Insights Into the Immune Mechanisms Leading to Lupus-Like Autoimmunity in New Zealand Black Mice

Insights into the immune mechanisms leading to lupus-like autoimmunity in New Zealand Black mice

Evelyn Yin-Wah Pau

A thesis submitted in conformity with the requirements

for the degree of Doctor of Philosophy

Graduate Department of Immunology

University of Toronto

Insights into the immune mechanisms leading to lupus-like autoimmunity in New

Zealand Black mice

Doctor of Philosophy Degree, 2013

Evelyn Yin-Wah Pau

Department of Immunology

University of Toronto

Abstract

Systemic lupus erythematosus (SLE) is a chronic, multi-organ autoimmune disease characterized by the production of antibodies against self nuclear antigens. Genetics play a dominant role in disease pathogenesis and functional examination of spontaneously-arising lupus-prone animal models has provided key insights into understanding the genetic complexity of the disease. The overarching goal of the work presented here is to identify the underlying immunologic abnormalities, together with lupus susceptibility loci that produce them, that promote the development of autoimmunity in the lupus-prone

New Zealand Black (NZB) background. Chapter 2 identifies the critical role of CD40-CD40L interactions in the pathogenesis of disease in NZB mice. We showed that this interaction is required for the production of class-switched IgG autoantibodies and development of hemolytic anemia and kidney disease. Polyclonal B cell activation, expansion of plasmacytoid dendritic cells (pDC), and elevated gene expression of baff were maintained in CD40L-deficient NZB mice, despite the lack of IgG immune complexes. Chapter 3 utilizes bicongenic mice carrying both NZB chromosomes 1 and 13 to investigate the genetic complexity in disease pathogenesis. In addition to identifying new phenotypes, examination of bicongenic mice showed that chronic stimulation of pDC due to the persistence of nuclear antigens leads to a refractory state with a failure to produce more IFN-α upon subsequent stimulation. Chapter 4 ii

identifies a novel lupus susceptibility locus on NZB chromosome 13 associated with impaired clearance of apoptotic debris, a key initiating step in the development of autoimmunity. Using subcongenic mice, this locus was localized and examined its impact on immune function. Work from this thesis will contribute to understanding the complex immunogenetic mechanisms that lead to development of SLE.

iii

Acknowledgments

There are many people who have contributed in different ways to this thesis:

My supervisor Dr. Joan Wither, for her wisdom and continuous support. Thank you for being the best supervisor and bringing me into the world of immunology.

Dr. Nan-Hua Chang, for shaping me into the researcher I am today and allowing me to coin the term “Nan is always right.”

Dr. Christina Loh, for introducing me to the Wither lab, teaching me to do research, and being the best colleague and friend in the lab. I couldn’t have done this without you.

Dr. Yui-Ho Cheung, for being a pioneer in the Wither lab and leading me into the world of TAing.

Dr. Carolina Landolt-Marticorena, for her humour and wit. We will always celebrate Candlemas.

Nafiseh Talaei, for the warmth and kindness she brings to the lab.

Yuriy Baglaenko, for supporting me with his sanity.

Kimberley Lifeso, for keeping Yuriy in check and being a sassy deskmate.

Kieran Manion, for her musical entertainment in the lab when she thinks nobody notices.

Gillian Minty, for taking over my c13 project and answering all the remaining questions.

Allie Rasiuk, for all her laughter and genotyping help.

Babak Noamani, for his constant source of gossip at TWH.

Connor Moffatt, our honourary Wither lab member, for the excitement he brings to the lab.

Past members of the lab: Julie Kim, Charmaine Ferguson, Gabriel Bonventi, and Yong-Chun Cai.

My supervisory committee Dr. Eleanor Fish and Dr. Jennifer Gommerman, for their thoughts, feedback, and expertise.

My family, for letting me pursue science, and Timothy Li, for his love and patience.

I am grateful for having you all in my life and in my graduate career. Thank you from the bottom of my heart.

Research conducted in this thesis was supported by grants from the Canadian Institutes of Health Research and The Arthritis Society. Studentship awards were supported by the Edward Dunlop Foundation Ontario Graduate Scholarships in Science and Technology (2007-2011), and the University of Toronto Doctoral Completion Award (2011-2012).

Table of Contents

Abstract ...... ii

Acknowledgments...... iv

Table of Contents ...... v

List of Figures and Tables ...... ix

List of Publications ...... xi

List of Abbreviations ...... xii

Chapter 1 Introduction ...... 1

1.1 Systemic lupus erythematosus ...... 2

1.1.1 Genetic factors in SLE ...... 2

1.1.2 Environmental factors in SLE ...... 3

1.2 Mouse models of lupus ...... 3

1.2.1 Spontaneous lupus models ...... 4

1.2.2 Congenic mouse models of lupus ...... 6

1.3 Mechanisms of lupus pathogenesis ...... 9

1.3.1 Impaired clearance and aberrant response to apoptotic debris ...... 10

1.3.2 Aberrant lymphocyte signalling ...... 21

1.3.3 Defects that promote survival of autoreactive lymphocytes...... 25

1.3.4 Defects that promote end organ damage ...... 27

1.4 Bridging mouse studies to human SLE ...... 28

1.5 Thesis objectives ...... 32

Chapter 2 Abrogation of pathogenic IgG autoantibody production in CD40L gene-deleted lupus-prone New Zealand Black mice ...... 34

2.1 Abstract ...... 35

2.2 Introduction ...... 35

2.3 Materials and Methods ...... 38

2.3.1 Mice ...... 38

2.3.2 Flow cytometry staining and analysis ...... 39

2.3.3 Measurement of antibody production ...... 39

2.3.4 Detection of anti-RBC antibodies ...... 40

2.3.5 Grading of kidney sections ...... 41

2.3.6 Quantitative real-time PCR analysis ...... 41

2.3.7 In vitro cell proliferation and Ig class-switching ...... 42

2.3.8 Statistical analysis ...... 43

2.4 Results ...... 43

2.4.1 Abrogated IgG autoAb and attenuated kidney disease in NZB.CD40L-/- mice...... 43

2.4.2 Variable effects of CD40L on the cellular phenotypic abnormalities seen in NZB mice...... 46

2.4.3 Elevated levels of baff, but not bone marrow type I IFN production, are independent of CD40L in NZB mice...... 49

2.4.4 B cell CD40L expression is not required for proliferation and Ig class-switching in response to TLR signals...... 53

2.5 Discussion ...... 59

2.6 Conclusions ...... 62

Chapter 3 TLR tolerance reduces IFN-alpha production despite plasmacytoid dendritic cell expansion and anti-nuclear antibodies in NZB bicongenic mice ...... 63

3.1 Abstract ...... 64

3.2 Introduction ...... 65

3.3 Materials and Methods ...... 66

3.3.1 Ethics statement ...... 66

3.3.2 Mice ...... 67

3.3.3 Flow cytometry analysis ...... 68

3.3.4 Measurement of Ab production ...... 69

3.3.5 Bone marrow-derived DC (BMDC) cultures and CD11c+ splenic DC isolation ...... 69

3.3.6 TLR stimulation and cytokine blockade ...... 70

3.3.7 Immunofluorescence staining of tissue sections ...... 70

3.3.8 Grading of kidney sections ...... 71

3.3.9 Measurement of mRNA expression ...... 72

3.3.10 Statistics...... 72

3.4 Results ...... 73

3.4.1 B6.NZBc1c13 mice demonstrate a dramatic expansion of DC populations ...... 73

3.4.2 Clinical autoimmune disease is not amplified in bicongenic mice despite altered autoAb production...... 78

3.4.3 In vivo cytokine production in bicongenic mice ...... 82

3.4.4 Reduced in vitro cytokine production by pDC from bicongenic mice ...... 85

3.4.5 Reduced IFN-α secretion by pDC does not result from cytokine or cellular inhibition ... 90

3.4.6 Bone marrow-derived pDC from bicongenic mice demonstrate normal cytokine production and tolerance following TLR stimulation in vitro ...... 92

3.4.7 Splenic pDC in older bicongenic mice have a phenotype suggesting chronic activation in vivo ...... 94

3.5 Discussion ...... 99

Chapter 4 Identification of a lupus-susceptibility locus leading to impaired clearance of apoptotic debris on New Zealand Black chromosome 13 ...... 103

