DOCSLIB.ORG

Two New Spiny Species of Dianthus (Caryophyllaceae) from Turkey

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Two New Spiny Species of Dianthus (Caryophyllaceae) from Turkey KSÜ Tarım ve Doğa Derg 21(4):545-554, 2018 KSU J. Agric Nat 21(4):545-554, 2018 Two New Spiny Species of Dianthus (Caryophyllaceae) from Turkey Ergin HAMZAOĞLU1 , Murat KOÇ2 , İlker BÜYÜK3 1Gazi University, Gazi Faculty of Education, Department of Mathematics and Science Education, 06500, Ankara, 2Bozok University, Boğazlıyan Vacotional School, 66400, Boğazlıyan, Yozgat, 3Ankara University, Faculty of Science, Department of Biology, 06100, Ankara : [email protected] ABSTRACT DOI :10.18016/ksudobil.347445 Some Dianthus L. (Caryophyllaceae) specimens which have spiny epicalyx scales and spiny leaves have been collected from the Hanönü Article History (Kastamonu) and the Mount Murat (Kütahya/Uşak). As a result of the Received : 28.10.2017 investigations, these specimens have been decided to be new species Accepted : 05.02. 2018 for the scientific world and they have been named as Dianthus varankii Hamzaoğlu & Koç and Dianthus halisdemirii Hamzaoğlu & Keywords Koç. The descriptions, ecological preferences, distribution information Dianthus, and conservation status of the new species was given. Also, they were new taxa, compared with closely related species, D. aculeatus Hamzaoğlu, based Turkey on its general morphology and seed micromorphology. The relationships between new species and their close relatives were Research Article determined based on the ITS sequences. Türkiye’den İki Yeni Dikenli Dianthus Türü (Caryophyllaceae) ÖZET Makale Tarihçesi Hanönü (Kastamonu) ve Murat Dağı’ndan (Kütahya/Uşak) epikaliks Geliş : 28.10.2017 pulları ve yaprakları dikenli olan bazı Dianthus L. (Caryophyllaceae) Kabul : 05.02.2018 örnekleri toplandı. Yapılan incelemeler sonucu bu örneklerin bilim dünyası için yeni oldukları anlaşıldı ve bunlar Dianthus varankii Anahtar Kelimeler Hamzaoğlu & Koç ve Dianthus halisdemirii Hamzaoğlu & Koç olarak Dianthus, adlandırıldı. Yeni türlerin betimlemeleri, ekolojik tercihleri, yayılış yeni taksonlar, bilgileri ve mevcut koruma durumları verildi. Ayrıca, yakın akraba Türkiye oldukları D. aculeatus Hamzaoğlu ile genel morfoloji ve tohum mikromorfolojisi bakımından karşılaştırıldılar. Yeni türler ile yakın Araştırma Makalesi akrabaları arasındaki moleküler benzerlikler ITS sekans analizine bağlı olarak belirlendi. To Cite : Hamzaoğlu E, Koç M, Büyük İ 2018. Two New Spiny Species of Dianthus (Caryophyllaceae) from Turkey. KSU J. Agric Nat 21(4):545-554, DOI :10.18016/ksudobil.347445. INTRODUCTION The development of PCR technology has increased our The genus Dianthus L. has approximately 600 species knowledge about the phylogeny of the Caryophyllaceae that mostly grows in Asia and Europe; there are 78 (White et al., 1990; Rettig et al., 1992; Gardes and species in Turkey (Dequan and Turland, 2001; Gemici Bruns, 1993). In recent years, p16-p25 primer pairs and Leblebici, 1995; Vural, 2008; Yılmaz et al., 2011; (surrounding ITS region) have been frequently used for İlçim et al., 2013; Hamzaoğlu et al., 2015; 2017). molecular phylogenetic studies in Caryophyllaceae Dianthus is the second largest genus after Silene L. in (Popp and Oxelman, 2001; Popp et al., 2005). Caryophyllaceae in Turkey (Reeve, 1967). The genus The aim of this study was to contribute to Dianthus has been divided into five sections in “Flora taxonomy by describe and adding two new species and Orientalis”. The most imported characters of section determine the genetic relationships among other spiny Dentati Boiss. are having a barbulate and dentate species of Dianthus collected from Turkey. petal limbs (Reeve, 1967; Boissier, 1867). On the other hand, some of the taxa of section Dentati have spiny MATERIAL and METHODS epicalyx leaves. Recently new species had been added Plant Materials into this spiny group (Yılmaz et al., 