Enterocytozoon Bieneusi Infection

Microsporidiosis: Enterocytozoon bieneusi infection

Dr. Ujjala Ghoshal Professor & Incharge Parasitology Department of Microbiology Sanjay Gandhi Postgraduate Institute of Medical ESCMIDSciences, Lucknow,eLibrary India E mail: [email protected] © by author Microsporidiosis

 Microsporidiosis is an opportunistic infection caused by a group of obligate intracellular eukaryotic pathogens, which is phylogenetically related to Fungi

 It is increasingly common pathology in humans due to growing number of persons with immunodepressive states

 About 1300 species of 150 genera known to infect vertebrates as well as invertebrates

 Fourteen species are implicated in human pathology, including Enterocytozoon bieneusi and Encephalitozoon intestinalis ESCMID eLibrary  E. bieneusi known ©to cause by90 %authorof human infections Enterocytozoon bieneusi

 In 1985, E. bieneusi was first recognized as opportunistic pathogen in AIDS patient

 E. bieneusi has been increasingly reported in treatment induced immunosuppression  Renal transplant (common)  Bone marrow transplant  Stem cell transplant and,  Liver transplant recipients  Cancer patients  Patient with Inflammatory bowel disease (IBD)  EESCMID. bieneusi has been reported eLibraryamong traveler's, children and elderly as well Lopez-Velez R et al. 1999 © by author Enterocytozoon bieneusi contd..

 E. bieneusi has been identified in  Pets and farm animals (dog, cat, pig, goat, donkey, cattle, rabbit)  Wild animals (fox, otter, raccoon, nutria)  Birds (industrial poultry, urban pigeons)

Desportes livage I et al. 2005; Anane S et al. 2010

 Spores of E. bieneusi have been detected in surface water and also certain fruits, vegetables and milk ESCMID eLibrary © by author E. bieneusi in HIV-infected patients

Country Patients with No. of Prevalence diarrhea patients

Weber et al. 1992 USA Mixed 134 4.5%

Kotler et al. 1994 USA Mixed 194 28.9%

Van Gool et al. Zimbabw Yes 129 10.1% 1995 e Anwar-Bruni et USA Mixed 371 5.9% al. 1996 Coyle et al. 1996 USA Mixed 111 27.9% Maiga et al. 1997 Mali Mixed 77 32.5%

Mathewson et al. USA Yes 83 6% 1998 Mwachari et al. Kenya Yes 36 2.8% 1998 CegielskiESCMID et al. Tanzania Yes eLibrary86 3.5% 1999 Brandonisio et al. Italy Mixed 154 4.5% 1999 © by author E. bieneusi in HIV-infected patients contd..

Country Patients with No. of Prevalence diarrhea patients Gumbo et al. Zimbabw Yes 55 50.9% 1999 e Wanachiwanawin Thailand Yes 66 33.3% et al. 1998 Wanachiwanawin Thailand Yes 91 28.6% et al. 1999

Ferreira et al. Portugal Yes 215 42.8% 2001 Waywa et al. Thailand Yes 288 9.7% 2001 Chokephaibulkit Thailand Yes 82 19.5% et al. 2001 Wanachiwanawin Thailand Yes 95 25.3% et al. 2002 Florez et al. 2003 Colombia Mixed 115 3.5% ESCMIDSulaiman et al. Peru Mixed eLibrary2672 3.9% 2003 Endeshaw et al. Ethiopia Yes 80 22.5% 2005 © by author E. bieneusi in HIV-infected patients contd..

