 and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainJX421712.1 ASR_H7_11A 18S902 ribosomal RNA100% gene, Submittedpartial sequence; by Sanz internal et al. transcribed 2012,MF347764 isolated spacerFungi from 1 and Pinus 5.8S sylvestnis ribosomal inRNA Spain875 gene, complete0 sequence; and internal transcribed spacer 2, partial sequence Sydowia polyspora strainKY246323.1 LJNL_313 small subunit896 ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedMF347753 transcribed from PinusFungi spacer yunnanensis 1, 5.8S ribosomal in China RNA875 gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246322.1 LJNL_301 small subunit896 ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedJN944640 transcribed from PinusSydowia spacer yunnanensis polyspora 1, 5.8S ribosomal in China RNA875 gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246321.1 LJNL_288 small subunit896 ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedAY465454 transcribed from PinusHormonema spacer yunnanensis 1, 5.8S ribosomal in China RNA875 gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence PC13 melanized Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,TAAAGAGATAGGGTCTTCACGGCCCGACCTCCAACCCTCTGTTGTTAAAACTACCTTGTTGCTTTGGCGGGACCGTCTCGGTCTCCGAGCGCACTAACCCTCGGGTTGGTGAGCGCCCGCCAGAGTCCAACCAAACTCTTGTATTAAACCAGTCGTCTGAGTATAAAATTTTAATTAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCATCGCTTGGTATTGGGAACGGTCCGTCGAAAGGCGGGCCTTCCTCGAAGACCTCGGCGGGGTTCAACCAACTTCGGGCGTAGTAGAGTTAAATCGAACGTCTCATAAGCTTGGTCGGATCTCATTGCCGTTAAACCTTTAAATTTTCTAGG 503Dothideomycetidae,Sydowia polyspora Dothideales, strainJX421712.1 ASR_H7_11A Dotheoriaceae 18S929 ribosomal RNA100% gene, Submittedpartial sequence; by Sanz internal et al. transcribed 2012,JX421712 isolated spacer Sydowia from 1 and Pinus polyspora 5.8S sylvestnis ribosomal inRNA Spain908 gene, complete0 sequence; and internal transcribed spacer 2, partial sequence Ascomycota sp. strainMG190402.1 A39 internal transcribed926 spacer 1,100% partial sequence;Submitted 5.8S by ribosomalMueller 2017, RNAJN944640 geneisolated and frominternalSydowia Picea transcribed polyspora babies stumpspacer 2,in 902completeFinland sequence;0 and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246323.1 LJNL_313 small subunit924 ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedAY465454 transcribed from PinusHormonema spacer yunnanensis 1, 5.8S ribosomal in China RNA902 gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246322.1 LJNL_301 small subunit924 ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedMF347890 transcribed from PinusFungi spacer yunnanensis 1, 5.8S ribosomal in China RNA899 gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246321.1 LJNL_288 small subunit924 ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedMF347828 transcribed from PinusFungi spacer yunnanensis 1, 5.8S ribosomal in China RNA899 gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence PC14 melanized Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,CTTCACGGCCCGACCTCCAACCCTCTGTTGTTAAAACTTACCTTGTTGCTTTGGCGGGACCGTCTCGGTCTCCGAGCGCACTAACCCTCGGGTTGGTGAGCGCCCGCCAGAGTCCAACCAAACTCTTGTATTAAACCAGTCGTCTGAGTATAAAATTTTAATTAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCATCGCTTGGTATTGGGAACGGTCCGTCGAAAGGCGGGCCTTCCTCGAAGACCTCGGCGGGGTTCAACCAACTTCGGGCGTAGTAGAGTTAAATCGAACGTCTCATAAGCTTGGTCGGATCTCATTGCCGTTAAACCTTTAAATTTTCTAGG 490Dothideomycetidae,Ascomycota sp. Dothideales, strainMG190402.1 A39 Dotheoriaceaeinternal transcribed898 spacer 1,99% partial sequence;Submitted 5.8S by ribosomalMueller 2017, RNA JX421712 geneisolated and frominternalSydowia Picea transcribed polyspora babies stumpspacer 2,in 875completeFinland sequence;0 and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainJX421712.1 ASR_H7_11A 18S898 ribosomal RNA99% gene, Submittedpartial sequence; by Sanz internal et al. transcribed 2012,MF347764 isolated spacer Fungi from 1 and Pinus 5.8S sylvestnis ribosomal inRNA Spain872 gene, complete0 sequence; and internal transcribed spacer 2, partial sequence Sydowia polyspora strainKY246323.1 LJNL_313 small subunit893 ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedMF347753 transcribed from PinusFungi spacer yunnanensis 1, 5.8S ribosomal in China RNA872 gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246322.1 LJNL_301 small subunit893 ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedJN944640 transcribed from PinusSydowia spacer yunnanensis polyspora 1, 5.8S ribosomal in China RNA872 gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246321.1 LJNL_288 small subunit893 ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedAY465454 transcribed from PinusHormonema spacer yunnanensis 1, 5.8S ribosomal in China RNA872 gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence PC15 melanized Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAGAGATAGGGTCTTCACGGCCCGACCTCCAACCCTCTGTTGTTAAAACTACCTTGTTGCTTTGGCGGGACCGTCTCGGTCTCCGAGCGCACTAACCCTCGGGTTGGTGAGCGCCCGCCAGAGTCCAACCAAACTCTTGTATTAAACCAGTCGTCTGAGTATAAAATTTTAATTAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCATCGCTTGGTATTGGGAACGGTCCGTCGAAAGGCGGGCCTTCCTCGAAGACCTCGGCGGGGTTCAACCAACTTCGGGCGTAGTAGAGTTAAATCGAACGTCTCATAAGCTTGGTCGGATCTCATTGCCGTTAAACCTTTAAATTTTCTAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCACTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAGAGATAGGGTCTTCACGGCCCGACCTCCAACCCTCTGTTGTTAAAACTACCTTGTTGCTTTGGCGGGACCGTCTCGGTCTCCGAGCGCACTAACCCTCGGGTTGGTGAGCGCCCGCCAGAGTCCAACCAAACTCTTGTATTAAACCAGTCGTCTGAGTATAAAATTTTAATTAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTACAC1237 Dothideomycetidae,Sydowia polyspora Dothideales, strainKY246321.1 LJNL_288 Dotheoriaceae small 1125subunit ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedKF752689 transcribed from PinusFungi spacer yunnanensis 1, 5.8S ribosomal in China 1101RNA gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Fungal sp. MG196Th4L3xKF752689.1 18S ribosomal RNA1125 gene, partial99% sequence;Submitted internal by transcribed Porras-Alfaro spacerJX981459 et 1, al. 5.8S 2013, ribosomal Sydowia isolated RNA from gene, Tequila and internal hispidissima1009 transcribed leaves0.00E+00 spacer in USA 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246322.1 LJNL_301 small 1120subunit ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedAF013228 transcribed from PinusSydowia spacer yunnanensis polyspora 1, 5.8S ribosomal in China 1083RNA gene, and0.00E+00 internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246319.1 LJNL_219 small 1120subunit ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedAM901950 transcribed from PinusAscomycota spacer yunnanensis 1, 5.8S ribosomal in China 1072RNA gene, and0.00E+00 internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246325.1 LJYS_302 small 1118subunit ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedAY253451 transcribed from PinusSydowia spacer yunnanensis polyspora1, 5.8S ribosomal in China RNA1065 gene, and0.00E+00 internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence PC16 melanized Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,TTAAAGAGATAGGGTCTTCACGGCCCGACCTCCAACCCTCTGTTGTTAAAACTACCTTGTTGCTTTGGCGGGACCGTCTCGGTCTCCGAGCGCACTAACCCTCGGGNTTGGTGAGCGCCCGCCAGAGTCCAACCAAACTCTTGTATTAAACCAGTCGTCTGAGTATAAAATTTTAATTAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCATCGCTTGGTATTGGGAACGGTCCGTCGAAAGGCGGGCCTTCCTCGAAGACCTCGGCGGGGTTCAACCAACTTCGGGCGTAGTAGAGTTAAATCGAACGTCTCATAAGCTTGGTCGGATCTCATTGCCGTTAAACCTTTAAATTTTCTAGG 505Dothideomycetidae,Sydowia polyspora Dothideales, strainJX421712.1 ASR_H7_11A Dotheoriaceae 18S926 ribosomal RNA99% gene, Submittedpartial sequence; by Sanz internal et al. transcribed 2012,JX421712 isolated spacer Sydowia from 1 and Pinus polyspora 5.8S sylvestnis ribosomal inRNA Spain902 gene, complete0 sequence; and internal transcribed spacer 2, partial sequence Sydowia polyspora strainKY246323.1 LJNL_313 small subunit920 ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedJN944640 transcribed from PinusSydowia spacer yunnanensis polyspora 1, 5.8S ribosomal in China RNA899 gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246322.1 LJNL_301 small subunit920 ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedAY465454 transcribed from PinusHormonema spacer yunnanensis 1, 5.8S ribosomal in China RNA899 gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246321.1 LJNL_288 small subunit920 ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedFR773346 transcribed from PinusDothoriaceae spacer yunnanensis 1, 5.8S ribosomal in China RNA895 gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246319.1 LJNL_219 small subunit920 ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedMF347890 transcribed from PinusFungi spacer yunnanensis 1, 5.8S ribosomal in China RNA893 gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence PC18 melanized Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,TTCACGGCCCGACCTCCAACCCTCTGTTGTTAAAACTACCTTGTTGCTTTGGCGGGACCGTCTCGGTCTCCGAGCGCACTAACCCTCGGGTTGGTGAGCGCCCGCCAGAGTCCAACCAAACTCTTGTATTAAACCAGTCGTCTGAGTATAAAATTTTAATTAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCATCGCTTGGTATTGGGAACGGTCCGTCGAAAGGCGGGCCTTCCTCGAAGACCTCGGCGGGGTTCAACCAACTTCGGGCGTAGTAGAGTTAAATCGAACGTCTCATAAGCTTGGTCGGATCTCATTGCCGTTAAACCTTTAAATTTTCTAGG 488Dothideomycetidae,Ascomycota sp. Dothideales, strainMG190402.1 A39 Dotheoriaceaeinternal transcribed902 spacer 1,100% partial sequence;Submitted 5.8S by ribosomalMueller 2017, RNAJX421712 geneisolated and frominternalSydowia Picea transcribed polyspora babies stumpspacer 2,in 881completeFinland sequence;0 and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainJX421712.1 ASR_H7_11A 18S902 ribosomal RNA100% gene, Submittedpartial sequence; by Sanz internal et al. transcribed 2012,MF347764 isolated spacer Fungi from 1 and Pinus 5.8S sylvestnis ribosomal inRNA Spain875 gene, complete0 sequence; and internal transcribed spacer 2, partial sequence Sydowia polyspora strainKY246323.1 LJNL_313 small subunit896 ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedMF347753 transcribed from PinusFungi spacer yunnanensis 1, 5.8S ribosomal in China RNA875 gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246322.1 LJNL_301 small subunit896 ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedJN944640 transcribed from PinusSydowia spacer yunnanensis polyspora 1, 5.8S ribosomal in China RNA875 gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246321.1 LJNL_288 small subunit896 ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedAY465454 transcribed from PinusHormonema spacer yunnanensis 1, 5.8S ribosomal in China RNA875 gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence PC19 white, fuzzy Trichoderma paraviridescensAscomycota, Pezizomycotina, Sordariomycetes,GACAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACCATACCAAACTGTTGCCTCGGCGGGGTCACGCCCCGGGTGCGTCGCAGCCCCGGAACCAGGCGCCCGCCGGAGGGACCAACCAAACTCTTTCTGTAGTCCCCTCGCGGACGTTATTTCTTACAGCTCTGAGCAAAAATTCAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGTCCGGCGTTGGGGATCGGGAACCCCTAAGACGGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCATGCGCAGTAGTTTGCACAACTCGCACCGGGAGCGCGGCGCGTCCACGTCCGTAAAACACCCAACTTCTGAAATG Hypocreomycetidae,535 Trichoderma Hypocreales,paraviridescensMH861204.1 Hypocreaceae strain CBS 274.79985 small subunit100% ribosomalSubmitted RNA bygene, Vu partialet al. 2017,sequence;X93984 isolated internal inTrichoderma Austria transcribed koningii spacer 1, 5.8S962 ribosomal RNA0 gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Trichoderma trixiae strainMF782828.1 35415DRJ 18S ribosomal985 RNA100% gene, partialSubmitted sequence; by Jankowiakinternal transcribed andKY750372 Bilanski spacer 2017,Trichoderma 1, 5.8S isolated ribosomal paraviridescens from RNA Fagus gene, 962sylvatica and internal in Poland transcribed0 spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Trichoderma olivascensMF782826.1 strain 35515DRJ 18S985 ribosomal100% RNA gene,Submitted partial sequence; by Jankowiak internal and transcribedKX100403 Bilanski spacer 2017,Trichoderma 1, isolated 5.8S ribosomal from Fagus RNA 962gene,sylvatica and ininternal Poland0 transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Trichoderma paraviridescensMF185990.1 isolate SFC101248985 small subunit100% ribosomalSubmitted RNA by gene, Park partial et al. sequence; 2017,KU942400 isolated internal Trichoderma from transcribed egg masses atroviride spacer of 1 Arctoscopus and962 5.8S ribosomal japonicas 0RNA ingene, South complete Korea sequence; and internal transcribed spacer 2, partial sequence Trichoderma viridescensMH279746.1 isolate s A and B 985small subunit100% ribosomalSubmitted RNA gene, by partial Newsham sequence; 2018,KT323131 internalisolated transcribedin AntarcticaTrichoderma spacer atroviride 1, 5.8S ribosomal962 RNA gene,0 and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence PC29 melanized Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,TAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAGAGATAGGGTCTTCACGGCCCGACCTCCAACCCTCTGTTGTTAAAACTACCTTGTTGCTTTGGCGGGACCGTCTCGGTCTCCGAGCGCACTAACCCTCGGGTTGGTGAGCGCCCGCCAGAGTCCAACCAAACTCTTGTATTAAACCAGTCGTCTGAGTATAAAATTTTAATTAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCATCGCTTGGTATTGGGAACGGTCCGTCGAAAGGCGGGCCTTCCTCGAAGACCTCGGCGGGGTTCAACCAACTTCGGGCGTAGTAGAGTTAAATCGAACGTCTCATAAGCTTGGTCGGATCTCATTGCCGTTAAACCTTTAAATTTTCTAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATC 604Dothideomycetidae,Sydowia polyspora Dothideales, strainKY246321.1 LJNL_288 Dotheoriaceae small 1110subunit ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedKF752689 transcribed from PinusFungi spacer yunnanensis 1, 5.8S ribosomal in China 1081RNA gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246319.1 LJNL_219 small 1110subunit ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedJX981459 transcribed from PinusSydowia spacer yunnanensis 1, 5.8S ribosomal in China 1076RNA gene, and0.00E+00 internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246322.1 LJNL_301 small 1107subunit ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedAY253451 transcribed from PinusSydowia spacer yunnanensis polyspora 1, 5.8S ribosomal in China 1063RNA gene, and0.00E+00 internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246325.1 LJYS_302 small 1105subunit ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedAF013228 transcribed from PinusSydowia spacer yunnanensis polyspora1, 5.8S ribosomal in China RNA1063 gene, and0.00E+00 internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Fungal sp. MG196Th4L3xKF752689.1 18S ribosomal RNA1105 gene, partial99% sequence;Submitted internal by transcribed Porras-Alfaro spacerAM901950 et 1, al. 5.8S 2013, ribosomal Ascomycota isolated RNA from gene, Tequila and internal hispidissima1059 transcribed leaves0.00E+00 spacer in USA 2, complete sequence; and 28S ribosomal RNA gene, partial sequence PC32 white to beige unknown Rhytismataceae sp.Ascomycota, Pezizomycotina, Leotiomycetes,AGGAWCATTACAGAGAACTTGCCCTTCGGGGTAGATCTCCCACCCTTTGTTTACATTACCCTTGTTGCTTTGGCAGGCCCGTCTCTCGGGACCGCCGGCTTCGGCTGGCCCGCGCCTGCCAGAGGATCTCAAACTCTTGTTTAATTGTCGTCTGAGTAATATTTAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACAACCCTCAAGCTCTGCTTGGTATTGGGCGTCACCGCTTCGGTGCGCCTCAAAATCAGTGGCGGTGCCATCCGGCTTCAAGCGTAGTAATTTTTCTCGCTCTGGGGACCCGGGTGCGTGCTTGCCAGCAACCCCCAATTTATCAAAGG Leotiomycetidae,479 Fungal sp.Rhytismatales PIMO_422 internalHQ535925.1 transcribed881 spacer 1, partial99% sequence;Submitted 5.8S ribosomal by Larkin RNA and gene HuntHQ535925 and 2010, internal isolatedHelotiales transcribed from Pinus spacer monticola 2, complete861 needles sequence; in USA 0and 28S ribosomal RNA gene, partial sequence Fungal sp. PIMO_369 internalHQ535920.1 transcribed881 spacer 1, partial99% sequence;Submitted 5.8S ribosomal by Larkin RNA and gene HuntHQ535920 and 2010, internal isolatedHelotiales transcribed from Pinus spacer monticola 2, complete861 needles sequence; in USA 0and 28S ribosomal RNA gene, partial sequence Fungal sp. T5N18c(B) 18SAY465450.1 ribosomal RNA gene,872 partial sequence;99% Submittedinternal transcribed by Ganley spacer and 1,NewcombeFR837916 5.8S ribosomal 2003,Rhytismataceae RNA isolated gene, andfrom internal Pinus transcribedmonticola850 in spacer USA0 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Rhytismataceae sp. ZK45/08FR837916.1 partial 18S rRNA870 gene, ITS1,99% 5.8S rRNASubmitted gene, ITS2 by and Kolarova partial 28S2011, AY465451rRNA isolated gene, fromisolateRhytismataceae Picea ZK45/08 abies needles in843 Czech Republic0 Rhytismataceae sp. sd1bN2a(A)AY465451.1 18S ribosomal865 RNA gene,99% partial sequence;Submitted internal by Ganley transcribed and NewcombeJN053095 spacer 1, 5.8S2003,Helotiales ribosomal isolated RNA from gene, Pinus and monticola841 internal transcribedin USA0 spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence PC33 white to beige unknown Rhytismataceae sp.Ascomycota, Pezizomycotina, Leotiomycetes,CAGAGAACTTGCCCTTCGGGGTAGATCTCCCACCCTTTGTTTACATTACCCTTGTTGCTTTGGCAGGCCCGTCTCTCGGGACCGCCGGCTTCGGCTGGCCCGCGCCTGCCAGAGGATCTCAAACTCTTGTTTAATTGTCGTCTGAGTAATATTTAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACAACCCTCAAGCTCTGCTTGGTATTGGGCGTCACCGCTTCGGTGCGCCTCAAAATCAGTGGCGGTGCCATCCGGCTTCAAGCGTAGTAATTTTTCTCGCTCTGGGGACCCGGGTGCGTGCTTGCCAGCAACCCCCAATTTATCAAAGG Leotiomycetidae,469 Fungal sp.Rhytismatales PIMO_422 internalHQ535925.1 transcribed867 spacer 1, partial100% sequence;Submitted 5.8S ribosomal by Larkin RNA and gene HuntHQ535925 and 2010, internal isolatedHelotiales transcribed from Pinus spacer monticola 2, complete847 needles sequence; in USA 0and 28S ribosomal RNA gene, partial sequence Fungal sp. PIMO_369 internalHQ535920.1 transcribed867 spacer 1, partial100% sequence;Submitted 5.8S ribosomal by Larkin RNA and gene HuntHQ535920 and 2010, internal isolatedHelotiales transcribed from Pinus spacer monticola 2, complete847 needles sequence; in USA 0and 28S ribosomal RNA gene, partial sequence Fungal sp. T5N18c(B) 18SAY465450.1 ribosomal RNA gene,863 partial sequence;99% Submittedinternal transcribed by Ganley spacer and 1,NewcombeJN053095 5.8S ribosomal 2003,Helotiales RNA isolated gene, andfrom internal Pinus transcribedmonticola841 in spacer USA0 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Fungal sp. agrD163 internalJN053095.1 transcribed spacer861 1, partial99% sequence;Submitted 5.8S ribosomal by Persoh RNA gene, and Rambled completeFR837916 2011,sequence; Rhytismataceae isolated and internal from lichen transcribed in 841Austria spacer 2, partial0 sequence Rhytismataceae sp. ZK45/08FR837916.1 partial 18S rRNA861 gene, ITS1,99% 5.8S rRNASubmitted gene, ITS2 by and Kolarova partial 28S2011, AY465451rRNA isolated gene, fromisolateRhytismataceae Picea ZK45/08 abies needles in838 Czech Republic0 Rhytismataceae sp. sd1bN2a(A)AY465451.1 18S ribosomal857 RNA gene,100% partial sequence;Submitted internal by Ganley transcribed and NewcombeAY971742 spacer 1, 5.8S2003,Helotiales ribosomal isolated RNA from gene, Pinus and monticola825 internal transcribedin USA0 spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence PC35 melanized Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,TTCACGGCCCGACCTCCAACCCTCTGTTGTTAAAACTACCTTGTTGCTTTGGCGGGACCGTCTCGGTCTCCGAGCGCACTAACCCTCGGGTTGGTGAGCGCCCGCCAGAGTCCAACCAAACTCTTGTATTAAACCAGTCGTCTGAGTATAAAATTTTAATTAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCATCGCTTGGTATTGGGAACGGTCCGTCGAAAGGCGGGCCTTCCTCGAAGACCTCGGCGGGGTTCAACCAACTTCGGGCGTAGTAGAGTTAAAATCGAACGTCTCATAAGCTTGGTCGGATCTCATTGCCGTTAAACCTTTAAAATTTTCTAGG 491Dothideomycetidae,Ascomycota sp. Dothideales, strainMG190402.1 A39 Dotheoriaceaeinternal transcribed887 spacer 1,99% partial sequence;Submitted 5.8S by ribosomalMueller 2017, RNA JX421712 geneisolated and frominternalSydowia Picea transcribed polyspora babies stumpspacer 2,in 861completeFinland sequence;0 and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainJX421712.1 ASR_H7_11A 18S887 ribosomal RNA99% gene, Submittedpartial sequence; by Sanz internal et al. transcribed 2012,MF347764 isolated spacer Fungi from 1 and Pinus 5.8S sylvestnis ribosomal inRNA Spain857 gene, complete0 sequence; and internal transcribed spacer 2, partial sequence Sydowia polyspora strainKY246323.1 LJNL_313 small subunit881 ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedMF347753 transcribed from PinusFungi spacer yunnanensis 1, 5.8S ribosomal in China RNA857 gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246322.1 LJNL_301 small subunit881 ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedJN944640 transcribed from PinusSydowia spacer yunnanensis polyspora 1, 5.8S ribosomal in China RNA857 gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246321.1 LJNL_288 small subunit881 ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedAY465454 transcribed from PinusHormonema spacer yunnanensis 1, 5.8S ribosomal in China RNA857 gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence PC38 melanized Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,CTTCACGGCCCGACCTCCAACCCTCTGTTGTTAAAACTACCTTGTTGCTTTGGCGGGACCGTCTCGGTCTCCGAGCGCACTAACCCTCGGGTTGGTGAGCGCCCGCCAGAGTCCAACCAAACTCTTGTATTAAACCAGTCGTCTGAGTATAAAATTTTAATTAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCATCGCTTGGTATTGGGAACGGTCCGTCGAAAGGCGGGCCTTCCTCGAAGACCTCGGCGGGGTTCAACCAACTTCGGGCGTAGTAGAGTTAAATCGAACGTCTCATAAGCTTGGTCGGATCTCATTGCCGTTAAACCTTTAAATTTTCTAGG 489Dothideomycetidae,Ascomycota sp. Dothideales, strainMG190402.1 A39 Dotheoriaceaeinternal transcribed904 spacer 1,100% partial sequence;Submitted 5.8S by ribosomalMueller 2017, RNAJX421712 geneisolated and frominternalSydowia Picea transcribed polyspora babies stumpspacer 2,in 883completeFinland sequence;0 and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainJX421712.1 ASR_H7_11A 18S904 ribosomal RNA100% gene, Submittedpartial sequence; by Sanz internal et al. transcribed 2012,MF347764 isolated spacer Fungi from 1 and Pinus 5.8S sylvestnis ribosomal inRNA Spain877 gene, complete0 sequence; and internal transcribed spacer 2, partial sequence Sydowia polyspora strainKY246323.1 LJNL_313 small subunit898 ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedMF347753 transcribed from PinusFungi spacer yunnanensis 1, 5.8S ribosomal in China RNA877 gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246322.1 LJNL_301 small subunit898 ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedJN944640 transcribed from PinusSydowia spacer yunnanensis polyspora 1, 5.8S ribosomal in China RNA877 gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246321.1 LJNL_288 small subunit898 ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedAY465454 transcribed from PinusHormonema spacer yunnanensis 1, 5.8S ribosomal in China RNA877 gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence PC42 white to green, fuzzy Trichoderma citrinoviride Ascomycota, Pezizomycotina, Sordariomycetes,CATTACCGAGTTTACAACTCCCAAACCCAATGTGAACGTTACCAATCTGTTGCCTCGGCGGGATTCTCTGCCCCGGGCGCGTCGCAGCCCCGGATCCCCATGGCGCCCGCCNGGAGGACCAACTCAAACTCTTTTTTCTCTCCGTCGCGGCCTACGTCGCGGGCTCTGTTTTATTTTTGCTCTGAGCCTTTCTCGGCGACCCTAGCGGGCGTCTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCCCCTCACCGGGCCGCCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCACCGGGAGCGCGGCGCGGCCACAGCCGTAAAACACCCCAAACTCTGAAATG Hypocreomycetidae,553 Trichoderma Hypocreales,citrinovirideMH624144.1 isolateHypocreaceae HZA9 small1002 subunit ribosomal99% RNASubmitted gene, partial by Tomah sequence; and internalZhangZ82907 2018,transcribedTrichoderma isolated spacer from 1,citrinoviride soil5.8S in ribosomal China973 RNA gene, and0 internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Trichoderma citrinovirideMH865864.1 strain CBS 1306831002 small subunit99% ribosomalSubmitted RNA gene, by Vu partial et al. sequence; 2017, isolatedZ82906 internal in USA transcribedTrichoderma spacer citrinoviride 1, 5.8S ribosomal973 RNA gene,0 and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Trichoderma citrinovirideMH861877.1 strain CBS 258.851002 internal transcribed99% spacerSubmitted 1, partial by Vu sequence; et al. 2017, 5.8S isolatedZ82905 ribosomal in USA TrichodermaRNA gene, complete citrinoviride sequence;973 and internal0 transcribed spacer 2, partial sequence Trichoderma citrinovirideMH602289.1 strain TC XXV internal1002 transcribed99% spacerSubmitted 1, partial by sequence; Bohacz and 5.8S Kornillowicz-Kowalska ribosomalZ82903 RNATrichoderma gene and2018, internal isolatedcitrinoviride transcribed from compost973 spacer in 2,Poland complete0 sequence; and large subunit ribosomal RNA gene, partial sequence Trichoderma citrinovirideMH602287.1 strain TC VIII internal1002 transcribed99% spacerSubmitted 1, partial bysequence; Bohacz and5.8S Kornillowicz-Kowalska ribosomalZ48949 RNA Trichodermagene and 2018, internal isolated transcribed from compost973 spacer in 2, Poland complete0 sequence; and large subunit ribosomal RNA gene, partial sequence PC43 white to green, fuzzy Trichoderma citrinoviride Ascomycota, Pezizomycotina, Sordariomycetes,TTACCGAGTTTACAACTCCCAAACCCAATGTGAACGTTACCAATCTGTTGCCTCGGCGGGATTCTCTGCCCCGGGCGCGTCGCAGCCCCGGATCCCATGGCGCCCGCCGGAGGACCAACTCAAACTCTTTTTTCTCTCCGTCGCGGCCTACGTCGCGGCTCTGTTTTATTTTTGCTCTGAGCCTTTCTCGGCGACCCTAGCGGGCGTCTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCCCCTCACCGGGCCGCCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCACCGGGAGCGCGGCGCGGCCACAGCCGTAAAACACCCCAAACTCTGAAATG Hypocreomycetidae,548 Trichoderma Hypocreales,citrinovirideMH624144.1 isolateHypocreaceae HZA9 small1013 subunit ribosomal100% RNASubmitted gene, partial by Tomah sequence; and internalZhangZ82907 2018,transcribedTrichoderma isolated spacer from 1,citrinoviride soil5.8S in ribosomal China989 RNA gene, and0 internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Trichoderma citrinovirideMH865864.1 strain CBS 1306831013 small subunit100% ribosomalSubmitted RNA gene, by Vu partial et al. sequence; 2017, isolatedZ82906 internal in USA transcribedTrichoderma spacer citrinoviride 1, 5.8S ribosomal989 RNA gene,0 and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Trichoderma citrinovirideMH861877.1 strain CBS 258.851013 internal transcribed100% spacerSubmitted 1, partial by Vu sequence; et al. 2017, 5.8S isolatedZ82905 ribosomal in USA TrichodermaRNA gene, complete citrinoviride sequence; 989 and internal0 transcribed spacer 2, partial sequence Trichoderma citrinovirideMH602289.1 strain TC XXV internal1013 transcribed100% spacerSubmitted 1, partial by sequence; Bohacz and 5.8S Kornillowicz-Kowalska ribosomalZ82903 RNATrichoderma gene and2018, internal isolatedcitrinoviride transcribed from compost989 spacer in 2,Poland complete0 sequence; and large subunit ribosomal RNA gene, partial sequence Trichoderma citrinovirideMH602287.1 strain TC VIII internal1013 transcribed100% spacerSubmitted 1, partial bysequence; Bohacz and5.8S Kornillowicz-Kowalska ribosomalZ48949 RNA Trichodermagene and 2018, internal isolated transcribed from compost989 spacer in 2, Poland complete0 sequence; and large subunit ribosomal RNA gene, partial sequence PC44s white to green, fuzzy Trichoderma viridescens Ascomycota, Pezizomycotina, Sordariomycetes,TACCGAGTTTACAACTCCCAAACCCAATGTGAACCATACCAAACTGTTGCCTCGGCGGGGTCACGCCCCGGGTGCGTCGCAGCCCCGGAACCAGGCGCCCGCCGGAGGGACCAACCAAACTCTTTCTGTAGTCCCCTCGCGGACGTTATTTCTTACAGCTCTGAGCAAAAATTCAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGTCCGGCGTTGGGGATCGGGAACCCCTAAGACGGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCATGCGCAGTAGTTTGCACAACTCGCACCGGGAGCGCGGCGCGTCCACGTCCGTAAAACACCCAACTTCTGAAATG Hypocreomycetidae,518 Trichoderma Hypocreales,paraviridescensMH861204.1 Hypocreaceae strain CBS 274.79957 small subunit100% ribosomalSubmitted RNA bygene, Vu partialet al. 2017,sequence;X93984 isolated internal inTrichoderma Austria transcribed koningii spacer 1, 5.8S935 ribosomal RNA0 gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Trichoderma viridescensMH855595.1 strain CBS 433.34957 internal transcribed100% spacerSubmitted 1, partial by Vusequence; et al. 2017, 5.8SMF928756 ribosomal isolated in RNATrichoderma United gene, Kingdom complete viridescens sequence;935 and internal0 transcribed spacer 2, partial sequence Trichoderma trixiae strainMF782828.1 35415DRJ 18S ribosomal957 RNA100% gene, partialSubmitted sequence; by Jankowiakinternal transcribed andKY764900 Bilanski spacer 2017,Trichoderma 1, 5.8S isolated ribosomal viridescens from RNA Fagus gene, 935sylvatica and internal in Poland transcribed0 spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Trichoderma olivascensMF782826.1 strain 35515DRJ 18S957 ribosomal100% RNA gene,Submitted partial sequence; by Jankowiak internal and transcribedKY764889 Bilanski spacer 2017,Trichoderma 1, isolated 5.8S ribosomal viridescens from Fagus RNA 935gene,sylvatica and ininternal Poland0 transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Fungal sp. isolate PdlM-Isolate-12C4-MAAAC-24MH411226.1 957 internal100% transcribedSubmitted spacer 1, by partial Slimen sequence; et al. 2018KY764878 5.8S ribosomalTrichoderma RNA gene viridescens and internal 935transcribed spacer0 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence PC45 melanized Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,ACGGCCCGACCTCCAACCCTCTGTTGTTAAAACTACCTTGTTGCTTTGGCGGGACCGTCTCGGTCTCCGAGCGNCACTAACCCTCGGGTTGGTGAGCGCCCGCCAGAGTCCAACCAAACTCTTGTATTAAACCAGTCGTCTGAGTATAAAATTTTAATTAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCATCGCTTGGTATTGGGAACGGTCCGTCGAAAGGCGGGCCTTCCTCGAAGACCTCGGCGGGGTTCAACCAACTTCGGGCGTAGTAGAGTTAAATCGAACGTCTCATAAGCTTGGTCGGATCTCATTGCCGTTAAACCTTTAAATTTTCTAGG 486Dothideomycetidae,Ascomycota sp. Dothideales, strainMG190402.1 A39 Dotheoriaceaeinternal transcribed891 spacer 1,99% partial sequence;Submitted 5.8S by ribosomalMueller 2017, RNA JX421712 geneisolated and frominternalSydowia Picea transcribed polyspora babies stumpspacer 2,in 868completeFinland sequence;0 and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainJX421712.1 ASR_H7_11A 18S891 ribosomal RNA99% gene, Submittedpartial sequence; by Sanz internal et al. transcribed 2012,MF347764 isolated spacerFungi from 1 and Pinus 5.8S sylvestnis ribosomal inRNA Spain865 gene, complete0 sequence; and internal transcribed spacer 2, partial sequence Sydowia polyspora strainKY246323.1 LJNL_313 small subunit887 ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedMF347753 transcribed from PinusFungi spacer yunnanensis 1, 5.8S ribosomal in China RNA865 gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246322.1 LJNL_301 small subunit887 ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedKT264638 transcribed from PinusHormonema spacer yunnanensis 1, 5.8S ribosomal in China RNA865 gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246321.1 LJNL_288 small subunit887 ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedJN944640 transcribed from PinusSydowia spacer yunnanensis polyspora 1, 5.8S ribosomal in China RNA865 gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence PC46 melanized Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAGAGATAGGGTCTTCATGGCCCGACCTCCAACCCTCTGTTGTTAAAACTACCTTGTTGCTTTGGCGGGACCGTCTCGGTCTCCGAGCGCACTAACCCTCGGGTTGGTGAGCGCCCGCCAGAGTCCAACCAAACTCTTGTATTAAACCAGTCGTCTGAGTATAAAATTTTAATTAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCATCGCTTGGTATTGGGAACGGTCCGTCGAAAGGCGGGCCTTCCTCGAAGACCTCGGCGGGGTTCAACCAACTTCGGGCGTAGTAGAGTTAAATCGAACGTCTTATAAGCTTGGTCGGATCTCATTGCCGTTAAACCTTTAAATTTTCTAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGACTTGGTCANTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCNGTAGGTGAACCTGCGGAAGGATCATTAAAGAGATAGGGTCTTCATGGCCCGACCTCCAACCCTCTGTTGTTAAAACTACCTTGTTGCTTTGGCGGGACCGTCTCGGTCTCCGAGCGCACTAACCCTCGGGTTGGTGAGCGCCCGCCAGAGTCCAACCAAACTCTTGTATTAAACCAGTCGTCTGAGTATAAAATTTTAATTAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCG1252 Dothideomycetidae,Rhizosphaera Dothideales, kalkhoffiiJX981459.1 strain Dotheoriaceae WA00000191421142 18S ribosomal99% RNASubmitted gene, partial by sequence;Pawlowska internal andJX981459 Wrzosek transcribed Sydowia 2012, spacer isolated 1, 5.8S in ribosomal plant tissue1115 RNA in gene, Poland and0 internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Fungal sp. MG196Th4L3xKF752689.1 18S ribosomal RNA1140 gene, partial100% sequence;Submitted internal by transcribed Porras-Alfaro spacerKF752689 et 1, al. 5.8S 2013, ribosomal Fungi isolated RNA from gene, Tequila and internal hispidissima1113 transcribed leaves0.00E+00 spacer in USA 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246319.1 LJNL_219 small 1138subunit ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedAF013228 transcribed from PinusSydowia spacer yunnanensis polyspora 1, 5.8S ribosomal in China 1113RNA gene, and0.00E+00 internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Hormonema dematioidesAF013228.1 18S ribosomal 1136RNA gene, partial99% sequence;Submitted internal by transcribed Catal and spacer AdamsAY253451 1, 1997,5.8S ribosomal isolatedSydowia RNAfrompolyspora gene Pinus and sylvestris internal1086 transcribedin USA0.00E+00 spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246321.1 LJNL_288 small 1133subunit ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedAM901950 transcribed from PinusAscomycota spacer yunnanensis 1, 5.8S ribosomal in China 1081RNA gene, and0.00E+00 internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainKY742579.1 GO2-10-4i small1131 subunit ribosomal99% RNASubmitted gene, partial by sequence; Taylor et internalal. 2017,AF462438 transcribed isolated Sydowia from spacer pine polyspora 1, 5.8Sneedles ribosomal in Scotland1077 RNA gene, and0.00E+00 internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence PC47 white to beige unknown Rhytismataceae sp.Ascomycota, Pezizomycotina, Leotiomycetes,TTACAGAGAACTTGCCCTTCGGGGTAGATCTCCCACCCTTTGTTTACATTACCCTTGTTGCTTTGGCAGGCCCGTCTCTCGGGACCGCCGGCTTCGGCTGGCCCGCGCCTGCCAGAGGATCTCAAACTCTTGTTTAATTGTCGTCTGAGTAATATTTAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACAACCCTCAAGCTCTGCTTGGTATTGGGCGTCACCGCTTCGGTGCGCCTCAAAATCAGTGGCGGTGCCATCCGGCTTCAAGCGTAGTAATTTTTCTCGCTCTGGGGACCCGGGTGCGTGCTTGCCAGCAACCCCCAATTTATCAAAGG Leotiomycetidae,472 Fungal sp.Rhytismatales PIMO_422 internalHQ535925.1 transcribed872 spacer 1, partial100% sequence;Submitted 5.8S ribosomal by Larkin RNA and gene HuntHQ535925 and 2010, internal isolatedHelotiales transcribed from Pinus spacer monticola 2, complete852 needles sequence; in USA 0and 28S ribosomal RNA gene, partial sequence Fungal sp. PIMO_369 internalHQ535920.1 transcribed872 spacer 1, partial100% sequence;Submitted 5.8S ribosomal by Larkin RNA and gene HuntHQ535920 and 2010, internal isolatedHelotiales transcribed from Pinus spacer monticola 2, complete852 needles sequence; in USA 0and 28S ribosomal RNA gene, partial sequence Fungal sp. T5N18c(B) 18SAY465450.1 ribosomal RNA gene,869 partial sequence;99% Submittedinternal transcribed by Ganley spacer and 1,NewcombeFR837916 5.8S ribosomal 2003,Rhytismataceae RNA isolated gene, andfrom internal Pinus transcribedmonticola847 in spacer USA0 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Rhytismataceae sp. ZK45/08FR837916.1 partial 18S rRNA867 gene, ITS1,99% 5.8S rRNASubmitted gene, ITS2 by and Kolarova partial 28S2011, JN053095rRNA isolated gene, fromisolateHelotiales Picea ZK45/08 abies needles in841 Czech Republic0 Fungal sp. agrD163 internalJN053095.1 transcribed spacer861 1, partial99% sequence;Submitted 5.8S ribosomal by Persoh RNA gene, and Rambled AY465451complete 2011,sequence; Rhytismataceae isolated and internal from lichen transcribed in 839Austria spacer 2, partial0 sequence Rhytismataceae sp. sd1bN2a(A)AY465451.1 18S ribosomal861 RNA gene,99% partial sequence;Submitted internal by Ganley transcribed and NewcombeAY971742 spacer 1, 5.8S2003,Helotiales ribosomal isolated RNA from gene, Pinus and monticola830 internal transcribedin USA0 spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence PC48 melanized Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,AGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAGAGATAGGGTCTTCACGGCCCGACCTCCAACCCTCTGTTGTTAAAACTACCTTGTTGCTTTGGCGGGACCGTCTCGGTCTCCGAGCGCACTAACCCTCGGGTTGGTGAGCGCCCGCCAGAGTCCAACCAAACTCTTGTATTAAACCAGTCGTCTGAGTATAAAATTTTAATTAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCATCGCTTGGTATTGGGAACGGTCCGTCGAAAGGCGGGCCTTCCTCGAAGACCTCGGCGGGGTTCAACCAACTTCGGGCGTAGTAGAGTTAAATCGAACGTCTCATAAGCTTGGTCGGATCTCATTGCCGTTAAACCTTTAAATTTTCTAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATC 601Dothideomycetidae,Sydowia polyspora Dothideales, strainKY246322.1 LJNL_301 Dotheoriaceae small 1105subunit ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedKF752689 transcribed from PinusFungi spacer yunnanensis 1, 5.8S ribosomal in China 1076RNA gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246321.1 LJNL_288 small 1105subunit ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedJX981459 transcribed from PinusSydowia spacer yunnanensis 1, 5.8S ribosomal in China 1070RNA gene, and0.00E+00 internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246319.1 LJNL_219 small 1105subunit ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedAY253451 transcribed from PinusSydowia spacer yunnanensis polyspora 1, 5.8S ribosomal in China 1063RNA gene, and0.00E+00 internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246329.1 LJYS_328 small 1099subunit ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedAF013228 transcribed from PinusSydowia spacer yunnanensis polyspora1, 5.8S ribosomal in China RNA1058 gene, and0.00E+00 internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246328.1 LJYS_327 small 1099subunit ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedJN944640 transcribed from PinusSydowia spacer yunnanensis polyspora1, 5.8S ribosomal in China RNA1054 gene, and0.00E+00 internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence PC49 melanized Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,AGGGTCTTCACGGCCCGACCTCCAACCCTCTGTTGTTAAAACTACCTTGTTGCTTTGGCGGGACCGTCTCGGTCTCCGAGCGCACTAACCCTCGGGTTGGTGAGCGCCCGCCAGAGTCCAACCAAACTCTTGTATTAAACCAGTCGTCTGAGTATAAAATTTTAATTAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCATCGCTTGGTATTGGGAACGGTCCGTCGAAAGGCGGGCCTTCCTCGAAGACCTCGGCGGGGTTCAACCAACTTCGGGCGTAGTAGAGTTAAATCGAACGTCTCATAAGCTTGGTCGGATCTCATTGCCGTTAAACCTTTAAATTTTCTAGG 494Dothideomycetidae,Ascomycota sp. Dothideales, strainMG190402.1 A39 Dotheoriaceaeinternal transcribed913 spacer 1,100% partial sequence;Submitted 5.8S by ribosomalMueller 2017, RNA JX421712 geneisolated and frominternalSydowia Picea transcribed polyspora babies stumpspacer 2,in 892completeFinland sequence;0 and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainJX421712.1 ASR_H7_11A 18S913 ribosomal RNA100% gene, Submittedpartial sequence; by Sanz internal et al. transcribed 2012,MF347764 isolated spacer Fungi from 1 and Pinus 5.8S sylvestnis ribosomal inRNA Spain886 gene, complete0 sequence; and internal transcribed spacer 2, partial sequence Sydowia polyspora strainKY246323.1 LJNL_313 small subunit907 ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedMF347753 transcribed from PinusFungi spacer yunnanensis 1, 5.8S ribosomal in China RNA886 gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246322.1 LJNL_301 small subunit907 ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedJN944640 transcribed from PinusSydowia spacer yunnanensis polyspora 1, 5.8S ribosomal in China RNA886 gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Sydowia polyspora strainKY246321.1 LJNL_288 small subunit907 ribosomal99% RNA gene,Submitted partial by sequence; Pan 2016, internal isolatedAY465454 transcribed from PinusHormonema spacer yunnanensis 1, 5.8S ribosomal in China RNA886 gene, and internal0 transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