2011; Hamzaoğlu Dianthus specimens which were identified as new et al., 2014). In addition, studies have shown that seed species were collected from Hanönü (Kastamonu) and surface patterns in genus Dianthus are sufficiently Murat Mountain (Kütahya/Uşak) in Turkey. Besides, distinctive (Hamzaoğlu et al., 2014; 2015; Hamzaoğlu the specimens included the materials needed for the and Koç, 2015). seed micromorphology studies. The specimens KSÜ Tarım ve Doğa Derg 21(4):545-554, 2018 Araştırma Makalesi/Research Article collected were comprehensively evaluated by the use of Oxelman, 2001; Popp et al., 2005). The PCR the literature along with the specimens present in amplification was performed in 50 µl volume GAZI, ANK, HUB, KNYA, E, K and P herbaria (Reeve, containing 10 µl of 10 × buffer, 1 unit Taq DNA 1967; Bojňanský & Fargašová, 2007; Yılmaz et al., polymerase (Promega, Madison, Wisconsin), 200 µM 2011; Hamzaoğlu et al., 2014). Pictures were taken dNTPs, 2 mM MgCl2, and 10 pmol of both primers, p16 with a CANON EOS60D digital camera. The seed and p25. PCR amplification was performed in a surface micromorphology was visualized using the Biometra TProfessional Standard (Biometra, GmbH, FEI Quanta 450 FEG (in 2017) and LEO 440 (in 2013) Germany) as follows: 94°C for 2 min, 35 cycles of 94°C scanning electron microscopes. The vegetative for 30 s, 55°C for 1 min, and 72°C for 1 min, and a final characteristics were measured with a ruler with 0.5 extension step of 8 min at 72°C. The amplification mm accuracy and the floral characteristics were products were analyzed by electrophoresis in 1.2% determined using an ocular micro-meter. agarose gel containing ethidium bromide, and the product sizes were determined on gels by nucleotide DNA Extraction size marker (100 bp ladder; Fermentas, Vilnius, All of the molecular experiments were performed in Lithuania). ‘Plant Molecular Biology Laboratory of Ankara The PCR products were sequenced in both directions University’ by İlker BÜYÜK. Leaf material of six (once using the forward primer, and once using the Dianthus (Caryophyllaceae) specimens was dried in reverse primer) with a BigDye cycle sequencing kit silica gel to preserve the tissue in the field for DNA (Applied Biosystems, Foster City, California) using an extraction. ABI 3130XL genetic analyzer Applied Biosystems, The genomic DNA was extracted according to the Foster City, California). The derived ITS sequences modified CTAB method as described by Aras et al. identity was confirmed by appropriate program Blast (2003). NanoDrop Lite Spectrophotometer (Thermo (NCBI) to search the DNA sequence databases for high Scientific, USA) was used to check DNA quality and similarity with other Dianthus species quantity and also the integrity of each DNA was (http://www.ncbi.nlm. nih.gov/BLAST). The quality checked by running a 1% agarose gel containing check of the nucleotide peaks and the collapsing the ethidium bromide and were visualized using an forward and reverse Sanger reads into consensus ultraviolet transilluminator (Syngene Chemi Genius 2 sequence was done through Geneious version R9 Bio Imaging System, UK). (http://www.geneious.com, Kearse et al., 2012). PCR Amplification and Sequencing Sequence Alignment and Phylogenetic Analysis Sequence comparison of the ITS is frequently used in The amplified fragments were sequenced and the phylogenetic reconstructions at the intraspecific outgroup Petrorhagia saxifraga (L.) Link. was taxonomic level (Chase et al. 2000; White et al., 1990; obtained from GenBank (https://www.ncbi.nlm. Hamzaoğlu et al., 2017). On this basis, ITS sequences nih.gov/genbank/) to compare with Dianthus of six Dianthus specimens were analyzed in the sequences (Table 1). All sequences were first aligned current study. The ITS region was amplified using a using CLC Main Workbench ver. 8.0 primer set P16 (5´- (https://www.qiagenbioinformatics.com/) and the TCACTGAACCTTATCATTTAGAGGA- 3´) and P25 