e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 1283–1291
Available online at www.sciencedirect.com
ScienceDirect
jo urnal homepage: www.elsevier.com/locate/etap
The identification of metallothionein in rare
minnow (Gobiocypris rarus) and its expression
following heavy metal exposure
a,b,c a,b,c,∗ a,b,c
Chunling Wang , Futie Zhang , Wenxuan Cao , a,b,c Jianwei Wang
a
Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, Hubei Province 430072, PR China
b
The Key Laboratory of Aquatic Biodiversity and Conservation of Chinese Academy Of Sciences, Wuhan, Hubei
430072, PR China
c
University of Chinese Academy of Sciences, Beijing 100039, PR China
a r t a b
i c s t
l e i n f o r a c t
Article history: Heavy metal, such as cadmium (Cd), lead (Pb) and copper (Cu) poses serious toxin to aquatic
Received 7 November 2013 organisms. These exogenous materials affect biological processes including physiology,
Received in revised form biochemistry and development. Metallothionein (MT), one of the metal-regulated genes,
15 April 2014 participates in regulating essential and detoxifying non-essential metals in living animals.
Accepted 18 April 2014 In this study, MT EST in rare minnow (Gobiocypris rarus) (GrMT) was obtained from the cDNA
Available online 28 April 2014 subtraction library and the GrMT cDNA was firstly cloned by RACE with a sequence of 379 bp,
which can code 60 amino acids. After Cd exposure, the GrMT expression levels dramati-
Keywords: cally changed in liver, spleen, gill, kidney, intestine, but moderately in muscle. Significantly
Heavy metals positive relationships were found between Cd dosages and MT expression levels in liver.
Rare minnow And there distinction existed at the GrMT transcript level in fish gender and developmen-
Metallothionein tal stages during Cd exposure. While Pb exposure, the expression alteration happened in
Gene expression spleen, gill, intestine, muscle, and moderately in liver. In the Cu treatment test, there were
slight changes in intestine and kidney, but more significant changes occurred in spleen, gill,
muscle, and liver. This study had investigated the effects of diverse heavy metals on GrMT
expression patterns. The results suggest that GrMT would be a potential biomarker to metal
contamination monitoring in aquatic environments and rare minnow could be one of the
perfect experimental fishes for surveying the freshwater pollution in China.
© 2014 Elsevier B.V. All rights reserved.
The heavy metal contamination in aquatic ecosystems has
1. Introduction
attracted worldwide attention. These exogenous materials
affect biological processes including physiology, biochem-
Heavy metals, such as cadmium (Cd), lead (Pb) and copper istry and development (Zhu et al., 2011). Cd is a ubiquitous
(Cu), are in high concentrations in many aquatic environment environment contaminant that has been detected in vari-
(Zenk, 1996). They pose serious toxin to aquatic organisms. ous aquatic organisms. Cd, even in low concentrations, could
∗
Corresponding author at: The Key Laboratory of Aquatic Biodiversity and Conservation of Chinese Academy Of Sciences, Wuhan, Hubei
430072, PR China. Tel.: +86 27 68780723; fax: +86 27 68780065.
E-mail address: [email protected] (F. Zhang).
http://dx.doi.org/10.1016/j.etap.2014.04.021
1382-6689/© 2014 Elsevier B.V. All rights reserved.
1284 e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 1283–1291
2+
induce oxidative stress response and DNA damage in the liv- (Wang et al., 2013). Mean lethal concentration (LC50) of Cd
ers of Cyprinus carpio var. color (Jia et al., 2011). When in high was evaluated among different groups with 10 fish in each
level, Cd would cause cytotoxicity (George et al., 1996). Cu is group at 48 h post-exposure.
an essential micronutrient for fish function. However, redun-
2+
dant Cu would exert a variety of physiological effects in fish, 2.1.2. Cd dosage-dependent experiment
such as increasing heart rates and retarding the development Rare minnow adult fish without gender difference, described
of zebra fish embryos (Johnson et al., 2007). Short-term expo- in Section 2.1.1, were exposed to six differential concentra-
sure to high concentration Pb can cause brain and kidney tions of Cd ion including: 0 g/L, 100 g/L, 200 g/L, 400 g/L,
damage and gastrointestinal distress in humans (Jarup, 2003). 800 g/L, and 1600 g/L. There were two tanks in each concen-
Gene expressions affected by heavy metals has arouse certain tration with 10 fish in each tank. Several fish were sacrificed
notices recently, and metallothionein (MT) is one of the genes and livers were collected at 0 h and 12 h exposure, then quickly
that are regulated by various heavy metal ions. removed and homogenized in RNAlater (Sigma) reagent and
◦
MTs are a family of cysteine-rich, low-molecular-weight, stored at −20 C until future analysis.
