DOCSLIB.ORG

Original Article Role of RHOT1 on Migration and Proliferation of Pancreatic Cancer

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Original Article Role of RHOT1 on Migration and Proliferation of Pancreatic Cancer Am J Cancer Res 2015;5(4):1460-1470 www.ajcr.us /ISSN:2156-6976/ajcr0006366 Original Article Role of RHOT1 on migration and proliferation of pancreatic cancer Qingqing Li1*, Lei Yao2*, Youzhen Wei2, Shasha Geng1, Chengzhi He3, Hua Jiang1 Departments of 1Geriatrics, 2Research Center for Translational Medicine, Shanghai East Hospital, Tongji University School of Medicine, Shanghai 200120, China; 3Department of Gastroenterology, Institute of Digestive Diseases, Tongji Hospital Affiliated to Tongji University, Shanghai 200065, China. *Equal contributors. Received January 26, 2015; Accepted March 12, 2015; Epub March 15, 2015; Published April 1, 2015 Abstract: Pancreatic cancer (PC) is one of the most malignant tumors. Rho GTPases can affect several types of hu- man cancers, including PC. In this study, we investigated the role of Ras homolog family member T1 (RHOT1), a new member of Rho GTPases in PC. IHC results showed that RHOT1 was expressed significantly higher in PC tissues than paracancerous tissues (P<0.01) and SMAD family member 4 (SMAD4) was expressed lower in PC tissues (P<0.01). RHOT1 was widely expressed in PC cell lines analyzed by reverse transcription PCR (RT-PCR), real-time quantitative PCR (RT-qPCR) and western blotting (WB). SiRNA-RHOT1 significantly suppressed the proliferation and migration of SW1990 cells. Moreover, SMAD4 was identified as an effector of RHOT1. Our findings suggest that RHOT1 can regulate cell migration and proliferation by suppressing the expression of SMAD4 in PC, which may provide a novel sight to explore the mechanism and therapeutic strategy for PC. Keywords: RHOT1, SMAD4, proliferation, migration, pancreatic cancer Introduction and invasion ability of cancer cells [7]. The depletion of RhoB, another Rho family member, Pancreatic cancer (PC) is one of the most malig- may lead to a decrease in migration and inva- nant tumors and ranks as the fourth leading sion of prostate cancer cells [8]. In this study, cause of cancer-related deaths [1]. In 2011, a we focused on the Ras homolog family member total of 44,030 new PC cases and 37,660 T1 (RHOT1), also named mitochondrial Rho PC-related deaths occurred in the United States (MIRO-1), which is a new member of Rho [2]. Due to its late diag nosis, highly aggressive GTPases and was reported to be involved in behavior and ineffective treatments, the 5-year mitochondrial transport [9], lymphocyte migra- survival rate of PC is less than 5% [3]. Therefore, tion and polarity [10]. Furthermore, mutations more accurate and reliable biological markers in the sequestosome 1 (SQSTM1) gene of need to be identified to facilitate earlier detec- Paget’s disease were associated with gene tion and better drug targets. Furthermore, ther- expression of RHOT1 which may contribute to apeutic strategies should be developed for dis- the over activity of osteoclasts [11]. However, ease treatment. The key to attaining these the role of RHOT1 in cancer is still elusive. objectives is to understand the molecular mechanisms related to the pathogenesis of PC. In the current work, we attempt to shed light on the molecular mechanism of RHOT1 in PC. Multiple key genetic mutations and environ- First, the expression level of RHOT1 was con- mental factors contribute to tumor initiation firmed in PC tissues and PC cell lines. Then, and progression, some proteins including Ras RHOT1 down-regulation assay was performed homolog family (Rho) GTPases have been iden- to detect proliferation and migration in the PC tified as crucial players in the proliferation, cell line. Finally, SMAD family member 4 invasion and survival of various cancer cells (SMAD4) was identified as one of the main [4-6]. RhoA, a Rho family member, plays impor- effectors of RHOT1. Our study provides new tant roles in the morphology, migration speed insights into the role of RHOT1 in PC and sug- Role of RHOT1 in