TL38 white, fuzzy Trichoderma koningii Ascomycota, Pezizomycotina, Sordariomycetes,TTACCGAGTTTACAACTCCCGAACCCAATGTGAACCATACCAAACTGTTGCCTCGGCGGGGTCACGCCCCGGGTGCGTCGCAGCCCCGGAACCAGGCGCCCGCCGGAGGGANCAACCAAACTCTTTCTGTAGTCCCCTCGCGGACGTTATTTCTTACAGCTCTGAGCAAAAATTCAAAATGTAATCAATAACTATTCAACAACGGATAGCTCTTGGTTCTGGCAAAGATGAAAACGCAGCG Hypocreomycetidae,241 Fungal sp. strain Hypocreales, J240SKU838382.1 internal Hypocreaceae transcribed394 spacer 1, partial96% sequence;Submitted 5.8S ribosomal by David RNAet al. gene 2016,JX320603 and isolated internal Fungi intranscribed USA spacer 2, complete379 sequence;4.00E-104 and 28S ribosomal RNA gene, partial sequence Fungal sp. strain J240I KU838373.1internal transcribed394 spacer 1, partial96% sequence;Submitted 5.8S ribosomal by David RNA et al. gene 2016,AF359255 and isolated internal Trichoderma transcribedin USA viride spacer 2, complete379 sequence;4.00E-104 and 28S ribosomal RNA gene, partial sequence Fungal sp. strain J198GKU838170.1 internal transcribed394 spacer 1, partial96% sequence;Submitted 5.8S ribosomal by David RNAet al. gene 2016,Z95923 and isolated internal Trichoderma in transcribed USA petersenii spacer 2, complete376 sequence;5.00E-103 and 28S ribosomal RNA gene, partial sequence Fungal sp. strain J190KKU838132.1 internal transcribed394 spacer 1, partial96% sequence;Submitted 5.8S ribosomal by David RNAet al. gene 2016,Z79628 and isolated internalTrichoderma in transcribed USA koningii spacer 2, complete376 sequence;5.00E-103 and 28S ribosomal RNA gene, partial sequence Fungal sp. strain J142RKU837975.1 internal transcribed394 spacer 1, partial96% sequence;Submitted 5.8S ribosomal by David RNAet al. gene 2016,X93984 and isolated internal Trichoderma in transcribed USA koningii spacer 2, complete376 sequence;5.00E-103 and 28S ribosomal RNA gene, partial sequence X93983 Trichoderma koningii 376 5.00E-103 Appendix B. Sequencing results from seed endophyte sampling in New Zealand Data Summary Genbank UNITE isolate species by consensus taxonomy sequence Seq length BLAST result accession # max score % identity accession source accession query description max score evalue OR.3 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,TAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTAACTCTACTACGCCCGAATTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGCNACGGACCGTTCCCAATACCAAGCGAGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGACGACTGGTTTAATACAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTCGGAGACCGAGACGGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTCAC Dothideomycetidae,510 Sydowia Dothideales, polyspora strainMH855019.1 Dotheoriaceae CBS 116.29 952 100 submitted by Vu et al.LN714608 2017 Sydowia polyspora 922 0 Sydowia polyspora strainKY246318.1 QJ_303 952 100 Submitted by Pan 2016, KY081694 isolated Sydowia in China polyspora 922 0 Sydowia polyspora strainMG098248.1 NW-FVA2201952 100 Submitted by Busskamp KC768096 et al. 2017,Sydowia isolated polyspora from a Pinus922 sylvestris twig0 in Germany Ascomycota sp. strainMG190569.1 A400 952 100 Submitted by Mueller JX981501 2017, isolated Sydowia from polyspora a Picea abies stump922 in Finland0 Ascomycota sp. strainMG190559.1 A386 952 100 Submitted by Mueller JX981459 2017, isolated Sydowia from a Picea abies stump922 in Finland0 OR.18 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,ACCTAGAAAATTTAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTAACTCTCTACGCCCGAAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGCGACGGACCGTTCCCATACCAAGCGATGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGACGCTGGTTTAATACAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTCGGAACCGAGACGGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTCACC Dothideomycetidae,520 Sydowia Dothideales, polyspora strainMH855019.1 Dotheoriaceae CBS 116.29 972 100 submitted by Vu et LN714608 al. 2017 Sydowia polyspora 949 0 Sydowia polyspora strainKY246318.1 QJ_303 972 100 Submitted by Pan 2016, JX981459 isolated Sydowia in China 949 0 Sydowia polyspora strainMG098248.1 NW-FVA2201972 100 Submitted by Busskamp EU700376 et al. 2017,Sydowia isolated from a Pinus949 sylvestris twig0 in Germany Ascomycota sp. strainMG190468.1 A186 972 100 Submitted by Mueller EU700375 2017, isolated Sydowia from a Picea abies stump949 in Finland0 Sydowia polyspora isolateLN714608.1 B3C 972 100 Submitted by Zelenka DQ317340 2014, isolated Dothioraceae in the Czech Republic949 0 OR.41 Aspergillus pseudoglaucusAscomycota, Pezizomycotina, Eurotiomycetes,AGGTCACCTGGTTAAAAAGATTGGTTGCGAGGCTAGCTGCCAGCTGGACCTACGGGAGCGGGTGACAAAGCCCCATACGCTCGAGGACCAGACATGGTGCCGCCACTGCCTTTTGGGCCCGTCCCCGTTACCAGGGACGGAAGCCCAACACACAAGCCGTGCTTGAGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACTGAATTCTGCAATTCACATTAATTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTATTGTTTAACTAAAAACTCAGACTGCAAACTTCAGACAGTGTTCAAATGTTAGTCTTCGGCGGGCCGTGGCCACGCCGAAGCAACAGGGTACAGATAGACACGGATGGGAGGTTGGACCCAGAGGGCCCGCACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACG Eurotiomycetidae,514 Paecilomyces Eurotiales, sp.Aspergillaceae MTFA02DQ132811.1 950 100 Submitted by Vujanovic DQ132811 et al. 2005 Aspergillus 928 0 Aspergillus pseudoglaucusKF923731.1 strain A671946 100 Submitted by Wang KF923731 et al. 2013, isolatedAspergillus from pseudoglaucus mofuren tea924 block 0 Aspergillus proliferansMG650614.1 isolate 201657E944 99 Submitted by Di Piazza KX463362 et al. 2017, Aspergillus isolated frompseudoglaucus marine921 sediments in Italy0 Aspergillus pseudoglaucusMH863986.1 strain CBS 126221944 99 Submitted by Vu et KX463361al. 2017, isolated Aspergillus in Portugal proliferans 921 0 Aspergillus ruber strainMH863985.1 CBS 126220 944 99 Submitted by Vu et KX463360al. 2017, isolated Aspergillus in Portugal proliferans 921 0 Aspergillus ruber strainMH855375.1 CBS 106.33 944 99 Submitted by Vu et KX463359al. 2017, isolated Aspergillus in Portugal proliferans 921 0 OR.62 Aspergillus pseudoglaucusAscomycota, Pezizomycotina, Eurotiomycetes,CAACCTGGTTAAAAAGATTGGTTGCGAGGCTAGCTGCCAGCTGGACCTACGGGAGCGGGTGACAAAGCCCCATACGCTCGAGGACCAGACATGGTGCCGCCACTGCCTTTTGGGCCCGTCCCCGTTACCAGGGACGGAAGCCCAACACACAAGCCGTGCTTGAGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACTGAATTCTGCAATTCACATTAATTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTATTGTTTAACTAAAAACTCAGACTGCAAACTTCAGACAGTGTTCAAATGTTAGTCTTCGGCGGGCCGTGGCCACGCCGAAGCAACAGGGTACAGATAGACACGGATGGGAGGTTGGACCCAGAGGGCCCGCACTCGGTAATGATCCTTCCGCAGGTTCACCTACGA Eurotiomycetidae,498 Aspergillus Eurotiales, proliferans AspergillaceaeMH137931.1 isolate 201657E918 100 submitted by Midilli KY859366 and Abaci GunyarAspergillus 2018, niveoglaucus isolated from897 animal feed in0 Turkey Aspergillus pseudoglaucusMH137919.1 strain BT12918 100 submitted by Midilli KX463362 and Abaci GunyarAspergillus 2018, pseudoglaucus isolated from897 animal feed in0 Turkey Aspergillus proliferansMG650614.1 isolate 201657E918 100 Submitted by Di Piazza KX463361 et al. 2017, Aspergillus isolated fromproliferans marine897 sediments in Italy0 Aspergillus ruber strainMH865326.1 CBS 129305 918 100 submitted by Vu et al.KX463360 2017 Aspergillus proliferans 897 0 Aspergillus pseudoglaucusMH863986.1 strain CBS 126221918 100 Submitted by Vu et KX463359 al. 2017, isolated Aspergillus in Portugal proliferans 897 0 OR.105 Trichoderma harzianum Ascomycota, Pezizomycotina, Sordariomycetes,TTTCAGAAGTTGGGTGTTTAACGGCTGTGGACGCGCCGCGCTCCCGATGCGAGTGTGCAAACTACTGCGCAGGAGAGGCTGCGGCGAGACCGCCACTGTATTTCGGAGACGGCCACCCGCTAAGGGAGGGCCGATCCCCAACGCCGACCCCCCGGAGGGGTTCGAGGGTTGAAATGACGCTCGGACAGGCATGCCCGCCAGAATACTGGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTGATTCATTTTCGAAACGCCTACGAGAGGCGCCGAGAAGGCTCAGATTATAAAAAAAACCCGCGAGGGGGTATACAATAAGAGTTTTAGGTTGGTCCTCCGGCGGGCGCCTTGGTCCGGGGCTGCNACGCACCCGGGGCAGAGATCCCGCCGAGGCAACAGTTTGGTAACGTTCACATTGGGTTTGGGAGTTGTAAACTCGGTAATGATCCCTCCGCTGGTT Hypocreomycetidae,551 Trichoderma Hypocreales, harzianumMG171156.1 Hypocreaceae isolate jz-2 1014 99 submitted by Zhou KX343098and Wang 2017,Trichoderma isolated from harzianum floating991 seedling matrix0 in China Trichoderma sp. isolateMG171155.1 jz-1 1014 99 submitted by Zhou andKR995121 Wang 2017,Trichoderma isolated from harzianum floating991 seedling matrix0 in China Trichoderma harzianumMH607613.1 isolate pen8 1014 99 Submitted by Moosa KR995109 et al. 2018, Trichoderma isolated from harzianum Citrus reticulata991 in Pakistan0 Stagonosporopsis ligulicolaMG195967.1 isolate C-2-11014 99 Submitted by Zhou KP090207and Wang 2017,Trichoderma isolated from tobacco991 in China 0 Trichoderma sp. isolateMG195966.1 Z-1 1014 99 Submitted by Zhou andKP009220 Wang 2017,Trichoderma isolated from tobacco991 in China 0 OR.116 Melampsora sp. Basidiomycota, Pucciniomycotina, Pucciniomycetes,CCAAAGACTGCCTCAATGACATATTACTACAACATCAAGTACGTCTTTCGAACTAATTCTAAACCATCCAAAAGTGCTGATCAATTTGAAGCGAGGCGTTATCACGCCAACACTCAGAATCCGTCTCCAATCCTTTTAGAAGCATTAGAGCCGAGGGGGGTTTCATGACATTCAAACAGGTGTACCTCTCGGAATAACCAAAAGGTGCAGGTGCGTTCAAAGATTCGATGATTCACTGAATTC Pucciniales,Melampsora Melampsoraceae ferrinii KY764068.1BPI 910186 453 100 submitted by Demers KF780835 et al. 2017, Melampsora isolated from Salix sp. 443host 4.00E-123 Melampsora sp. HMASKF780769.1 71119 453 100 submitted by Zhao etKF780826 al. 2013 Melampsora 443 4.00E-123 Melampsora sp. HMASKF780752.1 76122 453 100 submitted by Zhao etKF780824 al. 2013 Melampsora 443 4.00E-123 Melampsora sp. HMASKF780739.1 8619 453 100 submitted by Zhao etKF780823 al. 2013 Melampsora 443 4.00E-123 Melampsora chelidonii-pierotiiAB646769.1 strain E-1g453 100 Submitted by Shinyama KF780769 and Yamaoka Melampsora 2011, isolated from443 Cordyalis4.00E-123 incisa in Japan OR.130 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,AGGTCACCTAGAAAATTTAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTACTCTACTACGCCCGAAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGCGACGGACCGTTCCCAATACCAAGCGATGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCGACGACTGGTTTAATACAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCCGGAGACCGAGACGGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTTACTTC Dothideomycetidae,554 Sydowia Dothideales, polyspora strain KY246318.1Dotheoriaceae QJ_303 1026 99 Submitted by Pan 2016, JX981459 isolated Sydowia in China 998 0 Rhizosphaera kalkhoffiiJX981459.1 strain WA00000191421026 99 Submitted by Pawlowska KC768096 and WrzosekSydowia 2012, polyspora isolated from996 plant tissue in0 Poland Sydowia polyspora strainHG008754.1 F0210-49U41024 99 Submitted by Martin-Sanchez JX421703 2013,Sydowia isolated polyspora from air in 996France 0 Sydowia polyspora isolateKC768096.1 HO1 1024 99 Submitted by Davydenko HG008754 et al 2013,Sydowia isolated polyspora from Hylurgus996 ligniperda tissue0 in Ukraine Sydowia polyspora strainJX421703.1 ASR_H12_3A1024 99 Submitted by Sanz etKU195496 al. 2012, isolatedFungi from Pinus sylvestris994 tissue in Spain0 OR.131 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,TTAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTAACTCTACTACGCCCGAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGCGACGGACCGTTCCCAATACCAAGCGTGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTTAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGACGACTGGTTTAATAAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTCGGAGACCGAGACGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTTACTT Dothideomycetidae,538 Sydowia Dothideales, polyspora strain KY246318.1Dotheoriaceae QJ_303 998 99 Submitted by Pan 2016, KY081694 isolated Sydowia in China polyspora 973 0 Sydowia polyspora isolateKY081694.1 JM_TPM002998 99 Submitted by Munoz-Adalia KC768096 et al.Sydowia 2016 polyspora 973 0 Sydowia polyspora strainHG008754.1 F0210-49U4998 99 submitted