DOCSLIB.ORG

Narrow Gene Pool Can Threaten the Survival of Calamus Nagbettai R. R. Fernald & Dey: a Highly, Endemic Dioecious Rattan Spec

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Narrow Gene Pool Can Threaten the Survival of Calamus Nagbettai R. R. Fernald & Dey: a Highly, Endemic Dioecious Rattan Spec Journal of Genetics (2019)98:100 Ó Indian Academy of Sciences https://doi.org/10.1007/s12041-019-1147-5 (0123456789().,-volV)(0123456789().,-volV) RESEARCH ARTICLE Narrow gene pool can threaten the survival of Calamus nagbettai R. R. Fernald & Dey: a highly, endemic dioecious rattan species in the Western Ghats of India SUMA ARUN DEV1* , SWATHI BALAKRISHNAN1, ANOJA KURIAN1 and V. B. SREEKUMAR2 1Forest Genetics and Biotechnology Division, Kerala Forest Research Institute, Peechi, Thrissur 680 653, India 2Forest Ecology and Biodiversity Conservation Division, Kerala Forest Research Institute, Peechi, Thrissur 680 653, India *For correspondence. E-mail: [email protected]. Received 21 January 2019; revised 6 August 2019; accepted 16 August 2019 Abstract. Rattans, the spiny climbing palms of Arecaceae (Palmae) family exhibit high endemism to the biodiversity hot spots in India. Of the five rattan genera, Calamus is the only genus found in peninsular India with 15 of 21 species, endemic to the Western Ghats. The extensive utilization of rattans owing to their strength, durability and huge demand has resulted in depletion of their natural resources. Of the 15 endemic species, C. nagbettai is the most affected species on account of endemism, low population size and restricted distribution with fragmented populations. The present study revealed high amount of genetic diversity in the surviving scattered populations of the species using microsatellite markers. High gene flow (Nm = 1.498) observed across the populations resulted in low genetic differentiation (14%). A clear genetic admixture could be seen in Kerala as well as one of the Karnataka’s populations while the remaining two populations were genetically distinct. UPGMA, PCoA and STRUCTURE analyses showed significantly different genetic composition in Kerala population compared to other populations. Kerala and Karnataka populations of C. nagbettai were also unique in their genetic structure and allelic composition. Therefore, effective management and conservation strategies have to be implemented to preserve the rare alleles with adaptive potential to protect this economically valuable Calamus species from endangerment. Overexploitation, low seed set and poor regeneration, as well as habitat fragmentation can further threaten the survival of this endemic, narrowly distributed dioecious rattan species in the Western Ghats region. Keywords. rattans; overexploitation; simple sequence repeat; genetic diversity; conservation. Introduction Western Ghats and the Andaman and Nicobar Islands. Of all rattans, genus Calamus alone occurs in peninsular India, with a Rattans are spiny climbing palms with scaly fruits representation of 21 with 15 species endemic to the Western belonging to the family Arecaceae (Palmae). It comprises Ghats (Renuka 1992, 1999; Ravikanth et al. 2002;Uma of about 650 species in 22 genera distributed around the Shaanker et al. 2004). Kodagu region of the Western Ghats world and of which, Calamus is the largest genus with 375 harbours nine species of rattans with five endemic species (Uma species (Uhl and Dransfield 1987;Govaertset al. 2015). In Shaanker et al. 2004). Climate, topography and edaphic factors India, rattans are represented by five genera, namely Cala- play a vital role in phenological behaviour of the dioecious wind mus, Plectocomia, Daemonorops, Korthalsia and Salacca pollinating Calamus species (Manohara et al. 2007). with a total of about 60 species (Basu 1992; Renuka Rattans are highly treasured for their economic and 1992, 1995; Uma Shaanker et al. 2004). Rattans are highly