metal-binding proteins that have been reported for a variety of
2+
living organisms from prokaryotes to eukaryotes. MT has high 2.1.3. Male and female fish exposed to Cd solution
cysteine content (30%) and is highly conservative in the pro- separately
cess of evolution. It participates in regulating essential metals Male and female fish, described in Section 2.1.1, were sep-
2+
(zinc and copper) and detoxifying non-essential metals (cad- arately exposed to Cd solution. The concentration was
2+
mium, lead, and mercury) in living animals. The role of MT selected based on Cd 48hLC50. Male fish were treated in four
in detoxification of heavy metals and maintaining of essential tanks with 10 fish in each tank, 2 were metal treated groups
metal homeostasis, which is due to its high affinity for these while the other were blank. Several fish were sacrificed and
metals, is mostly investigated in recent years (Bervoets et al., kidney, liver, muscle, and spleen were collected at 0 h and
2013). 12 h exposure. Tissues were quickly removed and individually
◦
We employed rare minnow as a model fish in this study. homogenized in RNAlater (Sigma) reagent and stored at −20 C
Rare minnow, a native endemic species in China, has many until future analysis. Female fish were treated just as the male.
excellent biological characteristics for aquatic toxicity tests:
2+
small size (38–85 mm for adult), ease of culture in laboratory, 2.1.4. Fish zygote and larvae exposure to Cd solution
frequent spawning of transparent eggs (every 4 days), short Fish zygote not later than 8 h post-fertilization and newly
◦ 2+
generation span, wide range of temperature (0–35 C). More- hatched larvae were collected and exposed to Cd solu-
2+
over, it has been approved to be sensitive to Cd and other tion. The concentration was selected based on Cd 48hLC50.
environmental contaminant (Wei et al., 2008). After 0 h and 12 h exposure, zygote and larvae were collected,
In the present work, our goal was to study MT gene expres- quickly removed and individually homogenized in RNAlater
◦
sion pattern in rare minnow including: MT expression after (Sigma) reagent and stored at −20 C until future analysis.
2+ 2+
exposure to Cd ; the relationship between Cd concentra-
tion and MT expression level in liver; the influence of fish 2.1.5. Adult fish without gender difference exposed to
2+ 2+
development stage and adult gender on gene expression; and various concentrations of Pb and Cu solution
2+ 2+ 2+ 2+ 2+
the regulations of other metals such as Cu and Pb on MT Fish exposed to Pb and Cu were treated as the Cd exper-
expression, to offer the baseline biological data of rare minnow iment described in Section 2.1.1. Different groups included
2+
exposure to heavy metal pollution in water. 0 mg/L, 1 mg/L, 2 mg/L, 4 mg/L and 8 mg/L Pb solution, while
different groups included 0 g/L, 3 g/L, 6 g/L, 12 g/L and
2+ 2+
24 g/L Cu solution. Mean lethal concentration (LC50) of Pb
2. Materials and methods 2+
and Cu was evaluated among different groups with 10 fish
in each group at 48 h after exposure.
2.1. Fish and heavy metals exposure experiments
2.2. Total RNA isolation and cDNAs synthesis
CdCl2, Pb(NO3)2, and CuSO4 were purchased from Geel
(Belgium) for analysis. The ultra-pure grade water was from
Total RNA extraction was performed as described in our pre-
Millipore instrument (Hi-tech).
vious study (Wang et al., 2013).
2.1.1. Adult fish without gender difference exposed to 2.3. Construction of cDNA subtraction library and
2+
various concentrations of Cd solution rapid amplification of cDNA ends (RACE)
Rare minnow adult fish (2 months old) with an average length
±
2.1 0.2 mm were obtained from a laboratory hatchery and cDNA subtraction library was constructed as described in our
maintained in 5 L glass tanks (2 bodies/L) for 2 days before previous study (Wang et al., 2013).
metal exposure. During feeding, fish were maintained at To obtain full-length rare minnow MT cDNA sequence,
± ◦
25 1 C and subjected to a photoperiod of 16 h:8 h (light:dark). 3 and 5 rapid amplification of cDNA ends (RACE) reac-
TM
The average pH and dissolved oxygen (DO) of tank water tion was performed using the SMART RACE cDNA
were 7.4 ± 0.1 and 5.8± 0.2 mg/L, respectively. Before experi- Amplification Kit (Clontech Laboratories, USA) according to
2+
ment, the animals were apparently healthy. The Cd exposure the manufacturer’s instruction. The gene-specific primers
experiment was performed as described in our previous study (GSPs) were designed and synthesized according to partial
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 1283–1291 1285
Table 1 – Twenty-six metallothionein nucleotide fragments used for construction of phylogenetic tree.
Species Nucleotide Accession no. Species Nucleotide Accession no.