pancreatic cancer Table 1. Primers used for RT-PCR and RT-qPCR analyses utes. Afterwards, the sections were in- cubated with antibodies against RHOT1 Forward primer (5’-3’) Amplicon Gene Ta (°C)a (1:15) or SMAD4 (1:15) respectively Reverse primer (5’-3’) size (bp) overnight. The sections were washed RHOT1 F: GGGAGGAACCTCTTCTGGA 60 105 with TBST and incubated with peroxi- R: ATGAAGAAAGACGTGCGGAT dase-conjugated affinipure goat anti- GAPDH F: TGCACCACCAACTGCTTAGC 60 87 rabbit antibody for 1 hour. Finally, the R: GGCATGGACTGTGGTCATGAG sections were incubated with 3, 3’-di- SMAD4 F: GCTGCTGGAATTGGTGTTGATG 60 108 aminobenzidine (DAB) chromogen and R: AGGTGTTTCTTTGATGCTCTGTCT counterstained with hematoxylin (Sig- P53 F: TCAACAAGATGTTTTGCCAACTG 60 118 ma, USA). Stained sections were visual- R: ATGTGCTGTGACTGCTTGTAGATG ized and photographed using a Leica P16 F: CCCTCGTGCTGATGCTACTG 60 72 microscope (Leica Microsystems, Ger- many). The IHC scoring systems was R: CATCATGACCTGGTCTTCTAGGAA used as previously described [12]. Two Kras F: ACAGAAGTGGAGGATGCTTT 60 100 pathologists scored the sections in a R: TTTCACACAGCCAGGAGTCTT double-blind manner. aannealing temperature for PCR amplification. Cell culture Table 2. Sequence of oligonucleotides used in Human PC cell lines AsPC-1, BxPC-3, CFPAC-1, this study PANC-1 and SW1990 were purchased from the Oligonucleotides Sequence (5’-3’) Type Culture Collection of the Chinese Academy of Sciences, Shanghai, China. Cell lines Capan- siRNA1-RHOT1-S GCACUACUGAAUUAAAUCAdTdT 2 and JF305 were obtained from the Tumor siRNA1-RHOT1-AS UGAUUUAAUUCAGUAGUGCdTdT Marker Research Center, Beijing, China. AsPC- siRNA2-RHOT1-S CACGACUUAUUUAGAUGUAdTdT 1, BxPC-3, Capan-2, JF305 and SW1990 were siRNA2-RHOT1-AS UACAUCUAAAUAAGUCGUGdTdT all cultured in RPMI 1640 (GIBCO, USA). PANC-1 siRNA3-RHOT1-S CAACACUUUAUGGACAGCAdTdT and CFPAC-1 were cultivated in high glucose siRNA3-RHOT1-AS UGCUGUCCAUAAAGUGUUGdTdT DMEM (GIBCO, USA) and IMDM (GIBCO, USA), siRNA-NC-S UUCUCCGAACGUGUCACGUdTdT respectively. All media were supplemented with siRNA-NC-AS ACGUGACACGUUCGGAGAAdTdT 10% fetal bovine serum (GIBCO, USA), and 1% penicillin-streptomycin (GIBCO, USA). The cell lines were incubated at 37°C with 5% CO2 and gests RHOT1 may be a potential target for the sub-cultured when the cells reached 80%-90% diagnosis and treatment of PC. confluence. Otherwise, the media were repl- aced every 2 days. Materials and methods RNA extraction, reverse transcription PCR and Samples collection and immunohistochemistry quantitative PCR (IHC) All volunteers for this study were recruited with Total RNA from PC cells was extracted using informed consent. Moreover, this study was Trizol reagent (Invitrogen, USA) under RNase- approved by the committee on ethics of bio- free conditions, according to the manufactur- medicine research at Shanghai East Hospital, er’s instructions. All qualified RNA were reverse Tongji University. A total of 221 paraffin-embed- transcribed using the first strand cDNA synthe- ded pancreatic cancer tissues and paracancer- sis kit (CWBIO, CHINA). Reverse transcription ous tissues were selected from Shanghai Ea- PCR (RT-PCR) with Taq MasterMix (CWBIO, stern Hospital and Biobank Center of National CHINA) and real-time quantitative PCR (RT- Engineering Center for Biochip at Shanghai. For qPCR) with SYBR Green Master Mix (TOYOBO, IHC staining, the tissue sections were first JAPAN) assays were conducted to detect the dewaxed in xylene and then rehydrated with mRNA levels of target genes. All primers and graded alcohol solutions. Antigen retrieval was annealing temperatures are listed in Table 1. per formed by microwave heating the sections Glyceraldehyde-3-phosphate dehydrogenase in sodium citrate buffer (pH 6.0) for 10 min- (GAPDH) was used as the housekeeping gene. 1461 Am J Cancer Res 2015;5(4):1460-1470 Role of RHOT1 in pancreatic cancer Figure 1. The expression levels of RHOT1 in PC tissues. A. Characteristics of the 221 patients with PC. B. Samples paired T test was performed to analyze different expression of RHOT1 between cancer tissues and paracancerous