medicinal values. They are one of the major nontimber endemic with 43 of 60 species endemic to India and are forest products (NWFPs) in South and Southeast Asia mainly distributed in three regions, namely northeast India, (Lyngdoh et al. 2005). In Southeast Asia, approximately half a million population are engaged directly in rattan All authors contributed equally to this work. trade(UmaShaankeret al. 2004). The global trade in 100 Page 2 of 10 Suma Arun Dev et al. rattans approximates to USD two billion, a year (Rattan- such as Korthalsia, Daemonorops, Salacca and Calamus land 2011). Calamus species owing to its high strength, (Rao et al. 2007). flexibility and durability are extensively considered for The present study aims at identifying the genetic diversity furniture making, handicrafts and sports articles. They are status of C. nagbettai, an endemic peninsular rattan species, also used in Ayurvedic systems of medicine for the treat- for effective conservation and management of the available ment of various diseases like cold, rabies, among others gene pool. (Lakshmana 1993). Calamus oil extracted from the root is used for perfuming and flavouring liquors, and tender shoots of some species like C. erectus Roxb.,C.flori- Materials and methods bundus Griff. and C. latifolius Roxb. are edible (Singh et al. 2004). Population sampling and DNA extraction Of the 15 endemic species of Calamus in the Western Ghats, C. nagbettai regionally known as ‘nagbetha’ is one All available mature individuals of C. nagbettai from the of the endemic rattans confined to the Karnataka and Kerala only existing natural populations representing two geo- regions of the Western Ghats. This species is considered graphic areas (Kerala and Karnataka) of the Western Ghats sacred and worshipped in Karnataka and is mainly found in were sampled namely Subramanya (nine individuals), Kar- Subramanya forests of Dakshina Kannada district and also ikke (nine individuals), Charmadi (15 individuals) from parts of Hassan and Kodagu districts of Karnataka in Karnataka part and Umayar (15 individuals) from Kerala central Western Ghats. The species is highly threatened part (table 1). Fresh leaves were collected and dried on silica owing to their high economic and aesthetic values (Uma gel. Total DNA was extracted from 20 mg of leaf tissue Shaanker et al. 2004;Rameshaet al. 2007). In Kerala, using the modified Cetyl trimethyl ammonium bromide distributionofthespeciesishighlyrestrictedwithonlyfew (CTAB) method (Doyle and Doyle 1987). surviving individuals in the Umayar forest (Renuka and Sreekumar 2012). C. nagbettai is a high climbing, robust clustering rattan around 25-m long with cirrate leaf and SSRs attains reproductive maturity in about 16–20 years (direct observation-KFRI Palmetum). The sheaths are yellowish Fourteen microsatellite loci reported from C. simplicifolius green to green with spiny lower half. Male and female (Li et al. 2013) were considered for the present study inflorescences are up to 30 cm and 70 cm long, respec- (table 2). The forward primers were labelled with a flour- tively. Fruits are oblong–ovate with ruminate endosperm. ochrome (6-FAM). Polymerase chain reaction (PCR) was Destruction of habitat, change of land use pattern and forest performed using 20 lL reaction containing 50–100 ng DNA, fire along with increase in demand for raw material has 10x Taq buffer with 1.5 mM MgCl2, 200 lM dNTPs, 10 pm resulted in overexploitation and consequent erosion of of each primer and 2 U Taq DNA polymerase (Invitrogen, diversity in C. nagbettai. Endemism, low population size Bengaluru). The PCR reaction conditions included an initial and restricted distribution limits the genetic diversity and denaturation at 95°C for 5 min, followed by 35 cycles at fitness of the surviving individuals and the species weigh 94°C for 45 s, specific annealing temperatures for 60 s up as ‘vulnerable’ in the Red Data Book (Ahmedullah and (table 2), an extension period at 72°C for 45 s, followed by a Nayar 1986; Ravikanth et al. 2010). final extension period at 72°C for 10 min. SSR genotyping Among the available genetic markers, simple sequence was performed using ABI 3730XL sequencer (Applied repeats (SSRs) or microsatellites are codominant, locus- Biosystems) with an internal size standard of Gene Scan specific, ubiquitous, experimentally reproducible, multiple 500LIZ (Applied Biosystems). The SSR allele size was allele markers with high amount of polymorphism (Selkoe evaluated using GENEMAPPER software v4.0 (Applied and Toonen 2006; Zhang et al. 2014; Harris-Shultz et al. Biosystems). 2014; Chen and Okie 2015; Kumbhar et al. 2015; Mason 2015). SSR markers have been particularly used to distin- guish between closely related genotypes owing to their high degree of variability making them ideal for population Table 1. Details of C. nagbettai population in the Western Ghats. genetics (Smith and Devey 1994). SSR markers were employed to analyse genetic diversity and population No. of Longitude structure of palms such as Pheonix dactylifera L. (Billotte Locality samples Latitude (N) (E) et al. 2004; Elshibli and Korpelainen 2009), Elaeis Umayar, Kerala 15 8°52001.200N77°13008.100E guineensis Jacq. (Billotte 2001), Cocos nucifera L. (Perera Subramanya, 912°40013.200N75°37015.800E et al. 2000; Teulat et al. 2000; Meerow et al. 2003), Cala- Karnataka mus thwaitesii Becc. (Kurian et al. 2013) and C. simplici- Karikke, Karnataka 9 12°26027.900N75°25044.700E 0 00 0 00 folius Wei. (Li et al. 2013). Cross-species amplification of Charmadi, 15 13°03 56.0 N75°26 37.1 E Karnataka SSR markers was recently reported in four genera of rattans Endemic dioecious rattan species in the Western Ghats of India Page 3 of 10 100 Table 2. Microsatellite markers used for PCR amplification (Li et al. 2013). Locus Repeat motifs Primer sequence Annealing temperature (°C) CALeSSR080 (GA)6 F:(6-FAM)GCCTTTCCTCCACCTTGC 57.3 R:ATGCCACTGGTTGCCTCT CALeSSR082 (TC)5TT(TA)8 F:(6-FAM)ACAATCGAATGTAGCCAAGT
Load more

Recommended publications
  • Status of Research on Rattans: a Review
    http://sciencevision.info Sci Vis 10 (2), 51-56 Research Review April-June, 2010 ISSN 0975-6175 Status of research on rattans: a review Lalnuntluanga1*, L. K. Jha2 and H. Lalramnghinglova1 1 Department of Environmental Science, Mizoram University, Aizawl 796009, India 1 Department of Environmental Science, North-Eastern Hill University, Shillong 793022, India Received 20 July 2010 | Accepted 28 July 2010 ABSTRACT Rattan forms one of the major biotic components in tropical and sub -tropical forest ecosys- tem. Contributions made by the researchers on the distribution, taxonomy and uses of rattan species in the world with special reference to India are reviewed here. Key words: Rattan; distribution; taxonomy; utilisation; N.E. states. INTRODUCTION Argentina, the Caribbean, Africa and South-East Asian regions. Rattan diversity is rich in Malay- The name ‘cane’ (rattan) stands collectively sia, Indonesia, Philippines, China, Bangladesh, for the climbing members of a big group of Sri Lanka, Myanmar and India. Rattan is of palms known as Lepidocaryoideae, fruit bearing great economic importance in handicraft and scales. Rattans/canes are prickly climbing palms furniture making because of its richness in fibre, with solid stems, belonging to the family Areca- with suitable toughness and easy for processing. ceae and the sub-family Calamoideae. They are The innumerable pinnate leaves, which extend scaly-fruited palms. The rattans/canes comprise up to two metres in length, with their mosaic more than fifty per cent of the total palm taxa arrangement play a major role in intercepting found in India.1 They are distributed throughout the splash effect of rains and improve the water South-East Asia, the Western Pacific and in the holding capacity of the soil.