4.1 Abstract ...... 104

4.2 Introduction ...... 104

4.3 Materials and Methods ...... 107

vii

4.3.1 Mice ...... 107

4.3.2 Flow cytometry ...... 107

4.3.3 Measurement of Ab production ...... 108

4.3.4 Preparation of apoptotic cells ...... 108

4.3.5 Apoptotic cell uptake assays in vivo and in vitro ...... 109

4.3.6 Immunization ...... 109

4.3.7 Immunofluorescent staining & TUNEL analysis ...... 110

4.3.8 Statistics...... 110

4.4 Results ...... 111

4.4.1 Impaired clearance of apoptotic debris by c13 peritoneal macrophages ...... 111

4.4.2 Reduced clearance of apoptotic debris in the germinal centers of c13 mice ...... 113

4.4.3 Autoimmune phenotypes in c13 subcongenic mice require at least two distinct genetic loci ...... 119

4.5 Discussion ...... 123

Chapter 5 Discussion and future directions ...... 129

References ...... 139

viii

List of Figures and Tables

Table 1.1. Proposed mechanisms and candidate genes implicated to promote SLE...... 11

Figure 1.1. Current proposed model of lupus pathogenesis...... 12

Figure 2.1. IgG and IgA autoAb production is abrogated in NZB.CD40L-/- mice...... 44

Figure 2.2. Abrogated hemolytic anemia and attenuated kidney disease in NZB.CD40L-/- mice...... 45

Table 2.1. Splenic cell populations of B and T cells in B6 and NZB CD40L+/+, +/- and -/- mice at 4 months...... 47

Table 2.2. Splenic (Sp) and bone marrow (Bm) cell populations of macrophage and dendritic cell in B6 and NZB CD40L+/+, +/- and -/- mice at 4 months...... 50

Figure 2.3. CD40L affects MHC II expression on dendritic cell subsets...... 51

Figure 2.4. Elevated levels of baff in NZB mice are independent of CD40L...... 55

Figure 2.5. Reduced type I IFN gene expression in the bone marrow of 8 month old NZB.CD40L-/- mice...... 56

Figure 2.6. Similar gene expression in the kidneys and purified bone marrow plasmacytoid dendritic cells of B6 and NZB wildtype mice...... 57

Figure 2.7. CD40L does not play a role in proliferation and class-switching in response to TLR signals...... 58

Table 3.1. Comparison of the splenic phenotype in 8 month old B6.NZBc1c13 bicongenic mice with B6.NZBc1 and B6.NZBc13 congenic strains...... 74

Figure 3.1. Expansion of dendritic cell populations in the bicongenic mice...... 75

Table 3.2. Comparison of the B and T cell phenotypes in 8 month old B6.NZBc1c13 bicongenic mice with B6.NZBc1 and B6.NZBc13 congenic strains...... 77

Figure 3.2. AutoAb levels and renal involvement in various congenic mouse strains...... 81

Figure 3.3. Production of excess BAFF and TNF-α, but reduced levels of IFN-α in the spleens of B6.NZBc1c13 mice...... 83

Figure 3.4. Splenic BAFF expression in B6 and c1c13 bicongenic mice...... 84

Figure 3.5. IFN-α/β and IFN-α-induced gene expression in various organs of 2 and 9 month-old B6 and bicongenic mice...... 86 ix

Figure 3.6. Reduced IFN-α, but not TNF-α and IL-10 production following stimulation of splenocytes with TLR ligands in bicongenic mice...... 87

Figure 3.7. Similar levels of cytokine production, but reduced B7.2 expression in myeloid dendritic cells from bicongenic mice upon TLR stimulation...... 89

Figure 3.8. Cytokines or other cellular populations do not inhibit IFN-α production by CpG 2216 stimulated splenocytes from older c1c13 bicongenic mice...... 91

Figure 3.9. TLR tolerance impacts on IFN-α production, but not B7.2 upregulation, in BMDC from B6 and c1c13 bicongenic mice after repeated TLR9 stimulation...... 93

Figure 3.10. Examination of the splenic age-associated B cell population...... 95

Figure 3.11. Increased activation of cells in the immature and mature pDC subsets of older bicongenic mice...... 98

Figure 4.1. Impaired clearance of apoptotic debris by c13 peritoneal, but not in bone marrow- derived, macrophages in vitro...... 112

Figure 4.2. Genetic map of chromosome 13 subcongenic mouse strains used in the study...... 114

Figure 4.3. Increased numbers of large and more intact TUNEL+ apoptotic bodies associated with spontaneously arising TBM in the GC of c13 congenic and subcongenic mice...... 116

Figure 4.4. Impaired clearance of apoptotic debris in the germinal centers of NP-CGG immunized young c13 mice...... 118

Figure 4.5. Autoimmune phenotypes seen in original c13 congenic mice were maintained in c13 subcongenic mouse strains...... 122

Figure 5.1. Current proposed model of factors driving SLE autoimmunity ...... 130

Figure 5.2. Genetic map of chromosome 13 subcongenic mouse strains generated to date and candidate genes...... 131

List of Publications

1. Cheung, Y. H., C. Loh, E. Pau, J. Kim, and J. Wither. 2009. Insights into the genetic basis and immunopathogenesis of systemic lupus erythematosus from the study of mouse models. Semin.Immunol. 21:372-382. http://www.sciencedirect.com/science/article/pii/S1044532309000992

2. Pau, E., N. H. Chang, C. Loh, G. Lajoie, and J. E. Wither. 2011. Abrogation of pathogenic IgG autoantibody production in CD40L gene-deleted lupus-prone New Zealand Black mice. Clin Immunol 139:215-227. http://www.sciencedirect.com/science/article/pii/S1521661611000544

3. Pau, E., Y. H. Cheung, C. Loh, G. Lajoie, and J. E. Wither. 2012. TLR Tolerance Reduces IFN- Alpha Production Despite Plasmacytoid Dendritic Cell Expansion and Anti-Nuclear Antibodies in NZB Bicongenic Mice. PLoS One 7:e36761. http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0036761

4. Pau, E., C. Loh, G.E.S. Minty, N. H. Chang, and J. E. Wither. 2013. Identification of a lupus- susceptibility locus leading to impaired clearance of apoptotic debris on New Zealand Black chromosome 13. Genes and Immunity 14:154-161. http://www.nature.com/gene/journal/v14/n3/full/gene201264a.html

Additional publications not included in the thesis:

1. Chang, N. H., Y. H. Cheung, C. Loh, E. Pau, V. Roy, Y. C. Cai, and J. Wither. 2010. B cell activating factor (BAFF) and T cells cooperate to breach B cell tolerance in lupus-prone New Zealand Black (NZB) mice. PLoS One 5:e11691. http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0011691

2. Loh, C., E. Pau, N. H. Chang, and J. E. Wither. 2011. An intrinsic B-cell defect supports autoimmunity in New Zealand black chromosome 13 congenic mice. Eur J Immunol 41:527-536. http://onlinelibrary.wiley.com/doi/10.1002/eji.201040983/abstract;jsessionid=DC9E3E9C4D9B8 2C98E068448F7939683.d03t04

3. Loh, C., E. Pau, G. Lajoie, T. T. Li, Y. Baglaenko, Y. H. Cheung, N. H. Chang, and J. E. Wither. 2011. Epistatic suppression of fatal autoimmunity in New Zealand black bicongenic mice. J Immunol 186:5845-5853. http://www.jimmunol.org/content/186/10/5845.long

N.B. Underlined authors denote shared authorship.

List of Abbreviations

Ab Antibody

Ag Antigen

ANA Anti-nuclear antibodies

APRIL A proliferation-inducing ligand

AutoAb Autoantibodies

B6 C57BL/6

BAFF B cell activation factor of the TNF family

BCR B cell receptor

BM Bone marrow

BMM Bone marrow-derived macrophages

C Chromosome cM Centimorgan

DC Dendritic cell dsDNA Double stranded DNA

GC Germinal centers

GN Glomerulonephritis

IC Immune complexes

IFN Interferon

Ig Immunoglobulin

Mb Megabases

xii

mDC Myeloid dendritic cell

MHC II Major histocompatibility complex class II

MZ Marginal zone

NZB New Zealand Black

NZB/W (NZB x NZW)F1 hybrid

NZM New Zealand Mixed

NZW New Zealand White

ODN Oligodeoxynucleotide

PBS Phosphate buffered saline pDC Plasmacytoid dendritic cell

PM Peritoneal macrophages qRT-PCR Quantitative real-time polymerase chain reaction

RBC Red blood cell

RNP Ribonucleoprotein

SLE Systemic lupus erythematosus

Sm SMITH antigen ssDNA Single stranded DNA

TBM Tingible-body macrophages

TLR Toll-like receptor

TNF Tumour necrosis factor

xiii 1

Chapter 1

Introduction

Sections of Chapter 1.3 Mechanisms of lupus pathogenesis were adapted from a previously published review article from our laboratory.