tissues. **P<0.01, statistically significant. C. Immunohistochemical staining of RHOT1 in four patients. a, c, e and g showed the positive cytoplasmic expression of RHOT1 in cancer tissues; b, d, f and h showed the negative cyto- plasmic expression of RHOT1 in paracancerous tissues. All the four patients were in stage II. No. 1, 2, 4 patients are males, No.3 is female. Survival time of all these patients was less than 15 months after surgery. Each sample was performed in triplicate. Re- Small interfering RNA (siRNA) assay lative expression quantification analysis relied on the classical delta-delta-Ct method [13]. In order to choose the best effector, three can- didate siRNA pairs for human RHOT1 gene and Western blotting (WB) a negative control (NC) were designed and chemically synthesized by Biotend Biotech- Total protein from human PC cells was extract- nology Co., Ltd (Shanghai). All siRNA sequences ed, quantified, and subjected to 10% SDS-PAGE are shown in Table 2. SW1990 cells were trans- under denaturing conditions. The samples were fected with a candidate siRNA (final concentra- transferred to polyvinylidene fluoride mem- tion 50 nM) or a negative control using Lipo- branes (Millipore, USA). Membranes were blo- fectamine 2000 Transfection Reagent (Invi- cked for 1 h with TBS-T buffer (with 10% non-fat trogen, USA) according to the manufacturer’s dried milk). Afterwards, membranes were incu- instructions. Then, RT-qPCR and WB were used bated overnight at 4°C with primary antibodies to analyze the knock-down efficiency at various against RHOT1 (1:1000), β-actin (1:2000), or time points. SMAD4 (1:500). Then, membranes were washed 3 times with PBS-T buffer, followed by Cell proliferation and migration assays incubation in goat anti-rabbit secondary anti- body conjugated with horseradish peroxidase To assess the role of RHOT1 in cell prolifera- (1:5000; Life Science, USA) for 1 h at room tem- tion, SW1990 cells were plated in 96-well pla- perature. After washing with PBS-T 3 times, tes at a density of 1×105 cells in each well and immunoreactive proteins were detected using silenced with siRNAs. The number of cells was an eECL Western Blot kit (CWBIO, CHINA).
Load more

Recommended publications
  • Primate Specific Retrotransposons, Svas, in the Evolution of Networks That Alter Brain Function
    Title: Primate specific retrotransposons, SVAs, in the evolution of networks that alter brain function. Olga Vasieva1*, Sultan Cetiner1, Abigail Savage2, Gerald G. Schumann3, Vivien J Bubb2, John P Quinn2*, 1 Institute of Integrative Biology, University of Liverpool, Liverpool, L69 7ZB, U.K 2 Department of Molecular and Clinical Pharmacology, Institute of Translational Medicine, The University of Liverpool, Liverpool L69 3BX, UK 3 Division of Medical Biotechnology, Paul-Ehrlich-Institut, Langen, D-63225 Germany *. Corresponding author Olga Vasieva: Institute of Integrative Biology, Department of Comparative genomics, University of Liverpool, Liverpool, L69 7ZB, [email protected] ; Tel: (+44) 151 795 4456; FAX:(+44) 151 795 4406 John Quinn: Department of Molecular and Clinical Pharmacology, Institute of Translational Medicine, The University of Liverpool, Liverpool L69 3BX, UK, [email protected]; Tel: (+44) 151 794 5498. Key words: SVA, trans-mobilisation, behaviour, brain, evolution, psychiatric disorders 1 Abstract The hominid-specific non-LTR retrotransposon termed SINE–VNTR–Alu (SVA) is the youngest of the transposable elements in the human genome. The propagation of the most ancient SVA type A took place about 13.5 Myrs ago, and the youngest SVA types appeared in the human genome after the chimpanzee divergence. Functional enrichment analysis of genes associated with SVA insertions demonstrated their strong link to multiple ontological categories attributed to brain function and the disorders. SVA types that expanded their presence in the human genome at different stages of hominoid life history were also associated with progressively evolving behavioural features that indicated a potential impact of SVA propagation on a cognitive ability of a modern human.
