Food Control 38 (2014) 116e123
Contents lists available at ScienceDirect
Food Control
journal homepage: www.elsevier.com/locate/foodcont
A barcode for the authentication of the snappers (Lutjanidae) of the western Atlantic: rDNA 5S or mitochondrial COI?
Ivana Veneza a, Bruna Felipe a, Joiciane Oliveira a, Raimundo Silva a, Iracilda Sampaio b, Horacio Schneider b, Grazielle Gomes a,b,* a Laboratório de Genética Aplicada, Instituto de Estudos Costeiros, Universidade Federal do Pará, Campus Universitário de Bragança, Alameda Leandro Ribeiro s/n, Aldeia, Bragança, Pará, Brazil b Laboratório de Genética and Biologia Molecular, Instituto de Estudos Costeiros, Universidade Federal do Pará, Campus Universitário de Bragança, Brazil article info abstract
Article history: The increasing demand for fishery resources in recent years has stimulated a growth in the output of Received 5 February 2013 processed products, which has made the fraudulent substitution of species a common practice. In the Received in revised form present study two different protocols were evaluated for the molecular authentication of lutjanid species, 8 October 2013 one based on the banding pattern of the nuclear rDNA 5S gene, and the other on the sequences of the Accepted 9 October 2013 mitochondrial Cytochrome Oxidase subunit I (COI) gene. A total of 132 samples were analyzed from specimens identified previously as belonging to seven lutjanid species (Lutjanus purpureus, Lutjanus Keywords: synagris, Lutjanus vivanus, Lutjanus jocu, Lutjanus analis, Ocyurus chrysurus,andRhomboplites aurorubens), COI fi fi rDNA 5S as well as unidenti ed individuals. The results indicate the absence of a species-speci c rDNA 5S banding fi Snappers pattern in lutjanids. However, the 1131 bp fragment of the COI gene not only discriminated the identi ed Barcode lutjanid species systematically, but also defined the species of the unidentified specimens, identifying Lutjanids another two species from the database, Lutjanusbucanella and Lutjanuscyanopterus. The species were represented by well-defined consensual clades in the phylogenetic trees, supported by the interspecific distances and the mutations characteristic of each species. This segment of the COI gene proved to be a robust tool for the molecular authentication of lutjanid species. Ó 2013 Elsevier Ltd. All rights reserved.
1. Introduction processing can remove distinguishing features, and impede the diagnosis of species recognized solely on the basis of morphological The trade in fishery products has expanded significantly in traits (Carvalho, Neto, Brasil, & Oliveira, 2011; Céspedes et al., 1999; recent years, with a total worldwide harvest of 154 million tons in Filonzi, Chiesa, Vaghi, & Marzano, 2010; Sales, Rodrigues-Filho, 2011, including both wild-caught and farmed produce (FAO, 2012). Haimovici, Sampaio, & Schneider, 2011; Sotelo, Piñeiro, Gallardo, At the same time, there has been an ever-increasing tendency for & Pérez-Martín, 1993). the diversification of the products being marketed, including fillets Inadequate product labeling can have serious consequences in and steaks, smoked fish and canned goods, derived from a wide terms of public health, as well as having ecological and economic range of different fish species. implications. In addition to entailing potential risks for the con- This growth in trade has been accompanied by an increase in the sumer (Van Leeuwen et al., 2009), including financial costs e as fraudulent substitution of more valuable species by inferior ones shown by Marko et al. (2004) in the case of the snappers e it may (Ward, 2000). In addition to the marked morphological similarities impact management programs designed for the conservation of the of species of some fish families, such as the Sciaenidae, Mugilidae, stocks of certain species (Ward, 2000). and Lutjanidae (Allen, 1985; Cervigón, 1993; Cervigón et al., 1993), The lutjanids fishes known as snappers represent an important fishery resource in all the regions where they occur (Allen, 1985; Cervigón, 1993; Matos-Caraballo, 2000; Mendoza & Larez, 1996; Prescod, Oxenford, & Taylor, 1996; Zhang & Liu, 2006). These me- * Corresponding author. Instituto de Estudos Costeiros, Universidade Federal do dium to large-sized fishes are widely distributed in the Atlantic, Pará e Bragança, Alameda Leandro Ribeiro s/n, Aldeia, Bragança, CEP: 68.600-000 fi PA, Brazil. Tel.: þ55 091 3425 1593. Indian, and Paci c oceans. The family is composed of approximately E-mail addresses: [email protected], [email protected] (G. Gomes). 108 species distributed among 17 genera, organized in four
0956-7135/$ e see front matter Ó 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.foodcont.2013.10.012 I. Veneza et al. / Food Control 38 (2014) 116e123 117 subfamilies, the Etelinae, Apsilinae, Paradicichthyinae, and Lutja- cases (see Céspedes et al., 1999; Rodrigues-Filho et al., 2010; Sales ninae (Allen, 1985; Cervigón, 1993; Froese & Pauly, 2012; Moura & et al., 2011). Lindeman, 2007; Nelson, 2006). Given the marked morphological similarities among the Many lutjanids, such as the red snappers (Lutjanus vivanus, L. different lutjanid species and the fact that snappers are typically purpureus, L. campechanus, L. bucanella, and L. peru), are highly marketed in fillet form, which facilitates the illicit substitution of similar morphologically (Cervigón, 1993; Cervigón et al., 1993; species, an effective molecular species identification protocol Nelson, 2006) and are difficult to identify reliably based on which is both fast and inexpensive is urgently needed. In an external characteristics. This problem is exacerbated by the in- attempt to provide an appropriate