Mus musculus MT-3 NM 013603 Rattus norvegicus MT-4 NM 001126084
MT-1 NM 013602 MT-1A NM 138826
MT-2 NM 008630 Salmo salar MT NM 001141338
Homo sapiens MT-2A NM 005953 MT-A X97274
MT-1B NM 005947 Gobio gobio MT-1 AY953544
Carassius auratus MT X97271 MT-2 AY953546
Hemibarbus mylodon MT EF689139 Danio rerio MT-2 NM 001131053
Xenopus laevis MT X69380 MT-A X97278
Carassius cuvieri MT-A AY165047 MT NM 131075
Oryzias latipes MT NM 001104785 Cyprinus carpio MT AF002161
Oryctolagus cuniculus MT-3 NM 001082220 Ovis aries MT-3 NM 001009755
Bos taurus MT-3 NM 001113304 Hyriopsis cumingii MT FJ861993
Rattus norvegicus MT-3 NM 053968 Gobiocypris rarus MT KC190024
sequence of MT that had been obtained from the cDNA the specificity of the PCR product as displayed by a single
subtraction library above. The GSPs for MT were as fol- peak. When the efficiencies of MT and -actin amplifications
lows: GSP1, 5 -GATTGTGCCAAGACTGGAAC-3 ; and GSP2, were approximately equal, differences in mRNA expression
−Ct
5 -CTTCATTGACGCAGCTGGA-3 . Following experiment was patterns were calculated using the 2 method, where Ct is
performed as described in our previous work (Wang et al., the threshold cycle. The method was based on the equation:
−Ct
2013). the relative mRNA ratio of the target gene = 2 , where
− − −
The generated sequence was used to search for sequence Ct = (Ct(target) Ct(Actin))treatment (Ct(target) Ct(Actin))blank
similarity by BLAST analysis using the web servers of (Livak and Schmittgen, 2001).
the National Center of Biotechnology Information (Altschul
et al., 1997). Multiple sequence alignments were analyzed by 2.5. Statistical analyses
CLUSTALX program (Thompson et al., 1994) The neighbor-
joining method was used to construct a phylogenetic tree All data were presented as means ± SD. Group means were
based on the multiple alignments of known MT sequences compared using one-way ANOVA followed by Duncan’s mul-
(Table 1) by MEGA 4 program (Tamura et al., 2007). tiple range test to identify differences among groups, while
paired-samples were compared with Student’s t-test. A p value
2.4. mRNA quantification by real-time quantitative of less than 0.05 was considered significant. All analyses were
PCR performed by SPSS software (version 16.0).
The changes of MT expression in samples that involved differ-
3. Results and discussion
ent metals exposure were quantified by real-time quantitative
PCR analysis using a SuperReal PreMix (SYBR Green) (TIAN-
3.1. 48hLC50 of rare minnow exposure to heavy
GEN, China). Real-time quantitative PCR was performed as
metals
described in the previous work (Wang et al., 2013). The primers
for rare minnow MT were designed from partial fragment
2+ 2+ 2+
The 48hLC50 of Cd , Cu , and Pb solutions were as follow-
gained in the cDNA subtraction library while the primers for
ing: 400 g/L, 9 g/L, and 3.9 mg/L, respectively.
-actin were designed from conserved regions of correspond-
ing genes from rare minnow. All the primers were listed in
◦
Table 2. The thermal conditions for PCR were as follows: 95 C 3.2. Cloning and characterization of GrMT cDNA
◦ ◦ ◦
for 15 min, 39 cycles with 95 C for 15 s, 60 C for 15 s, 72 C for
◦
25 s, and finally at 72 C for 5 min. A melting curve was created MTs are low molecular and cysteine-rich proteins, which were
◦ ◦ ◦
by increasing the temperature from 65 C to 95 C by 0.5 C discovered in 1957 as cadmium-binding proteins isolated from
intervals. All samples were analyzed in triplicate. After PCR, horse kidney (Margoshes and Vallee, 1957). In the present
the melting curve analysis was performed to demonstrate study, GrMT EST was obtained from cDNA subtraction library
and we got GrMT cDNA sequence by performing 3 - and 5 -
RACE. GrMT cDNA was composed of a 69 bp 5 UTR, a 183 bp
ORF and a 127 bp 3 UTR (Fig. 1). The nucleotide sequence for
Table 2 – Primers for RACE-PCR and real-time PCR. GrMT was submitted to GenBank with accession number. The
Gene name 5 –3 Primer sequence Note predicted amino acid sequence of GrMT cDNA corresponds to
a protein of 60 amino acids, 20 of them being cysteines, where
MT-F TGTGCCAAGACTGGAACTTG RACE-PCR
cysteine content forms 33.3%. This value is consistent with the
MT-R GCAGCAGGGACAGCAACTCTTCT RACE-PCR
-actin-F TGGTATGGGACAGAAAGAC Real-time PCR cysteine content found in Hemibarbus mylodon (Cho et al., 2008).