    [Show full text]
  • Genetic and Genomic Analysis of Hyperlipidemia, Obesity and Diabetes Using (C57BL/6J × TALLYHO/Jngj) F2 Mice
    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Nutrition Publications and Other Works Nutrition 12-19-2010 Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P. Stewart Marshall University Hyoung Y. Kim University of Tennessee - Knoxville, [email protected] Arnold M. Saxton University of Tennessee - Knoxville, [email protected] Jung H. Kim Marshall University Follow this and additional works at: https://trace.tennessee.edu/utk_nutrpubs Part of the Animal Sciences Commons, and the Nutrition Commons Recommended Citation BMC Genomics 2010, 11:713 doi:10.1186/1471-2164-11-713 This Article is brought to you for free and open access by the Nutrition at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Nutrition Publications and Other Works by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. Stewart et al. BMC Genomics 2010, 11:713 http://www.biomedcentral.com/1471-2164/11/713 RESEARCH ARTICLE Open Access Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P Stewart1, Hyoung Yon Kim2, Arnold M Saxton3, Jung Han Kim1* Abstract Background: Type 2 diabetes (T2D) is the most common form of diabetes in humans and is closely associated with dyslipidemia and obesity that magnifies the mortality and morbidity related to T2D. The genetic contribution to human T2D and related metabolic disorders is evident, and mostly follows polygenic inheritance. The TALLYHO/ JngJ (TH) mice are a polygenic model for T2D characterized by obesity, hyperinsulinemia, impaired glucose uptake and tolerance, hyperlipidemia, and hyperglycemia.
    [Show full text]
  • Discovery of Genes by Phylocsf Supplemental
    Supplemental Materials for Discovery of high-confidence human protein-coding genes and exons by whole-genome PhyloCSF helps elucidate 118 GWAS loci Supplemental Methods ....................................................................................................................... 2 Supplemental annotation methods ........................................................................................................... 2 Manual annotation overview ...................................................................................................................................... 2 Summary diagram for the workflow used in this study ................................................................................. 3 Transcriptomics analysis ............................................................................................................................................. 3 Comparative annotation ............................................................................................................................................... 4 Overlap of novel annotations with transposon sequences ........................................................................... 6 Assessing the novelty of annotations ...................................................................................................................... 7 Additional considerations for the annotation of PCCRs in other species ............................................... 7 PhyloCSF and browser tracks ....................................................................................................................
    [Show full text]
  • Role and Mechanisms of Mitophagy in Liver Diseases
    cells Review Role and Mechanisms of Mitophagy in Liver Diseases Xiaowen Ma 1, Tara McKeen 1, Jianhua Zhang 2 and Wen-Xing Ding 1,* 1 Department of Pharmacology, Toxicology and Therapeutics, University of Kansas Medical Center, 3901 Rainbow Blvd., Kansas City, KS 66160, USA; [email protected] (X.M.); [email protected] (T.M.) 2 Department of Pathology, Division of Molecular Cellular Pathology, University of Alabama at Birmingham, 901 19th street South, Birmingham, AL 35294, USA; [email protected] * Correspondence: [email protected]; Tel.: +1-913-588-9813 Received: 13 February 2020; Accepted: 28 March 2020; Published: 31 March 2020 Abstract: The mitochondrion is an organelle that plays a vital role in the regulation of hepatic cellular redox, lipid metabolism, and cell death. Mitochondrial dysfunction is associated with both acute and chronic liver diseases with emerging evidence indicating that mitophagy, a selective form of autophagy for damaged/excessive mitochondria, plays a key role in the liver’s physiology and pathophysiology. This review will focus on mitochondrial dynamics, mitophagy regulation, and their roles in various liver diseases (alcoholic liver disease, non-alcoholic fatty liver disease, drug-induced liver injury, hepatic ischemia-reperfusion injury, viral hepatitis, and cancer) with the hope that a better understanding of the molecular events and signaling pathways in mitophagy regulation will help identify promising targets for the future treatment of liver diseases. Keywords: alcohol; autophagy; mitochondria; NAFLD; Parkin; Pink1 1. Introduction Autophagy (or macroautophagy) involves the formation of a double membrane structure called an autophagosome. Autophagosomes bring the enveloped cargoes to the lysosomes to form autolysosomes where the lysosomal enzymes consequently degrade the cargos [1,2].