approach to this problem, the dustrial processing of catches, which typically involves the removal present study evaluated two different molecular methods e one of the fillets. based on the banding patterns of the amplified rDNA 5S gene Based on the analysis of a fragment of the mitochondrial Cyto- resolved on an agarose gel, and the other, a more conventional chrome b gene, Marko et al. (2004) discovered that approximately approach, which has been shown to be effective in snappers (see 80% of the fillets sold in the United States as red snapper Victor, Hanner, Shivji, Hyde, & Caldow, 2009), based on the analysis (L. campechanus) were actually derived from other lutjanid species, of the sequences of a fragment of the mitochondrial COI gene. This presumably as a result of errors in the identification of specimens comparative analysis will provide an initial step towards the during the production process and/or the intentional substitution development of rapid and low-cost molecular protocols that pro- with less popular and/or cheaper species. vide an unambiguous identification of snapper species. Molecular studies based on nucleotide sequences have become increasingly popular for the identification of fishes and/ 2. Material and methods or fishery products (Brown et al., 1996; Carrera et al., 2000; Chiu, Su, Pai, & Chang, 2012; De Salle & Birstein, 1996; Filonzi et al., 2.1. Samples 2010; Mackie et al., 1999; Rasmussen & Morrissey, 2008; Wen, Hu, Zhang, & Fan, 2011). One genomic region that has been A total of 132 lutjanid specimens (Table 1) were analyzed in the used successfully for molecular diagnosis is the Cytochrome present study. The samples were obtained from the Lutjanidae Oxidase subunit I (COI) gene, which is considered to be a “bio- tissue bank held by the Applied Genetics Laboratory at the Coastal logical barcode” (Hebert, Cywinska, Ball, & de Waard, 2003). A Studies Institute of the Federal University of Pará in Bragança, number of studies have demonstrated the usefulness of different Brazil. In all, 37 of the specimens had been identified previously fragments of this gene for the identification of fish species and (Allen, 1985; Cervigón, 1993; Cervigón et al., 1993; Menezes & the products derived from them (Carvalho, Neto, et al., 2011; Figueiredo, 1980), representing seven species, belonging to three Carvalho, Oliveira, et al., 2011; Filonzi et al., 2010; Haye, genera e Lutjanus (L. purpureus, L. synagris, L. jocu, L. analis, and Segovia, Vera, Gallardo, & Gallardo-Escárate, 2012; Rasmussen, L. vivanus), and the monotypic Rhomboplites aurorubens and Morrissey, & Hebert, 2009; Silva-Oliveira et al., 2011; Ward, Ocyurus chrysurus. The remaining 95 specimens, which were Zemlak, Innes, Last, & Hebert, 2005; Yang, Huang, Hsieh, Huang, collected at a number of different locations around the Brazilian & Chen, 2012). coast, were considered to be “unidentified snappers” or UISs for In addition to DNA sequences, a number of alternatives have this analysis. A number of additional specimens were included in been tested, based on faster and more practicable approaches, the analysis to provide a comparative perspective of rDNA 5S which allow for the analysis of PCR (Polymerase Chain Reaction) banding patterns at the family level. These specimens include three products directly in agarose gels (see Rodrigues-Filho et al., 2010), individuals representing two haemulidae species (Conodon nobilis such as the banding pattern provided by the amplification of the and Genyatremus luteus), a scombridae (Scomberomorus brasi- rDNA 5S gene. This marker is a multigenic family composed of liensis), a centropomidae (Centropomus undecimalis), and a sciae- repeated units in a conserved coding region with approximately nidae, Cynoscion sp. (Table 1). 120 base pairs arranged in tandem, separated by non-transcribed The approach adopted here was to use the specimens identified spacers (NTS) of variable length (Alves-Costa et al., 2008; Martins according to their morphological traits as models for the identifi- & Wasko, 2004; Pinhal et al., 2008; Rodrigues-Filho et al., 2010; cation of all the other samples, based on both the amplification of Wasko, Martins, Wright, & Galetti, 2001). This arrangement pro- the rDNA 5S/NTS gene and the sequencing of the COI gene. In duces a unique banding pattern which is species-specific in many addition to evaluating the different molecular procedures for the
Table 1 List of the taxa analyzed in the present study, their common names, codes and the number of samples used for the analysis of each genomic region.
Family Species Common name Code Samples used for 5S Samples used for COI
Lutjanidae Lutjanus purpureus Southern red snapper Lpu 3 6 Lutjanus synagris Lane snapper Lsy 3 8 Lutjanus jocu Dog snapper Ljo 3 5 Lutjanus analis Mutton snapper Lan 3 5 Lutjanus vivanus Silk snapper Lvi 3 3 Rhomboplites aurorubens Vermellion snapper Rau 3 3 Ocyurus chrysurus Yellowtail snapper Och 3 7 Identified Snapper 37 Unidentified Snapper UIS 15 95 TOTAL 36 132 Haemulidae Conodon nobilis Barred grut Cno 1 2 Genyatremus luteus Torroto grunt Glu 1 1 Scombridae Scomberomorus brasiliensis Serra Spanish mackerel Sbr 1 Sciaenidae Cynoscion sp. Weakfish Csp 1 Centropomidae Centropomus undecimalis Common snook Cun 1 TOTAL 41 135 118 I. Veneza et al. / Food Control 38 (2014) 116e123 identification of species, it was possible to recognize certain in- Cycle Sequencing Reading Reaction e PE Applied Biosystems). The consistencies in the original identification of the specimens, which precipitated product was electrophoresed in an automatic capillary was based on morphological traits. sequencer, model ABI 3500 xl (Applied Biosystems).