-actin-R TGTAGAAGGTGTGATGCC Real-time PCR Otherwise, the cysteine residues form 6 Cys-X-Cys, 2 Cys-X2-
MT-F GGGACTTTCGGACTCTTT Real-time PCR Cys and 4 Cys-X3-Cys motifs, where X represents non-cysteine
MT-R GGGACAGCAACTCTTCTT Real-time PCR
amino acids (Fig. 1). When GrMT was compared to MT gene in
1286 e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 1283–1291
TCATTCACAAACCGAGTGAAGCGATATTTCAAGGGACTTTCGGACTCTTTGAGA ATA
CTACTGA GGAAA
M D P C D C A K T G T C N C G A T C K
ATGGATCCTTGCGATTGTGCCAA GACTGGAACTTGCAACTGCGGTGCCACCTGCAAG
C T N C Q C T T C K K S C C P C C P S
TGCACCAATTGCCAGTG TACCACCTGCAAGAAGAGTTGCTGTCCCTGCTGCCCGTCT
G C S K C A S G C V C K G N S C G S S
GGTTGCA GCAAATGTGCCTCTGGTTGTGTCTGTAAGGGCAATTCCTGCGGCTCTAGC
C C Q TGCTGTCAG *
TGA
GGAGGTCAACGTGATGTTTTGTTACAGC AATGTGAATTTGTTCGTCGGTAGTCGTCC
TTGTTTTGCATTGC ATAAATGTATTTCTGTGGGATAATAAATAACCTCCATTTTTTCTC
GTTGATAA CAA
Fig. 1 – Nucleotide and deduced amino acid sequence of rare minnow MT. The nucleotide sequence for rare minnow MT was
deposited in GenBank with accession number: KC190024. The start codon and stop codon are indicated in bold. Cys-X-Cys
motifs were noted by boxes, and Cys-X2-Cys were noted by wave lines, while underlines noted the Cys-X3-Cys formation.
other fish, both the number and location of cysteine residues then clustered with Mammalia. A MT gene of rare minnow was
were highly conserved. The amino acid sequences of the GrMT isolated and characterized for the first time in this work. The
were 56.5%, 59.0%, 34.7%, 60.7%, 73.8% and 98.3% homologous isolation and characterization of novel MT genes will make
with those of Xenopus laevis, Homo sapiens, Crassostrea virginica, a better interpretation about the evolution of MT genes and
Oryctolagus cuniculus, Salmo salar, and H. mylodon, respectively their functional divergence.
(Fig. 2). The amino acid sequence of GrMT is similar in length
with the species in Fig. 2, which vary from 59 aa to 75 aa. A
phylogenetic tree was constructed with GrMT and 25 other 3.3. Rare minnow exposed to heavy metals
known metallothionein nucleotide sequences (Fig. 3). It sug-
2+
gests that MT gene we cloned from rare minnow belongs to 3.3.1. GrMT expression in tissues response to Cd
the MT family. It is obvious that there are two main clades exposure at different time
in the NJ tree: invertebrate and vertebrate. Lineage vertebrate To test spatiotemporal expression of GrMT, the mRNA levels
consisted of Actinopterygii, Amphibia, and Mammalia, where of GrMT after Cd exposure at concentration of 400 g/L at dif-
Actinopterygii and Amphibia form one monophyletic group, ferent time (1 h, 6 h, 12 h, 24 h, and 48 h) were measured in
Fig. 2 – Multiple alignments of metallothionein amino acid sequences. Missing amino acids are denoted by hyphens.
Identical (*) and similar (: and.) residues identified by the CLUSTALX program are indicated. The accession numbers are
listed below: Xenopus laevis metallothionein (AAB59949, XlMT), Homo sapiens metallothionein (AAP97267, HsMT),
Crassostrea virginica metallothionein (CAA42522, CvMT), Oryctolagus cuniculus metallothionein (1515428A, OcMT), Salmo
salar metallothionein (NP 001134810, SsMT), Hemibarbus mylodon metallothionein (ABS87377, HmMT).
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 1283–1291 1287
Fig. 3 – Neighbor-joining (NJ) tree analyzed with MEGA 4 based on 26 metallothionein family nucleotide sequences. The
metallothionein sequences are derived from Mus musculus (Mm), Homo sapiens (Hs), Carassius auratus (Ca), Hemibarbus
mylodon (Hm), Xenopus laevis (Xl), Carassius cuvieri (Cc), Oryzias latipes (Ol), Oryctolagus cuniculus (Oc), Bos taurus (Bt), Rattus
norvegicus (Rn), Salmo salar (Ss), Gobio gobio (Gg), Danio rerio (Dr), Cyprinus carpio (Cca), Ovis aries (Oa), and Hyriopsis cumingii
(Hc). GenBank accession numbers of nucleotide fragments used for analysis are shown in Table 1.