Insights into the genetic basis and immunopathogenesis of systemic lupus erythematosus from the study of mouse models.

Published in Seminars in Immunology. December 2009, Volume 21, pp. 372-382

1.1 Systemic lupus erythematosus

Systemic lupus erthematosus (SLE) is a chronic, multi-organ autoimmune disease marked by the production of antibodies against nuclear antigens (1, 2). Autoantibody (autoAb) binding to nuclear antigens results in formation of immune complexes (IC) that deposit in various organs such as the skin, brain, heart, lungs, joints, and kidneys, leading to inflammation and end-organ damage. Patients usually develop the disease in their late teens to early 40s, with a strong 9:1 female sex bias (3). The worldwide prevalence of the disease ranges from 20 to 150 cases per 100,000 population, with a 2- to 4-fold higher incidence in non-Caucasians as compared to Caucasians (4, 5). Due to the clinical heterogeneity of SLE, the current American College of Rheumatology guideline requires that patients fulfill four of eleven clinical criteria to make a definite diagnosis (6).

1.1.1 Genetic factors in SLE

It has been well established that SLE has a strong genetic basis. Twin studies showed a concordance rate of 24% in monozygotic twins with only 2% in dizygotic twins for SLE (7). There is also strong familial aggregation in SLE. The prevalence rate in parents/offspring is 2.7% and in siblings is 2.9%, much higher than the general European population (0.010-0.081%) (8). Given the evidence for a strong genetic component in the development of lupus, many studies have sought to investigate candidate genes contributing to lupus. It is now generally acknowledged that multiple lupus susceptibility loci work in concert to produce the lupus phenotype. Consistent with this contention, genome-wide association studies (GWAS) and candidate gene studies have identified over 20 independent loci that confer an increased risk for development of SLE (9). However, it is still unclear how these genes and pathways interact with each other to contribute to the disease. As a result, we and others have turned to animal

3 models to gain insights into the mechanisms by which individual genetic loci interact with each other to produce the lupus phenotype.

1.1.2 Environmental factors in SLE

Evidence also suggests that various environmental factors act to promote SLE (reviewed in (10)). These include ultraviolet light (e.g. UVA2, UVB), viruses (e.g. Epstein-Barr virus), hormones (e.g. estrogen), drugs (e.g. hydralazine with 20% incidence and procainamide with 5-8% incidence), smoking, occupational exposure and diet (11-13). These factors can promote disease through the induction of apoptosis, DNA damage, molecular mimicry, DNA methylation, cellular activation, and cytokine secretion (reviewed in (14)). The combination of genetic and environmental factors give rise to the complexity and heterogeneity of human SLE.

1.2 Mouse models of lupus

Because SLE is a complex genetic disease where multiple susceptibility loci work together, study of mouse models has provided many of the insights into how these genes interact with each other to produce disease. These findings have come from both forward and reverse genetic approaches. Forward genetics have been used to map phenotypes from spontaneous lupus models to specific chromosomal regions and then to isolate these regions (usually on a non-autoimmune background through generation of congenic mice) to define the genes involved. In contrast, reverse genetics manipulate known genes, usually through knock-outs or transgenes, to understand their function in promoting lupus. These studies have identified genes that promote as well as protect mice from the development of lupus and in some cases, other autoimmune diseases. Our laboratory and others have extensively reviewed the advances in the understanding of genetics and immunopathology of SLE using mouse models, with the key points outlined below (3, 15-18).

1.2.1 Spontaneous lupus models

There are three main models of spontaneous lupus mouse strains that have been well characterized.

These are the New Zealand Black (NZB) mouse and its crosses, the MRL-lpr, and the BXSB mouse models. All these mice have abnormal cellular activation leading to a breach in B cell tolerance, resulting in production of autoAb, formation of IC, and deposition of Ig and complement in the kidneys, producing glomerulonephritis (GN)(19). However, each model varies with respect to other aspects of their autoimmune phenotypes and immune mechanisms by which they develop disease. These mouse models provide insights into various pathways that lead to the development of lupus that is likely to be reflected in human SLE.

1.2.1.1 NZB mice and their crosses

The NZB, (NZB x NZW)F1 hybrid (NZB/W), and their recombinant inbred derived lines NZM2410 and

NZM2328, are considered to most closely resemble human SLE (3). Similar to human lupus, the NZB and NZB/W models have a female sex bias in disease development. While the NZB mouse develops high titer antibodies (Ab) against ssDNA and lymphocytes, their GN is mild and of late onset (20). However, replacement of the NZB H-2d MHC haplotype with a H-2bm12 haplotype results in severe nephritis, suggesting that the NZB background bears a full complement of non-MHC lupus susceptibility genes

(21).

In contrast to the NZB/W, MRL-lpr, and BXSB mouse strains, NZB mice develop anti-RBC Abs, resulting in hemolytic anemia, another feature of human SLE (reviewed in (22)). The F1 cross between

NZB and NZW mice, results in more severe kidney disease. These mice develop proteinuria at around 6 months of age with ~50% mortality from kidney disease at 8.5 months of age, as compared to NZB mice, who typically die around 16 months of age (19). The NZM2410 and NZM2328 inbred mouse strains

5 were generated from crosses between NZB and NZW (23, 24). Study of the NZM2410 mice showed the existence of three major lupus susceptibility loci (Sle1, Sle2, and Sle3) contributing to anti-dsDNA autoAb production and development of severe GN (reviewed in (17)). Although NZM2328 mice also develop GN, the disease in these mice appears to occur independent of anti-dsDNA Ab production, with two susceptibility loci located on chromosomes 1 and 4 having been identified (24, 25).

1.2.1.2 MRL-lpr mice

The MRL-lpr strain carries the lpr mutation in the Fas gene, resulting in a lymphoproliferative disease, severe GN, and 50% mortality at 5 months of age (reviewed in (26)). Unlike the NZB mouse and its crosses, both male and female mice are affected with the disease. In addition, MRL-lpr mice have marked lymphadenopathy, form Abs against small nuclear ribonucleoprotein and IgG (rheumatoid factors), and demonstrate an expansion of CD4- CD8- B220+ T cells (19, 26). Introduction of the Fas-lpr mutation into other genetic backgrounds also produces to varying degrees lymphadenopathy and autoAb production, but only strains with a pre-disposition to lupus susceptibility can produce full-blown autoimmunity.

Despite the development of a strong autoimmune phenotype in MRL-lpr mice, mutations in the Fas and

FasL genes in human lupus are very uncommon, with only a few cases reported to date (27-30).

1.2.1.3 BXSB mice

BXSB is a recombinant inbred cross of C57BL/6 x SB/Le (19). In contrast to the NZB and MRL-lpr models, male mice are more severely affected in the BXSB mouse strains, with ~50% mortality at 5 months of age. This is mainly due to the Y-linked autoimmune acceleration (Yaa) genetic locus, which results from a translocation of the telomeric end of the X chromosome to the Y chromosome, leading to duplication of at least 16 genes including Toll-like receptor 7 (TLR7) (31). TLR7, which recognizes ssRNA, is expressed in the endosomal compartment of antigen-presenting cells, and has been

6 demonstrated to play a major role in promoting autoimmunity (32). The role of TLRs in autoimmunity is discussed further in Section 1.3.1.2.

1.2.2 Congenic mouse models of lupus

Identification of susceptibility alleles in spontaneously arising lupus-prone mouse strains has been facilitated by the generation of congenic mouse strains, in which homozygous chromosomal intervals containing a single or small cluster of susceptibility alleles from a lupus-prone strain have been backcrossed onto a non-autoimmune, usually C57BL/6 (B6), genetic background (33). The phenotypes in the congenic mice are then characterized and compared to B6 mice. Susceptibility loci have now been identified on all chromosomes. There is significant overlap of these loci between multiple lupus-prone strains, with the most densely mapped areas being in the MHC region and portions of chromosomes 1,

4, 7 and 13 (reviewed in (3, 15-17)). In NZB mice, studies from our laboratory and others have repeatedly mapped susceptibility loci to chromosomes 1, 4, 7 and 13. Although congenic mice with intervals from these chromosomes have been generated by our laboratory, only those with chromosome 1 or 13 intervals (denoted B6.NZBc1 and B6.NZBc13, respectively) have a strong autoimmune phenotype.