alignment was checked using the MEGA7 software (5´- GGGTAGTCCCGCCTGACCTG - 3´) (Popp and (Kumar et al., 2016). Table 1. GenBank accession numbers of the ITS sequences from six spiny Dianthus sect. Dentati specimens which were obtained in this study. Collector number Species GenBank accession no. Hamzaoğlu 6589 Dianthus erinaceus Boiss. var. erinaceus KY364854 Hamzaoğlu 6590 D. erinaceus Boiss. var. alpinus Boiss. KY364855 Hamzaoğlu 6596 D. goekayi Kaynak, Yılmaz & Daşkın KY364856 Hamzaoğlu 6744 D. aculeatus Hamzaoğlu KY364857 Hamzaoğlu 7241 D. varankii Hamzaoğlu & Koç KY364858 Koç 2127 D. halisdemirii Hamzaoğlu & Koç KY364859 Outgroup Petrorhagia saxifraga (L.) Link KX184019.1 The pairwise sequence divergence between species in Maximum likelihood (ML) method (Felsenstein, 1985; ITS was determined by Kimura-2 parameter model Tamura et al., 2011; Kumar et al., 2016). (Kimura, 1980). The base composition analysis was performed using MEGA7 and the phylogenetic tree RESULTS and DISCUSSION (bootstrap replicates=1000) was constructed using the Dianthus varankii Hamzaoğlu & Koç, sp. nov. 546 KSÜ Tarım ve Doğa Derg 21(4):545-554, 2018 Araştırma Makalesi/Research Article Type: Turkey, A5 Kastamonu, Hanönü, Küreçayı Hamzaoğlu 7241 & Koç (holo. GAZI, iso. GAZI, ANK) village turnout, Pinus brutia Ten. and Quercus (Figure 1). pubescens Willd. openings, 480 m, 13.08.2016, Figure 1. Dianthus varankii sp. nov. (A) habit and habitat, (B) spiny leaves, (C) petals, (D) calyx and epicalyx scales. Diagnosis: Dianthus varankii is related to D. 23.5 mm, veinless below, distinctly 3540-veined aculeatus. It differs from this species mainly by stem above, puberulous, purplish; teeth narrowly oblong- 10‒26 cm long (not 2–6 cm); calyx 24‒30 mm long (not lanceolate, 710 × 11.5 mm, 79-veined, with ciliate 18‒26 mm); petal 30–37 mm long (not 22–26 mm); claw
Load more

Recommended publications
  • Untangling Phylogenetic Patterns and Taxonomic Confusion in Tribe Caryophylleae (Caryophyllaceae) with Special Focus on Generic
    TAXON 67 (1) • February 2018: 83–112 Madhani & al. • Phylogeny and taxonomy of Caryophylleae (Caryophyllaceae) Untangling phylogenetic patterns and taxonomic confusion in tribe Caryophylleae (Caryophyllaceae) with special focus on generic boundaries Hossein Madhani,1 Richard Rabeler,2 Atefeh Pirani,3 Bengt Oxelman,4 Guenther Heubl5 & Shahin Zarre1 1 Department of Plant Science, Center of Excellence in Phylogeny of Living Organisms, School of Biology, College of Science, University of Tehran, P.O. Box 14155-6455, Tehran, Iran 2 University of Michigan Herbarium-EEB, 3600 Varsity Drive, Ann Arbor, Michigan 48108-2228, U.S.A. 3 Department of Biology, Faculty of Sciences, Ferdowsi University of Mashhad, P.O. Box 91775-1436, Mashhad, Iran 4 Department of Biological and Environmental Sciences, University of Gothenburg, Box 461, 40530 Göteborg, Sweden 5 Biodiversity Research – Systematic Botany, Department of Biology I, Ludwig-Maximilians-Universität München, Menzinger Str. 67, 80638 München, Germany; and GeoBio Center LMU Author for correspondence: Shahin Zarre, [email protected] DOI https://doi.org/10.12705/671.6 Abstract Assigning correct names to taxa is a challenging goal in the taxonomy of many groups within the Caryophyllaceae. This challenge is most serious in tribe Caryophylleae since the supposed genera seem to be highly artificial, and the available morphological evidence cannot effectively be used for delimitation and exact determination of taxa. The main goal of the present study was to re-assess the monophyly of the genera currently recognized in this tribe using molecular phylogenetic data. We used the sequences of nuclear ribosomal internal transcribed spacer (ITS) and the chloroplast gene rps16 for 135 and 94 accessions, respectively, representing all 16 genera currently recognized in the tribe Caryophylleae, with a rich sampling of Gypsophila as one of the most heterogeneous groups in the tribe.