Country Patients with No. of Prevalence diarrhea patients Tumwine et al. Uganda Yes 91 76.9% 2005 Endeshaw et al. Ethiopia Yes 214 18.2% 2006 Sarfati Et al. 2006 Cameroon Yes 152 5%

Chacin Bonilla et Venezuela Mixed 103 13.6% al. 2006 Kulkarni et al. India Yes 137 1.5% 2009 Viriyavejakul et al. Thailand Mixed 64 81.3% 2009 Kucerova et al. Russia na 46 13% 2011 Wang et al. 2013 China 683 5.7% AgholiESCMID et al. 2013 Iran Mixed eLibrary356 2.2% Khanduja et al. India Mixed 222 1.8% 2016 © by author E. bieneusi in renal transplant recipients

Country Patients with No. of patients Prevalence/ no. diarrhea of cases

Guerard A et al. France Yes 2 2 (E. bieneusi) 1999 Metge S et al. France Yes 1 1 (E. bieneusi) 2000 Mohindra AR et USA urine 1 1 (E. cuniculi) al. 2002 Gamboa- Mexico Yes 1 1 (E. cuniculi) Dominguez A et al. 2003 Lanternier F et France Yes 1 1 (E. bieneusi) al. 2009 Champion L et France Yes 10 10 (E. bieneusi) al. 2010 ESCMID eLibrary Talabani H et al. France Urine sample 1 1 (E. cuniculi) 2010 © by author E. bieneusi in renal transplant recipients contd.. Country Patients with No. of patients Prevalence/ no. diarrhea of cases Galvan AL et al. 2011 Spain Yes 2 2 (E. bieneusi) Pomares C et al. 2012 France Yes 1 1 (E. bieneusi) Visvesvara GS et al. USA Yes 1 1 (E. bieneusi) 2013 Godron A et al. 2013 France Yes 1 1 (E. bieneusi) Ladapo TA et al. 2014 Nigeria yes 2 2 (E. cuniculi) Brown M et al. 2018 Australia Yes 1 1 (E. bieneusi) Ghoshal U et al. 2015 India Mixed 272 E. bieneusi 5.8% In diarrhea: 9.6% Tabatabiae ESCMID F et al. Iran Urine eLibrary sample 38 E. bieneusi 2015 5.26% Kicia M et al. 2016 Poland Mixed 86 32% © by author E. bieneusi 23% E. bieneusi in malignancy patients Country Patients with No. of patients Prevalence/ no. of diarrhea cases Nevez G et al. 2015 France - 5 CD4 T cell 5 cases (E. hellem) prolymphocytic leukemia patients Hamamci B et al. 2015 Turkey Yes 93 patients 9.7% (9/93) (E. bieneusi) Jimenez GB et al. 2012 Mexico Yes 13 leukemia & 4 (E. bieneusi) lymphoma patients Yakub J et al. 2012 Pakistan Mixed 13 Hepatocellular 3 cases carcinoma (E. bieneusi) Baiomy A et al. 2010 Egypt Mixed 40 malignancy 2% (1/40) patients Microsporidia Lono AR et al. 2008 Malaysia Mixed 311 cancer 3 cases patients (Breast, (Encephalitozoon ESCMID eLibraryCervical, lung) spp.) Chabchoub N et al. Tunisia Mixed 35 haematological 8.6% 2009 malignancy E. bieneusi patients Encephalitozoon © by author spp. E. bieneusi in children

Country Patients with No. of patients Prevalence diarrhea Del Aguila C et al. Spain Mixed 83 1.2% (1/83) 1997 Tumwine JK et al. Uganda Mixed 1779 17.4% (310/1779) 2002 Tumwine JK et al. Uganda Mixed 243 32.9% (80/243) 2002 Samie A et al. 2007 South Africa Mixed 67 4.5% (3/67) Ayinmode AB et al. Nigeria Mixed 43 9.3% (4/43) 2011 Yang J et al. 2014 China Mixed 255 7.5%(19/255) Wang ESCMIDT et al. 2017 China Mixed eLibrary500 0.2%(1/500) Ding S et al. 2018 China Mixed 93 11.82%(11/93) © by author Other groups may be at risk

 Bone marrow transplant (BMT) patients:  4% (8/200) of BMT patients had E. bieneusi

Cetinkaya U et al. 2015  Stem cell transplant:  2 cases of allogeneic haematopoietic stem cell transplant recipients had E. bieneusi Bukreyeva I et al. 2017  Liver transplant:  6.8% (3/44) of liver transplant recipients had E. bieneusi  A paediatric patient with liver kidney transplant had