1.2.2.1 Chromosome 1 congenic strains

Several susceptibility loci from lupus-prone strains NZB, NZM2410, NZM2328, 129, MRL-lpr and BXSB have been mapped to chromosome 1, leading to production of high titer ANA and development of GN

(reviewed in (16, 17)).

Our laboratory has focused on dissecting the genes leading to development of autoimmunity on chromosome 1 of the NZB mouse strain, and has confirmed autoimmune phenotypes seen in Nba2 mice with a locus derived from the NZB 171-178Mb interval and mice with a NZM2410 (NZW-derived)

7 interval containing Sle1 (34-36). B6.NZBc1 mice, with an introgressed NZB chromosome 1 interval extending from 61.9 to 191.4 Mb, produce predominantly IgG anti-chromatin Abs and lack the polyclonal B cell activation phenotype of NZB mice (35, 37). One of the characteristic features of these mice is increased T cell activation with spontaneous activation of histone-reactive T cells, the T cell population that is proposed to provide support for anti-chromatin Ab production. Although these mice also have increased B cell activation, this is T cell dependent. The autoimmune disease and altered cellular activation profile in these mice can be fully recapitulated by the transfer of bone marrow (BM) cells. In mixed chimeric mice, with a mixture of B6 and B6.NZBc1 Bm cells, only B6.NZBc1 derived cells are activated, recruited into germinal centers (GC), or differentiate into autoAb-producing cells, indicating that intrinsic B and T cell functional defects are required for the generation of the autoimmune phenotype (37). Using subcongenic lines with truncated NZB chromosome 1 intervals, our laboratory has recently reported at least four lupus susceptibility loci and a suppressor locus in 61.9-191.4

Mb, revealing additional genetic complexity to the development of SLE in these mice (38).

Similarly, studies of subcongenic lines (Sle1a, Sle1b, Sle1c, and Sle1d) derived from the Sle1 locus found in the NZM2410 interval 154-197 Mb (derived from the NZW background) have revealed that the phenotypes associated with Sle1 including anti-chromatin autoAb, a defect in B cell tolerance, increased CD4+ T cell activation, abnormal GC formation, reduced number of regulatory T cells, and development of GN arise from interactions between multiple genes (39-46). Genetic analysis of the BXSB strain has also found multiple susceptibility loci (Bxs1-4) within the originally mapped regions on chromosome 1 that contribute to autoAb production and GN (47, 48).

At present, it is not known whether the same genetic polymorphisms contribute to development

8 of lupus in these three mouse strains, although it is likely that there will be some overlap based upon the limited number of primordial mouse strains that have given rise to current laboratory mouse strains.

Candidate genes found in chromosome 1 congenic mice include Slam/Cd2 gene cluster, Ly108, Ifi202,

Fcgr2b, Cr2 and Marco. Their roles in autoimmunity are discussed in Section 1.3.

1.2.2.2 Chromosome 13 congenic strains

Studies from our laboratory as well as others have repeatedly mapped susceptibility loci on chromosome

13 from NZB, NZW and BXSB mice, associated with production of autoAb, polyclonal B cell activation, the presence of endogenous retrovirus envelope protein gp70, which can act as an acute reactant, anti- gp70 Ab, and development GN (49-51). These loci include an unnamed region identified by our laboratory containing Nba, Sgp3, and Bxs6.

Our laboratory has focused on B6.NZBc13 mice, which have an introgressed NZB chromosome

13 interval extending from 47 to 120 Mb. These mice recapitulated most of the abnormal B cell phenotypes observed in NZB mice including: increased serum IgM levels, elevated levels of multiple IgM autoAbs, increased B cell activation, and expansion of marginal zone (MZ) and CD5+ B cell populations

(49). In addition, these mice also demonstrate increased T cell activation and expansion of CD11c+ dendritic cells (DC), but not plasmacytoid DC (pDC), populations. The presence of high-titer IgM and

IgG anti-chromatin Abs suggests that these mice are mounting a specific response to chromatin and apoptotic debris with little epitope spreading and, unlike the B6.NZBc1 mice, lack the spontaneous activation of histone-reactive T cells (49). By producing hematopoietic chimeric mice, we recently found that B6.NZBc13 mice have a BM derived cell intrinsic defect, leading to most of the original autoimmune phenotypes including B cell activation, DC expansion, and autoAb production (52). Using Ig transgenic mice, we have shown that a B6.NZBc13 autoimmune B cell repertoire is required for development of this

9 phenotype and that the B cells from this mouse strain are hyper-responsive to the TLR3 ligand, dsRNA analogue poly(I:C), resulting in increased survival and proliferation. However, in mixed BM chimeric mice reconstituted with both B6 and B6.NZBc13 cells, levels of B and T cell activation in both B6 and

B6.NZBc13 B and T cells were comparable. This suggests that there may also be external factors contributing to lupus in B6.NZBc13 mice.

Endogenous retroviruses have been suggested to play a role in the development of murine lupus

(reviewed in (53)). These viruses are RNA viruses that are reverse transcribed into DNA and integrated into the host genome. Retroviral envelope glycoprotein gp70, anti-gp70 Ab, and their IC have been found in the circulation and in glomeruli of NZB, NZB/W, MRL-lpr, and BXSB mice (19, 54). Furthermore, two loci on chromosome 13 have been mapped to gp70 production, Sgp3 derived from NZB or NZW, and

Bxs6 derived from BXSB (50, 51). It was thought that gp70, together with endogenous retroviral virions carrying ssRNA, can mediate disease through the activation of TLR7 with the help of the Sgp3 or Bxs6 locus. In the B6.NZBc13 mice, the enhanced B cell response to dsRNA is not likely due to the gp70 production, since gp70 is a modified polytropic provirus (ssRNA virus) shown to be dependent on TLR7 activation (51, 52, 55).

Currently, there are no candidate genes that have been clearly identified in chromosome 13 congenic mice. Studies related to narrowing down the regions containing lupus susceptibility loci on

NZB chromosome 13 are described in Chapter 4.

1.3 Mechanisms of lupus pathogenesis

Previous work from genetically manipulated mice, spontaneous lupus mouse models, and human GWAS have greatly aided in dissecting the immune mechanisms involved in lupus pathogenesis. As shown in

Table 1.1, genetic manipulations that promote the development of autoAbs in lupus can be classified into three major categories; 1) those that impair clearance of apoptotic debris and promote aberrant presentation of apoptotic debris to the immune system; 2) those that impact on aberrant lymphocyte signalling; or 3) those that promote survival of autoreactive lymphocytes (Table 1.1 modified from (3, 15,

16)). Once autoAbs are produced, additional genetic polymorphisms impact on the ability of the Abs to promote end organ damage. The current proposed model of lupus pathogenesis is illustrated in Fig. 1.1.

1.3.1 Impaired clearance and aberrant response to apoptotic debris

Normally, dying cells are rapidly taken up by macrophages, which secrete tolerogenic cytokines such as

TGF-β and IL-10, preventing immune activation to self antigens (56, 57). However, if this uptake pathway or immune suppression mechanism are impaired, an inflammatory immune response can result that can ultimately lead to autoimmunity. It has been proposed that the presence and accumulation of nuclear antigens from undigested apoptotic cells can lead to recognition by autoreactive B cells, resulting in the breach of self tolerance and autoAb production, as well as increased presentation to T cells following abnormal DC and macrophage activation and cytokine production (reviewed in (58)).

1.3.1.1 Clearance of apoptotic debris

Genetic manipulations affecting the clearance of apoptotic debris have been shown to promote the development of lupus (Table 1.1). These include the complement opsonin C1qa, and scavenger receptor

Mertk (mer receptor tyrosine kinase), which lead to defective clearance of apoptotic cells by macrophages

(59-61). Polymorphisms in C1q may also play a role in the NZB mouse strain and its crosses, since quantitative trait loci studies using NZB/W×NZW mice have mapped low serum C1q levels and development of nephritis to an overlapping region on NZB chromosome 4 (62). Delay in uptake of apoptotic cells can lead to the accumulation of nuclear debris that can later become immuno-stimulatory

Table 1.1. Proposed mechanisms and candidate genes implicated to promote SLE.