    [Show full text]
  • BOLLETTINO DELLA SOCIETÀ ENTOMOLOGICA ITALIANA Non-Commercial Use Only
    BOLL.ENTOMOL_150_2_cover.qxp_Layout 1 07/09/18 07:42 Pagina a Poste Italiane S.p.A. ISSN 0373-3491 Spedizione in Abbonamento Postale - 70% DCB Genova BOLLETTINO DELLA SOCIETÀ ENTOMOLOGICA only ITALIANA use Volume 150 Fascicolo II maggio-agosto 2018Non-commercial 31 agosto 2018 SOCIETÀ ENTOMOLOGICA ITALIANA via Brigata Liguria 9 Genova BOLL.ENTOMOL_150_2_cover.qxp_Layout 1 07/09/18 07:42 Pagina b SOCIETÀ ENTOMOLOGICA ITALIANA Sede di Genova, via Brigata Liguria, 9 presso il Museo Civico di Storia Naturale n Consiglio Direttivo 2018-2020 Presidente: Francesco Pennacchio Vice Presidente: Roberto Poggi Segretario: Davide Badano Amministratore/Tesoriere: Giulio Gardini Bibliotecario: Antonio Rey only Direttore delle Pubblicazioni: Pier Mauro Giachino Consiglieri: Alberto Alma, Alberto Ballerio,use Andrea Battisti, Marco A. Bologna, Achille Casale, Marco Dellacasa, Loris Galli, Gianfranco Liberti, Bruno Massa, Massimo Meregalli, Luciana Tavella, Stefano Zoia Revisori dei Conti: Enrico Gallo, Sergio Riese, Giuliano Lo Pinto Revisori dei Conti supplenti: Giovanni Tognon, Marco Terrile Non-commercial n Consulenti Editoriali PAOLO AUDISIO (Roma) - EMILIO BALLETTO (Torino) - MAURIZIO BIONDI (L’Aquila) - MARCO A. BOLOGNA (Roma) PIETRO BRANDMAYR (Cosenza) - ROMANO DALLAI (Siena) - MARCO DELLACASA (Calci, Pisa) - ERNST HEISS (Innsbruck) - MANFRED JÄCH (Wien) - FRANCO MASON (Verona) - LUIGI MASUTTI (Padova) - MASSIMO MEREGALLI (Torino) - ALESSANDRO MINELLI (Padova)- IGNACIO RIBERA (Barcelona) - JOSÉ M. SALGADO COSTAS (Leon) - VALERIO SBORDONI (Roma) - BARBARA KNOFLACH-THALER (Innsbruck) - STEFANO TURILLAZZI (Firenze) - ALBERTO ZILLI (Londra) - PETER ZWICK (Schlitz). ISSN 0373-3491 BOLLETTINO DELLA SOCIETÀ ENTOMOLOGICA ITALIANA only use Fondata nel 1869 - Eretta a Ente Morale con R. Decreto 28 Maggio 1936 Volume 150 Fascicolo II maggio-agosto 2018Non-commercial 31 agosto 2018 REGISTRATO PRESSO IL TRIBUNALE DI GENOVA AL N.
    [Show full text]
  • Red List of Vascular Plants of the Czech Republic: 3Rd Edition
    Preslia 84: 631–645, 2012 631 Red List of vascular plants of the Czech Republic: 3rd edition Červený seznam cévnatých rostlin České republiky: třetí vydání Dedicated to the centenary of the Czech Botanical Society (1912–2012) VítGrulich Department of Botany and Zoology, Masaryk University, Kotlářská 2, CZ-611 37 Brno, Czech Republic, e-mail: [email protected] Grulich V. (2012): Red List of vascular plants of the Czech Republic: 3rd edition. – Preslia 84: 631–645. The knowledge of the flora of the Czech Republic has substantially improved since the second ver- sion of the national Red List was published, mainly due to large-scale field recording during the last decade and the resulting large national databases. In this paper, an updated Red List is presented and compared with the previous editions of 1979 and 2000. The complete updated Red List consists of 1720 taxa (listed in Electronic Appendix 1), accounting for more then a half (59.2%) of the native flora of the Czech Republic. Of the Red-Listed taxa, 156 (9.1% of the total number on the list) are in the A categories, which include taxa that have vanished from the flora or are not known to occur at present, 471 (27.4%) are classified as critically threatened, 357 (20.8%) as threatened and 356 (20.7%) as endangered. From 1979 to 2000 to 2012, there has been an increase in the total number of taxa included in the Red List (from 1190 to 1627 to 1720) and in most categories, mainly for the following reasons: (i) The continuing human pressure on many natural and semi-natural habitats is reflected in the increased vulnerability or level of threat to many vascular plants; some vulnerable species therefore became endangered, those endangered critically threatened, while species until recently not classified may be included in the Red List as vulnerable or even endangered.