    [Show full text]
  • Taxonomic Enumeration of Angiosperm Flora of Sreenagar Upazila, Munshigang, Dhaka, Bangladesh
    J. Asiat. Soc. Bangladesh, Sci. 43(2): 161-172, December 2017 TAXONOMIC ENUMERATION OF ANGIOSPERM FLORA OF SREENAGAR UPAZILA, MUNSHIGANG, DHAKA, BANGLADESH ZAKIA MAHMUDAH, MD. MUZAHIDUL ISLAM, TAHMINA HAQUE AND MOHAMMAD ZASHIM UDDIN1 Department of Botany, University of Dhaka, Dhaka-1000, Bangladesh Abstract The present article focuses the status of angiosperm flora of Sreenagar upazila under Munshiganj district. The study was done from July 2015 to June 2016. A total of 219 plant species of angiosperms was identified belonging to 165 genera and 70 families. Among them 38 species were monocotyledons and 181 plant species were dicotyledons. Herbs were the largest life forms among the angiosperms and contained about 58% of total plant species occurring in this area. Trees and shrubs occupied 23% and 12% respectively. Climbers were 6% but epiphytes (1%) were very negligible in number in the study area. About 51 medicinal plants were recorded from this study. The following species viz. Lasia spinosa, Calamus tenuis, Tinospora crispa, Passiflora foetida and Calotropis procera were recorded only once and hence considered as rare species in Sreenagar upazila. An invasive poisonous plant Parthenium hysterophorus was also found in Sreenagar. Key words: Diversity, Angiosperm flora, Sreenagar, Munshiganj district Introduction Sreenagar is an upazila under Munshiganj district situated on the bank of ‘Padma’ river. It is a part of Dhaka division, located in between 23°27' and 23°38' north latitudes and in between 90°10' and 90°22' east longitudes. The total area is 202, 98 square kilometer and bounded by Serajdikhan and Nawabganj upazilas on the north, Lohajong and Shibchar upazilas on the south, Serajdikhan and Nawabganj and Dohar upazilas on the west.
    [Show full text]
  • WIAD CONSERVATION a Handbook of Traditional Knowledge and Biodiversity
    WIAD CONSERVATION A Handbook of Traditional Knowledge and Biodiversity WIAD CONSERVATION A Handbook of Traditional Knowledge and Biodiversity Table of Contents Acknowledgements ...................................................................................................................... 2 Ohu Map ...................................................................................................................................... 3 History of WIAD Conservation ...................................................................................................... 4 WIAD Legends .............................................................................................................................. 7 The Story of Julug and Tabalib ............................................................................................................... 7 Mou the Snake of A’at ........................................................................................................................... 8 The Place of Thunder ........................................................................................................................... 10 The Stone Mirror ................................................................................................................................. 11 The Weather Bird ................................................................................................................................ 12 The Story of Jelamanu Waterfall .........................................................................................................
    [Show full text]
  • Rattans of Vietnam
    Rattans of Vietnam: Ecology, demography and harvesting Bui My Binh Rattans of Vietnam: Ecology, demography and harvesting Bui My Binh [ 1 ] Rattans of Vietnam: Ecology, demography and harvesting Bui My Binh Rattans of Vietnam: ecology, demography and harvesting ISBN: 978-90-393-5157-4 Copyright © 2009 by Bui My Binh Back: Rattan stems are sun-dried for a couple of days Printed by Ponsen & Looijen of GVO printers & designers B.V. Designed by Kooldesign Utrecht [ 2 ] Rattans of Vietnam: Ecology, demography and harvesting Vietnamese rotans: ecologie, demografie en oogst (met een samenvatting in het Nederlands) Song Vi_t Nam: sinh thái, qu_n th_ h_c và khai thác (ph_n tóm t_t b_ng ti_ng Vi_t) Proefschrift ter verkrijging van de graad van doctor aan de Universiteit Utrecht op gezag van de rector magnificus, prof. Dr. J.C. Stoof, ingevolge het besluit van het College voor Promoties in het openbaar te verdedigen op woensdag 14 oktober 2009 des middags te 2.30 uur door Bui My Binh geboren op 17 februari 1973 te Thai Nguyen, Vietnam [ 3 ] Rattans of Vietnam: Ecology, demography and harvesting Promotor: Prof.dr. M.J.A. Werger Prof.dr. Trieu Van Hung Co-promotor: Dr. P.A Zuidema This study was financially supported by the Tropenbos International and the Netherlands Fellowship Programme (Nuffic). [ 4 ] [ 5 ] Rattans of Vietnam: Ecology, demography and harvesting [ 6 ] C Contents Chapter 1 General introduction 9 9 Chapter 2 Vietnam: Forest ecology and distribution of rattan species 17 17 Chapter 3 Determinants of growth, survival and reproduction of