2.2. Isolation, amplification, and sequencing of the genetic material 2.3. Analyses
The genetic material was isolated following the protocol of 2.3.1. Banding pattern e rDNA 5S/NTS Sambrook and Russell (2001). The genomic regions (rDNA 5S and Three specimens were selected from each of the seven lutjanid COI) were amplified by Polymerase Chain Reaction (PCR) in a final species analyzed in the present study for the evaluation of intra- fi volume of 25 ml, containing 4 ml of dNTP (1.25 mM), 2.5 mlof10 speci c variation (Table 1), together with a number of the un- identified specimens (UISs). Two separate batteries of PCRs were buffer, 1 ml of MgCl2 (50 mM), 1 ml of each primer (50 ng/mL), approximately 100 ng of the total DNA, 0.2 ml of Taq DNA poly- conducted. One included a single representative of each lutjanid merase (5 U/mL) (Invitrogen, Carlsbad, CA, USA), and purified water species together with the specimens representing other perciform to complete the final reaction volume. families (Haemulidae, Scombridae, Centropomidae, and Sciaeni- The primers used to amplify the rDNA 5S gene were 5SA (50- dae), in an attempt to confirm species- or genus-specific banding TACGCCCGATCTCGTCCGATC-30) and 5SB (50-CAGGCTGGTATGGC patterns, or a pattern that is characteristic of the lutjanids. In the CGTAAGC-30), as used by Sales et al. (2011), with the following second battery, a number of different individuals of each species amplification conditions: initial denaturation at 95 C for 4 min, were included, together with the UISs. followed by 35 cycles of 20 s at 95 C, 50 s at 55 C, and 30 s at 72 C, The positive PCRs were submitted to further submarine elec- and final extension of 7 min a 72 C. trophoresis, this time in concentrated (2%) agarose gel stained with The COI gene was amplified using the primers FishF1, FishF2 ethidium bromide, together with a ladder (DirectLoadÔ 50 bp Step (Ward et al., 2005), COIF and COIA (Palumbi & Benzie, 1991) Ladder, containing 17 fragments) which was used as a metric for the (Table 2), thus permitting the analysis of a fragment of 1131 bp for measurement of the observed bands. The electrophoretic run lasted all species of Lutjanidae and Haemulidae. For each individual, were an hour and a half with a current of approximately 70 V. The gel was two reactions of PCR, first to amplify a fragment of about 550 bp, subsequently viewed under ultraviolet light in a transilluminator located in second portion of COI, using the primes described by and photographed for analysis. Palumbi and Benzie (1991) (COIF and COIA), and then, a fragment of approximately 1200 bp, including the barcode region, with FishF1 2.3.2. The mitochondrial COI gene or FishF2 (Ward et al., 2005) and COI A (Palumbi & Benzie, 1991). The sequences obtained for the COI gene were aligned manually The primers used for the sequencing were FishF1 or FishF2 and using the BIOEDIT program (Hall, 1999). For the identification of COIF (Table 2). individuals and species we created two databases, a reduced bank The amplification conditions were: initial denaturation at 94 C with the 600 bp barcode region of all previously identified Lutja- for 3 or 5 min, followed by 35 cycles of 30 or 40 s at 94 C, 40 s or nidae specimens and a total bank of all the 132 analyzed snappers 1 min at 53 Ce56.2 C(Table 2), and 45 s or 2 min at 72 C, and final with the 1131 bp of COI. For the reduced dataset, we included one fi extension of 10 min a 72 C. The positive PCRs were sequenced representative of each previously identi ed lutjanid (initially seven using the dideoxy-terminal method (Sanger, Nichlen, & Coulson, individuals), obtained from the BOLD platform (Barcode of Life 1977), with Big Dye kit reagents (ABI PrismÔ Dye Terminator Database) (Database available in www.boldsystems.org), Rhombo- plites aurorubens e ANGBF7605-12; Ocyurus chrysurus e ANGBF7608-12; Lutjanus synagris e ANGBF7611-12; L. purpureus e Table 2 DOACS017-08; L. vivanus e ANGBF7609-12; L. jocu e ANGBF7613- Primers used to amplify the fragment of COI gene (1131 bp) for each species of 12; L. analis e ANGBF7686-12. Lutjanidae and Haemulidae, with the respective hybridization temperature. The data were fed into the DnaSP v 5 program (Librado & Rozas, Species Combination of primers Hybridization 2009) to generate a list of haplotypes, which were used as a ( C) benchmark for the taxonomic identification of the samples. Lutjanus COIF-50CCTGCAGGAGGAGGAGAYCC30b,c 53.8 Phylogenetic trees were constructed using the Neighbor-Joining 0 0b synagris COIA-5 AGTATAAGCGTCTGGGTAGTC3 (NJ) and Maximum Likelihood (ML) approaches. The NJ trees were Lutjanus FishF1-50TCAACCAACCACAAAGACATTGGCAC30a,c 53.8 0 0 produced in MEGA 5.0 (Tamura et al., 2011), using the K2P evolu- jocu COIA-5 AGTATAAGCGTCTGGGTAGTC3 b Ocyurus 53.8 tionary model (Kimura, 1980), which is normally used