    [Show full text]
  • New Jersey Strategic Management Plan for Invasive Species
    New Jersey Strategic Management Plan for Invasive Species The Recommendations of the New Jersey Invasive Species Council to Governor Jon S. Corzine Pursuant to New Jersey Executive Order #97 Vision Statement: “To reduce the impacts of invasive species on New Jersey’s biodiversity, natural resources, agricultural resources and human health through prevention, control and restoration, and to prevent new invasive species from becoming established.” Prepared by Michael Van Clef, Ph.D. Ecological Solutions LLC 9 Warren Lane Great Meadows, New Jersey 07838 908-637-8003 908-528-6674 [email protected] The first draft of this plan was produced by the author, under contract with the New Jersey Invasive Species Council, in February 2007. Two subsequent drafts were prepared by the author based on direction provided by the Council. The final plan was approved by the Council in August 2009 following revisions by staff of the Department of Environmental Protection. Cover Photos: Top row left: Gypsy Moth (Lymantria dispar); Photo by NJ Department of Agriculture Top row center: Multiflora Rose (Rosa multiflora); Photo by Leslie J. Mehrhoff, University of Connecticut, Bugwood.org Top row right: Japanese Honeysuckle (Lonicera japonica); Photo by Troy Evans, Eastern Kentucky University, Bugwood.org Middle row left: Mile-a-Minute (Polygonum perfoliatum); Photo by Jil M. Swearingen, USDI, National Park Service, Bugwood.org Middle row center: Canadian Thistle (Cirsium arvense); Photo by Steve Dewey, Utah State University, Bugwood.org Middle row right: Asian
    [Show full text]
  • Composition and Ecology of the Quercus Coccifera L
    Plant Biosystems, 2015 http://dx.doi.org/10.1080/11263504.2014.1001461 ORIGINAL ARTICLE Composition and ecology of the Quercus coccifera L. communities along the eastern Adriatic coast (NE Mediterranean) N. JASPRICA1,Zˇ .SˇKVORC2, K. DOLINA1, M. RUSˇCˇ IC´ 3,S.KOVACˇ IC´ 4, & J. FRANJIC´ 2 1Institute for Marine and Coastal Research, University of Dubrovnik, Kneza Damjana Jude 12, P.O. Box 83, HR-20000 Dubrovnik, Croatia; 2Faculty of Forestry, University of Zagreb, Svetosˇimunska 25, HR-10000 Zagreb, Croatia; 3Faculty of Natural Sciences, Mathematics and Education, University of Split, Teslina 12, HR-21000 Split, Croatia and 4Botanical Garden, Faculty of Science, University of Zagreb, Marulic´ev trg 9a, HR-10000 Zagreb, Croatia Abstract The aim of this study is to classify and describe all plant communities with Quercus coccifera covering the entire eastern Adriatic coast and islands from north Croatia to south Albania, and to relate their species composition, chorotypes and life forms to environmental factors using Pignatti ecological indicator values. From total 70 phytosociological releve´s, we identified and described four floristically and ecologically distinctive vegetation communities (two new proposed subassociations, one association and stand each) using TWINSPAN and the Braun-Blanquet classification scheme. In Croatia and Montenegro, Q. coccifera is forming macchia within the Fraxino orni–Quercetum cocciferae pistacietosum lentisci. Quercus coccifera occurs only sparsely in south Croatia as a shrubland within Fraxino orni–Quercetum cocciferae nerietosum oleandri subassociation or macchia within the Erico arboreae–Arbutetum unedonis association. Despite the difference in biogeographic position and bioclimates, low shrubby Albanian Q. coccifera stands are more closely related to the Q.