E.bieneusi Agholi M et al. 2013; Desobeaux G et al. 2013  InflammatoryESCMID bowel disease eLibrary (IBD):  12.7% (9/71) of IBD patients had E. bieneusi © by authorHasani Z et al. 2017 Modes of Transmission

 Human to human transmission:  Spores of E. bieneusi are excreted into the environment via • Fecal matter (most common) • Pulmonary secretions (three case reports) • Urine

Del aguila C et al. 1997; Weber R et al. 1992; Botterel F et al. 2002; Kicia M et al. 2014; Anane S et al. 2010

 Animal to human transmission:  Several studies reported similar genotypes infecting humans and various animals  No formal proof of animal to human transmission of ESCMIDmicrosporidiosis, except eLibraryone case of seroconversion in a child in close contact with dog © by authorPrasertbun R et al. 2017; McInnes EF et al. 1991 Modes of transmission contd..

 Waterborne transmission:

 Recent study confirms the presence of E. bieneusi in surface water, E. intestinalis in tertiary sewage effluents, surface and ground water

 This represents the first confirmation to the species level of human pathogenic microsporidia in water indicating these pathogens may be waterborne

 Spores eliminated from fecal matter of infected animals in contact with surface water, thus subsequent contamination ESCMIDof water sources eLibrary Jawanmard E et al. 2018; Grackzyk TK et al. 2007; Sorel N et al. ©2003 by author Modes of Transmission contd..

 Food-borne transmission:  Spores of microsporidia have been identified in irrigation water and certain plants (lettuce, parsley, strawberries)

 Soft fruits, vegetables and herbs collected from markets in Poland were contaminated with E. bieneusi

Jedrzejewski S et al. 2007 Milk contaminated with E. bieneusi has been reported in

herds from Korea and China Lee JH 2008; Peng XQ et al. 2016

In 2009, a food borne outbreak of gastrointestinal illness in overESCMID100 people was eLibraryassociated with consumption of E. bieneusi contaminated cucumbers in Sweden © by authorDecraena V et al. 2012 Clinical manifestations

 Intestinal microsporidiosis in immunocompromised hosts:  Chronic intractable diarrhea  4 to 8 bowel movements per day  Loose to watery stool  Anorexia, weight loss  Nausea, vomiting  Dehydration with mild hypokalemia and hypomagnesia  Fat malabsorption

 Immunocompromised patients with CD4 count≤ 100 cells/µl are more susceptible

 Intestinal ESCMIDmicrosporidosis ineLibraryimmunocompetant hosts :  Self limiting watery diarrhea resolved within 2 wks  May persist as ©an asymptomatic by authorinfection Other clinical manifestations

 Pulmonary microsporidiosis  Persistent cough  Nonpurulent sputum  Dyspnea  Wheezing Botterel F et al. 2002

 Biliary microsporidiosis  Disseminate to hepotobiliary system leading to cholangitis ESCMID AnaneeLibrary S et al. 2010; Franzen C et al. 1999 © by author Life Cycle

Infective form: Spore Spores inhaled / ingested

Polar tubule injects sporoplasm into the host cell Spore

Sporoplasm develops into meronts and further sporonts Sporonts ESCMID give rise to sporoblasts eLibrary Mature spores are released, excreted with feces© by authorSporoplasm ejected into host cell Laboratory Diagnosis

Fluorescent Light Microscopy Microscopy

Diagnosis

Transmission Molecular ESCMIDElectron Microscopy eLibrarymethods © by author Samples

 Stool (three samples; most common)  Urine  Biopsy  Sputum  Bronchoalveolar lavage fluid

ESCMID eLibrary © by author Diagnosis: Light Microscopy

 Weber’s trichrome stain is widely used to identify spores of Microsporidia

 Spores appear as rose ovoid elements presenting a colorless posterior vacuole against green background Spores of Microsporidia under Important points: light microscopy  1.In Smearsome shouldcases be verystain thinuptake 2.is Pretreatmentstronger ofat fecalthe specimenequator, with 10% KOH may improve quality of smear 3. Use of positive control smear is highly recommended corresponding ESCMIDto the polar eLibrary filament © by authorSpore Weber’s modified trichrome stain