    [Show full text]
  • A High-Throughput Approach to Uncover Novel Roles of APOBEC2, a Functional Orphan of the AID/APOBEC Family
    Rockefeller University Digital Commons @ RU Student Theses and Dissertations 2018 A High-Throughput Approach to Uncover Novel Roles of APOBEC2, a Functional Orphan of the AID/APOBEC Family Linda Molla Follow this and additional works at: https://digitalcommons.rockefeller.edu/ student_theses_and_dissertations Part of the Life Sciences Commons A HIGH-THROUGHPUT APPROACH TO UNCOVER NOVEL ROLES OF APOBEC2, A FUNCTIONAL ORPHAN OF THE AID/APOBEC FAMILY A Thesis Presented to the Faculty of The Rockefeller University in Partial Fulfillment of the Requirements for the degree of Doctor of Philosophy by Linda Molla June 2018 © Copyright by Linda Molla 2018 A HIGH-THROUGHPUT APPROACH TO UNCOVER NOVEL ROLES OF APOBEC2, A FUNCTIONAL ORPHAN OF THE AID/APOBEC FAMILY Linda Molla, Ph.D. The Rockefeller University 2018 APOBEC2 is a member of the AID/APOBEC cytidine deaminase family of proteins. Unlike most of AID/APOBEC, however, APOBEC2’s function remains elusive. Previous research has implicated APOBEC2 in diverse organisms and cellular processes such as muscle biology (in Mus musculus), regeneration (in Danio rerio), and development (in Xenopus laevis). APOBEC2 has also been implicated in cancer. However the enzymatic activity, substrate or physiological target(s) of APOBEC2 are unknown. For this thesis, I have combined Next Generation Sequencing (NGS) techniques with state-of-the-art molecular biology to determine the physiological targets of APOBEC2. Using a cell culture muscle differentiation system, and RNA sequencing (RNA-Seq) by polyA capture, I demonstrated that unlike the AID/APOBEC family member APOBEC1, APOBEC2 is not an RNA editor. Using the same system combined with enhanced Reduced Representation Bisulfite Sequencing (eRRBS) analyses I showed that, unlike the AID/APOBEC family member AID, APOBEC2 does not act as a 5-methyl-C deaminase.
    [Show full text]
  • Depletion of the P43 Mitochondrial T3 Receptor Increases Sertoli Cell
    Depletion of the p43 mitochondrial T3 receptor increases Sertoli cell proliferation in mice Betty Fumel, Stéphanie Roy, Sophie Fouchécourt, Gabriel Livera, Anne-Simone Parent, Francois Casas, Florian Jean Louis Guillou To cite this version: Betty Fumel, Stéphanie Roy, Sophie Fouchécourt, Gabriel Livera, Anne-Simone Parent, et al.. De- pletion of the p43 mitochondrial T3 receptor increases Sertoli cell proliferation in mice. PLoS ONE, Public Library of Science, 2013, 8 (9), pp.1-15. 10.1371/journal.pone.0074015. hal-01129770 HAL Id: hal-01129770 https://hal.archives-ouvertes.fr/hal-01129770 Submitted on 28 May 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Depletion of the p43 Mitochondrial T3 Receptor Increases Sertoli Cell Proliferation in Mice Betty Fumel1,2,3,4, Ste´phanie Roy1, Sophie Fouche´court1, Gabriel Livera5, Anne-Simone Parent6, Franc¸ois Casas7,8, Florian Guillou1* 1 INRA, UMR85 Physiologie de la Reproduction et des Comportements, Nouzilly, France, 2 CNRS, UMR7247 Physiologie de la Reproduction et des Comportements, Nouzilly, France,
    [Show full text]
  • Functional Characterization of Novel Rhot1 Variants, Which Are Associated with Parkinson’S Disease