by Martin-Sanchez JX981501 2013,Sydowia isolated polyspora from air in France973 0 Rhizosphaera kalkhoffiiJX981459.1 strain WA0000019142998 99 Submitted by Pawlowska JX981459 and WrzosekSydowia 2012, isolated from973 plant tissue in0 Poland Sydowia polyspora isolateKC768096.1 HO1 998 99 Submitted by Davydenko JX421717 et al 2013,Sydowia isolated polyspora from Hylurgus973 ligniperda tissue0 in Ukraine OR.136 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,TTAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTAACTCTACTACGCCCGAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGCGACGGACCGTTCCCAATACCAAGCGTGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTTAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGACGACTGGTTTAATAAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTCGGAGACCGAGACGGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAGAGGNTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTC Dothideomycetidae,507 Sydowia Dothideales, polyspora strainMH855019.1 Dotheoriaceae CBS 116.29 942 99 Submitted by Vu et LN714608 al. 2017 Sydowia polyspora 921 0 Sydowia polyspora strainKY246318.1 QJ_303 942 99 Submitted by Pan 2016, KY081694 isolated Sydowia in China polyspora 921 0 Sydowia polyspora strainMG098248.1 NW-FVA2201942 99 Submitted by Busskamp KC768096 et al. 2017,Sydowia isolated polyspora from a Pinus921 sylvestris twig0 in Germany Ascomycota sp. strainMG190569.1 A400 942 99 Submitted by Mueller JX981501 2017, isolatedSydowia from polyspora a Picea abies stump921 in Finland0 Ascomycota sp. strainMG190559.1 A386 942 99 Submitted by Mueller JX981459 2017, isolatedSydowia from a Picea abies stump921 in Finland0 OR.138 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,TAGAAAATTTAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTAACTCTACTCGCCCGAAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGCGACGGACCGTTCCCAATCCAAGCGATGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAAGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCTCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGACGACTGTTTAATACAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTCGGAGACCAGACGGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTCACC Dothideomycetidae,517 Sydowia Dothideales, polyspora strainMH855019.1 Dotheoriaceae CBS 116.29 966 100 submitted by Vu et LN714608al. 2017 Sydowia polyspora 944 0 Sydowia polyspora strainKY246318.1 QJ_303 966 100 Submitted by Pan 2016, JX981459 isolatedSydowia in China 944 0 Sydowia polyspora strainMG098248.1 NW-FVA2201966 100 Submitted by Busskamp EU700376 et al. 2017,Sydowia isolated from a Pinus944 sylvestris twig0 in Germany Ascomycota sp. strainMG190468.1 A186 966 100 Submitted by Mueller EU700375 2017, isolatedSydowia from a Picea abies stump944 in Finland0 Sydowia polyspora genomicLN714608.1 DNA sequence966 contains100 18S rRNASubmitted gene, ITS1,by Zelenka 5.8S DQ317340 rRNA 2014, gene, isolatedDothioraceae ITS2, in 28S the rRNA Czech gene, Republic isolate944 B3C 0 OR.173 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,TTTAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTAACTCTACTACGCCCGAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGCGACGGACCGTTCCCAATACCAAGCATGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTTAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGACGACTGGTTTAATAAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTCGGAGACCGAGACGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTCAC Dothideomycetidae,509 Sydowia Dothideales, polyspora strainMH855019.1 Dotheoriaceae CBS 116.29 952 100 submitted by Vu et LN714608 al. 2017 Sydowia polyspora 930 0 Sydowia polyspora strainKY246318.1 QJ_303 952 100 Submitted by Pan 2016, KY081694 isolatedSydowia in China polyspora 930 0 Sydowia polyspora strainMG098248.1 NW-FVA2201952 100 Submitted by Busskamp KC768096 et al. 2017,Sydowia isolated polyspora from a Pinus930 sylvestris twig0 in Germany Ascomycota sp. strainMG190569.1 A400 952 100 Submitted by Mueller JX981501 2017, isolatedSydowia from polyspora a Picea abies stump930 in Finland0 Ascomycota sp. strainMG190559.1 A386 952 100 Submitted by Mueller JX981459 2017, isolated Sydowia from a Picea abies stump930 in Finland0 OR.176 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,CAACCTAGAAAATTTAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTAACTTACTACGCCCGAAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGCGACGGACCGTTCCAATACCAAGCGATGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGAGACTGGTTTAATACAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTCGAGACCGAGACGGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTCACCTACAGAAACCTTGTTACGA Dothideomycetidae,541 Sydowia Dothideales, polyspora strain KY246318.1Dotheoriaceae QJ_303 1005 99 Submitted by Pan 2016, JX981459 isolated Sydowia in China 982 0 Rhizosphaera kalkhoffiiJX981459.1 strain WA00000191421005 99 Submitted by Pawlowska AM901950 and Wrzosek Ascomycota 2012, isolated from982 plant tissue in0 Poland Uncultured ascomyceteAM901950.1 clone BF-OTU3381005 99 Submitted by Pitkaranta EU700376 2007, isolatedSydowia from house dust980 in Finland 0 Rhizosphaera kalkhoffiiEU700375.1 strain CBS 280.381003 99 Submitted by Park andEU700375 Jung 2008 Sydowia 980 0 Sydowia polyspora strainMH855019.1 CBS 116.29 1000 99 submitted by Vu et KF752689al. 2017 Fungi 978 0 Sydowia polyspora strainKY246330.1 LJYS_338 1000 99 Submitted by Pan 2016, JX136304 isolated Fungi from Pinus yunnanensis978 in China 0 OR.177 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,AGGTCACCTAGAAATTTAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTACTCTACTACGCCCGAAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGCGACGGACCGTCCCAATACCAAGCGATGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGAGACTGGTTTAATACAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTCGAGACCGAGACGGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTC Dothideomycetidae,521 Sydowia Dothideales, polyspora strain HG008754.1Dotheoriaceae F0210-49U4974 100 submitted by Martin-Sanchez KC768096 2013,Sydowia isolated polyspora from air in France951 0 Sydowia polyspora isolateKC768096.1 HO1 974 100 Submitted by Davydenko JX421703 et al 2013,Sydowia isolated polyspora from Hylurgus951 ligniperda tissue0 in Ukraine Sydowia polyspora strainJX421703.1 ASR_H12_3A974 100 Submitted by Sanz etHG008754 al. 2012, isolatedSydowia from polyspora Pinus sylvestris951 tissue in Spain0 Sydowia polyspora strainJX421717.1 ASR_H47_16A972 100 Submitted by Sanz et JX981501 al. 2012, isolatedSydowia from polyspora Pinus sylvestris949 tissue in Spain0 Rhizosphaera kalkhoffiiJQ353722.1 voucher HMBF-CHN2968 99 Submitted by You et JX421717 al. 2012, isolatedSydowia in Chinapolyspora 949 0 OR.195 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,AGGTCACCTAGAAAATTTAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTACTCTACTACGCCCGAAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGCGACGGACCTTCCCAATACCAAGCGATGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAACGACTGGTTTAATACAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTGGAGACCGAGACGGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTCACCTACAGAAACCTTGTTA Dothideomycetidae,541 Sydowia Dothideales, polyspora strainMH855019.1 Dotheoriaceae CBS 116.29 1000 99 submitted by Vu et JX981459al. 2017 Sydowia 976 0 Sydowia polyspora strainKY246318.1 QJ_303 1000 99 Submitted by Pan 2016, EU700376 isolatedSydowia in China 976 0 Rhizosphaera kalkhoffiiJX981459.1 strain WA00000191421000 99 Submitted by Pawlowska EU700375 and WrzosekSydowia 2012, isolated from976 plant tissue in0 Poland Rhizosphaera kalkhoffiiEU700375.1 strain CBS 280.381000 99 Submitted by Park andAM901950 Jung 2008Ascomycota 976 0 Uncultured ascomyceteAM901950.1 clone BF-OTU3381000 99 Submitted by Pitkaranta KC768096 2007, isolatedSydowia from polyspora house dust975 in Finland 0 Sydowia polyspora genomicHG008754.1 DNA containing998 ITS1, 5.8S99 rRNAsubmitted gene and by ITS2, Martin-Sanchez strain JX421703 F0210-49U4 2013,Sydowia isolated polyspora from air in France975 0 OR.197 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,GGTCAACCTAGAAATTTAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTACTCTACTACGCCCGAAGTTGNTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGNNACGGACCGTCCCAATACCAAGCGATGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCTTCTTCATCGATGCGAGAACCAAGAGATCCGNTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGCGACTGGNTTAATACAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTGGAGACCGAGACGGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCATGAAGAC Dothideomycetidae,490 Sydowia Dothideales, polyspora strainMH855019.1 Dotheoriaceae CBS 116.29 893 99 submitted by Vu et al.LN714608 2017 Sydowia polyspora 870 0 Sydowia polyspora strainKY246318.1 QJ_303 893 99 Submitted by Pan 2016, LN614489 isolated Rhizosphaera in China 870 0 Sydowia polyspora strainMG098248.1 NW-FVA2201893 99 Submitted by Busskamp KX147627 et al. 2017,Sydowia isolated from a Pinus870 sylvestris twig0 in Germany Sydowia sp. DTO 302-F4KX147627.1 893 99 Submitted by van Nieuwenhuijzen KX147626 Sydowia et al. 2016, isolated from870 exposed outdoors0 in Norway Sydowia sp. DTO 302-F3KX147626.1 893 99 Submitted by van Nieuwenhuijzen KX147625 Sydowia et al. 2016, isolated from870 exposed outdoors0 in Norway OR.199 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,TTAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTAACTCTACTACGCCCGAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGCGACGGACCGTTCCCAATACCAAGCGTGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTTAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGACGACTGGTTTAATAAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTCGGAGACCGAGACGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTCACC Dothideomycetidae,509 Sydowia Dothideales, polyspora strainMH855019.1 Dotheoriaceae CBS 116.29 952 100 submitted by Vu et al.LN714608 2017 Sydowia polyspora 930 0 Sydowia polyspora strainKY246318.1 QJ_303 952 100 Submitted by Pan 2016, KY081694 isolated Sydowia in China polyspora 930 0 Sydowia polyspora strainMG098248.1 NW-FVA2201952 100 Submitted by Busskamp KC768096 et al. 2017,Sydowia isolated polyspora from a Pinus930 sylvestris twig0 in Germany Ascomycota sp. strainMG190569.1 A400 952 100 Submitted by Mueller JX981501 2017, isolated Sydowia from polyspora a Picea abies stump930 in Finland0 Ascomycota sp. strainMG190559.1 A386 952 100 Submitted by Mueller JX981459 2017, isolated Sydowia from a Picea abies stump930 in Finland0
WA.3 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,TAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTAACTCTACTACGCCCGAAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGCGACGGACCGTTCCCAATACCAAGCGATGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGACGACTGGTTTAATACAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTCGGAGACCGAGACGGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTCACCT Dothideomycetidae,515 Sydowia Dothideales, polyspora strainMH855019.1 Dotheoriaceae CBS 116.29 952 100 submitted by Vu et LN714608al. 2017 Sydowia polyspora 930 0 Sydowia polyspora strainKY246318.1 QJ_303 952 100 Submitted by Pan 2016, KY081694 isolated Sydowia in China polyspora 930 0 Sydowia polyspora strainMG098248.1 NW-FVA2201952 100 Submitted by Busskamp KC768096 et al. 2017,Sydowia isolated polyspora from Pinus 930sylvestris twig in0 Germany Ascomycota sp. strainMG190569.1 A400 952 100 Submitted by Mueller JX981501 2017, isolated Sydowia from polyspora a Picea abies stump930 in Finland0 Ascomycota sp. strainMG190559.1 A386 952 100 Submitted by Mueller JX981459 2017, isolatedSydowia from a Picea abies stump930 in Finland0 WA.106 Sydowia sp. Ascomycota, Pezizomycotina, Dothideomycetes,CCTAGAAAATTTAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTAACTCTACTACGCCCGAAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGCGACGGACCGTTCCCAATACCAAGCGATGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGACGACTGGTTTAATACAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTCGGAGACCGAGACGGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACG Dothideomycetidae,543 Sydowia Dothideales, polyspora strain KY246318.1Dotheoriaceae QJ_303 1003 100 Submitted by Pan 2016, JX981459 isolated Sydowia in China 980 0 Rhizosphaera kalkhoffiiJX981459.1 strain WA00000191421003 100 Submitted by Pawlowska EU700376 and WrzosekSydowia 2012, isolated from980 plant tissue in0 Poland Rhizosphaera kalkhoffiiEU700375.1 strain CBS 280.381003 100 Submitted by Park and EU700375 Jung 2008Sydowia 980 0 Uncultured ascomyceteAM901950.1 clone BF-OTU3381003 100 Submitted by Pitkaranta AM901950 2007, isolatedAscomycota from house dust980 in Finland 0 Ascomycota sp. strainMG190468.1 A186 1002 100 Submitted by Mueller KM104064 2017, isolated Fungi from a Picea abies stump975 in Finland0 WA.108 