    [Show full text]
  • A Taxonomic Backbone for the Global Synthesis of Species Diversity in the Angiosperm Order Caryophyllales
    Zurich Open Repository and Archive University of Zurich Main Library Strickhofstrasse 39 CH-8057 Zurich www.zora.uzh.ch Year: 2015 A taxonomic backbone for the global synthesis of species diversity in the angiosperm order Caryophyllales Hernández-Ledesma, Patricia; Berendsohn, Walter G; Borsch, Thomas; Mering, Sabine Von; Akhani, Hossein; Arias, Salvador; Castañeda-Noa, Idelfonso; Eggli, Urs; Eriksson, Roger; Flores-Olvera, Hilda; Fuentes-Bazán, Susy; Kadereit, Gudrun; Klak, Cornelia; Korotkova, Nadja; Nyffeler, Reto; Ocampo, Gilberto; Ochoterena, Helga; Oxelman, Bengt; Rabeler, Richard K; Sanchez, Adriana; Schlumpberger, Boris O; Uotila, Pertti Abstract: The Caryophyllales constitute a major lineage of flowering plants with approximately 12500 species in 39 families. A taxonomic backbone at the genus level is provided that reflects the current state of knowledge and accepts 749 genera for the order. A detailed review of the literature of the past two decades shows that enormous progress has been made in understanding overall phylogenetic relationships in Caryophyllales. The process of re-circumscribing families in order to be monophyletic appears to be largely complete and has led to the recognition of eight new families (Anacampserotaceae, Kewaceae, Limeaceae, Lophiocarpaceae, Macarthuriaceae, Microteaceae, Montiaceae and Talinaceae), while the phylogenetic evaluation of generic concepts is still well underway. As a result of this, the number of genera has increased by more than ten percent in comparison to the last complete treatments in the Families and genera of vascular plants” series. A checklist with all currently accepted genus names in Caryophyllales, as well as nomenclatural references, type names and synonymy is presented. Notes indicate how extensively the respective genera have been studied in a phylogenetic context.
    [Show full text]
  • Reproductive Characteristics As Drivers of Alien Plant Naturalization and Invasion
    Reproductive characteristics as drivers of alien plant naturalization and invasion Dissertation submitted for the degree of Doctor of Natural Sciences presented by Mialy Harindra Razanajatovo at the Faculty of Sciences Department of Biology Date of the oral examination: 12 February 2016 First referee: Prof. Dr. Mark van Kleunen Second referee: Prof. Dr. Markus Fischer Konstanzer Online-Publikations-System (KOPS) URL: http://nbn-resolving.de/urn:nbn:de:bsz:352-0-324483 Summary Due to human activity and global movements, many plant species have been introduced to non-native regions where they experience novel abiotic and biotic conditions. Some of these alien species manage to establish reproducing naturalized populations, and some naturalized alien species subsequently become invasive. Invasion by alien plant species can negatively affect native communities and ecosystems, but what gives the alien species an advantage under novel conditions is still not clear. Therefore, identifying the drivers of invasions has become a major goal in invasion ecology. Reproduction is crucial in plant invasions, because propagule supply is required for founding new populations, population maintenance and spread in non-native regions. Baker’s Law, referring to the superior advantage of species capable of uniparental reproduction in establishing after long distance dispersal, has received major interest in explaining plant invasions. However, previous findings regarding Baker’s Law are contradicting. Moreover, there has been an increasing interest in understanding the integration of alien plant species into native plant-pollinator networks but few studies have looked at the pollination ecology of successful (naturalized and invasive) and unsuccessful (non-naturalized and non-invasive) alien plant species.
    [Show full text]
  • Vascular Flora of Eight Water Reservoir Areas in Southern Italy
    11 2 1593 the journal of biodiversity data February 2015 Check List LISTS OF SPECIES Check List 11(2): 1593, February 2015 doi: http://dx.doi.org/10.15560/11.2.1593 ISSN 1809-127X © 2015 Check List and Authors Vascular flora of eight water reservoir areas in southern Italy Antonio Croce Second University of Naples, Department of Environmental Biological and Pharmaceutical Sciences and Technologies, Via Vivaldi, 43, 8100 Caserta, Italy E-mail: [email protected] Abstract: Artificial lakes play an important role in Although many authors have reported the negative maintaining the valuable biodiversity linked to water impact of dams on rivers and their ecosystems (e.g., bodies and related habitats. The vascular plant diversity McAllister et al. 2001; Nilsson et al. 2005), dams are of eight reservoirs and surrounding areas in southern very important for wildlife, such as birds (Mancuso Italy was inventoried and further analysed in terms of 2010). Artificial lakes fulfill an important role as water biodiversity. A total of 730 specific and subspecific taxa reservoirs for agricultural irrigation; however, their were recorded, with 179 taxa in the poorest area and 303 other functions, such as recreation, fishing, and bio- in the richest one. The results indicate a good richness diversity conservation, should not be overlooked. The of the habitats surrounding the water basins, with some Italian National Institute for Economic Agriculture species of nature conservation interest and only a few (INEA) launched the project “Azione 7” (Romano and alien species. Costantini 2010) to assess the suitability of reservoirs in southern Italy for nature conservation purposes.