Mouse Human Knock-outs and Candidate genes from Genome-wide and candidate transgenics congenic studies gene studies Impaired clearance Complement & C1qa -/- C1q C1q and aberrant clearance Merkd Marco C2 response to DNaseI -/- C4A, C4B apoptotic debris SAP -/- CRP MFG-E8 -/- TREX1 LXR -/- ATG5 PPARδ -/- Ro -/- TLR & IFN TLR7 Tg TLR7 (Yaa) IRAK1 signalling Tir8 -/- IRAK1 MECP2 Ifi202 TNFAIP3 IRF5 SPP1 Antigen H-2 HLA presentation Aberrant lymphocyte B cell signalling CD22 -/- SHP-1 mev BLK signalling Lyn -/- Fcgr2b LYN FcγRIIb -/- CSK CD19 Tg FCGR2B MSH5 BANK1 PRDM1 ETS1 IKZF1 T cell signalling G2A -/- Ly108 (SLAM) LY9 (SLAM) Gadd45a -/- Coro1a PTPN22 p21 -/- STAT4 Roquin san/san TNFSF4 Ro52 -/- IL10 Other CD45 E613R PDCD1 Pdcd1 -/- UBE2L3 Rai -/- p66ShcA -/- Promote survival of Bim -/- Fas lpr/lpr FAS autoreactive Bcl-2 Tg FasL gld/gld FASL lymphocytes BAFF Tg PTEN +/- IL-2Rβ -/- CTLA-4 -/- Promote end organ Kallikreins KLK1, KLK3 damage ITGAM FCGR2A, FCGR3A, FCGR3B

Figure 1.1. Current proposed model of lupus pathogenesis. Accumulation of apoptotic and necrotic debris from dying cells is thought to be one of the initiating steps in the breach of tolerance to nuclear antigens in lupus. Macrophages, other phagocytes, or soluble factors with defects in the recognition and/or effective clearance of apoptotic cells allow the accumulation of apoptotic debris, exposing a large amount of endogenous nuclear antigen in the environment. Autoreactive B cells recognizing nuclear antigens can breach tolerance through the BCR and TLRs and become activated. Unengulfed apoptotic debris can also be presented by follicular DCs in the germinal center to B cells. With the help of autoreactive T cells, autoreactive B cells can differentiate into plasma cells, producing IgG anti-nuclear autoAb. Defects in B and T cell signalling and in apoptosis and survival can also exacerbate this autoimmune process. IgG autoAbs can form immune complexes to activate macrophages, monocytes and immature DCs, and plasmacytoid DCs through FcγR and TLR receptors, secreting inflammatory cytokines such as IFN-α and BAFF. The final outcome is end-organ damage mediated by IgG immune complexes, and cellular and cytokine responses, generating more cell death and sustaining the positive feedback loop in lupus autoimmunity.

(63, 64). To this end, gene deletions of DNaseI or SAP (serum amyloid P component) that normally play a role in the removal of DNA or solubilization of chromatin released by late apoptotic/necrotic cells, respectively, also promote lupus (65, 66). Milk fat globule epidermal growth factor 8 (Mfg-e8) is found to bind both phosphatidylserine on apoptotic bodies and integrins on macrophages and DCs and is produced mainly by follicular DCs in the GC (67, 68). Mfg-e8 knockout mice showed impaired clearance of apoptotic debris by tingible-body macrophages in the GC, and developed lupus-like phenotypes including splenomegaly, anti-dsDNA autoAbs, ANA, IgG deposition in kidneys, and proteinuria (69).

Liver X receptor (LXR; Nhr1h3/Nhr1h2) is a nuclear receptor that normally senses the cellular level of cholesterol; however, gene-deletion of this receptor also leads to defective phagocytosis of apoptotic cells by peritoneal and tingible-body macrophages, ultimately resulting in the development of lupus-like autoimmunity (70). PPARδ (Ppard), a nuclear sensor that recognizes native and oxidized fatty acids in macrophages, was found recently to act as a transcriptional sensor of apoptotic cells, controlling the uptake of apoptotic cells by macrophages (71). Mice deficient in PPARδ, specifically in macrophages on a

129/SvJ background, have impaired clearance of apoptotic cells, contributing to a lupus-like disease.

Finally, mice deficient in Ro, a well characterized auto-antigen in lupus, also develop lupus-like autoimmunity and demonstrate photosensitivity, a typical clinical characteristic of human SLE. This appears to result from impaired clearance of defective ribonucleoproteins, as Ro plays an important role in the binding and removal of misfolded ribosomal RNA (72).

In contrast to the abundant data demonstrating the role of impaired clearance in lupus pathogenesis from knockout mice, there is a paucity of data identifying genetic loci that lead to similar defects in lupus-prone mice and humans. Recently, B10.BXSB congenic mice carrying the Yaa and

Bxs1/2 or Bxs2/3 loci were found to have reduced expression of Marco (macrophage receptor with collagenous structure), leading to reduced uptake of apoptotic cells by BM-derived macrophages (73).

Data outlined in Chapter 4 demonstrate that impaired clearance of apoptotic debris is also seen in

B6.NZBc13 mice and provides insights into why genetic loci leading these defects may be difficult to find in lupus-prone mouse strains. Human lupus patients also demonstrate impaired clearance of apoptotic debris. As the novel genes identified in GWAS studies of human lupus are characterized, it is likely that a subset of these genes will impact on clearance of apoptoic debris.

1.3.1.2 TLR and IFN-α signalling

Over the past decade, the mechanisms leading to activation of the immune system by apoptotic debris have been clarified. In particular, both mouse and human studies have implicated a critical role of nucleic acid-sensing TLRs (TLR3, TLR7/8 and TLR9) in the response to apoptotic debris and development of lupus (reviewed in (32, 74-76)). TLR3, 7/8, and 9 are expressed intracellularly, where double stranded

RNA (recognized by TLR3), single stranded RNA (recognized by TLR7/8), and CpG DNA (recognized by

TLR9) are directed to the endolysosomal compartment for recognition and processing. TLR signalling in antigen presentating cells such as B cells, DCs and macrophages, can result in various events including

Ab production, cellular activation and differentiation, antigen presentation, cytokine secretion and IFN-

α production. TLR3 is expressed in myeloid DCs (mDC), macrophages, and specific B cell subsets (such as marginal zone cells), whereas TLR7 and TLR9 are mainly expressed in pDCs and B cells, as well as in mDCs (reviewed in (75)). The importance of these molecules in lupus pathogenesis has been demonstrated by examining knockout mice of intracellular TLRs or by pharmacologic blockade of TLR function. Treatment of NZB/W mice with an inhibitor of TLR7 and TLR9 resulted in disease suppression (77). Introduction of the chemical-induced point mutation 3d in the Unc93b1 gene, which

15 blocks cross-presentation to the Unc93b1 protein involved in trafficking of nuclear antigens to the endosome for TLR3, -7 and -9, onto the BXSB and B6.Fas-lpr genetic backgrounds lead to a reduction in autoAb production, development of GN, and mortality (78).

1.3.1.2.1 B cells and TLRs in SLE

BCR-mediated endocytosis of nuclear antigens and subsequent intracellular TLR engagement in autoreactive B cells is thought to initiate the cellular activation and autoAb production against self antigens seen in lupus (reviewed in (76, 79). One of the first reports eludicating the role of TLRs in B cell autoimmunity came from examining B cells from transgenic mice expressing the AM14 BCR, a receptor with low affinity for autologous IgG2a (rheumatoid factor; RF) derived from the MRL-lpr mouse (80, 81).

It was found that AM14 RF+ B cells proliferated to IgG2a IC containing DNA, chromatin, and nucleosomes, but not to IgG2a IC containing trinitrophenyl (TNP). Furthermore, MyD88 (required for

TLR7 and TLR9 signalling) deficient AM14 RF+ mice exhibited no mitogenic response to chromatin IC in B cells, suggesting a critical role for TLR signalling in the breach in tolerance for these autoreactive B cells (81).