six tissues including liver, intestine, spleen, muscle, gill, and GrMT levels were induced in the four tissues. However, the dif-
kidney. The results were shown in Fig. 4A. ferences were not so obvious in spleen and muscle between
2+
When exposed to Cd , the GrMT mRNA expression level genders, about 4-fold and 3-fold separately. The variations of
in muscle barely changed (1- to 2.3-fold) during the process. GrMT in the liver were 1-fold for females and 12-fold for males,
After 1 h exposure, no alteration was observed in all the tis- while in the kidney were 3-fold for females and 21-fold for
sues. Initial induction happened in spleen (11-fold) at 6 h post males. Gender difference really existed in these two tissues
exposure. Cd exposure induced GrMT expression at 12 h in (Fig. 5).
liver (7.5-fold), spleen (5-fold), and kidney (10-fold). Then, the GrMT mRNA levels showed dosage-dependence and sex-
2+
expression level was mildly changed in liver, spleen, kidney, relation in rare minnow after exposure to Cd . In the present
and gill. However, in intestine, the expression was up-regulate study, males are more susceptible than females in liver and
(3.7-fold). At the end of the exposure, induction was occurred kidney tissues. In Lethrinus lentjan, female seems to accumu-
in liver (4-fold), kidney (13-fold), and gill (7-fold). Interestingly, late more heavy metals than male (Al-Yousuf et al., 2000).
the expression was suppressed in spleen (5.8-fold) at 24 h post Thus, male animals and females may be different in MT
exposure and intestine (5.3-fold) after 6 h exposure (Fig. 4A). induction. Dosage-dependent MT expression was observed
The change of GrMT expression was more pronounced in rare minnow, which agrees well with results obtained in
2+
in liver after 12 h exposure to Cd (Fig. 4A). Therefore, we Scophthalmus maximus (George et al., 1996). That might be the
2+
exposed fish to 400 g/L Cd solution for 12 h in the following appearance of the detoxification function of MT.
study.
3.3.3. GrMT expression in fish zygote and larvae exposed
2+ 2+
3.3.2. Cd dosage-dependent and gender-different GrMT to Cd
2+
gene expression After exposure to 400 g/L Cd for 12 h, GrMT mRNA levels
In dosage-dependent study for 12 h post exposure at liver, increased in zygote (3.4-fold) and larvae (9.5-fold), showing
GrMT mRNA levels showed concentration positively related larvae stage to be more sensitive (Fig. 7). Similar phenomenon
regulation. When rare minnow exposed to 100 g/L and occurred in the previous study. Rare minnow seemed to
2+
200 g/L Cd solution, the inducing effect was not obvious be more sensitive to heavy metal exposures at larval stage
(1.2- to 1.5-folds). GrMT inductions were 2.4-fold and 2.7-fold than at embryonic stage (Zhu et al., 2011). In Chironomus
in 400 g/L and 800 g/L solutions, respectively. More pro- riparius larvae, MT expression was induced significantly after
2+ 2+ 2+
nounced induction occurred in 1600 g/L (8.3-fold) (Fig. 6). long-term exposure to Cd , Cu , and Pb (Park and Kwak,
2+
Male and female fish were exposed to 400 g/L Cd solu- 2012). The induction of MT could protect cells from oxidative
tion separately for 12 h to study if gender difference existed. damage. Moreover, MT may play a significant role during
1288 e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 1283–1291
2+
Fig. 4 – MT mRNA levels in different tissues at 0 h, 1 h, 6 h, 12 h, 24 h, and 48 h after exposure to (A) 400 g/L Cd , (B) 9 g/L
2+ 2+
Cu , and (C) 3.9 mg/L Pb . Values are means ± SE. Different transcript expression levels were confirmed by one-way
ANOVA. ‘*’Significant difference (p < 0.05) and **highly significant difference (p < 0.01).
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 1283–1291 1289
2+
Fig. 5 – Gender difference in mRNA levels of GrMT after exposure to 400 g/L Cd for 0 h and 12 h in four tissues. Values are
means ± SE. *Significant difference by Student’s t-test (p < 0.05).
embryogenesis and early development just as it does in for 6 h, its MT level was up-regulated about 9.8-fold in kidney.
zebrafish (Chen et al., 2004). Subsequently, at each time interval the changes were mildly
in kidney (1.8-fold). At 12 h, increasing MT expression levels
2+ were found in spleen (2.8-fold), intestine (4.8-fold), gill (5.4-
3.3.4. GrMT expression in tissues response to Cu and
2+ fold), and muscle (5.4-fold). The induction was observed only
Pb exposure at different time
in muscle at 24 h (6.2-fold). At the end of the test, MT level was
As MTs are metal-binding proteins, we exposed rare minnow
2+ 2+ induced only in spleen (3.3-fold) (Fig. 4C).
to 9 g/L Cu and 3.9 mg/L Pb to study the effects of other
Some heavy metals, particularly Cu and Zn, are essential
heavy metals on GrMT expression.