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,CAACCTAGAAAATTTAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTAACTCTACTACGCCCGAAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGNNACGGACCGTTCCCAATACCAAGCGATGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGACGACTGGTTTAATACAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTCGGAGACCGAGACGGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACG Dothideomycetidae,546 Sydowia Dothideales, polyspora strain KY246318.1Dotheoriaceae QJ_303 1002 99 Submitted by Pan 2016, JX981459 isolated Sydowia in China 978 0 Rhizosphaera kalkhoffiiJX981459.1 strain WA00000191421002 99 Submitted by Pawlowska EU700376 and WrzosekSydowia 2012, isolated from978 plant tissue in0 Poland Rhizosphaera kalkhoffiiEU700375.1 strain CBS 280.381002 99 Submitted by Park andEU700375 Jung 2008 Sydowia 978 0 Uncultured ascomyceteAM901950.1 clone BF-OTU3381002 99 Submitted by Pitkaranta AM901950 2007, isolatedAscomycota from house dust978 in Finland 0 Sydowia polyspora strainMH855019.1 CBS 116.29 998 99 submitted by Vu et KF752689al. 2017 Fungi 973 0 Sydowia polyspora strainKY246330.1 LJYS_338 998 99 Submitted by Pan 2016, JX136304 isolatedFungi in China 973 0 WA.111 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,TTAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTAACTCTACTACGCCCGAAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGCGACGGACCGTTCCCAATACCAAGCGATGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGACGACTGGTTTAATACAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTCGGAGACCGAGACGGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTCACCTA Dothideomycetidae,517 Sydowia Dothideales, polyspora strainMH855019.1 Dotheoriaceae CBS 116.29 955 100 submitted by Vu et LN714608al. 2017 Sydowia polyspora 933 0 Sydowia polyspora strainKY246318.1 QJ_303 955 100 Submitted by Pan 2016, KY081694 isolatedSydowia in China polyspora 933 0 Sydowia polyspora strainMG098248.1 NW-FVA2201955 100 Submitted by Busskamp KC768096 et al. 2017,Sydowia isolated polyspora from Pinus 933sylvestris twig in0 Germany Ascomycota sp. strainMG190569.1 A400 955 100 Submitted by Mueller JX981501 2017, isolated Sydowia from polyspora a Picea abies stump933 in Finland0 Ascomycota sp. strainMG190559.1 A386 955 100 Submitted by Mueller JX981459 2017, isolated Sydowia from a Picea abies stump933 in Finland0 WA.113 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,AGGTCAACCTAGAAATTTAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTAACTCTACTACGCCCGAAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGCGACGGACCGTTCCCAATACCAAGCGATGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGACGACTGGTTTAATACAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTCGGAGACCGAGACGGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTAC Dothideomycetidae,548 Sydowia Dothideales, polyspora strain KY246318.1Dotheoriaceae QJ_303 1007 99 Submitted by Pan 2016,JX981459 isolated Sydowia in China 982 0 Rhizosphaera kalkhoffiiJX981459.1 strain WA00000191421007 99 Submitted by Pawlowska EU700376 and WrzosekSydowia 2012, isolated from982 plant tissue in0 Poland Rhizosphaera kalkhoffiiEU700375.1 strain CBS 280.381007 99 Submitted by Park and EU700375 Jung 2008Sydowia 982 0 Uncultured ascomyceteAM901950.1 clone BF-OTU3381007 99 Submitted by Pitkaranta AM901950 2007, isolatedAscomycota from house dust982 in Finland 0 Sydowia polyspora strainMH855019.1 CBS 116.29 1005 99 submitted by Vu et al.KC768096 2017 Sydowia polyspora 980 0 Sydowia polyspora strainHG008754.1 F0210-49U41005 99 Submitted by Martin-Sanchez JX421703 2013,Sydowia isolated polyspora from air in 980France 0 WA.115 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,TTAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTAACTCTACTACGCCCGAAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGCGACGGACCGTTCCCAATACCAAGCGATGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGACGACTGGTTTAATACAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTCGGAGACCGAGACGGTCCCGCCNAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTCACCTACAAGAAACCTTGTTA Dothideomycetidae,532 Sydowia Dothideales, polyspora strainMH855019.1 Dotheoriaceae CBS 116.29 966 99 submitted by Vu et KY081694al. 2017 Sydowia polyspora 944 0 Sydowia polyspora strainKY246318.1 QJ_303 966 99 Submitted by Pan 2016, KC768096 isolated Sydowia in China polyspora 944 0 Ascomycota sp. strainMG190507.1 A272 966 99 Submitted by Mueller JX981501 2017, isolatedSydowia from polyspora a Picea abies stump944 in Finland0 Ascomycota sp. strainMG190468.1 A186 966 99 Submitted by Mueller JX981459 2017, isolatedSydowia from a Picea abies stump944 in Finland0 Sydowia polyspora isolateKY081694.1 JM_TPM002966 99 Submitted by Munoz-Adalia JX421717 et al.Sydowia 2016 polyspora 944 0 WA.121 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,CAACCTAGAAAATTTAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTAACTCTACTACGCCCGAAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGCGACGGACCGTTCCCAATACCAAGCGATGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGACGACTGGTTTAATACAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTCGGAGACCGAGACGGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTCACCTACAGAAACCTTGTTACG Dothideomycetidae,546 Sydowia Dothideales, polyspora strain KY246318.1Dotheoriaceae QJ_303 1003 99 Submitted by Pan 2016, JX981459 isolated Sydowia in China 980 0 Rhizosphaera kalkhoffiiJX981459.1 strain WA00000191421003 99 Submitted by Pawlowska EU700376 and Wrzosek Sydowia 2012, isolated from980 plant tissue in0 Poland Rhizosphaera kalkhoffiiEU700375.1 strain CBS 280.381003 99 Submitted by Park andEU700375 Jung 2008 Sydowia 980 0 Uncultured ascomyceteAM901950.1 clone BF-OTU3381003 99 Submitted by Pitkaranta AM901950 2007, isolatedAscomycota from house dust980 in Finland 0 Sydowia polyspora strainMH855019.1 CBS 116.29 1000 99 submitted by Vu et KF752689al. 2017 Fungi 976 0 Sydowia polyspora strainKY246330.1 LJYS_338 998 99 Submitted by Pan 2016, JX136304 isolated Fungi in China 976 0 WA.122 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,CCGAGGTCAACCTAGAAAATTTAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTAACTCTACTACGCCCGAAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGCGACGGACCGTTCCCAATACCAAGCGATGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGACGACTGGTTTAATACAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTCGGAGACCGAGACGGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTAC Dothideomycetidae,552 Sydowia Dothideales, polyspora strain KY246318.1Dotheoriaceae QJ_303 1020 100 Submitted by Pan 2016, JX981459 isolated Sydowia in China 996 0 Rhizosphaera kalkhoffiiJX981459.1 strain WA00000191421020 100 Submitted by Pawlowska EU700376 and WrzosekSydowia 2012, isolated from996 plant tissue in0 Poland Rhizosphaera kalkhoffiiEU700375.1 strain CBS 280.381020 100 Submitted by Park andEU700375 Jung 2008 Sydowia 996 0 Uncultured ascomyceteAM901950.1 clone BF-OTU3381020 100 Submitted by Pitkaranta AM901950 2007, isolatedAscomycota from house dust996 in Finland 0 Sydowia polyspora strainMH855019.1 CBS 116.29 1018 100 submitted by Vu et al.KF752689 2017 Fungi 991 0 Sydowia polyspora strainKY246330.1 LJYS_338 1014 99 Submitted by Pan 2016, JX136304 isolated Fungi in China 991 0 WA.123 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,TAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTAACTCTACTACGCCCGAAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGCNACGGACCGTTCCCAATACCAAGCGATGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGACGACTGGTTTAATACAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTCGGAGACCGAGACGGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTAC Dothideomycetidae,531 Sydowia Dothideales, polyspora strain KY246318.1Dotheoriaceae QJ_303 997 99 Submitted by Pan 2016, KY081694 isolated Sydowia in China polyspora 955 0 Ascomycota sp. strainMG190507.1 A272 997 99 Submitted by Mueller KC768096 2017, isolated Sydowia from polyspora a Picea abies stump955 in Finland0 Ascomycota sp. strainMG190468.1 A186 997 99 Submitted by Mueller JX981501 2017, isolatedSydowia from polyspora a Picea abies stump955 in Finland0 Sydowia polyspora isolateKY081694.1 JM_TPM002997 99 Submitted by Munoz-Adalia JX981459 et al.Sydowia 2016 955 0 Sydowia polyspora strainHG008754.1 F0210-49U4997 99 Submitted by Martin-Sanchez JX421717 2013,Sydowia isolated polyspora from air in 955France 0 WA.127 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,GGTCACCTAGAAAATTTAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTAACTCTACTACGCCCGAAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGCGACGGACCGTTCCCAATACCAAGCGATGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGACGACTGGTTTAATACAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTCGGAGACCGAGACGGTCCCGCCNAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTAC Dothideomycetidae,547 Sydowia Dothideales, polyspora strain KY246318.1Dotheoriaceae QJ_303 1002 99 Submitted by Pan 2016,JX981459 isolated Sydowia in China 976 0 Rhizosphaera kalkhoffiiJX981459.1 strain WA00000191421002 99 Submitted by Pawlowska EU700376 and Wrzosek Sydowia 2012, isolated from976 plant tissue in0 Poland Rhizosphaera kalkhoffiiEU700375.1 strain CBS 280.381002 99 Submitted by Park and EU700375 Jung 2008Sydowia 976 0 Uncultured ascomyceteAM901950.1 clone BF-OTU3381002 99 Submitted by Pitkaranta AM901950 2007, isolatedAscomycota from house dust976 in Finland 0 Sydowia polyspora strainMH855019.1 CBS 116.29 1000 99 submitted by Vu et KU195496al. 2017 Fungi 975 0 Ascomycota sp. strainMG190468.1 A186 1000 99 Submitted by Mueller KC768096 2017, isolated Sydowia from polyspora a Picea abies stump975 in Finland0 Sydowia polyspora strainHG008754.1 F0210-49U41000 99 Submitted by Martin-Sanchez JX981501 2013,Sydowia isolated polyspora from air in 975France 0 WA.129 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,TTAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTAACTCTACTACGCCCGAAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGCGACGGACCGTTCCCAATACCAAGCGATGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGACGACTGGTTTAATACAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTCGGAGACCGAGACGGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTC Dothideomycetidae,512 Sydowia Dothideales, polyspora strainMH855019.1 Dotheoriaceae CBS 116.29 946 100 submitted by Vu et LN714608al. 2017 Sydowia polyspora 924 0 Sydowia polyspora strainKY246318.1 QJ_303 946 100 Submitted by Pan 2016, KY081694 isolatedSydowia in China polyspora 924 0 Sydowia polyspora strainMG098248.1 NW-FVA2201946 100 Submitted by Busskamp KC768096 et al. 2017,Sydowia isolated polyspora from Pinus 924sylvestris twig in0 Germany Ascomycota sp. strainMG190569.1 A400 946 100 Submitted by Mueller JX981501 2017, isolated Sydowia from polyspora a Picea abies stump924 in Finland0 Ascomycota sp. strainMG190559.1 A386 946 100 Submitted by Mueller JX981459 2017, isolated Sydowia from a Picea abies stump924 in Finland0 WA.140 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,TTAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTAACTCTACTACGCCCGAAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGCGACGGACCGTTCCCAATACCAAGCGATGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGACGACTGGTTTAATACAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTCGGAGACCGAGACGGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTCACCTA Dothideomycetidae,517 Sydowia Dothideales, polyspora strainMH855019.1 Dotheoriaceae CBS 116.29 955 100 submitted by Vu et LN714608al. 2017 Sydowia polyspora 933 0 Sydowia polyspora strainKY246318.1 QJ_303 955 100 Submitted by Pan 2016, KY081694 isolated Sydowia in China polyspora 933 0 Sydowia polyspora strainMG098248.1 NW-FVA2201955 100 Submitted by Busskamp KC768096 et al. 2017,Sydowia isolated polyspora from Pinus 933sylvestris twig in0 Germany Ascomycota sp. strainMG190569.1 A400 955 100 Submitted by Mueller JX981501 2017, isolated Sydowia from polyspora a Picea abies stump933 in Finland0 Ascomycota sp. strainMG190559.1 A386 955 100 Submitted by Mueller JX981459 2017, isolatedSydowia from a Picea abies stump933 in Finland0 WA.142 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,AACCTAGAAAATTTAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTAACTCTACTACGCCCGAAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGCGACGGACCGTTCCCAATACCAAGCGATGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGACGACTGGTTTAATACAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTCGGAGACCGAGACGGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACG Dothideomycetidae,545 Sydowia Dothideales, polyspora strain KY246318.1Dotheoriaceae QJ_303 1007 100 Submitted by Pan 2016, JX981459 isolated Sydowia in China 984 0 Rhizosphaera kalkhoffiiJX981459.1 strain WA00000191421007 100 Submitted by Pawlowska EU700376 and WrzosekSydowia 2012, isolated from984 plant tissue in0 Poland Rhizosphaera kalkhoffiiEU700375.1 strain CBS 280.381007 100 Submitted by Park and EU700375 