for this chrysurus molecular marker (Hubert et al., 2008; Rasmussen et al., 2009; Lutjanus 53.8 Victor et al., 2009; Ward et al., 2005). The ML trees were gener- cyanopterus ated by the PHYML 3.0 program (Guindon & Gascuel, 2003), using Lutjanus 56.2 analis the evolutionary model suggested by JMODELTEST 0.1.1 (Posada, Conodon 53,8 2008). The significance of the observed groupings was estimated nobilis by bootstrap analysis, based on 1000 pseudoreplicates. The se- Genyatremus 55 quences of the species Conodon nobilis and Genyatremus luteus luteus 0 0 (Haemulidae) were used as the outgroup. Lutjanus COIF-5 CCTGCAGGAGGAGGAGAYCC3 b,c 55 0 0 fi purpureus COIA-5 AGTATAAGCGTCTGGGTAGTC3 b Intra and interspeci c genetic divergence was evaluated using Lutjanus FishF2-50TCGACTAATCATAAAGATATCGGCAC30a,c 55 the K2P (Kimura, 1980) distances obtained from MEGA 5.0 (Tamura 0 0 vivanus COIA-5 AGTATAAGCGTCTGGGTAGTC3 b et al., 2011). Preliminary analyses (list of haplotypes and phyloge- Lutjanus 55 netic trees) permitted the allocation of individuals to different buccanella Rhomboplites 55 groups corresponding to each lutjanid species, including the UISs. aurorubens Some of the UISs were not allocated to any established group, formed distinct groups. Overall, a total of 10 groups were identified, a Ward et al. (2005). b Palumbi and Benzie (1991). including the seven lutjanid species (L. purpureus, L. vivanus, c Primers used for sequencing. L. synagris, L. analis, L. jocu, R. aurorubens, and O. chrysurus), two I. Veneza et al. / Food Control 38 (2014) 116e123 119 others, designated UIS1 and UIS2, as well as the representatives of Two databases were used for analysis, one containing all 135 the outgroup (Haemulidae). The pattern of interspecific genetic samples, with 132 Lutjanidae and three Haemulidae (1131 bp) and distances was supported by the polymorphic sites, demonstrating the other, only the samples for the seven identified species (n ¼ 37), the mutations that separate the different species, observed in together with the specimens UIS1 and UIS2 (n ¼ 3) and specimens MEGA 5.0 (Tamura et al., 2011). from the BOLD platform (n ¼ 9), resulting in a total of 52 sequences In addition to the analyses performed, the “barcode” sequences (49 Lutjanidae and 3 Haemulidae) with a 600 bp barcode fragment. of all specimens were submitted to NCBI/BLAST (Basic Local A total of 52 haplotypes were identified in the 132 lutjanid Alignment Search Tool) to confirm identification. This allowed the samples, of which the most common were those of the species identification of individuals UIS 1 and UIS 2 to the species level, L. synagris and O. chrysurus, shared by 38 and nine specimens, with respective representatives later included in the reduced respectively. L. analis, O. chrysurus and L. jocu presented the largest dataset (Lutjanus cyanopterus e ANGBF7616-12; Lutjanus bucanella number of haplotypes (21, eight and six, respectively), while all e ANGBF7617-12). other species were represented by only one or a few haplotypes. The majority of the unidentified specimens had haplotypes typical 3. Results of one of the seven lutjanid species sampled. The trees generated using the different methods (ML and NJ) 3.1. rDNA 5S/NTS gene produced exactly the same topology, so only the NJ tree is pre- sented here, although the ML bootstrap values are shown in the The amplification of the rDNA 5S/NTS gene in the seven lutjanid Fig. 3. The lutjanid species form well-supported consensual clades species resulted in bands of different sizes for the majority of the in both trees, which are well differentiated from the outgroup individuals (Fig. 1), which included intraspecific differences and a (Fig. 3A and B). All of the unidentified specimens were allocated to lack of any clear species- or genus-specific pattern. In addition, one of the seven species clades except for four individuals (speci- many individuals assigned to different species shared the same mens UIS1 and UIS2) (Fig. 3A). However, with the barcode fragment banding pattern (Fig. 2). Most of the lutjanids, including the un- it was possible to identify them as L. bucanella (UIS 1) and identified specimens, presented two bands, one of which (of L. cyanopterus (UIS 2), and to confirm the identify of all specimens approximately 200 bp) was shared by all individuals, while the that had a prior identification (Fig. 3B). other e of around 450 bp e was observed in all the different species Of the 95 UISs, 10 were identified as L. vivanus,11asO. chrysurus, (Figs. 1 and 2). 