 In 1992, Weber et al. described a modified trichrome stain  Chromotrope 2R ten times (6g) the trichrome stain  Trichrome blue staining for 90 minutes

 Modifications in Weber’s modified trichrome stain:

Authors Modification Ryan et al. Used aniline blue as counterstain (1993) Kokoskin et al. Change in temp. & time of chromotrope (1994) staining mechanism, 50°C for 10 min. DidierESCMIDet al. Change ineLibrarytemp. & time of chromotrope (1995) staining mechanism, 37°C for 30 min. © by author Efficacy of modified trichrome stain

Test Authors Sample Sensitivit Specificit Size y y (%) (%) Modified Didier E S et al.1995 74 100 82.8 Trichrome (GS: TEM) stain Subrungruang I et al. 290 86.7 100 Gold 2004 standard (GS): PCR Saigal K et al. 2013 395 63.8 100

ESCMIDGhoshal U et al . 2015eLibrary730 93.8 100 © by author Diagnosis: Fluorescent microscopy

 Optical brightening agents such as Calcofluor, Fungifluor and Uvitex 2B are used

 It is a non-specific staining technique with sensitivity 100% and specificity ranging from 68.5% to 77.4%

Ghoshal U et al. 2015; Didier ES et al. 1995

 Interpretation of results in body fluids like urine is easy; however, with stools false-positive and false-negative results ESCMIDhave been seen eLibrary © by author Diagnosis: Fluorescent microscopy contd..

Spores of Microsporidia Yeast like cells (YLC)

• Size varies: spores are smaller as compared to YLC • Microsporidia spores visible as spotted spores while YLC ESCMIDare large somewhat oval shaped eLibrary • In case of YLC budding can be seen • Spores give brilliant ©white bycalcoflour authorflourescence Diagnosis: Indirect Immunofluorescence test

 Indirect immunofluorecence antibody (IFA) using monoclonal antibodies is effective for species differentiation

 This test differentiates between Enterocytozoon bieneusi and Encephalitozoon intestinalis

 It is a simple and rapid technique with reasonably good sensitivity and specificity

 Specific monoclonal antibodies currently available in the form of laboratory kits furnished by Bordier Affinity products, SAESCMIDand Meridian diagnostics eLibrary © by author Diagnosis: Indirect Immunofluorescence test contd..  Sensitivity and specificity of IFA ranges from 83.3% to 100% and 86% to 99.4%, respectively

Ghoshal U et al. 2016; AlMekhlafi MA et al. 2011; Didier ES et al. 1995

 E. bieneusi was identified in 4%(8/200) of BMT patients using IFA MAbs Cetinkaya U et al. 2015

ESCMID eLibrary Spores of Enterocytozoon © by bieneusi author identified using IFA test Diagnosis: Histopathology

 Spores do not tend to stain predictably in routine histologic preparations

 Sensitivity of Haematoxylin and eosin, Giemsa and PAS stain remains uncertain

 Modified Grams stain (Brown Brenn, Brown-Hopps) is sensitive and generally recommended

ESCMID eLibrary

Biopsy specimen show oval © bodiesby author Diagnosis: Transmission electron Microscopy

 Electron microscopy is oldest technique

 Characteristic structural features of the spores can provide genus and species of the microsporidia based on:  Structure and organization of the polar filament: 5 to 7 coils in E. bieneusi  Modalities of cytoplasmic and nuclear division  Different stages of the parasite cycle  Nature of the host-parasite interface

ESCMIDFor stool samples, species eLibraryidentification is difficult as most of the proliferative stages are absent, only spores are present © by author Diagnosis: Transmission electron Microscopy

 Sensitivity of TEM is limited in detecting microsporidia

 It is a complex method requiring rigorous, invasive sampling in addition to technical expertise

 Results are difficult to obtain and interpret

 Overall, it is an expensive technique; thus, not used in routine practice ESCMID eLibrary © by author Diagnosis: Molecular methods

 Molecular methods provide a precious tool for  Detection & species differentiation  Taxonomic Classification  Phylogenetic studies