    FUNCTIONAL CHARACTERIZATION OF NOVEL RHOT1 VARIANTS, WHICH ARE ASSOCIATED WITH PARKINSON’S DISEASE DISSERTATION zur Erlangung des Grades eines DOKTORS DER NATURWISSENSCHAFTEN DER MATHEMATISCH-NATURWISSENSCHAFTLICHEN FAKULTÄT und DER MEDIZINISCHEN FAKULTÄT DER EBERHARD-KARLS-UNIVERSITÄT TÜBINGEN vorgelegt von DAJANA GROßMANN aus Wismar, Deutschland Mai 2016 II PhD-FSTC-2016-15 The Faculty of Sciences, Technology and Communication The Faculty of Science and Medicine and The Graduate Training Centre of Neuroscience DISSERTATION Defense held on 13/05/2016 in Luxembourg to obtain the degree of DOCTEUR DE L’UNIVERSITÉ DU LUXEMBOURG EN BIOLOGIE AND DOKTOR DER EBERHARD-KARLS-UNIVERISTÄT TÜBINGEN IN NATURWISSENSCHAFTEN by Dajana GROßMANN Born on 14 August 1985 in Wismar (Germany) FUNCTIONAL CHARACTERIZATION OF NOVEL RHOT1 VARIANTS, WHICH ARE ASSOCIATED WITH PARKINSON’S DISEASE. III IV Date of oral exam: 13th of May 2016 President of the University of Tübingen: Prof. Dr. Bernd Engler …………………………………… Chairmen of the Doctorate Board of the University of Tübingen: Prof. Dr. Bernd Wissinger …………………………………… Dekan der Math.-Nat. Fakultät: Prof. Dr. W. Rosenstiel …………………………………… Dekan der Medizinischen Fakultät: Prof. Dr. I. B. Autenrieth .................................................. President of the University of Luxembourg: Prof. Dr. Rainer Klump …………………………………… Supervisor from Luxembourg: Prof. Dr. Rejko Krüger …………………………………… Supervisor from Tübingen: Prof. Dr. Olaf Rieß …………………………………… Dissertation Defence Committee: Committee members: Dr. Alexander
    [Show full text]
  • The Intra-Mitochondrial O-Glcnacylation System Acutely Regulates OXPHOS Capacity and ROS Dynamics in the Heart
    The intra-mitochondrial O-GlcNAcylation system acutely regulates OXPHOS capacity and ROS dynamics in the heart Justine Dontaine Asma Bouali Frederic Daussin Laurent Bultot https://orcid.org/0000-0002-5088-0101 Didier Vertommen Manon Martin Rahulan Rathagirishnan Alexanne Cuillerier University of Ottawa Sandrine Horman Christophe Beauloye Université catholique de Louvain, Institut de Recherche Expérimentale et Clinique Laurent Gatto UCLouvain https://orcid.org/0000-0002-1520-2268 Benjamin Lauzier Luc Bertrand https://orcid.org/0000-0003-0655-7099 Yan Burelle ( [email protected] ) University of Ottawa https://orcid.org/0000-0001-9379-146X Article Keywords: O-GlcNAcylation, OXPHOS capacity, cellular regulatory mechanism Posted Date: July 19th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-690671/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License 1 THE INTRA-MITOCHONDRIAL O-GLCNACYLATION SYSTEM ACUTELY 2 REGULATES OXPHOS CAPACITY AND ROS DYNAMICS IN THE HEART. 3 4 Justine Dontaine1, A. Bouali2, F. Daussin3, L. Bultot1, D. Vertommen4, M. Martin5, R. 5 Rathagirishnan2, A. Cuillerier6, S. Horman1, C. Beauloye1,7, L. Gatto5, B. Lauzier8, L. Bertrand1,9*, 6 Y. Burelle2,6* 7 1Pole of cardiovascular research (CARD), Institute of Experimental and Clinical Research (IREC), UCLouvain, 8 Brussels, Belgium 9 2Interdisciplinary School of Health Sciences, Faculty of Health Sciences, University of Ottawa, Ottawa, ON, Canada 10 3Univ. Lille, Univ. Artois, Univ. Littoral Côte d’Opale, ULR 7369
    [Show full text]
  • Mitochondria-Cytoskeleton Associations In