    [Show full text]
  • In Vitro Anthelmintic Activity of Leaf Extracts of Four Different Types of Calamus Species
    Pharmacy & Pharmacology International Journal Research Article Open Access In vitro anthelmintic activity of leaf extracts of four different types of calamus species Abstract Volume 5 Issue 2 - 2017 Development of anthelmintic resistance and high cost of conventional anthelmintic Sajan Das, Rumana Akhter, Sumaiya Huque, drugs led to the evaluation of medicinal plants as an alternative source of anthelmintics. In the present study, methanol, ethanol and chloroform leaf extract Rafi Anwar, Promit Das, Kaniz Afroz Tanni of Calamus guruba, Calamus viminalis, Calamus erectus and Calamus tenuis were and Mohammad Shahriar explored for anthelmintic activity at two concentrations (50 and 100mg/ml), using Department of Pharmacy, University of Asia Pacific, Bangladesh adult earth worm Pheretima posthuma. All the leaf extracts of Calamus species tested Correspondence: Mohammad Shahriar, Department for the anthelmintic activity possess significant activity in a dose dependent manner of Pharmacy, University of Asia Pacific, Bangladesh, Tel as compared to the albendazole. The overall findings of the present study have shown +881841844259, Email [email protected] that Calamus guruba, Calamus viminalis, Calamus erectus and Calamus tenuis contain possible anthelmintic compounds. Received: January 30, 2017 | Published: April 17, 2017 Keywords: Calamus guruba, Calamus viminalis, Calamus erectus, Calamus tenuis, Anthelmintic activity, Pheretima Posthuma, Albendazole, In vitro study, hookworm infestation, entrobiasis, filariasis, taeniasis; hydatidcyst, fluke infection, helminthiasis, wonder drug, niclosamide, oxyclozanide, bithionol Introduction viminalis is known as Khorkoijja bet in Bangladesh and is widely used as handicrafts and furniture material. Ripe fruit pulps are edible. This Infections caused by various species of parasitic worms plant has also been used in traditional medicine for treatment of dog (helminths) of the gastrointestinal tract are the most widespread of bite, urogenital and gynecological infection.6 The leaf extract of C.
    [Show full text]
  • Occurrence of White-Winged Wood Duck (Cairina Scutulata) in Nameri National Park, Assam, India1
    Bird Populations 11:7-13 © The Institute for Bird Populations 2012 OCCURRENCE OF WHITE-WINGED WOOD DUCK (CAIRINA SCUTULATA) IN NAMERI NATIONAL PARK, ASSAM, INDIA1 NIRANJAN DAS2 Department of Geography North-Eastern Hill University Shillong-793022, Meghalaya-INDIA SUJATA DEORI Department of Geography North Gauhati College North Guwahtai-781031, Kamrup (Assam)-INDIA Abstract. Nameri National Park is a part of the North Bank Landscape of Brahmaputra River as designated by World Wildlife Fund and located near Assam and Arunachal Pradesh; it also is a part of the Eastern Himalayan Bio-diversity Hotspot. A survey conducted during 2008-2009 logged 337 avian species and from that effort a detailed checklist of birds was compiled. Included was White-winged Wood Duck (Cairina scutulata), which is considered an endangered species (2010 IUCN Red List Category as evaluated by Bird Life International). Herein we describe the ecology and distribution of White Winged Wood Duck in Nameri National Park, based on this survey. Key words: India, Nameri National Park, White Winged Wood Duck FRECUENCIA DEL PATO CAIRINA SCUTULATA EN EL PARQUE NACIONAL NAMERI, ASSAM, INDIA Resumen. El Parque Nacional Nameri forma parte del Paisaje de la Orilla Norte del Río Brahmaputra designado por el Fondo Mundial para la Naturaleza y ubicado cerca de Assam y Arunachal Pradesh; también forma parte del Hotspot de Biodiversidad de los Himalayas Orientales. Un conteo llevado a cabo en 2008-2009 registró 337 especies de aves, y de ese esfuerzo surgió una lista detallada de aves. La lista incluye al pato Cairina scutulata, considerado especie en peligro (categoría de la lista roja de la UICN evaluada por BirdLife International).