2+ for life and play important role in living organism. These and
After Cu treatment, alternations (about 2-fold) in kidney
other nonessential heavy metals, including Cd and Pb, are
and intestine were not so apparently as in other tissues. In
2+ highly reactive and toxic to organisms. Heavy metal could
liver, Cu induced GrMT level after 24 h exposure (5.8-fold).
inhibit activity of vital enzymes or cause oxidative damage
The expression in spleen changed dramatically. At 1 h post
to cell (Serafim et al., 2012), which may be hazardous for living
exposure, the expression showed significantly induction (17.6-
systems, including proteins and genes. All the three studied
fold), and then about 7.7-fold induction. However, after 48 h
2+ metals caused induction of MT gene in rare minnow. How-
exposure, MT level was restrained (5-fold). In gill, Cu treat-
ever, up-regulation in Cd-exposed fish was more pronounced
ment induced MT expression from 6 h to 24 h exposure (11-,
than fish exposed to other heavy metals. This agrees well with
9.7- and 7.7-fold). In muscle, the significant induction occurred
results obtained in other species. Cd showed stronger effect
only at 24 h post treatment (5.7-fold) (Fig. 4B).
than Cu did on MT up-regulation in Perna perna (Baraj et al.,
Pb exposure induced GrMT expression in spleen, kidney,
2011). In Kryptolebias marmoratus, Cd also caused a stronger
intestine, gill, and muscle. However, no significant trend was
induction of MT than Cu and Zn did (Rhee et al., 2009). Cu
observed in liver (2-fold) during exposure. At 1 h post treat-
undergoes redox cycling, while Cd and Pb can result in produc-
ment, dramatical induction occurred both in spleen (30-fold)
2+ ing reactive oxygen species (Gao et al., 2012). MT expression is
and intestine (13.7-fold). When rare minnow exposed to Pb
2+
Fig. 6 – MT mRNA expression in rare minnow liver after exposure to varying doses of Cd for 12 h. Values are means ± SE.
1290 e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 1283–1291
2+
Fig. 7 – MT mRNA levels in zygote and larvae in rare minnow after exposure to 400 g/L Cd for 12 h. Values are means ± SE.
induced to bind with metals, which can prevent heavy metals The dynamic changes during exposure in tissues relates
toxicity. MT has two subunits: ␣ domain and  domain. The ␣ to metals transference among tissues and confounding phys-
2+
domain prefers to bind to Cd , while  domain prefers to bind iological process. Some confounding factors need to be taken
2+
with Zn , which indicates that the two subunits may play into consideration. Such a phenomenon has been reported
different role in detoxification and metabolism activities of in Crassostrea rhizophorae. Some kind of tolerance mechanism
heavy meals (Zhou et al., 2000). It appears that metals are dif- may suppress MT expression in samples from heavy metal
ferentially handled by the MTs. Thus, the inductions of GrMT contaminated sites (Rebelo et al., 2003). Specifically, heavy
expression were varied by different metals. metals may have interacted with other intracellular com-
Otherwise, GrMT expression in the present work may be pounds. It also may be possible that after exposure for a while
influenced by exposure time and tissue type as well. the accumulation of heavy metals reached at a threshold,
The induction mainly occurred in liver, spleen, kidney, and thus MT biosynthesis was limited. When the organs could
gill, while intestine and muscle were less susceptive to heavy not produce more MT, toxic effects occurred. Decreased MT
metals. This agrees well with previous reports. In S. maximus, mRNA expression may be associated with the response to
synthesis of MT mainly happened in liver, kidney, and gill oxidative stress (Park and Kwak, 2012), which is an adverse
(George et al., 1996). Cd exposure in Salmo trutta induced higher reaction resulting from the exposure of molecules, cells or
levels of MT in liver and kidney as well as in gills (Hansen tissues to excess levels of free radical oxidants, especially
et al., 2006). MT can bind with metals, increases the resis- reactive oxygen species.