The role of nuclear-sensing TLRs in the production of anti-nuclear autoAbs has been investigated in a number of lupus mouse models. Introduction of a TLR7 knockout onto the MRL-lpr background resulted in a dramatic reduction of autoAbs against the RNA-associated antigens, Sm and

RNP, while autoAb levels against dsDNA and nucleosomes were unaffected (82). These mice also demonstrated reduced kidney disease, decreased lymphocyte activation, and decreased serum IgG2a and

IgG3. Similar findings were obtained in the pristane-induced lupus model. In this model, injection of the hydrocarbon oil 2,6,10,14-tetramethylpentadecane (TMPD) results in development of lupus-like

16 autoimmunity with production of autoAbs against a variety of DNA, RNA and RNP associated nuclear antigens (reviewed in (83)). TLR7-deficient TMPD-treated mice showed no production of RNA-specific autoAbs, while DNA specific autoAb levels were unaltered (84). These mice also showed less IgG and C3 deposition in the kidneys and reduced development of GN. A critical insight into the role of TLR7 in SLE came from the discovery of the Yaa genetic element from BXSB mice, where an increased TLR7 gene dosage was shown to be required for the accelerated autoimmune phenotype (31, 85, 86). When the Yaa genetic locus was introduced onto the autoimmune B6.FcγRIIB-/- mouse background, accelerated autoimmunity developed, together with a shift in the specificity of autoreactive B cells towards those producing anti-nucleolar Abs (87). Transgenic mice expressing multiple copies of TLR7 showed increased RNA-specific autoAbs, ANAs, activation of B cells, T cells and DCs, hyper-responsiveness to the TLR7 ligand imiquimod in splenocytes, expansion of plasma cells, DCs and myeloid DCs, severe splenomegaly, GN, and increased mortality (86). Although TLR8 also recognizes ssRNA, its role in animal models of SLE is still undefined. One report has shown that B6 mice that are TLR8-deficient develop lupus-like autoimmunity with elevated levels of autoAbs against SmRNP, RNP and DNA, splenomegaly, and development of GN (88). Interestingly, TLR8-deficient mice showed a four-fold increase in TLR7 expression in BM-derived DCs, suggesting that TLR7 may play a role in these autoimmune phenotypes.

The production of anti-dsDNA autoAbs is one of the diagnostic criteria for SLE in lupus patients; however, the role of TLR9 in autoAb production has been controversial in various lupus-prone mouse models. Interestingly, TLR9 appeared to have a protective role in the development of autoimmunity, since mice with a TLR9 deficiency showed exacerbation of disease. TLR9-/- MRL-lpr mice

17 showed reduced levels of anti-nucleosome autoAbs, splenomegaly, and accelerated renal disease and mortality (82), and similar findings were observed in TLR9-deficient B6-lpr, B6.Nba2 (carrying NZB lupus-susceptibility locus), and B6.Nba2.Yaa mice (89, 90). However, inconsistent observations were seen in anti-dsDNA autoAb levels as different assays were used. TLR9-deficient MRL-lpr and B6-lpr mice showed no changes in the production anti-dsDNA autoAbs, while B6.Nba2 and B6.Nba2.Yaa mice showed significantly elevated levels of anti-dsDNA autoAbs. Previously, it was suggested that rather than dsDNA, nucleosome or chromatin is the physiologic autoAg in the development of lupus and these autoAbs preferentially bind to continuous DNA-histone epitopes instead of isolated dsDNA segments

(32, 91). One potential explanation for the exacerbation of disease in these mice is that TLR7 is upregulated in TLR9-deficient mice.

TLR3, recognizing dsRNA and the secondary structure of endogenous RNAs, is normally expressed at low levels in murine B cells (92). NZB/W mice showed polyclonal B cell activation and autoAb production after stimulation with the TLR3 ligand, polyinosinic-polycytidylic acid

(poly(I:C))(93). Interestingly, introduction of a TLR3-deletion onto the MRL-lpr background led to no change in the autoAb levels against DNA or RNA and no development of renal disease (94). In humans,

CD138+ plasmablasts or plasma cells express TLR3 and secrete Ab in response to poly(I:C), raising the possibility that genetic variations affecting the signalling through this molecule could also affect autoAb production in lupus (95).

In further support of the role of TLR signalling in lupus, gene deletion of Tir8 (Toll-IL-1 receptor

8; Sigirr), a suppressor of TLR-mediated signalling, on the B6-lpr genetic background resulted in augmented development of lupus nephritis, with enhanced B cell activation, autoAb production and DC

18 activation (96). Similarly, gene deletion of IRAK1 (IL-1 receptor-associated kinase 1), which is part of the

TLR and IL-1 receptor signalling pathways, on the B6.Sle1 and B6.Sle3 congenic background resulted in reduction of IgM and IgG autoAbs and GN (97). Interestingly, on the B6.Sle3 background, this normalized the increased DC activation and cytokine production phenotypes seen in the original congenic strain.

1.3.1.2.2 Plasmacytoid dendritic cells and TLRs in SLE

Plasmacytoid dendritic cells (pDC) are potent producers of type I interferon (IFN-α/β) and express TLR7 and TLR9 (reviewed in (98)). Normally, pDCs produce IFN-α in response to viral infection and activate the innate immune system. In the past decade, numerous human and mouse studies have reported that

IgG ICs are important IFN-α inducing mediators in SLE through the activation of pDCs (reviewed in (32,

74)). Previous work from Ronnblom’s group found that pDCs produce IFN-α upon stimulation with IgG

ICs derived from lupus patients mixed with apoptotic or necrotic debris and confirmed the critical role of

IgG ICs and pDCs in lupus pathogenesis (99-102). pDC activation by IgG IC requires the presence of endogenous DNA and RNA in the apoptotic debris (103). Uptake of nuclear Ag in IgG ICs is mediated by receptors for the Fc region of IgG (FcγR), in particular, FcγRIIa (104). Studies in both humans and mice have determined that FcγRs on the surface of pDCs bind to and internalize IgG ICs containing nuclear Ag, transporting them to the endosomal compartment that contains TLR7 and TLR9, and activate pDCs (reviewed in (74, 75, 105).

pDCs normally circulate in low numbers. While in lupus patients, there is no consistent trend in pDC frequency in various studies (reviewed in (106)), one report showed that the pDC population is diminished in the blood, but expanded in the inflamed skin lesions of lupus patients and produced the

IFN-α/β inducible protein MxA (107). Similar to lupus patients, NZB mice also have an expansion of pDCs, which is seen in the BM and which is accompanied by high expression of TLR9, resulting in enhanced secretion of IFN-α upon stimulation (108).

1.3.1.2.3 IFN-α in SLE

Type I IFNs, consisting of multiple IFN-α subtypes and a single IFN-β, are pleiotropic cytokines that act on various cell types to elicit a wide range of responses in both innate and adaptive immunity, many of which have been demonstrated to exacerbate autoimmunity in lupus (reviewed in (75, 98)). An early study by Hooks et al. showed that elevated serum levels of IFN-α correlated with disease activity in SLE patients (109). This study was confirmed by Kirou and colleagues, who reported overexpression of IFN-α inducible genes in the peripheral blood mononuclear cells of lupus patients known as the “IFN signature”

(110).

Studies in lupus-prone mice support a role for IFN-α in lupus. Santiago-Raber et al. generated an

IFNAR-1 gene-deleted NZB mouse and found significant reduction of disease phenotypes such as anti- nuclear and anti-erythrocyte autoAb production, hemolytic anemia, kidney disease and mortality (111).

NZB mice also showed elevated serum levels of IFN-α compared to controls upon CpG oligodeoxynucleotide (ODN) injection, which is thought to mimic endogenous DNA autoAg through the activation of TLR 9 in pDC (108). In NZB/W mice, introduction of exogenous IFN-α showed acceleration of disease with increased ANA and ds-DNA autoAb production, and GN at an earlier age

(112). The pristane-induced lupus model displayed an IFN signature similarly seen in human lupus, and showed disease attenuation in IFNAR-1-/- mice (113, 114). IFNAR-1 knockout B6-lpr mice also showed disease reduction; however, surprisingly, MRL-lpr IFNAR-1-/- mice had accelerated disease (115, 116).

This latter finding suggests that type I IFN may not play an important exacerbating role in all lupus- prone mouse models. In support of this, the IFNAR1 gene-deletion had a minimal impact on B6.Nba2 mice (117). This is despite the observations that increased expression of Ifi202, an IFN-inducible transcriptional regulator, is seen in B6.Nba2 congenic mice and that a promoter polymorphism in this gene is associated with reduced B cell apoptosis in mice, and enhanced NF-κB activation and cytokine production in the RAW 264.7 monocytic cell line (118-120).