    Cell Division Mitochondria-cytoskeleton associations in mammalian cytokinesis Lawrence et al. Lawrence et al. Cell Div (2016) 11:3 DOI 10.1186/s13008-016-0015-4 Lawrence et al. Cell Div (2016) 11:3 DOI 10.1186/s13008-016-0015-4 Cell Division RESEARCH Open Access Mitochondria‑cytoskeleton associations in mammalian cytokinesis E. J. Lawrence*, E. Boucher and C. A. Mandato Abstract Background: The role of the cytoskeleton in regulating mitochondrial distribution in dividing mammalian cells is poorly understood. We previously demonstrated that mitochondria are transported to the cleavage furrow during cytokinesis in a microtubule-dependent manner. However, the exact subset of spindle microtubules and molecular machinery involved remains unknown. Methods: We employed quantitative imaging techniques and structured illumination microscopy to analyse the spatial and temporal relationship of mitochondria with microtubules and actin of the contractile ring during cytokine- sis in HeLa cells. Results: Superresolution microscopy revealed that mitochondria were associated with astral microtubules of the mitotic spindle in cytokinetic cells. Dominant-negative mutants of KIF5B, the heavy chain of kinesin-1 motor, and of Miro-1 disrupted mitochondrial transport to the furrow. Live imaging revealed that mitochondrial enrichment at the cell equator occurred simultaneously with the appearance of the contractile ring in cytokinesis. Inhibiting RhoA activ- ity and contractile ring assembly with C3 transferase, caused mitochondrial mislocalisation during division. Conclusions: Taken together, the data suggest a model in which mitochondria are transported by a microtubule- mediated mechanism involving equatorial astral microtubules, Miro-1, and KIF5B to the nascent actomyosin contrac- tile ring in cytokinesis. Keywords: Mitochondria, Cytoskeleton, Cytokinesis, Microtubules, Actin, Miro, KIF5B Background and Myosin II at the equatorial cortex.
    [Show full text]
  • ER-Mitochondria Contacts Promote Mtdna Nucleoids Active Transportation Via Mitochondrial Dynamic Tubulation
    ARTICLE https://doi.org/10.1038/s41467-020-18202-4 OPEN ER-mitochondria contacts promote mtDNA nucleoids active transportation via mitochondrial dynamic tubulation Jinshan Qin1, Yuting Guo2,3, Boxin Xue1, Peng Shi 4, Yang Chen4, Qian Peter Su1,5, Huiwen Hao1, ✉ ✉ Shujuan Zhao1, Congying Wu4,LiYu6, Dong Li 2,3 & Yujie Sun 1 1234567890():,; A human cell contains hundreds to thousands of mitochondrial DNA (mtDNA) packaged into nucleoids. Currently, the segregation and allocation of nucleoids are thought to be passively determined by mitochondrial fusion and division. Here we provide evidence, using live-cell super-resolution imaging, that nucleoids can be actively transported via KIF5B-driven mito- chondrial dynamic tubulation (MDT) activities that predominantly occur at the ER- mitochondria contact sites (EMCS). We further demonstrate that a mitochondrial inner membrane protein complex MICOS links nucleoids to Miro1, a KIF5B receptor on mito- chondria, at the EMCS. We show that such active transportation is a mechanism essential for the proper distribution of nucleoids in the peripheral zone of the cell. Together, our work identifies an active transportation mechanism of nucleoids, with EMCS serving as a key platform for the interplay of nucleoids, MICOS, Miro1, and KIF5B to coordinate nucleoids segregation and transportation. 1 State Key Laboratory of Membrane Biology, Biomedical Pioneer Innovation Center (BIOPIC), School of Life Sciences, Peking University, 100871 Beijing, China. 2 National Laboratory of Biomacromolecules, CAS Center for Excellence in Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, 100101 Beijing, China. 3 College of Life Sciences, University of Chinese Academy of Sciences, 100049 Beijing, China. 4 School of Basic Medical Sciences, Peking University, 100191 Beijing, China.