    [Show full text]
  • The Silvicultural and Sustainable Management of Rattan Production Systems
    Tuscia University - Faculty of Agriculture The Silvicultural and Sustainable Management of Rattan Production Systems BSc in Agroecology and Rural Development Academic year 2004/2005 In Cooperation with FAO - Food and Agriculture Organization of the United Nations Università degli studi della Tuscia Facoltà di Agraria Via San Camillo de Lellis, Viterbo Elaborato Finale Corso di laurea triennale in Agricoltura Ecologica e Sviluppo Rurale Anno Accademico 2004/2005 Silvicoltura e Gestione Sostenibile della Produzione del Rattan The Silvicultural and Sustainable Management of Rattan Production Systems Relatore: Prof. Giuseppe Scarascia-Mugnozza Correlatore: Ms Christine Holding-Anyonge (FAO) Studente: Edoardo Pantanella RÉSUMÉ La coltivazione del rattan, e dei prodotti non legnosi in genere, offre grandi potenzialità sia economiche, in qualità di materia prima e di prodotto finito, che ecologiche, intese come possibilità legate alla riduzione dell’impatto dello sfruttamento forestale attraverso forme di utilizzo alternativo alla produzione del legno. Studi specifici relativi agli aspetti tassonomici e biologici del rattan, indirizzati al miglioramento della conoscenza sulle caratteristiche biologiche delle numerose specie e dei possibili sistemi di sviluppo e di gestione silvicolturale delle piantagioni, hanno una storia recente. Essi hanno preso il via solo a partire dagli anni ’70, a seguito della scarsa disponibilità del materiale in natura. Nel presente elaborato si sono indagati gli aspetti biologici e silviculturali del rattan. Su queste
    [Show full text]
  • Research Paper Investigation on Calamus Tenuis Roxb. Leaves
    Academia Journal of Medicinal Plants 6(7): 133-138, July 2018 DOI: 10.15413/ajmp.2018.0127 ISSN 2315-7720 ©2018 Academia Publishing Research Paper Investigation on Calamus tenuis Roxb. leaves: Quantitative phytochemical, antioxidant and antibacterial activity Accepted 13th June, 2018 ABSTRACT Calamus tenuis Roxb. leaves were tested for its quantitative phytochemical, antioxidant and antibacterial activities using three different solvents (n-hexane, chloroform and methanol). From the results obtained, the highest concentrations total phenol, total tannin and flavonoid contents were found in methanol (80.0 ± 0.2 mgGAE/g, 136.8 ± 3.5 mgGAE/g, 288.4 ± 2.3 mgQE/g respectively), while lowest concentrations were found in n-hexane (21.6 ± 0.1 mgGAE/g, 59.1 ± 0.9 mgGAE/g, 81.2 ± 4.4 mgQE/g, respectively). In vitro antioxidant properties were analyzed using qualitative and quantitative DPPH free radical scavenging method, where ascorbic acid was used as standard. Throughout the study, methanol extract showed marked antioxidant activity (IC50=121.9 ± 11.34 µg/mL), whereas in n- hexane, it was found the lowest antioxidant activity (IC50= 654.99 ± 342.6 µg/mL). Selected pathogens (Micrococcus, Salmonella typi, Vibrio cholera, Staphylococcus aureus and E. coli) were tested using those solvent extracts of two different concentrations (100 and 200 µg/disc). E.coli was reluctant to all solvent extracts except methanol (6.5 ± 0.6 mm) of 200 µg/disc. Chloroform extract of 200 µg/disc exhibited nearly same activity against Micrococcus (5.8 ± 0.2 mm), Staphylococcus aureus (6.0 ± 0.0 mm), Vibrio cholera (6.3 ± 0.3 mm) and Salmonella typhi (6.2 ± Muhammad Shamim Al Mamun1*, Rokeya Khatun1 and Tasfia Sharin 0.2 mm), while it had no activity against E.