Jung 2008Sydowia 984 0 Uncultured ascomyceteAM901950.1 clone BF-OTU3381007 100 Submitted by Pitkaranta AM901950 2007, isolatedAscomycota from house dust984 in Finland 0 Sydowia polyspora strainMH855019.1 CBS 116.29 1003 100 submitted by Vu et KF752689al. 2017 Fungi 978 0 Ascomycota sp. strainMG190468.1 A186 1003 100 Submitted by Mueller JX136304 2017, isolated Fungi from a Picea abies stump978 in Finland0 Sydowia polyspora strainKY246330.1 LJYS_338 1002 99 Submitted by Pan 2016, KU516595 isolatedSydowia in China polyspora 975 0 WA.144 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,AGGTCAACCTAGAAAATTTAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTAACTCTACTACGCCCGAAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGCGACGGACCGTTCCCAATACCAAGCGATGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGACGACTGGTTTAATACAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTCGGAGACCGAGACGGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAGAGGNTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACG Dothideomycetidae,550 Sydowia Dothideales, polyspora strain KY246318.1Dotheoriaceae QJ_303 1013 99 Submitted by Pan 2016,JX981459 isolated Sydowia in China 989 0 Rhizosphaera kalkhoffiiJX981459.1 strain WA00000191421013 99 Submitted by Pawlowska EU700376 and WrzosekSydowia 2012, isolated from989 plant tissue in0 Poland Rhizosphaera kalkhoffiiEU700375.1 strain CBS 280.381013 99 Submitted by Park andEU700375 Jung 2008 Sydowia 989 0 Uncultured ascomyceteAM901950.1 clone BF-OTU3381013 99 Submitted by Pitkaranta AM901950 2007, isolatedAscomycota from house dust989 in Finland 0 Sydowia polyspora strainMH855019.1 CBS 116.29 1009 99 submitted by Vu et KF752689al. 2017 Fungi 984 0 Sydowia polyspora strainKY246330.1 LJYS_338 1007 99 Submitted by Pan 2016, JX136304 isolated Fungi in China 984 0 WA.145 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,CAACCTAGAAAATTTAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTAACTCTACTACGCCCGAAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGCGACGGACCGTTCCCAATACCAAGCGATGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGACGACTGGTTTAATACAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTCGGAGACCGAGACGGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTCACC Dothideomycetidae,528 Sydowia Dothideales, polyspora strainMH855019.1 Dotheoriaceae CBS 116.29 976 100 submitted by Vu et al.LN714608 2017 Sydowia polyspora 953 0 Sydowia polyspora strainKY246318.1 QJ_303 976 100 Submitted by Pan 2016, JX981459 isolated Sydowia in China 953 0 Sydowia polyspora strainMG098248.1 NW-FVA2201976 100 Submitted by Busskamp EU700376 et al. 2017,Sydowia isolated from Pinus 953sylvestris twig in0 Germany Sydowia polyspora isolateLN714608.1 B3C 976 100 Submitted by Zelenka EU700375 2014, isolatedSydowia in the Czech Republic953 0 Rhizosphaera kalkhoffiiJX981459.1 strain WA0000019142976 100 Submitted by Pawlowska DQ317340 and WrzosekDothioraceae 2012, isolated from953 plant tissue in0 Poland WA.147 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,CCGAGGTCACCTAGAAAATTTAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTAACTCTACTACGCCCGAAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGCGACGGACCGTTCCCAATACCAAGCGATGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGACGACTGGTTTAATACAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTCGGAGACCGAGACGGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTCACCTA Dothideomycetidae,536 Sydowia Dothideales, polyspora strainMH855019.1 Dotheoriaceae CBS 116.29 985 99 submitted by Vu et KU195496al. 2017 Fungi 962 0 Sydowia polyspora strainKY246318.1 QJ_303 985 99 Submitted by Pan 2016, LN714608 isolated Sydowia in China polyspora 960 0 Sydowia polyspora strainMG098248.1 NW-FVA2201985 99 Submitted by Busskamp JX981459 et al. 2017,Sydowia isolated from Pinus 960sylvestris twig in0 Germany Uncultured fungus cloneKU195496.1 Derema_II_024985 99 Submitted by Fransson EU700376 et al. 2015, Sydowia isolated from Allanblackia960 stuhlmannii0 roots in Tanzania Sydowia polyspora isolateLN714608.1 B3C 985 99 Submitted by Zelenka EU700375 2014, isolated Sydowia in the Czech Republic960 0 WA.150 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,AGGTCAACCTAGAAATTTAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTAACTCTACTACGCCCGAAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGCGACGGACCGTTCCCAATACCAAGCGATGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGACGACTGGTTTAATACAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTCGGAGACCGAGACGGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTCACCTAC Dothideomycetidae,534 Sydowia Dothideales, polyspora strainMH855019.1 Dotheoriaceae CBS 116.29 981 99 submitted by Vu et LN714608al. 2017 Sydowia polyspora 957 0 Sydowia polyspora strainKY246318.1 QJ_303 981 99 Submitted by Pan 2016, JX981459 isolated Sydowia in China 957 0 Sydowia polyspora strainMG098248.1 NW-FVA2201981 99 Submitted by Busskamp EU700376 et al. 2017,Sydowia isolated from Pinus 957sylvestris twig in0 Germany Sydowia polyspora isolate LN714608.1 B3C 981 99 Submitted by Zelenka EU700375 2014, isolated Sydowia in the Czech Republic957 0 Rhizosphaera kalkhoffiiJX981459.1 strain WA0000019142981 99 Submitted by Pawlowska AM901950 and Wrzosek Ascomycota 2012, isolated from957 plant tissue in0 Poland WA.151 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,CAACCTAGAAAATTTAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTAACTCTACTACGCCCGAAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGCGACGGACCGTTCCCAATACCAAGCGATGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGACGACTGGTTTAATACAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTCGGAGACCGAGACGGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTC Dothideomycetidae,525 Sydowia Dothideales, polyspora strainMH855019.1 Dotheoriaceae CBS 116.29 970 100 submitted by Vu et LN714608al. 2017 Sydowia polyspora 948 0 Sydowia polyspora strainKY246318.1 QJ_303 970 100 Submitted by Pan 2016, JX981459 isolated Sydowia in China 948 0 Sydowia polyspora strainMG098248.1 NW-FVA2201970 100 Submitted by Busskamp FJ235953 et al. 2017,Fungi isolated from Pinus 948sylvestris twig in0 Germany Sydowia polyspora isolate LN714608.1 B3C 970 100 Submitted by Zelenka EU700376 2014, isolatedSydowia in the Czech Republic948 0 Rhizosphaera kalkhoffiiJX981459.1 strain WA0000019142970 100 Submitted by Pawlowska EU700375 and WrzosekSydowia 2012, isolated from948 plant tissue in0 Poland WA.152 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,AGGTCAACCTAGAAAATTTAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTAACTCTACTACGCCCGAAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGCGACGGACCGTTCCCAATACCAAGCGATGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGACGACTGGTTTAATACAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTCGGAGACCGAGACGGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTCACCTACAGAAACCTTGTTACG Dothideomycetidae,550 Sydowia Dothideales, polyspora strain KY246318.1Dotheoriaceae QJ_303 1011 99 Submitted by Pan 2016,JX981459 isolated Sydowia in China 987 0 Rhizosphaera kalkhoffiiJX981459.1 strain WA00000191421011 99 Submitted by Pawlowska EU700376 and WrzosekSydowia 2012, isolated from987 plant tissue in0 Poland Rhizosphaera kalkhoffiiEU700375.1 strain CBS 280.381011 99 Submitted by Park andEU700375 Jung 2008 Sydowia 987 0 Uncultured ascomyceteAM901950.1 clone BF-OTU3381011 99 Submitted by Pitkaranta AM901950 2007, isolatedAscomycota from house dust987 in Finland 0 Sydowia polyspora strainMH855019.1 CBS 116.29 1007 99 submitted by Vu et KF752689al. 2017 Fungi 984 0 Sydowia polyspora strainKY246330.1 LJYS_338 1005 99 Submitted by Pan 2016, JX136304 isolated Fungi in China 984 0 WA.153 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,CCTAGAAAATTTAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTAACTCTACTACGCCCGAAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGCGACGGACCGTTCCCAATACCAAGCGATGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGACGACTGGTTTAATACAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTCGGAGACCGAGACGGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTA Dothideomycetidae,541 Sydowia Dothideales, polyspora strainMH855019.1 Dotheoriaceae CBS 116.29 970 100 submitted by Vu et JX981459al. 2017 Sydowia 976 0 Sydowia polyspora strainKY246318.1 QJ_303 970 100 Submitted by Pan 2016, EU700376 isolated Sydowia in China 976 0 Sydowia polyspora strainMG098248.1 NW-FVA2201970 100 Submitted by Busskamp EU700375 et al. 2017,Sydowia isolated from Pinus 976sylvestris twig in0 Germany Sydowia polyspora isolateLN714608.1 B3C 970 100 Submitted by Zelenka AM901950 2014, isolated Ascomycota in the Czech Republic976 0 Rhizosphaera kalkhoffiiJX981459.1 strain WA0000019142970 100 Submitted by Pawlowska KM104064 and Wrzosek Fungi 2012, isolated from971 plant tissue in0 Poland WA.157 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,AGGTCACCTAGAAAATTTAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTAACTCTACTACGCCCGAAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGCGACGGACCGTTCCCAATACCAAGCGATGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGACGACTGGTTTAATACAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTCGGAGACCGAGACGGTCCCGCCNAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTCACCTA Dothideomycetidae,533 Sydowia Dothideales, polyspora strainMH855019.1 Dotheoriaceae CBS 116.29 976 99 submitted by Vu et KU195496 al. 2017 Fungi 953 0 Sydowia polyspora strainKY246318.1 QJ_303 976 99 Submitted by Pan 2016, LN714608 isolated Sydowia in China polyspora 951 0 Sydowia polyspora strainMG098248.1 NW-FVA2201976 99 Submitted by Busskamp JX981459 et al. 2017,Sydowia isolated from Pinus 951sylvestris twig in0 Germany Uncultured fungus cloneKU195496.1 Derema_II_024976 99 Submitted by Fransson EU700376 et al. 2015, Sydowia isolated from Allanblackia951 stuhlmannii0 roots in Tanzania Sydowia polyspora isolate LN714608.1 B3C 976 99 Submitted by Zelenka EU700375 2014, isolated Sydowia in the Czech Republic951 0 WA.162 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,TTAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTAACTCTACTACGCCCGAAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGCGACGGACCGTTCCCAATACCAAGCGATGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGACGACTGGTTTAATACAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTCGGAGACCGAGACGGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTCAC Dothideomycetidae,514 Sydowia Dothideales, polyspora strainMH855019.1 Dotheoriaceae CBS 116.29 950 100 submitted by Vu et LN714608 al. 2017 Sydowia polyspora 928 0 Sydowia polyspora strainKY246318.1 QJ_303 950 100 Submitted by Pan 2016, KY081694 isolatedSydowia in China polyspora 928 0 Sydowia polyspora strainMG098248.1 NW-FVA2201950 100 Submitted by Busskamp KC768096 et al. 2017,Sydowia isolated polyspora from Pinus 928sylvestris twig in0 Germany Ascomycota sp. strainMG190569.1 A400 950 100 Submitted by Mueller JX981501 2017, isolated Sydowia from polyspora a Picea abies stump928 in Finland0 Ascomycota sp. strainMG190559.1 A386 950 100 Submitted by Mueller JX981459 2017, isolated Sydowia from a Picea abies stump928 in Finland0 WA.164 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,CAACCTAGAAAATTTAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTAACTCTACTACGCCCGAAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGCGACGGACCGTTCCCAATACCAAGCGATGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGACGACTGGTTTAATACAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTCGGAGACCGAGACGGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTCACC Dothideomycetidae,528 Sydowia Dothideales, polyspora strainMH855019.1 Dotheoriaceae CBS 116.29 976 100 submitted by Vu et LN714608al. 2017 Sydowia polyspora 953 0 Sydowia polyspora strainKY246318.1 QJ_303 976 100 Submitted by Pan 2016, JX981459 isolatedSydowia in China 953 0 Sydowia polyspora strainMG098248.1 NW-FVA2201976 100 Submitted by Busskamp EU700376 et al. 2017,Sydowia isolated from Pinus 953sylvestris twig in0 Germany Sydowia polyspora isolateLN714608.1 B3C 976 100 Submitted by Zelenka EU700375 2014, isolatedSydowia in the Czech Republic953 0 Rhizosphaera kalkhoffiiJX981459.1 strain WA0000019142976 100 Submitted by Pawlowska DQ317340 and WrzosekDothioraceae 2012, isolated from953 plant tissue in0 Poland WA.165 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,CCTAGAAAATTTAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTAACTCTACTACGCCCGAAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGCGACGGACCGTTCCCAATACCAAGCGATGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGACGACTGGTTTAATACAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTCGGAGACCGAGACGGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTA Dothideomycetidae,541 Sydowia Dothideales, polyspora strainMH855019.1 Dotheoriaceae CBS 116.29 1000 100 submitted by Vu et JX981459al. 2017 Sydowia 976 0 Sydowia polyspora