    [Show full text]
  • Epigenetic Regulation of Mitochondrial Quality Control Genes in Multiple Myeloma: a Sequenom Massarray Pilot Investigation on Hmcls
    Journal of Clinical Medicine Communication Epigenetic Regulation of Mitochondrial Quality Control Genes in Multiple Myeloma: A Sequenom MassARRAY Pilot Investigation on HMCLs Patrizia D’Aquila 1,†, Domenica Ronchetti 2,3,† , Maria Eugenia Gallo Cantafio 4, Katia Todoerti 2,3, Elisa Taiana 2,3 , Fernanda Fabiani 5, Alberto Montesanto 1, Antonino Neri 2,3, Giuseppe Passarino 1 , Giuseppe Viglietto 4, Dina Bellizzi 1,‡ and Nicola Amodio 4,*,‡ 1 Department of Cell Biology, Ecology and Earth Sciences, University of Calabria, 87036 Rende, Italy; [email protected] (P.D.); [email protected] (A.M.); [email protected] (G.P.); [email protected] (D.B.) 2 Department of Oncology and Hemato-Oncology, University of Milan, 20122 Milan, Italy; [email protected] (D.R.); [email protected] (K.T.); [email protected] (E.T.); [email protected] (A.N.) 3 Hematology, Fondazione Cà Granda IRCCS Policlinico, 20122 Milan, Italy 4 Department of Experimental and Clinical Medicine, Magna Graecia University of Catanzaro, 88100 Catanzaro, Italy; [email protected] (M.E.G.C.); [email protected] (G.V.) 5 Medical Genetics, University “Magna Graecia”, 88100 Catanzaro, Italy; [email protected] * Correspondence: [email protected]; Tel.: +39-0961-3694159 † P.D. and D.R. equally contributed to this work. ‡ D.B. and N.A. equally contributed to this work. Citation: D’Aquila, P.; Ronchetti, D.; Gallo Cantafio, M.E.; Todoerti, K.; Abstract: The mitochondrial quality control network includes several epigenetically-regulated genes Taiana, E.; Fabiani, F.; Montesanto, A.; involved in mitochondrial dynamics, mitophagy, and mitochondrial biogenesis under physiologic Neri, A.; Passarino, G.; Viglietto, G.; conditions.
    [Show full text]
  • Transposon Mutagenesis Identifies Genetic Drivers of Brafv600e Melanoma
    ARTICLES Transposon mutagenesis identifies genetic drivers of BrafV600E melanoma Michael B Mann1,2, Michael A Black3, Devin J Jones1, Jerrold M Ward2,12, Christopher Chin Kuan Yew2,12, Justin Y Newberg1, Adam J Dupuy4, Alistair G Rust5,12, Marcus W Bosenberg6,7, Martin McMahon8,9, Cristin G Print10,11, Neal G Copeland1,2,13 & Nancy A Jenkins1,2,13 Although nearly half of human melanomas harbor oncogenic BRAFV600E mutations, the genetic events that cooperate with these mutations to drive melanogenesis are still largely unknown. Here we show that Sleeping Beauty (SB) transposon-mediated mutagenesis drives melanoma progression in BrafV600E mutant mice and identify 1,232 recurrently mutated candidate cancer genes (CCGs) from 70 SB-driven melanomas. CCGs are enriched in Wnt, PI3K, MAPK and netrin signaling pathway components and are more highly connected to one another than predicted by chance, indicating that SB targets cooperative genetic networks in melanoma. Human orthologs of >500 CCGs are enriched for mutations in human melanoma or showed statistically significant clinical associations between RNA abundance and survival of patients with metastatic melanoma. We also functionally validate CEP350 as a new tumor-suppressor gene in human melanoma. SB mutagenesis has thus helped to catalog the cooperative molecular mechanisms driving BRAFV600E melanoma and discover new genes with potential clinical importance in human melanoma. Substantial sun exposure and numerous genetic factors, including including BrafV600E, recapitulate the genetic and histological hallmarks skin type and family history, are the most important melanoma risk of human melanoma. In these models, increased MEK-ERK signaling factors. Familial melanoma, which accounts for <10% of cases, is asso- initiates clonal expansion of melanocytes, which is limited by oncogene- ciated with mutations in CDKN2A1, MITF2 and POT1 (refs.
    [Show full text]