    [Show full text]
  • Progress Report - 2 2012
    Rufford Small Grant: Progress Report - 2 2012 Project Title: Assessing the diversity of national red listed vascular plants and hotspots identification at Rema- Kalenga Wildlife Sanctuary, Bangladesh Project leader: Md. Qumruzzaman Chowdhury Project summary Rema-Kalenga Wildlife Sanctuary (RKWS) is one of the most critical protected areas (PA) in Bangladesh where a large number endemic plant and animal species have already disappeared due to severe anthropogenic disturbances. Therefore, assessment of red listed species diversity and identification of biodiversity hotspots are important in conservation management. Hence, the general objective of the work is to develop baseline information on the occurrence and diversity patterns of the national red listed vascular plant species in the PA to foster conservation of these threatened components of nature. Specific objectives (I) Quantification of red listed species diversity and exploration of their distributional patterns in different habitats. (II) Identification of hotspots within the PA. Results Diversity of Red Listed Vascular Plants We found a total of 66 red listed vascular plants of 35 families and 55 genera in the Rema- Kalenga Wildlife Sanctuary (Table 1). Plantation forest consists of 47 species of 42 genus and 28 families. Natural forest has 17 unique species. Highest richness value (18) was found in plot 2 of natural forest and lowest value was observed in sample plot 4 (Figure 1a). Out of 50 plots in 1 Rufford Small Grant: Progress Report - 2 2012 plantation forest 4 plots did not have any red listed species. Richness value ranged from 0 to 14 with a mean value of 5.32. In terms of alpha diversity, mean values were 1.64 and 1.07 for natural and plantation forests, respectively (Figure 1b).
    [Show full text]
  • A Revised Delimitation of the Rattan Genus Calamus (Arecaceae)
    Phytotaxa 204 (3): 235–236 ISSN 1179-3155 (print edition) www.mapress.com/phytotaxa/ PHYTOTAXA Copyright © 2015 Magnolia Press Correspondence ISSN 1179-3163 (online edition) http://dx.doi.org/10.11646/phytotaxa.204.3.7 Corrections to Phytotaxa 197: A revised delimitation of the rattan genus Calamus (Arecaceae) WILLIAM J. BAKER Royal Botanic Gardens, Kew, Richmond, Surrey, TW9 3AB, United Kingdom, [email protected] In Phytotaxa 197 (Baker 2015), I placed the rattan genera Ceratolobus Blume (in Schultes & Schultes 1830: lxxx), Dae- monorops Blume (in Schultes & Schultes 1830: 1333) and Pogonotium Dransfield (1980: 763) in synonymy with Calamus Linnaeus (1753: 325). Subsequently, two nomenclatural errors and one overlooked synonym have been drawn to my atten- tion. These are corrected here. Calamus luteus W.J.Baker, nom. nov. Daemonorops aurea Renuka & Vijayak., Rheedea 4: 122 (1994), Calamus aureus (Renuka & Vijayak) W.J.Baker, Phytotaxa 197: 141 (2015), nom. illeg., non Calamus aureus Reinw. ex Mart., Hist. Nat. Palm. 3: 341 (1853). Note:—In making a new combination for Daemonorops aurea Renuka & Vijayak., a homonym, Calamus aureus (Renuka & Vijayak) W.J.Baker, was created (Baker 2015), Calamus aureus Reinw. ex Mart. having been overlooked. To correct this, a replacement name, Calamus luteus W.J.Baker, is made here. Calamus jenkinsianus Griff., Calcutta J. Nat. Hist. 5: 81 (1845). Daemonorops jenkinsiana (Griff.) Mart., Hist. Nat. Palm. 3: 327 (1853), Palmijuncus jenkinsianus (Griff.) Kuntze, Revis. Gen. Pl. 2: 733 (1891). Calamus nutantiflorus Griff., Calcutta J. Nat. Hist. 5: 79 (1845). Daemonorops nutantiflora (Griff.) Mart., Hist. Nat. Palm. 3: 326 (1853). Palmijuncus nutantiflorus (Griff.) Kuntze, Revis.