32 as L. synagris,24asL. analis, one as L. purpureus,14asL. jocu,two Overall, four distinct banding patterns were identified (Figs. 1 were allocated to UIS1 (L. bucanella) and one to UIS2 and 2) e (a) a single band of approximately 200 bp, which is (L. cyanopterus). Species-specific mutations were found in the denominated here as the “lutjanid family band”, (b) a double band, polymorphic sites representing all the species throughout the including the lutjanid family band and a second band of approxi- fragment of 1131 bp, however, due to the high number of poly- mately 450 bp, (c) a triple band, including the two bands in (b) plus morphic sites, only those observed in the barcode fragment are a third band of approximately 600 bp, and (d) a triple band as (c), shown in Fig. 4 but with a third sequence of only 300 bp instead of 600 bp. The mean genetic distance (K2P) between the lujanids and the Comparing bands among different families, it was not possible outgroup for the 1.1 kb fragment varied from 18.2% for R. aurorubens to identify a band that is unique to the Lutjanidae, given that even and Haemulidae to 19.9% for L. cyanopterus and Haemulidae. the 200 bp band identified as the “lutjanid family band” was in fact Within the lutjanids, interspecific distances ranged from 3.1% (for L. found in the common snook, Centropomus undecimalis.However,it purpureus vs. L. vivanus) to 12.7% (for R. aurorubens vs. L. cya- was possible to differentiate the lutjanids from the haemulidae and nopterus), although L. cyanopterus was the most divergent overall. sciaenidae. Even so, the diagnosis of the family based on this Distances between genera varied from 6.6% to 11.4% for Ocyurus vs. marker was inconclusive. Lutjanus, and 5.6%e12.7% for Rhomboplites vs. Lutjanus (Table 3). Mean divergence within species does not exceed 0.5% in any case. 3.2. Mitochondrial COI gene 4. Discussion A 1131 bp fragment of the COI gene was obtained from the specimens of the seven lutjanid species, as well as the unidentified 4.1. rDNA 5S bands or COI sequences? specimens and three haemulidae specimens, which were used as the outgroup, resulting in a total of 135 sequences (Genbank The amplified products of the rDNA 5S gene did not provide a Accession Number: KF633260eKF633393; KF646804). The 132 clear banding pattern capable of differentiating the lutjanid species lutjanids presented 880 conserved and 251 polymorphic sites. analyzed in the present study. In addition to the observed
Fig. 1. Image of the 2% agarose gel, showing the products of the amplification of the rDNA 5S/NTS gene. In (1) nine lutjanidae species: Ocyurus chrysurus (Och); Rhomboplites aurorubens (Rau); Lutjanus purpureus (Lpu); Lutjanus vivanus (Lvi); Lutjanus synagris (Lsy); Lutjanus analis (Lan); Lutjanus jocu (Ljo); Unidentified Snappers (UIS) 68 and 44; (2) two haemulidae: Conodon nobilis (Cno); Genyatremus luteus (Glu); (3) one scombridae: Scomberomorus brasiliensis (Sbr); (4) one sciaenidae of the genus Cynoscion (Csp); and (5) one centropomidae: Centropomus undecimalis (Cun). L (DNA Ladder- DirectLoadÔ Step Ladder, 50 bps, containing 17 fragments). 120 I. Veneza et al. / Food Control 38 (2014) 116e123
Fig. 2. Image of the 2% agarose gel, showing the products of the amplification of the rDNA 5S/NTS gene demonstrating the pattern of intraspecific variation. Ocyurus chrysurus (Och); Rhomboplites aurorubens (Rau); Lutjanus purpureus (Lpu); Lutjanus vivanus (Lvi); Lutjanus synagris (Lsy); Lutjanus analis (Lan) and Lutjanus jocu (Ljo), as well as Unidentified Snappers (UIS). L (DNA Ladder- DirectLoadÔ Step Ladder, 50 bps, containing 17 fragments). intraspecific variation, the same banding pattern was recorded in M. platanus, others e M. hospes, M. incilis, M. sp. and M. curema e different species, a situation also found in fishes such as mullets were differentiated (Rodrigues-Filho et al., 2010). In this case, (Mugilidae). However, whereas equivalent banding patterns were however, the authors attributed the results to problems with the observed in some mullet species, i.e., Mugil cephalus, M. liza, and taxonomy of the group, rather than the ineffectiveness of the
Fig. 3. Phylogenetic Neighbor-Joining trees for the fragment of the Cytochrome Oxidase subunit I gene for the whole data set, including 132 lutjanids and the outgroup (hamulids) (1131 bp) (A) and a subset for only the barcode region (600 bp) containing only the identified lutjanids and UIS1 and UIS2 together with sequences retrieved from the BOLD platform (B). The numbers above the nodes correspond to the bootstrap values for the Neighbor Joining (left) and Maximum Likelihood (right) approaches. I. Veneza et al. / Food Control 38 (2014) 116e123 121
Fig. 4. The approximately 145 polymorphic sites of the 600 bp of the barcode Cytochrome Oxidase subunit I (COI) gene sequences analyzed in the present study, showing the mutations that separate the species. Rau ¼ Rhomboplites aurorubens; Och ¼ Ocyurus chrysurus; Lpu ¼ Lutjanus purpureus; Ljo ¼ Lutjanus jocu; Lsy ¼ Lutjanus synagris; Lan ¼ Lutjanus analis; Lvi ¼ Lutjanus vivanus; Lbu (UIS 1) ¼ Lutjanus bucanella; Lcy (UIS 2) ¼ Lutjanus cyanopterus.