tance of tissues and cells to oxidative stress, which plays a
vital role in detoxification metals (Viarengo et al., 2000). Gill
is an important organ to uptake, reserve and transport heavy 4. Conclusion
metals in fish (Smaoui-Damak et al., 2004). After exposure to
heavy metals, MT expression in gill was induced. However, The results of this work systematically present spatial and
the induction occurred a little slower than in other organs, temporal GrMT expression profiles in rare minnow after expo-
which may be influenced by metals accumulation. In general, sure to three different heavy metals, which is vital for future
2+
liver is important in metabolism and detoxification xenobi- work. It also shows that the sensitivity of rare minnow to Cd
otics. It can sequester and reduce the amount of free metal exposure depends on fish gender, life stages of fish develop-
ions to protect the organ from oxidative damage. Various ment (zygote or larvae), exposure duration, dosage and tissue
2+
metabolism processes happened in liver. The expression was types. The fish appears to be more sensitive to Cd exposure
induced sharply in spleen, which is an important immune at larval stage, which emphasizes the need for utilization of
and hematopoietic organ. This result confirms earlier stud- different developmental stages of rare minnow when survey-
ies. Cu showed much stronger effects on the transcription ing water pollution. Among the three metals tested, it seems
2+ 2+
of metallothionein in spleen tissue after 7-day exposure in that Cd is stronger in affecting gene expression, while Cu
Morone saxatilis (Geist et al., 2007). Kidney is a metabolism could cause fish death at a lower concentration. In conclusion,
organ, which is important in accumulating Cd (Romeo et al., GrMT could be a potential biomarker of metal contamination
2000). Metal ions, treated in liver, were less toxic when trans- in aquatic environments as its binding to heavy metals. This
ported to kidney, which can explain the results in this work. work paves the promising ways to use rare minnow as one of
MT induction in muscle and intestine was moderate. Muscle the perfect experimental fishes for surveying the freshwater
is the largest fraction of fish and heavy metals concentration pollution in China.
may be lower (Woo et al., 2006). Intestine is vital in digest-
ing and absorbing food and water, as well as immunity and
metabolism. The changes occurred in intestine may asso-
Conflicts of interest
ciate with absorbing and accumulating Cd which may lead to
metabolism barrier.
The authors declare that there are no conflicts of interest.
e n v i r o n m e n t a l t o x i c o l o g y a n d p h a r m a c o l o g y 3 7 ( 2 0 1 4 ) 1283–1291 1291
Transparency documents associated with this article can Johnson, A., Carew, E., Sloman, K.A., 2007. The effects of copper
be found, in the online version, at http://dx.doi.org/10.1016/ on the morphological and functional development of
j.etap.2014.04.021. zebrafish embryos. Aquat. Toxicol. 84, 431–438.
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene
expression data using real-time quantitative PCR and the 2(T)
Acknowledgements (-Delta Delta C) method. Methods 25, 402–408.
Margoshes, M., Vallee, B.L., 1957. A cadmium protein from equine
kidney cortex. J. Am. Chem. Soc. 79, 4813–4814.
The authors thank Miss Zhang Weiwei for sample collection.
Park, K., Kwak, I.-S., 2012. Assessment of potential biomarkers,
This study was supported by the grants from the National
metallothionein and vitellogenin mRNA expressions in
Natural Science Foundation of China (30900154), the Knowl- various chemically exposed benthic Chironomus riparius
edge Innovation Program of the Chinese Academy of Sciences larvae. Ocean Sci. J. 47, 435–444.
(Y15E011101) and the National 863 High Technology Research Rebelo, M.F., Pfeiffer, W.C., da Silva, H., Moraes, M.O., 2003.
Cloning and detection of metallothionein mRNA by RT-PCR in
Program of China (2012AA06A302-4).
mangrove oysters (Crassostrea rhizophorae). Aquat. Toxicol. 64,
359–362.
r e f e r e n c e s
Rhee, J.S., Raisuddin, S., Hwang, D.S., Lee, K.W., Kim, I.C., Lee, J.S.,
2009. Differential expression of metallothionein (MT) gene by
trace metals and endocrine-disrupting chemicals in the
hermaphroditic mangrove killifish, Kryptolebias marmoratus.
Al-Yousuf, M.H., El-Shahawi, M.S., Al-Ghais, S.M., 2000. Trace
Ecotoxicol. Environ. Saf. 72, 206–212.
metals in liver, skin and muscle of Lethrinus lentjan fish
Romeo, M., Bennani, N., Gnassia-Barelli, M., Lafaurie, M., Girard,
species in relation to body length and sex. Sci. Total Environ.
J.P., 2000. Cadmium and copper display different responses
256, 87–94.
towards oxidative stress in the kidney of the sea bass
Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J.H., Zhang, Z.,
Dicentrarchus labrax. Aquat. Toxicol. 48, 185–194.
Miller, W., Lipman, D.J., 1997. Gapped BLAST and PSI-BLAST: a
Serafim, A., Company, R., Lopes, B., Rosa, J., Cavaco, A., Castela,
new generation of protein database search programs. Nucleic
G., Castela, E., Olea, N., Bebianno, M.J., 2012. Assessment of
Acids Res. 25, 3389–3402.
essential and nonessential metals and different metal
Baraj, B., Niencheski, F., Fillmann, G., Martins, C.D.G., 2011.
exposure biomarkers in the human placenta in a population
Assessing the effects of Cu, Cd, and exposure period on
from the south of Portugal. J. Toxicol. Environ. Health A 75,
metallothionein production in gills of the Brazilian brown
867–877.
mussel Perna perna by using factorial design. Environ. Monit.