    [Show full text]
  • Chapter 1 Introduction
    Introduction CHAPTER 1 INTRODUCTION Plants have been proven to play a remarkable role as food in human life. Most of the edible plants were domesticated from wild ancestors long before of recorded history [History of plant foods, 2015]. Wild plants play an important role in community nutrition and it is used in preparation of most of the traditional recipes [Deb et al., 2013]. They also have a proven track record to be most useful in treatment of diseases worldwide with minimal cost and side effects [Yabesh et al., 2014]. Edible plants serve the purpose of food during scarcity due to its availability throughout the year [Guy and Francois, 2003; Ogle et al., 2003]. Indian subcontinent is inhabited by over 53.8 million tribal population in about 5000 forest dominated villages of tribal community and comprising 15% of the total geographical area of Indian landmasses, representing one of the greatest emporia of ethno-botanical wealth [Ciba Foundation Symposium 185, 1994]. North-eastern states of India have a rich flora of medicinally important plants which are consumed as ethnomedicine not only by local tribes but also by urban population [Jadeja et al., 2012]. Assam, with diverse ethnic communities and socio-cultural complexities, has maintained one of the oldest and most diverse traditions associated with the use of ethnomedicinal plants [Borah et al., 2009]. Dibrugarh district of Assam embraces a large number of ethnomedicinal plants which are used by the natives as food or in treatment of diseases or both [Bhuyan, 2015]. There is a class of wild plants knows as Rattan, of which some are edible and used as an ingredient in many delicious and nutritious dishes, and also as traditional medicine Page 1 Introduction [Boonsermsuk et al., 2007].
    [Show full text]
  • Chapter 6 ENUMERATION
    Chapter 6 ENUMERATION . ENUMERATION The spermatophytic plants with their accepted names as per The Plant List [http://www.theplantlist.org/ ], through proper taxonomic treatments of recorded species and infra-specific taxa, collected from Gorumara National Park has been arranged in compliance with the presently accepted APG-III (Chase & Reveal, 2009) system of classification. Further, for better convenience the presentation of each species in the enumeration the genera and species under the families are arranged in alphabetical order. In case of Gymnosperms, four families with their genera and species also arranged in alphabetical order. The following sequence of enumeration is taken into consideration while enumerating each identified plants. (a) Accepted name, (b) Basionym if any, (c) Synonyms if any, (d) Homonym if any, (e) Vernacular name if any, (f) Description, (g) Flowering and fruiting periods, (h) Specimen cited, (i) Local distribution, and (j) General distribution. Each individual taxon is being treated here with the protologue at first along with the author citation and then referring the available important references for overall and/or adjacent floras and taxonomic treatments. Mentioned below is the list of important books, selected scientific journals, papers, newsletters and periodicals those have been referred during the citation of references. Chronicles of literature of reference: Names of the important books referred: Beng. Pl. : Bengal Plants En. Fl .Pl. Nepal : An Enumeration of the Flowering Plants of Nepal Fasc.Fl.India : Fascicles of Flora of India Fl.Brit.India : The Flora of British India Fl.Bhutan : Flora of Bhutan Fl.E.Him. : Flora of Eastern Himalaya Fl.India : Flora of India Fl Indi.
    [Show full text]