marker, as may have occurred in the lutjanids analyzed in the group of vertebrates, hampering molecular identification using present study. this marker. The discrimination of species using rDNA 5S banding patterns By contrast, a large number of studies have emphasized the should be possible due to differences in the size of the fragments effectiveness of the COI gene for the reliable discrimination of taxa, amplified, which are related to variation in the NTSs. This should in both invertebrates (Greenstone et al., 2005; Haye et al., 2012; provide a distinct banding pattern observable in the gel, as found in Hogg & Hebert, 2004; Silva-Oliveira et al., 2011; Smith, Woodley, other fishery resources, such as cephalopods (Sales et al., 2011), Janzen, Hallwachs, & Hebert, 2006) and vertebrates, including a salmonids (Pendás, Móran, Martínez, & Garcia-Vásquez, 1995), and variety of fishes, such as teleosts, rays, chimaeras, and sharks sharks (Pinhal, Gadig, & Martins, 2009). However, many species (Ardura, Linde, Moreira, & Garcia-Vazquez, 2010; Hubert et al., present fragments of the same size, and can be distinguished only 2008; Ward, Hanner, & Hebert, 2009; Ward et al., 2005). Many of by mutations (base substitutions), as found in the genus Brycon the studies of fishes have focused on the discrimination of (Wasko et al., 2001) and members of the family Sciaenidae (Alves- commercially-important species, providing an important tool for Costa et al., 2008). the identification of fraudulent practices in the fishery trade. Spe- Four distinct banding patterns were observed in the lutjanids, cific cases include Filonzi et al. (2010) study of Dicentrarchus labrax, which may indicate the existence of different classes of the rDNA Sparus aurata, and Mullus surmuletus, Barbuto et al. (2010) on 5S gene in this family. A similar situation has been described for a Mustelus spp., Rasmussen et al. (2009) on salmon and trout, and number of other fishes, such as Salmo salar (Pendás, Móran, catfish (Siluriformes), studied by Wong et al. (2011) and Carvalho, Freije, & Garcia-Vásquez, 1994), Oncorhynchus mykiss (Móran, Neto, et al. (2011). Martínez, Garcia-Vásquez, & Pendás, 1996), Oreochromis niloti- The results of the present study have shown that it is possible to cus (Martins et al., 2002), and the genera Coregonus (Sajdak, identify all the lutjanid species using the COI gene, further rein- Reed, & Phillips, 1998), Leporinus (Martins & Galetti, 2001)and forcing the efficiency of this marker as a reliable bio-identifier. In Brycon (Wasko et al., 2001). Two different arrangements of the addition to the seven species identified initially, two other species ribosomal 5S gene have been found in sciaenidae fishes, as were discriminated using the COI barcode fragment, resulting in a shown by Alves-Costa et al. (2008) in Isopisthus parvipinnis, total of nine species of Lutjanidae analysed. which suggests that this may be a common arrangement in this Most COI studies have analyzed a fragment located in the first half of this gene, which is considered to be a “barcode” (Hebert Table 3 et al., 2003; Rock et al., 2008; Ward et al., 2005). The present Mean genetic distances (k2P) between species (lutjanids and haemulids e outgroup) study includes an alternative segment, located in the second half of considering a 1131-bp fragment of the Cytochrome Oxidase subunit I (COI) gene. the gene e approximately between nucleotides 770 and 1300 e ¼ ¼ ¼ ¼ OG outgroup; Rau R. aurorubens; Och O. chrysurus; Lpu L. purpureus; which together with the barcode region produced a fragment with Lvi ¼ L. vivanus; Lsy ¼ L. synagris; Lan ¼ L. analis; Ljo ¼ L. jocu; Lbu ¼ L. bucanella; Lcy ¼ L. cyanopterus. approximately 1130 bp. The arrangement of polymorphic sites in the region of COI Nucleotide divergence (%) analyzed here revealed the presence of species-specific mutations 123456789 throughout the segment, reinforcing its effectiveness for the dif- 1OG ferentiation of species. 2 Rau 18.2 The separation of the lutjanids in the phylogenetic trees was 3 Och 18.8 8.3 reinforced by the genetic distances found among species, which 4 Lpu 18.7 5.6 7.6 reflects the interspecific polymorphism mentioned above, were 5 Lvi 19.5 6.7 6.6 3.1 fi 6 Lsy 19.5 6.3 7.6 7.3 7.2 typical of those found within and between sh species in other 7 Lan 19 6.5 7.1 6.1 6.7 5.7 studies. For the divergence between families e Lutjanidae and 8 Ljo 18.6 11 11 10.9 11.5 10.9 10.4 Haemulidae (outgroup) e the values found in the present study 9 Lbu 18.9 7.4 7 6.8 6.6 6.2 5.2 11.3 were similar to those recorded by Ward et al. (2005), although 10 Lcy 19.9 12.7 11.4 11.8 12 11.5 11.1 11.4 12.5 Hubert et al. (2008) reported mean values greater than 19%. 122 I. Veneza et al. / Food Control 38 (2014) 116e123