strainKY246318.1 QJ_303 1000 100 Submitted by Pan 2016, EU700376 isolated Sydowia in China 976 0 Ascomycota sp. strainMG190468.1 A186 1000 100 Submitted by Mueller EU700375 2017, isolated Sydowia from a Picea abies stump976 in Finland0 Rhizosphaera kalkhoffiiJX981459.1 strain WA00000191421000 100 Submitted by Pawlowska AM901950 and Wrzosek Ascomycota 2012, isolated from976 plant tissue in0 Poland Rhizosphaera kalkhoffiiEU700375.1 strain CBS 280.381000 100 Submitted by Park KM104064and Jung 2008 Fungi 971 0 Uncultured ascomyceteAM901950.1 clone BF-OTU3381000 100 Submitted by Pitkaranta KF752689 2007, isolatedFungi from house dust971 in Finland 0 Sydowia polyspora strainKY246330.1 LJYS_338 994 99 Submitted by Pan 2016, JX136304 isolatedFungi in China 971 0 WA.166 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,TTAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTAACTCTACTACGCCCGAAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGCNACGGACCGTTCCCAATACCAAGCGATGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGACGACTGGTTTAATACAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTCGGAGACCGAGACGGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACG Dothideomycetidae,533 Sydowia Dothideales, polyspora strain KY246318.1Dotheoriaceae QJ_303 981 99 Submitted by Pan 2016, KY081694 isolated Sydowia in China polyspora 958 0 Sydowia polyspora isolateKY081694.1 JM_TPM002981 99 Submitted by Munoz-Adalia KC768096 et al.Sydowia 2016 polyspora 958 0 Sydowia polyspora strainHG008754.1 F0210-49U4981 99 Submitted by Martin-Sanchez JX981501 2013,Sydowia isolated polyspora from air in 958France 0 Rhizosphaera kalkhoffiiJX981459.1 strain WA0000019142981 99 Submitted by Pawlowska JX981459 and WrzosekSydowia 2012, isolated from958 plant tissue in0 Poland Sydowia polyspora isolateKC768096.1 HO1 981 99 Submitted by Davydenko JX421717 et al. 2013,Sydowia isolated polyspora from Hylurgus958 ligniperda in0 Ukraine WA.172 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,CAACCTAGAAAATTTAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTAACTCTACTACGCCCGAAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGCGACGGACCGTTCCCAATACCAAGCGATGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGACGACTGGTTTAATACAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTCGGAGACCGAGACGGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACG Dothideomycetidae,546 Sydowia Dothideales, polyspora strain KY246318.1Dotheoriaceae QJ_303 1009 100 Submitted by Pan 2016, JX981459 isolated Sydowia in China 985 0 Rhizosphaera kalkhoffiiJX981459.1 strain WA00000191421009 100 Submitted by Pawlowska EU700376 and Wrzosek Sydowia 2012, isolated from985 plant tissue in0 Poland Rhizosphaera kalkhoffiiEU700375.1 strain CBS 280.381009 100 Submitted by Park and EU700375 Jung 2008Sydowia 985 0 Uncultured ascomyceteAM901950.1 clone BF-OTU3381009 100 Submitted by Pitkaranta AM901950 2007, isolatedAscomycota from house dust985 in Finland 0 Sydowia polyspora strainMH855019.1 CBS 116.29 1005 100 submitted by Vu et al.KF752689 2017 Fungi 980 0 Sydowia polyspora strainKY246330.1 LJYS_338 1003 99 Submitted by Pan 2016, JX136304 isolatedFungi in China 980 0 WA.174 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,TTAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTAACTCTACTACGCCCGAAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGCGACGGACCGTTCCCAATACCAAGCGATGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGACGACTGGTTTAATACAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTCGGAGACCGAGACGGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTCACCTA Dothideomycetidae,517 Sydowia Dothideales, polyspora strainMH855019.1 Dotheoriaceae CBS 116.29 955 100 submitted by Vu et LN714608al. 2017 Sydowia polyspora 933 0 Sydowia polyspora strainKY246318.1 QJ_303 955 100 Submitted by Pan 2016, KY081694 isolatedSydowia in China polyspora 933 0 Sydowia polyspora strainMG098248.1 NW-FVA2201955 100 Submitted by Busskamp KC768096 et al. 2017,Sydowia isolated polyspora from Pinus 933sylvestris twig in0 Germany Ascomycota sp. strainMG190569.1 A400 955 100 Submitted by Mueller JX981501 2017, isolated Sydowia from polyspora a Picea abies stump933 in Finland0 Ascomycota sp. strainMG190559.1 A386 955 100 Submitted by Mueller JX981459 2017, isolatedSydowia from a Picea abies stump933 in Finland0 WA.175 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,CAACCTAGAAAATTTAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTAACTCTACTACGCCCGAAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGCGACGGACCGTTCCCAATACCAAGCGATGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGACGACTGGTTTAATACAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTCGGAGACCGAGACGGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTA Dothideomycetidae,544 Sydowia Dothideales, polyspora strainMH855019.1 Dotheoriaceae CBS 116.29 1005 100 submitted by Vu et JX981459al. 2017 Sydowia 982 0 Sydowia polyspora strainKY246318.1 QJ_303 1005 100 Submitted by Pan 2016, EU700376 isolated Sydowia in China 982 0 Rhizosphaera kalkhoffiiJX981459.1 strain WA00000191421005 100 Submitted by Pawlowska EU700375 and WrzosekSydowia 2012, isolated from982 plant tissue in0 Poland Rhizosphaera kalkhoffiiEU700375.1 strain CBS 280.381005 100 Submitted by Park AM901950and Jung 2008 Ascomycota 982 0 Uncultured ascomyceteAM901950.1 clone BF-OTU3381005 100 Submitted by Pitkaranta KF752689 2007, isolatedFungi from house dust976 in Finland 0 Ascomycota sp. strainMG190468.1 A186 1002 100 Submitted by Mueller JX136304 2017, isolatedFungi from a Picea abies stump976 in Finland0 Sydowia polyspora strainKY246330.1 LJYS_338 1000 99 Submitted by Pan 2016, DQ093678 isolatedSydowia in China polyspora 976 0 WA.179 Rhizosphaera kalkhoffii Ascomycota, Pezizomycotina, Dothideomycetes,CCTAGAAAATTTAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTAACTCTACTACGCCCGAAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGNNACGGACCGTTCCCAATACCAAGCGATGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGACGACTGGTTTAATACAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTCGGAGACCGAGACGGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACG Dothideomycetidae,543 Sydowia Dothideales, polyspora strain KY246318.1Dotheoriaceae QJ_303 996 99 Submitted by Pan 2016, JX981459 isolatedSydowia in China 973 0 Rhizosphaera kalkhoffiiJX981459.1 strain WA0000019142996 99 Submitted by Pawlowska EU700376 and WrzosekSydowia 2012, isolated from973 plant tissue in0 Poland Rhizosphaera kalkhoffiiEU700375.1 strain CBS 280.38996 99 Submitted by Park andEU700375 Jung 2008 Sydowia 973 0 Uncultured ascomyceteAM901950.1 clone BF-OTU338996 99 Submitted by Pitkaranta AM901950 2007, isolatedAscomycota from house dust973 in Finland 0 Ascomycota sp. strainMG190468.1 A186 996 99 Submitted by Mueller KM104064 2017, isolated Fungi from a Picea abies stump967 in Finland0 WA.182 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,GAGGTCACCTAGAAAATTTAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTAACTCTACTACGCCCGAAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGCGACGGACCGTTCCCAATACCAAGCGATGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGACGACTGGTTTAATACAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTCGGAGACCGAGACGGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACG Dothideomycetidae,550 Sydowia Dothideales, polyspora strain KY246318.1Dotheoriaceae QJ_303 1011 99 Submitted by Pan 2016,JX981459 isolated Sydowia in China 985 0 Rhizosphaera kalkhoffiiJX981459.1 strain WA00000191421011 99 Submitted by Pawlowska EU700376 and Wrzosek Sydowia 2012, isolated from985 plant tissue in0 Poland Rhizosphaera kalkhoffiiEU700375.1 strain CBS 280.381011 99 Submitted by Park andEU700375 Jung 2008 Sydowia 985 0 Uncultured ascomyceteAM901950.1 clone BF-OTU3381011 99 Submitted by Pitkaranta AM901950 2007, isolatedAscomycota from house dust985 in Finland 0 Sydowia polyspora strainHG008754.1 F0210-49U41009 99 Submitted by Martin-Sanchez KU195496 2013,Fungi isolated from air in 984France 0 Sydowia polyspora isolateKC768096.1 HO1 1009 99 Submitted by Davydenko KC768096 et al. 2013,Sydowia isolated polyspora from Hylurgus984 ligniperda in0 Ukraine WA.186 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,CCTAGAAAATTTAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTAACTCTACTACGCCCGAAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGCGACGGACCGTTCCCAATACCAAGCGATGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGACGACTGGTTTAATACAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTCGGAGACCGAGACGGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTCACCTA Dothideomycetidae,527 Sydowia Dothideales, polyspora strainMH855019.1 Dotheoriaceae CBS 116.29 974 100 submitted by Vu et LN714608al. 2017 Sydowia polyspora 951 0 Sydowia polyspora strainKY246318.1 QJ_303 974 100 Submitted by Pan 2016, JX981459 isolated Sydowia in China 951 0 Sydowia polyspora strainMG098248.1 NW-FVA2201974 100 Submitted by Busskamp EU700376 et al. 2017,Sydowia isolated from Pinus 951sylvestris twig in0 Germany Ascomycota sp. strainMG190468.1 A186 974 100 Submitted by Mueller EU700375 2017, isolated Sydowia from a Picea abies stump951 in Finland0 Sydowia polyspora isolateLN714608.1 B3C 974 100 Submitted by Zelenka AM901950 2014, isolated Ascomycota in the Czech Republic951 0 WA.191 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,AGGTCAACCTAGAAAATTTAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTAACTCTACTACGCCCGAAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGCGACGGACCGTTCCCAATACCAAGCGATGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGACGACTGGTTTAATACAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTCGGAGACCGAGACGGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACG Dothideomycetidae,550 Sydowia Dothideales, polyspora strain KY246318.1Dotheoriaceae QJ_303 1016 100 Submitted by Pan 2016, JX981459 isolated Sydowia in China 993 0 Rhizosphaera kalkhoffiiJX981459.1 strain WA00000191421016 100 Submitted by Pawlowska EU700376 and WrzosekSydowia 2012, isolated from993 plant tissue in0 Poland Rhizosphaera kalkhoffiiEU700375.1 strain CBS 280.381016 100 Submitted by Park and EU700375 Jung 2008Sydowia 993 0 Uncultured ascomyceteAM901950.1 clone BF-OTU3381016 100 Submitted by Pitkaranta AM901950 2007, isolatedAscomycota from house dust993 in Finland 0 Sydowia polyspora strainMH855019.1 CBS 116.29 1013 100 submitted by Vu et KF752689al. 2017 Fungi 987 0 Sydowia polyspora strainKY246330.1 LJYS_338 1011 99 Submitted by Pan 2016, JX136304 isolated Fungi in China 987 0 WA.197 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,CCTAGAAAATTTAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTAACTCTACTACGCCCGAAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGCGACGGACCGTTCCCAATACCAAGCGATGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGACGACTGGTTTAATACAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTCGGAGACCGAGACGGTCCCGCCNAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTCACCTAC Dothideomycetidae,528 Sydowia Dothideales, polyspora strainMH855019.1 Dotheoriaceae CBS 116.29 972 99 submitted by Vu et LN714608al. 2017 Sydowia polyspora 949 0 Sydowia polyspora strainKY246318.1 QJ_303 972 99 Submitted by Pan 2016, JX981459 isolated Sydowia in China 949 0 Sydowia polyspora strainMG098248.1 NW-FVA2201972 99 Submitted by Busskamp EU700376 et al. 2017,Sydowia isolated from Pinus 949sylvestris twig in0 Germany Ascomycota sp. strainMG190468.1 A186 972 99 Submitted by Mueller EU700375 2017, isolated Sydowia from a Picea abies stump949 in Finland0 Sydowia polyspora isolate LN714608.1 B3C 972 99 Submitted by Zelenka AM901950 2014, isolated Ascomycota in the Czech Republic949 0 WA.199 Sydowia polyspora Ascomycota, Pezizomycotina, Dothideomycetes,CCTAGAAAATTTAAAGGTTTAACGGCAATGAGATCCGACCAAGCTTATAAGACGTTCGATTTAACTCTACTACGCCCGAAGTTGGTTGAACCCCGCCGAGGTCTTCGAGGAAGGCCCGCCTTGCGACGGACCGTTCCCAATACCAAGCGATGCTTGAGTGGTGTAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTAATTTAATTAAAATTTTATACTCAGACGACTGGTTTAATACAAGAGTTTGGTTGGACTCTGGCGGGCGCTCACCAACCCGAGGGTTAGTGCGCTCGGAGACCGAGACGGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAGAGGGTTGGAGGTCGGGCCATGAAGACCCTATCTCTTTAATGATCCTTCCGCAGGTTCAC Dothideomycetidae,524 Sydowia Dothideales, polyspora strainMH855019.1 Dotheoriaceae CBS 116.29 968 100 submitted by Vu et LN714608al. 2017 Sydowia polyspora 946 0 Sydowia polyspora strainKY246318.1 QJ_303 968 100 Submitted by Pan 2016, JX981459 isolated Sydowia in China 946 0 Sydowia polyspora strainMG098248.1 NW-FVA2201968 100 Submitted by Busskamp FJ235953 et al. 2017,Fungi isolated from Pinus 946sylvestris twig in0 Germany Ascomycota sp. strainMG190468.1 A186 968 100 Submitted by Mueller EU700376 2017, isolatedSydowia from a Picea abies stump946 in Finland0 26013 Sydowia polyspora isolate LN714608.1 B3C 968 100 Submitted by Zelenka EU700375 2014, isolatedSydowia in the Czech Republic946 0 ave. seq length 530.877551