IFN-α has been demonstrated to have an impact on many factors, ultimately contributing to lupus autoimmunity. In B cells, IFN-α promotes the upregulation of TLR7, antibody secretion especially of the complement-fixing Ig isotypes IgG2a and IgG3, and differentiation of B cells into antibody- producing plasma cells without T cell help (121-124). In DCs, IFN-α can induce DC maturation and pDC activation, and promote production of B cell survival factors BAFF and APRIL by DCs, where BAFF and

APRIL can further promote the survival of autoreactive B cells (98, 125). The role of BAFF in autoimmunity will be further explained in Section 1.3.3.1. In T cells, IFN-α/β has been shown to augment

T cell polarization into pro-inflammatory Th1 effectors, promote IFN-γ production by T cells and DCs, and maintain survival of CD4+ and CD8+ T cells (126, 127). Thus, IFN- α/β appear to be critical mediators of lupus autoimmunity.

1.3.1.2.4 TLR tolerance

There have been several reports on TLR tolerance where cells, such as macrophages, DCs, neutrophils, and epithelial cells, that are stimulated with TLR ligands, become refractory to subsequent activation with the same TLR stimulus (128-131). In pDCs, two reports have shown that in humans, production of

IFN-α by pDCs is suppressed by repeated stimulation with TLR ligands or Ig IC-containing nuclear

21 antigens, where pDCs from SLE patients showed significantly more inhibition of IFN- α production compared to healthy controls (132, 133). It was suggested that this phenotype is representative of chronic

SLE; however, the underlying mechanism leading to this impairment is currently unclear.

1.3.1.3 Antigen presentation in SLE

Early reports indicated that the MHC complex (H-2) on chromosome 17 is linked to the development of

SLE in a mouse-strain dependent fashion (16, 21, 134). H-2d/z (on BWF1), H-2b (on BXSB), and H-2bm12

(on NZB) alleles have been shown to modify the severity of disease through effects on autoAb production, lymphoproliferation, and GN development. NZB mice which normally express the H-2d

MHC haplotype develop mild kidney disease, however replacement of this MHC with the H-2bm12 haplotype leads to severe nephritis (21). Notably, in human lupus, the strongest lupus susceptibility locus is mapped to the MHC region. Fine mapping of this locus suggests the presence of both HLA and non-

HLA components to this susceptibility.

1.3.2 Aberrant lymphocyte signalling

1.3.2.1 B cell defects Modification of the strength or nature of B cell signalling has been shown to have an impact on lupus pathogenesis. In general, changes in the expression of CD22, SHP-1, Lyn, and CD19 that lead to a decreased threshold for B cell activation, promote lupus. Deficiency of CD22, a B cell specific inhibitory receptor, results in a breach of B cell tolerance to dsDNA, but is insufficient by itself to cause renal damage (135). On the other hand, the SHP-1 mev mutation and targeted deletion of the SHP-1 inhibitory receptor resulted in a more severe lupus-like autoimmune disease. These mice also had altered B cell development and disturbed B cell tolerance mechanisms (136, 137). Gene deletion of Lyn produced a

22 similar autoimmune phenotype. Notably, this phenotype was MyD88-dependent, implicating a role for

TLR signalling in the breach of B cell tolerance in these mice (138-140). Finally, transgenic mice overexpressing CD19 demonstrate a breach of B cell anergy and develop a lupus-like phenotype (141,

142).

B6 mouse with a gene-deletion of FcγRIIb, a low affinity inhibitory Fc receptor in B cell signalling, is a well-studied model of lupus autoimmunity. These mice develop fatal GN, splenomegaly, and expansion of plasma cells and activated T cells (143). Furthermore, these mice produce high-titer class-switched IgG2a and IgG2b autoAb in a TLR9- and MyD88-dependent, but T cell-independent manner (144). Notably, various genetic polymorphisms of FcγRIIB, which is located on chromosome 1, resulting in decreased expression and/or impaired upregulation in GC, are found in lupus-prone NZB,

NZW, BXSB and MRL-lpr mice and are thought to contribute to disease development (45, 145-148).

1.3.2.2 T cell defects

A decreased threshold for T cell activation has also been demonstrated to promote lupus autoimmunity.

T cells from mice lacking G2a, a lymphoid-expressed orphan G protein-coupled receptor, show hyperresponsiveness to TCR stimulation, resulting in a lupus-like autoimmune disease (149). Similarly,

Gadd45a and p21 knockout mice, both p53-effector genes, have a reduced threshold for T cell activation and proliferation, and accelerate autoimmunity (150). One of the mechanisms by which these defects may act to promote disease is through enhanced differentiation of pro-inflammatory T cells subsets, such as Th1, Th17, and T follicular helper cells. Expansions of T follicular helper cells and Th17 cells have been shown to induce autoimmunity in the Roquinsan/san and Ro52-/- mice, respectively (151, 152). Studies in our laboratory have demonstrated that NZB genetic loci leading to a decreased activation threshold

23 and T cell functional defects that promote expansion of Th1 and Th17 cells are associated with increased autoAb production and renal disease in B6.NZBc1 mice (Talaei et al., submitted).

One of the genetic loci that is associated with a decreased T cell activation threshold and enhanced differentiation of Th1 cells is Ly108, part of the SLAM/CD2 gene cluster on chromosome 1.

NZB, NZM2410, and a variety of other lupus-prone backgrounds share the same susceptibility allele which has been shown to be associated with enhanced TCR-mediated responses (148, 153-156). Coronin-

1A (Coro1a), a candidate gene for the Lmb3 lupus susceptibility locus mapped on chromosome 7 from

MRL.B6-Lmb3-Faslpr mice, also modulates disease by affecting the T cell activation threshold (157).

Coronin-1A encodes for a filamentous actin regulator protein, and a disease-suppressing mutation of

Coro1a in B6-lpr mice results in reduced T cell migration, activation and survival, protecting these mice from disease (158, 159).

1.3.2.3 Role of CD40-CD40L interactions in SLE

CD40 and CD40L (CD154) are members of the TNF receptor superfamily, where CD40 is expressed on B cells, macrophages, and DCs, and CD40L is expressed on activated CD4+ T cells and platelets (reviewed in (160, 161)). Interaction between CD40 and CD40L mediates various critical responses such as: 1) T cell-dependent B cell responses, including B cell costimulation, proliferation, Ig class-switching, maturation to Ab-producing plasma cells, and GC formation; 2) T cell priming, activation and differentiation; and 3) DC maturation and activation by T cells.

Defects in CD40-CD40L interactions can contribute to the pathogenesis of lupus. Increased expression of CD40L is found on T cells and platelets in patients with active SLE (162, 163) and soluble

CD40L is increased in sera from SLE patients, which correlates with disease activity (164). Active SLE

24 patients also showed ectopic and functional expression of CD40L on B cells that can contribute to autoAb production in vitro (165, 166). Consistent with a potential role for this aberrant expression in lupus pathogenesis, B6 transgenic mice expressing CD40L on their B cells developed lupus-like autoimmunity (167). Ectopic expression of CD40L has been identified in DBA/2 mice and lupus-prone

BXSB mice, suggesting that altered CD40L expression may contribute to the pathogenesis of autoimmunity in these mice (168, 169). Increased expression of CD40L on platelets may also promote disease, since depletion of activated platelets showed disease attenuation in NZB/W mice (163).

Supporting the role of CD40-CD40L interactions in SLE, administration of anti-CD40L delayed disease onset and significantly reduced autoAb production and GN mediated by IC, resulting in increased survival in NZB/W mice (170). Similarly, human lupus patients treated with an anti-CD40L humanized mAb showed reduction in autoAb levels and severity of renal disease (171, 172). But, thromboembolic complications in lupus patients treated with anti-CD40L mAb halted clinical trials, where these side effects are likely due to the activation of platelets (reviewed in (173)).

However, there is some variation in the role of CD40-CD40L interactions among mouse models and different human populations with SLE. MRL-lpr mice deficient in CD40L produced more class- switched IgG autoAb, and anti-CD40L treatment accelerated renal disease (174, 175). Furthermore, a

SNP in the CD40 gene was recently identified in Greek and Turkish patients with SLE, which is associated with reduced CD40 expression in monocytes and B cells (176). Thus, it remains unclear whether there is an absolute requirement for CD40-CD40L in lupus pathogenesis, especially in the production of pathogenic IgG autoAb.

1.3.2.4 Other defects in lymphocyte signalling

Some mutations or deletions in the signalling molecules that promote lupus, including CD45 (E613R),

Pdcd1, Rai, and P66shcA, affect both T and B cell function. In general, these defects are associated with aberrant activation of B and T cells (177-180).