    [Show full text]
  • Southern Ontario Vascular Plant Species List
    Southern Ontario Vascular Plant Species List (Sorted by Scientific Name) Based on the Ontario Plant List (Newmaster et al. 1998) David J. Bradley Southern Science & Information Section Ontario Ministry of Natural Resources Peterborough, Ontario Revised Edition, 2007 Southern Ontario Vascular Plant Species List This species checklist has been compiled in order to assist field biologists who are sampling vegetative plots in Southern Ontario. It is not intended to be a complete species list for the region. The intended range for this vascular plant list is Ecoregions (Site Regions) 5E, 6E and 7E. i Nomenclature The nomenclature used for this listing of 2,532 plant species, subspecies and varieties, is in accordance with the Ontario Plant List (OPL), 1998 [see Further Reading for full citation]. This is the Ontario Ministry of Natural Resource’s publication which has been selected as the corporate standard for plant nomenclature. There have been many nomenclatural innovations in the past several years since the publication of the Ontario Plant List that are not reflected in this listing. However, the OPL has a listing of many of the synonyms that have been used recently in the botanical literature. For a more up to date listing of scientific plant names visit either of the following web sites: Flora of North America - http://www.efloras.org/flora_page.aspx?flora_id=1 NatureServe - http://www.natureserve.org/explorer/servlet/NatureServe?init=Species People who are familiar with the Natural Heritage Information Centre (NHIC) plant species list for Ontario, will notice some changes in the nomenclature. For example, most of the Aster species have now been put into the genus Symphyotrichum, with a few into the genus Eurybia.
    [Show full text]
  • Caryophyllaceae.Pdf
    Flora of China 6: 1–113. 2001. CARYOPHYLLACEAE 石竹科 shi zhu ke Lu Dequan (鲁德全)1, Wu Zhengyi (吴征镒 Wu Cheng-yih)2, Zhou Lihua (周丽华)2, Chen Shilong (陈世龙)3; Michael G. Gilbert4, Magnus Lidén5, John McNeill6, John K. Morton7, Bengt Oxelman8, Richard K. Rabeler9, Mats Thulin8, Nicholas J. Turland10, Warren L. Wagner11 Herbs annual or perennial, rarely subshrubs or shrubs. Stems and branches usually swollen at nodes. Leaves opposite, decussate, rarely alternate or verticillate, simple, entire, usually connate at base; stipules scarious, bristly, or often absent. Inflorescence of cymes or cymose panicles, rarely flowers solitary or few in racemes, capitula, pseudoverticillasters, or umbels. Flowers actinomorphic, bisexual, rarely unisexual, occasionally cleistogamous. Sepals (4 or)5, free, imbricate, or connate into a tube, leaflike or scarious, persistent, sometimes bracteate below calyx. Petals (4 or)5, rarely absent, free, often comprising claw and limb; limb entire or split, usually with coronal scales at juncture of claw and limb. Stamens (2–)5–10, in 1 or 2 series. Pistil 1; carpels 2–5, united into a compound ovary. Ovary superior, 1-loculed or basally imperfectly 2–5-loculed. Gynophore present or absent. Placentation free, central, rarely basal; ovules (1 or) few or numerous, campylotropous. Styles (1 or)2–5, sometimes united at base. Fruit usually a capsule, with pericarp crustaceous, scarious, or papery, dehiscing by teeth or valves 1 or 2 × as many as styles, rarely berrylike with irregular dehiscence or an achene. Seeds 1 to numerous, reniform, ovoid, or rarely dorsiventrally compressed, abaxially grooved, blunt, or sharply pointed, rarely fimbriate-pectinate; testa granular, striate or tuberculate, rarely smooth or spongy; embryo strongly curved and surrounding perisperm or straight but eccentric; perisperm mealy.