The genetic distances between genera recorded in the present Ardura, A., Linde, A. R., Moreira, J. C., & Garcia-Vazquez, E. (2010). DNA barcoding for fi study were lower than those recorded by Ward et al. (2005) and conservation and management of Amazonian commercial sh. Biological Con- servation, 143, 1438e1443. Carvalho, Oliveira, et al. (2011), and in some cases, such as Barbuto, M., Galimberti, A., Ferri, E., Labra, M., Malandra, R., Galli, P., et al. (2010). L. purpureus vs. R. aurorubens and L. vivanus vs O. chrysurus,were DNA barcoding reveals fraudulent substitutions in shark seafood products: the ‘‘ ” e more characteristic of intrageneric comparisons. Gold, Voelker, and Italian case of palombo (Mustelus spp.). Food Research International, 43,376 381. Renshaw (2011) proposed a molecular phylogeny for some lutja- Brown, J. R., Beckenbach, K., Beckenbach, A. T., & Smith, M. J. (1996). Length vari- nids using mitochondrial markers (NADH-subunit 4, COI and Cy- ation, heteroplasmy and sequence divergence in the mitochondrial DNA of four tochrome b) and discussed the close relationship between Ocyurus, species of Sturgeon (Acipmer). Genetics, 142, 525e535. Carrera, E., Garcia, T., Céspedes, A., Gonzalez, I., Fernandez, A., Asensio, L. M., et al. Lutjanus, and Rhomboplites, which they interpreted as being (2000). Differentiation of smoked Salmo salar, Oncorhynchus mykiss and Brama consistent with that of a single genus, as proposed by Miller and raii using the nuclear marker 5S rDNA. International Journal of Food Science & Cribb (2007). Technology, 35,401e406. fi Carvalho, D. C., Neto, D. A. P., Brasil, B. S. F., & Oliveira, D. A. A. (2011). DNA barcoding In the present study, mean interspeci c distances were over unveils a high rate of mislabeling in a commercial freshwater catfish from 2.5% in all cases, and well above the mean distances observed Brazil. Informa Healthcare, 22(S1), 97e105. within populations (0.5%), reflecting the presence of well-defined Carvalho, D. C., Oliveira, D. A. A., Pompeu, P. S., Leal, C. G., Oliveira, C., & Hanner, R. fi and coherent groups equivalent to species. Comparing DNA bar- (2011). Deep barcode divergence in Brazilian freshwater shes: the case of the São Francisco River basin. Informa Healthcare, 22(S1), 80e86. coding sequences in L. analis and L. cyanopterus, Victor et al. (2009) Cervigón, F. (1993) (2th ed.).. Los peces marinhos de Venezuela (Vol. II (pp. 498) found a divergence of over 11%. Ward et al. (2005) detected a mean Caracas, Venezuela: Fundacion Científica Los Roques. distance of approximately 9.9% for comparisons between species of Cervigón, F., Capriani, F., Fischer, W., Garibaldi, L., Hendrickx, M., Lemus, A. J., et al. (1993). FAO species identification sheets for fishery purpose. Field guide to the the same genus and 0.4% for intra-population comparisons, which commercial marine and Brackish-water resources of the Northerrn Coast of South are similar to the values of 8.3% and 0.3%, respectively, recorded by America (pp. 513). Rome: FAO. Hubert et al. (2008). A similar pattern was observed in the present Céspedes, A., Garcia, T., Carrera, E., Gonzalez, I., Fernandez, A., Hernandez, P. E., et al. (1999). Identication of sole (Solea solea) and Greenland halibut (Reinhardtius study. hippoglossoides) by PCR amplication of the 5S rDNA gene. Journal of Agricultural Overall, the results presented here, including genetic diver- and Food Chemistry, 47, 1046e1050. gence, the distribution of polymorphic sites, and tree topology, Chiu, T. H., Su, Y. C., Pai, J. Y., & Chang, H. C. (2012). Molecular markers for detection fi and diagnosis of the giant grouper (Epinephelus lanceolatus). Food Control, 24, con rm the hypothesis that different regions of the COI gene may 29e37. be used successfully to create a reliable authentication system for De Salle, R., & Birstein, V. J. (1996). PCR identification of black caviar. Nature, 381, fishery products. This procedure thus constitutes a powerful tool 197e198. fi FAO. (2012). The state of world fisheries and aquacultura. Disponível em:
Matos-Caraballo, D. (2000). Overview of Puerto Rico’s small-scale fisheries statis- gene as a diagnostic tool for the discrimination of South American mullets of tics: 1994e1997. Proceedings of the Gulf and Caribbean Fisheries Institute, 51, the genus Mugil. Aquaculture Research,1e6. 215e231. Sajdak, S. L., Reed, K. M., & Phillips, R. B. (1998). Intraindividual and interspecies Mendoza, J. J., & Larez, A. (1996). Abundance and distribution of snappers and variation in the 5S rDNA of coregonid fish. Journal of Molecular Evolution, 46, groupers targeted by the artisanal medium range fishery off northeastern 680e688. Venezuela (1981e1992). ICLARM Conference Proceedings, 48, 266e276. Sales, J. B. L., Rodrigues-Filho, L. F. S., Haimovici, M., Sampaio, I., & Schneider, H. Menezes, N. A., & Figueiredo, J. L. (1980). Manual de Peixes marinhos do Sudeste do (2011). Food Control, 22,96e98. Brasil. IV. Teleostei (3) (pp. 96). São Paulo: Museu de Zoologia e Universidade de Sambrook, j., & Russell, D. (2001). Molecular cloning: A laboratory manual. Cold São Paulo (USP). Spring Harbor, New York: Cold 303 Spring Harbor Laboratory Press. Miller, T. L., & Cribb, T. H. (2007). Phylogenetic relationships of some common Indo- Sanger, F., Nichlen, S., & Coulson, A. R. (1977). DNA sequencing with chain- Pacific snappers (Perciformes: Lutjanidae) based on mitochondrial DNA se- termination inhibitors. Proceeding of the National Academy of Science of the quences, with comments on the taxonomic position of the Caesioninae. Mo- USA, 74, 5463e5468. lecular Phylogenetics and Evolution, 44, 450e460. Silva-Oliveira, G. C., Ready, J. S., Iketani, G., Bastos, S., Gomes, G., Sampaio, I., et al. Móran, P., Martínez, J. L., Garcia-Vásquez, E., & Pendás, A. M. (1996). Sex linkage of (2011). The invasive status of Macrobrachium rosenbergii (De Man, 1879) in 5S rDNA in rainbow trout (Oncorhynchus mykiss). Cytogenetics and Cell Genetics, Northern Brazil, with an estimation of areas at risk globally. Aquatic Invasions, 75,145e150. 