 Polymerase chain reaction(PCR) amplify different regions  Small subunit rRNA  Large subunit rRNA  Internal transcribed spacer (ITS) Internal transcribed spacer (ITS)  It is a sensitive, specific and reproducible method with sensitivity ranging from 96.8% to 100%, while specificity ranging ESCMIDfrom 99.8% to 100 %eLibrary Subrungruang I et al. 2004; Ghoshal U et al. 2015 © by author PCR

 PCR detection threshold for microsporidia is 102 spores/g of feces

 However, it is long, expensive technique and parasite load cannot be identified

Other techniques  Restriction fragment length polymorphism  Nested PCR  Multiplex PCR  Sequencing ESCMIDInsitu Hybridization eLibrary © by author PCR contd…

HinfI Hind III

b) Representative gel image showing a) PCR product of patient sample positive for spores of microsporidia, and b) Digestion pattern of PCR products using restriction enzymes HinfI and HindIII

ESCMID eLibraryGhoshal U et al. 2015 © by author Diagnosis: Multiplex PCR

 A widespread technique used for amplification of multiple targets in a single PCR experiment

 Authors developed multiplex PCR to amplify E. bieneusi and Enc. intestinalis among patients with diarrhea

Rubio JM et al. 2004; Seung-Hyun L et al. 2010

 Multiplex PCR was useful in detecting Microsporidia and Cryptosporidium; thus, helpful for detecting outbreaks of waterborne protozoan infections ESCMID eLibraryTaniuchi M et al . 2011 © by author Diagnosis: Real-time PCR

 Real time PCR detects accumulative amplicons in real time via  Fluorescent dyes or Fluorescent labeled probes

It is a specific highly sensitive method with detection threshold < 40 spores/ml in stool

Advantages over PCR  Quantitative test over broad dynamic range  Employs multi-well format and no post-amplification processing ESCMIDIncreases throughput and reduceseLibrarythe risk of contamination © by author Diagnosis: Real-time PCR contd..

 Enables close follow up of the kinetics of microsporidia eradication in patients under treatment

 A multiplex real time PCR was developed for simultaneous detection of E. bieneusi and E. intestinalis in stool samples

 The sensitivity and specificity for detecting pathogens in species-specific DNA controls was 100%

Verweij JJ et al. 2007

 E. bieneusi was identified among HIV positive patients using real ESCMIDtime PCR eLibrary Wumba R et al. 2012 © by author Genotyping & Phylogenetic anlaysis of E. bieneusi

PCR analysis of hyper-variable ITS sequences of E. bieneusi sequence, ITS of rRNA gene submitted in NCBI retrieved from NCBI Sequencing of PCR products Multiple alignment of Comparison of obtained ITS sequences obtained is done sequences with those in using Clustal W NCBI databases

Phylogenetic tree constructed using Mega ESCMID eLibrary5.0 © by author Genotypes of E. bieneusi

 E. bieneusi is a complex species with multiple genotypes and diverse hosts range

 Genotyping is a valuable tool to obtain information about diversity, transmission and evolution of E. bieneusi

 More than 150 genotypes detected in feces of humans, various animals & birds Mathis et al. 2005; Sulaiman et al. 2003  High-resolution multi-locus sequence typing (MLST) has been developed using  Three microsatellites markers (MS1, MS3, and MS7) and  One ESCMIDminisatellite (MS4) markers eLibrary © by author Genotypes of E. bieneusi contd..  Five major groups (clusters) numbered 1 to 5

Groups Genotypes

1 Includes all except one of previously reported E. bieneusi isolates from humans. Also reported from domestic and wild animals.