    [Show full text]
  • Latin for Gardeners: Over 3,000 Plant Names Explained and Explored
    L ATIN for GARDENERS ACANTHUS bear’s breeches Lorraine Harrison is the author of several books, including Inspiring Sussex Gardeners, The Shaker Book of the Garden, How to Read Gardens, and A Potted History of Vegetables: A Kitchen Cornucopia. The University of Chicago Press, Chicago 60637 © 2012 Quid Publishing Conceived, designed and produced by Quid Publishing Level 4, Sheridan House 114 Western Road Hove BN3 1DD England Designed by Lindsey Johns All rights reserved. Published 2012. Printed in China 22 21 20 19 18 17 16 15 14 13 1 2 3 4 5 ISBN-13: 978-0-226-00919-3 (cloth) ISBN-13: 978-0-226-00922-3 (e-book) Library of Congress Cataloging-in-Publication Data Harrison, Lorraine. Latin for gardeners : over 3,000 plant names explained and explored / Lorraine Harrison. pages ; cm ISBN 978-0-226-00919-3 (cloth : alkaline paper) — ISBN (invalid) 978-0-226-00922-3 (e-book) 1. Latin language—Etymology—Names—Dictionaries. 2. Latin language—Technical Latin—Dictionaries. 3. Plants—Nomenclature—Dictionaries—Latin. 4. Plants—History. I. Title. PA2387.H37 2012 580.1’4—dc23 2012020837 ∞ This paper meets the requirements of ANSI/NISO Z39.48-1992 (Permanence of Paper). L ATIN for GARDENERS Over 3,000 Plant Names Explained and Explored LORRAINE HARRISON The University of Chicago Press Contents Preface 6 How to Use This Book 8 A Short History of Botanical Latin 9 Jasminum, Botanical Latin for Beginners 10 jasmine (p. 116) An Introduction to the A–Z Listings 13 THE A-Z LISTINGS OF LatIN PlaNT NAMES A from a- to azureus 14 B from babylonicus to byzantinus 37 C from cacaliifolius to cytisoides 45 D from dactyliferus to dyerianum 69 E from e- to eyriesii 79 F from fabaceus to futilis 85 G from gaditanus to gymnocarpus 94 H from haastii to hystrix 102 I from ibericus to ixocarpus 109 J from jacobaeus to juvenilis 115 K from kamtschaticus to kurdicus 117 L from labiatus to lysimachioides 118 Tropaeolum majus, M from macedonicus to myrtifolius 129 nasturtium (p.
    [Show full text]
  • Plant-Virus Infection Inhibitors: the Great Potential of Caryophyllales Species
    Physiological and Molecular Plant Pathology 113 (2021) 101597 Contents lists available at ScienceDirect Physiological and Molecular Plant Pathology journal homepage: www.elsevier.com/locate/pmpp Plant-virus infection inhibitors: The great potential of Caryophyllales species Lígia Maria Lembo Duarte a,*, Maria Am´elia Vaz Alexandre a, Alexandre Levi Rodrigues Chaves a, D´eborah Yara Alves Cursino dos Santos b, Ana Claudia Oliveira de Souza c, Luis Carlos Bernacci c a Laboratorio´ de Fitovirologia e Fisiopatologia, Instituto Biologico,´ Sao~ Paulo, Brazil b Laboratorio´ de Fitoquímica, Departamento de Botanica,^ Instituto de Bioci^encias, Universidade de Sao~ Paulo, Sao~ Paulo, Brazil c Centro de Recursos Gen´eticos Vegetais, Instituto Agronomico^ de Campinas, Sao~ Paulo, Brazil ARTICLE INFO ABSTRACT Keywords: Caryophyllales is one of the largest orders in eudicots and comprises 39 families with approximately 12,500 Caryophyllales species. Although extracts from species of this order have been considered potential inhibitors of plant virus Antiviral protein infection since the early 20th century, few species have actually been investigated. In this review, we present an Defense inducer exhaustive analysis of published papers that investigate this inhibitory effect, organized into one table with more Inhibitor mode of action than 100 species. In addition, the main hypotheses regarding the mode of action by which the compounds inhibit Signaling plant defense viral infection are discussed, providing several examples. The proteinaceous nature of antiviral proteins (AVP) produced by Caryophyllales, as well as the role of ribosome-inactivating proteins (RIPs) and pathogenesis-related proteins (PRs) as plant-defense inducers have received considerable attention. It is worth mentioning that data concerning the role of AVPs produced by species of Caryophyllales as signaling plant defense against viruses are scarce.
    [Show full text]