6(3), 419e428. Moura, R. L., & Lindeman, K. C. (2007). A new species of snapper (Perciformes: Smith, M. A., Woodley, N. E., Janzen, D. H., Hallwachs, W., & Hebert, P. D. N. (2006). Lujanidae) from Brazil, with comments on the distribution of Lutjanus griseus DNA barcodes reveal cryptic host-specificity within the presumed polyphagous and L. apodus. Zootaxa, 1422,31e43. members of a genus of parasitoid flies (Diptera: Tachinidae). Proceedings of the Nelson, J. S. (2006). Fishes of the world (4th ed.). (pp. 539) New Jersey: John Wiley & National Academy of Sciences, 103, 3657e3662. Sons, Inc. Sotelo, C., Piñeiro, C., Gallardo, J. M., & Pérez-Martín, R. I. (1993). Fish species identi- Palumbi, S., & Benzie, J. (1991). Large mitocondrial DNA differences between fication in seafood products. Trends in Food Science and Technology, 4,395e440. morphologically similar Penaeid shrimp. Molecular Marine Biology and Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., & Kumar, S. (2011). MEGA Biotechnology, 1,27e34. 5: molecular evolutionary genetics analysis using maximum likelihood, Pendás, A. M., Móran, P., Freije, J. P., & Garcia-Vásquez, E. (1994). Chromosomal evolutionary distance, and maximum Parsimony methods. Molecular Biology location and nucleotide sequence of two tandem repeats of the Atlantic salmon and Evolution, 28(10), 2731e2739. 5S rDNA. Cytogenetics and Cell Genetics, 67,31e36. Van Leeuwen, S. P., van Velzen, M. J., Swart, C. P., van der Veen, I., Traag, W. A., & de Pendás, A. M., Móran, P., Martínez, J. L., & Garcia-Vásquez, E. (1995). Applications of Boer, J. (2009). Halogenated contaminants in farmed salmon, trout, tilapia, 5S rDNA in Atlantic salmon, brow trout, and in Atlantic salmon x brown trout pangasius, and shrimp. Environmental Science and Technology, 43,4009e4015. hybrid identification. Molecular Ecology, 4,275e276. Victor, B. C., Hanner, R., Shivji, M., Hyde, J., & Caldow, C. (2009). Identification of the Pinhal, D., Gadig, O. B. F., & Martins, C. (2009). Molecular organization of 5S rDNA in larval and juvenile stages of the Cubera Snapper, Lutjanus cyanopterus, using sharks of the genus Rhizoprionodon: insights into the evolutionary dynamics of DNA barcoding. Zootaxa, 2215,24e36. 5S rDNA in vertebrate genomes. Genetics Research, 91,61e72. Ward, R. D. (2000). Genetics in fisheries management. Hydrobiologia, 420,191e201. Pinhal, D., Gadig, O. B. F., Wasko, A. P., Oliveira, C., Ron, E., Foresti, F., et al. (2008). Ward, R. D., Hanner, R., & Hebert, P. D. N. (2009). The campaign to DNA barcode all Discrimination of shark species by simple PCR of 5S rDNA repeats. Genetics and fishes, FISH-BOL. Journal of Fish Biology, 74, 329e356. Molecular Biology, 31,361e365. Ward, R. D., Zemlak, T. S., Innes, B. H., Last, P. R., & Hebert, P. D. N. (2005). DNA Posada, D. (2008). JMODELTEST: phylogenetic model averaging. Molecular Biology barcoding Australia’s fish species. Philosophical Transactions of the Royal Society and Evolution, 25, 1253. of London. Series B, 360, 1847e1857. Prescod, S. D., Oxenford, H. A., & Taylor, C. (1996). The snapper fishery of Barbados: Wasko, A. P., Martins, C., Wright, J. M., & Galetti, P. M., Jr. (2001). Molecular orga- present status and a preliminary assessment of the potential for expansion. nization of 5S rDNA in fishes of the genus Brycon. Genome, 44, 893e902. Proceedings of the Gulf and Caribbean Fisheries Institute, 44,159e179. Wen, J., Hu, C., Zhang, L., & Fan, S. (2011). Genetic identification of global com- Rasmussen, R. S., & Morrissey, M. T. (2008). Application of DNA-based methods to mercial sea cucumber species on the basis of mitochondrial DNA sequences. identify fish and seafood substitution on the commercial market. Comprehen- Food Control, 22,72e77. sive Reviews in Food Science and Food Safety, 8,118e154. Wong, L. L., Peatman, E., Lu, J., Kucuktas, H., He, S., Zhou, C., et al. (2011). DNA Rasmussen, R. S., Morrissey, M. T., & Hebert, P. D. N. (2009). DNA barcoding of barcoding of catfish: species authentication and phylogenetic assessment. PLoS commercially important Salmon and trout species (Oncorhynchus and Salmo) One, 6, e17812. from North America. Journal of Agricultural and Food Chemistry, 57,8379e8385. Yang, Y. C., Huang, Y. W., Hsieh, C. H., Huang, Y. R., & Chen, C. H. (2012). A unique Rock, J., Costa, F. O., Walker, D. I., North, A. W., Hutchinson, W. F., & Carvalho, G. R. specification method for processed unicorn filefish products using a DNA bar- (2008). DNA barcodes of fish of the Scotia Sea, Antarctica indicate priority code marker. Food Control, 25, 292e302. groups for taxonomic and systematics focus. Antarctic Science, 20, 253e262. Zhang, J., & Liu, X. (2006). The phylogenetic relationship of the family Lutjanidae Rodrigues-Filho, L. F. S., Cunha, D. B., Vallinoto, M., Schneider, H., Sampaio, I., & based on analyses of AFLP and mitochondrial 12S rRNA sequences. Chinese Fraga, E. (2010). Polymerase chain reaction banding patterns of the 5S rDNA Science Bulletin, 51,143e148.