Smaoui-Damak, W., Hamza-Chaffai, A., Bebianno, M.J., Amiard,
Assess. 179, 155–162.
J.C., 2004. Variation of metallothioneins in gills, from the Gulf
Bervoets, L., Knapen, D., De Jonge, M., Van Campenhout, K., Blust,
of the clam Ruditapes decussatus Gabes (Tunisia). Comp.
R., 2013. Differential hepatic metal and metallothionein levels
Biochem. Physiol. C Toxicol. Pharmacol. 139, 181–188.
in three feral fish species along a metal pollution gadient.
Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: molecular
PLoS ONE 8 (3), e60805.
evolutionary genetics analysis (MEGA) software version 4.0.
Chen, W.Y., John, J.A.C., Lin, C.H., Lin, H.F., Wu, S.C., Lin, C.H.,
Mol. Biol. Evol. 24, 1596–1599.
Chang, C.Y., 2004. Expression of metallothionein gene during
Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. Clustal-W
embryonic and early larval development in zebrafish. Aquat.
improving the sensitivity of progressive multiple sequence
Toxicol. 69, 215–227.
alignment through sequence weighting, position-specific gap
Cho, Y.S., Lee, S.Y., Kim, K.Y., Bang, I.C., Kim, D.S., Nam, Y.K., 2008.
penalties and weight matrix choice. Nucleic Acids Res. 22,
Gene structure and expression of metallothionein during
4673–4680.
metal exposures in Hemibarbus mylodon. Ecotox. Environ. Safe
Viarengo, A., Burlando, B., Ceratto, N., Panfoli, I., 2000.
71, 125–137.
Antioxidant role of metallothioneins: a comparative overview.
Gao, A.B., Wang, L., Yuan, H., 2012. Expression of metallothionein
Cell. Mol. Biol. 46, 407–417.
cDNA in a freshwater crab, Sinopotamon yangtsekiense, exposed
Wang, C.L., Zhang, F.T., Cao, W.X., Wang, J.W., 2013. The
to cadmium. Exp. Toxicol. Pathol. 64, 253–258.
identification of apolipoprotein C-I in rare minnow
Geist, J., Werner, I., Eder, K.J., Leutenegger, C.M., 2007.
(Gobiocypris rarus) and its expression following cadmium
Comparisons of tissue-specific transcription of stress
exposure. Environ. Toxicol. Pharmacol. 35, 419–426.
response genes with whole animal endpoints of adverse
Wei, Y.H., Liu, Y., Wang, J.S., Tao, Y., Dai, J.Y., 2008. Toxicogenomic
effect in striped bass (Morone saxatilis) following treatment
analysis of the hepatic effects of perfluorooctanoic acid on
with copper and esfenvalerate. Aquat. Toxicol. 85, 28–39.
rare minnows (Gobiocypris rarus). Toxicol. Appl. Pharmacol.
George, S.G., Todd, K., Wright, J., 1996. Regulation of
226, 285–297.
metallothionein in teleosts: induction of MT mRNA and
Woo, S., Yum, S., Jung, L.H., Shim, W.J., Lee, C.H., Lee, T.K., 2006.
protein by cadmium in hepatic and extrahepatic tissues of a
Heavy metal-induced differential gene expression of
marine flatfish, the turbot (Scophthalmus maximus). Comp.
metallothionein in Javanese medaka, Oryzias javanicus. Mar.
Biochem. Physiol. C Toxicol. Pharmacol. 113, 109–115.
Biotechnol. 8, 654–662.
Hansen, B.H., Romma, S., Garmo, O.A., Olsvik, P.A., Andersen,
Zenk, M.H., 1996. Heavy metal detoxification in higher plants – a
R.A., 2006. Antioxidative stress proteins and their gene
review. Gene 179, 21–30.
expression in brown trout (Salmo trutta) from three rivers with
Zhou, Y.J., Li, L.Y., Ru, B.G., 2000. Expression, purification and
different heavy metal levels. Comp. Biochem. Physiol. C
characterization of beta domain and beta domain dimer of
Toxicol. Pharmacol. 143, 263–274.
metallothionein. Biochim. Biophys. Acta Gen. Subj. 1524,
Jarup, L., 2003. Hazards of heavy metal contamination. Br. Med.
87–93.
Bull. 68, 167–182.
Zhu, B., Wu, Z.F., Li, J., Wang, G.X., 2011. Single and joint action
Jia, X.Y., Zhang, H.J., Liu, X.X., 2011. Low levels of cadmium
toxicity of heavy metals on early developmental stages of
exposure induce DNA damage and oxidative stress in the liver
Chinese rare minnow (Gobiocypris rarus). Ecotoxicol. Environ.
of Oujiang colored common carp Cyprinus carpio var, color.
Saf. 74, 2193–2202.
Fish Physiol. Biochem. 37, 97–103.