2 Includes genotypes of E. bieneusi isolated in farm animals, exclusively from cattles and one genotype from chicken 3 Includes three genotypes isolated from muskrat and one from cat 4 Includes genotypes isolated exclusively from racoons

5 Includes most distinct genotype in humans CAF4 and ESCMIDother genotype isolated eLibrary from marmoset © by author Treatment Drugs

Albendazole Fumagilin Fumagilin analog Others

    Microtubule inhibitor Encephalitozoon TNP-470 Furazolidone & E. bieneusi  Sinefungin  Encephalitozoon Atovaquone E. bieneusi → variable Thrombocytopenia Azithromycin Itraconazole Fumagillin inhibits Microsporidia replication ESCMID eLibraryOctreotide Sulpha drugs © by author Treatment

 Criteria for therapeutic success includes  Resolution of clinical manifestations  Absence of spores in the sample

 Efficacy of therapeutics depend upon the causal species

 Albendazole has limited efficacy against E. bieneusi

 Fumagillin has been used successfully against E. bieneusi causing intestinal microsporidiosis in humans ESCMID eLibraryDidier PJ et al. 2006; Zhang H et al. 2005 © by author Prevention

 The most likely transmission mode being orofecal, high risk subjects should abide by strict rules of hygiene

 Besides hand washing, advice includes washing fresh vegetables, drinking bottled (or boiled) water, eating well- cooked meat and seafood and limiting contact with animals susceptible of transmitting the disease

 For HIV-infected subjects, reconstitution of immune defenses with antiretroviral therapy is the key to prevention ESCMID eLibrary © by author E. bieneusi: Destablizing global ecosystem

 Microsporidia now pose major global challenges to our future health, food security and economy

 The ability of the parasites to enter the global food chain is a real threat for future health and food security

 An outbreak of E. bieneusi in cucumbers in Sweden caused gastrointestinal disease in more than 100 people

 Government has set out ‘One Health’ agenda to apply molecular and ecological tools to better understand the biology and ESCMIDtrack the spread of Microsporidian eLibraryparasites.  Future legislation will impose stricter barriers on global food trade and travel to reduce© bythe threat authorof imported parasites. Our Experience at SGPGIMS, India

Objectives:

Prevalence of Microsporidia among immunocompromised patients (HIV patients, haematological malignancy patients and renal transplant recipients)

 Species identification using PCR-RFLP between E. bieneusi, Encephalitozoon intestinalis, E. cuniculi and E. hellem

 Genotyping and phylogenetic analysis of E. bieneusi isolates ESCMID eLibrary © by author Methodology

 Study duration: April 2010 to March 2017  Subjects: Immunocompromised patients Questionnaire

Stool sample

DNA sample

PCR-RFLP for species identification Formol-ether concentration Genotyping of E. bieneusi Nested PCR

ESCMIDModified trichrome stain eLibrary © by authorSequencing Methodology

Phylogenetic analysis RFLP ITS sequences retrieved from HinfI HindIII NCBI E. bieneusi 230bp & 940bp 386bp & 784bp E. intestinalis 120bp, 250bp, - 350bp, 460bp

Multiple alignment done E. hellem 260bp, 350bp, - using Clustal W 580bp E. cuniculi 350bp, 830bp -

Phylogenetic tree constructed using Mega 5.0 PCR Primer sequence Genotyping Primary (410 bp) of FP 5’GATGGTCATAGGGATGAAGAGCTT3’ PCR E. bieneusi RP 5’ ACGGATCCAAGTGATCCTGTATT3’ Target gene: SSU rRNA gene Secondary (392 bp) FP: 5’CACCAGGTTGATTCTGCC 3’ FP 5’ AGGGATGAAGAGCTTCGGCTCTG3’ ESCMID eLibraryRP 5’ AGTGATCCTGTATTAGGGATATT3’ RP: 5’ GTGACGGGCGGTGTGTAC 3’ Expected size: 1200 bp © by author Microsporidia in Immunocompromised patients patients (N=725)

28(3.86%)

ESCMID eLibrary © by author Microsporidia prevalent among diarrhea patients No. of immunocompromised patients = 725 No. of immunocompromised patients with diarrhea = 308

 27/725 (3.72%) positive by PCR  Results were confirmed by sequencing L PC 1 2 3 NC

1200 bp

L- 50 bp ladder; PC- Positive Control; 1-3 – Digestion pattern of PCR products using Samples;ESCMID NC- Negative Control eLibraryrestriction enzymes HinfI and HindIII E. bieneusi was identified in all of them using Hinf I & Hind III © by author Genotypes of E. bieneusi

 ITS sequences were amplified in 27 E. bieneusi positive cases KP325473-KP325476

 E. bieneusi belonged to eight distinct genotypes (Ind1 to Ind8)  KP325473-KP325476;  KU360238-KU360241

 Among them, all genotypes (Ind1 to Ind8) are novel

392 ESCMIDbp eLibrary Lane M, 100 bp ladder; PC, positive control of ITS of E. bieneusi; Lane 1-3, samples amplified for ITS of E. bieneusi ; NC, negative control © by author Genotypes of E. bieneusi

 Distribution of Genotypes of E. bieneusi identified among 27 immunocompromised patients

S.no. Genotype No. of patients identified (%age) 1 Ind 1 5 (18.5%) 2 Ind 2 4 (14.8%) 3 Ind 3 6 (22.2%) 4 Ind 4 4 (14.8%) 5 Ind 5 4 (14.8%) 6 Ind 6 2 (7.4%) 7 Ind 7 1 (3.7%) ESCMID8 Ind 8 eLibrary1 (3.7%) © by author Genotypes of E. bieneusi

Close sequence similarity to genotypes reported from both animals & humans  95% similarity with Genotypes L, K, D reported in cats and horses

Ind5 Ind6 Ind1

Genotypes of E. bieneusi

Ind2 Ind8 Ind3 Ind4 Ind7  CloseESCMIDsequence similarity to eLibrarygenotypes reported from humans  94% similarity with genotype A © by author Phylogenetic analysis

Anthroponotic transmission (n=14)

1. World’s first and largest study on genetic characterization of Microsporidia in Renal Transplant: patients with RT, particularly among younger patients with chronic and associated giardiasis

2. E. bieneusi is the most common species.

3. Modified trichrome stain and PCR has high sensitivity, specificity and diagnostic accuracy.

4. PCR is useful for species identification

5. 8 novel genotypes of E. bieneusi have been reported

6. Close sequence similarity to genotypes reported from both animals & humansESCMID; anthroponotic and eLibraryzoonotic modes of transmission may exist © by author Publications

Publications: 15 Impact factor: Up to 3.85 Citation: 97 Impact factor: 3.85

Metabolomics. 2012:8; 540-555.

Impact factor: 2.27

Acta Trop. 2014; 133:1-7.

Impact factor: 0.882

Indian J Med Microbiol. 2015;33:357-63..

Impact factor: 1.67

Indian J Med Sci 2006; 60:106-110

BMC Res Notes. 2012: 7;5:416.

Asian Journal of Transfusion Sciences 2012;6: 174-178

J Diarrhoeal Dis Research 1999; 17: 43-5

Trop Parasitol. 2015;5(2):101-105

ESCMID eLibraryTrop TGastroenterol 2012;33:135–141 Indian J Public Health..2010:1:79-81 © by author Research: Parasitology

J Infect Public Health, 2017 ; 17: 30150-8

Acta Parasitol 2017; 62: 63-68

Pathog Glob Health. 2016; 17:1-5

Journal of Biosciences and Medicines, 2016, 4, 85-96

Gut Liver. 2017 Mar 15;11(2):196-208

Acta Trop. 2017;178:55-60

Gastroenterol clinic North America. 2017; 46:103-120

 Indian Council of Medical Research, New Delhi, India

 Dr. Jaco Jan Verweij, Netherlands for providing DNA of E. bieneusi

Lab Members

 E. bieneusi is the commonest cause of diarrhea among immunocompromised hosts including those with HIV and renal transplant recipients

 High degree of clinical suspicion and specific diagnostic methods is important for appropriate management of patients

 Species identification is very important in Microsporidia as treatment varies as per the species

 Preventive measures should emphasize on environmental and ESCMIDpersonal hygiene and qualityeLibraryof drinking water © by author Conclusion

Further research is needed to develop effective agent against E. bieneusi

Studies focusing on E. bieneusi genome and biochemical structure will be useful for identifying novel therapeutic compounds ESCMID eLibrary © by author