1.3.3 Defects that promote survival of autoreactive lymphocytes

There are a number of genetic manipulations that lead to impaired apoptosis that are associated with the development of lupus-like disease. Mutations of the pro-apoptotic death receptor Fas (lpr mutation), as seen in MRL-lpr mice, and its ligand FasL (gld mutation) result in development of lupus as well as lymphoproliferative disease (181). The extent to which these mutations produce lupus is somewhat variable depending upon the mouse background onto which the mutation has been crossed. Knockout mice lacking Bim, a gene involved in the intiation of apoptosis in the Bcl-2 regulated pathway, demonstrate an accumulation of lymphoid and myeloid cells and developed lupus-like kidney disease.

Both Fas and Bim have been found to be critical in controlling the selection of low affinity B cells in the

GC, which could allow tolerance to be breached (182-184). Overexpression of the anti-apoptotic protein

Bcl-2 or BAFF in transgenic mice have both been shown to result in enhanced survival of autoreactive cells, leading to autoimmunity (185, 186). The role of BAFF in lupus is further explained in the next

Section 1.3.3.1.

Similar defects have been observed in spontaneously arising lupus-prone mouse strains. Resting

B cells from NZB mice showed reduced apoptosis after IgM cross-linking (187). Our laboratory has also previously confirmed this finding and shown that this B cell apoptosis defect promotes the survival of transitional T1 B cells, but not mature B cells (188). Using the hen egg lysozyme (HEL) anergy model, we

26 have further found that anergic self-reactive B cells from NZB mice have enhanced survival that is associated with increased expression of Bcl-2 and altered response to BAFF (189). Finally, B6 mice carrying the Sle1b locus on chromosome 1 have increased levels of the SLAM molecule Ly108.1, which is associated with enhanced survival of autoreactive B cells and reduced apoptosis after BCR crosslinking

(154).

PTEN (phosphatase and tensin homolog) is known as a tumour suppressor gene, and interestingly, PTEN heterozygous mice showed impaired Fas-mediated apoptosis and reduced T cell activation threshold, promoting autoimmunity (190). Finally, deletion of IL-2Rβ and CTLA-4 both mediate lupus-like phenotypes through the dysregulation of T cell activation and apoptosis (191, 192).

1.3.3.1 BAFF in SLE

BAFF (B cell-activating factor of the tumor necrosis factor family; BLyS; TNFSF13b), and APRIL (a proliferation-inducing ligand) are cytokines that promote the maturation and survival of peripheral B cells (reviewed in (193, 194)). BAFF is mainly produced by monocytes, macrophages, DCs, follicular

DCs, neutrophils and T cells. BAFF-R, TACI, and BCMA are receptors for BAFF and APRIL and are expressed in various B cell subsets. Previous studies by Litinskiy et al. have demonstrated that IFN-α,

IFN-γ, CD40L and bacterial LPS stimulation can activate monocytes and DC to produce BAFF (195).

BAFF levels appear to be critical for the maintenance of B cell tolerance as an excess survival signal from BAFF allows autoreactive B cells to mature, overcoming the death signal triggered by autoAg at the T1-T2 transition (reviewed in (196)). Indeed, elevated serum levels of BAFF have been observed in many human autoimmune diseases, including SLE (193). In SLE, increased serum BAFF levels correlate with the production of anti-dsDNA autoAb and disease activity (197). Similarly, mice that overexpress

BAFF (BAFF-Tg) develop a lupus-like disease (186). Thien and colleagues used the HEL anergy model in

BAFF-Tg mice to demonstrate that autoreactive B cells are rescued from peripheral deletion by excess

BAFF (198). Studies from our laboratory have used the HEL model to examine B cell anergy in young

NZB mice. Although the B cells in these mice appeared functionally anergic, elevated levels of anti-HEL autoAb were produced (189). This breach of tolerance appeared to be partially related to BAFF. Serum

BAFF and splenic baff mRNA expression were elevated in NZB transgenic mice and NZB anti-HEL B cells demonstrated a BAFF-dependent increased survival following transfer into soluble HEL recipient mice. It is currently unclear which cell population(s) produce the elevated levels of BAFF in NZB mice.

Elevated BAFF levels have also been observed in other lupus-prone models such as NZB/W and MRL-lpr

(199).

BAFF has been found to enhance TLR7 and TLR9 expression on B cells and promote the production of pathogenic anti-nuclear autoAb even in the absence of T cells in BAFF-Tg mice (200). It is possible that this leads to the generation of a positive feedback loop that further amplifies the autoimmunie process. IgG IC have been shown to induce monocytes or immature DC to differentiate into conventional DC and promote production of BAFF by myeloid DC in a TLR9 independent fashion, maintaining the survival of autoreactive B cells and plasma cells (201). Thus, excess BAFF can promote the breach in B cell tolerance and drive autoimmunity.

1.3.4 Defects that promote end organ damage

Candidate gene studies have identified polymorphisms in the kallikreins, serine esterases encoded by genes located in the lupus susceptibility locus Sle3 on chromosome 7 (202, 203). These polymorphisms result in reduced expression of a series of kallikrein genes in NZM2410 and NZW mouse strains, which

28 promote increased susceptibility to glomerular basement-specific Ab-induced nephritis, suggesting a protective role of kallikrein in lupus autoimmunity.

1.4 Bridging mouse studies to human SLE

Studies from mouse models and genetically manipulated mice have provided many insights into understanding the pathogenesis of lupus in human patients. Genome wide association studies (GWAS) and candidate gene analysis in SLE patients have validated many of the genes identified in mouse studies by identifying single nucleotide polymorphisms (SNPs) and copy number variants. Many groups have recently summarized the GWAS and candidate gene studies in SLE (9, 204, 205). Relevant findings from these studies and their potential roles in SLE are summarized in Table 1.1.

Many genetic risk variants have been identified that affect genes in the complement pathway and/or are predicted to impact on clearance of apoptotic cells. Complete deficiency of genes in the complement pathway is rare, but individuals with such deficiencies or SNPs resulting in reduced expression of C1q, C2, C4A or C4B are associated with increased risk for lupus (206-210).

Polymorphisms in the promoter region of the C-reactive protein (CRP), involved in uptake of apoptotic debris, are associated with SLE (211). TREX1 encodes for 3’ repair exonuclease 1 which proofreads DNA polymerase and functions as a cytosolic DNA sensor (212). Absence of TREX1 results in accumulation of endogenous retro-element DNA and frameshift or missense mutations of TREX1 are found in lupus patients, promoting impaired clearance and induction of IFN-α production (213). Finally, genetic variants in ATG5 (autophagy-related gene 5), a gene required for the formation of autophagosomes, have recently been identified as risk alleles in SLE (214, 215).

Various genetic variants that are predicted to lead to altered TLR and IFN signalling are associated with an increased risk for lupus. IRAK1 (IL-1 receptor-associated kinase 1) has been shown to regulate activation of NF-κB in TCR and TLR signalling and numerous SNPs in this gene are associated with adult- and childhood-onset SLE (97). Polymorphisms in MECP2, located in the same Xq28 region as

IRAK1, are also associated with lupus and patients with the disease-associated MECP2 haplotype showed upregulation of genes regulated by IFN (216, 217). TNFAIP3 (TNF-α-induced protein 3; A20) is a ubiquitin-modifying enzyme that can restrict NF-κB downstream signalling of TNFR1, CD40, TLR, Nod- like receptors, and IL-1R, and control cell activation, cytokine production, and apoptosis (reviewed in

(218)). Mutations and polymorphisms of TNFAIP3 have been identified in autoimmune, inflammatory, and malignant diseases, including SLE (219). IRF5 (IFN regulatory factor 5) controls expression of IFN- dependent genes and is a non-MHC region that is strongly and consistently associated with SLE (214,

220, 221). Osteopontin (SPP1) is overexpressed in SLE patients and is shown to be critical in IFN-α production by pDC in mice (222, 223). The HLA region at chromosome 6p21.3 was the first genetic association found in SLE. This region encodes over 120 genes, many of which are linked to SLE (220,

224-227).

There are numerous lupus-susceptibility genes that have an impact on B cell signalling.

Polymorphisms of genes in the B cell signalling pathway including BLK, LYN, and BANK1, are associated with human lupus, where they are postulated to play a role in B cell activation and tolerance (219, 220,

226). Recently, a risk allele was identified in CSK, a c-Src tyrosine kinase associated with Lyp (PTPN22 gene product), which conferred to increase CSK expression, enhanced phosphorylation of Lyn, and activation of mature B cells (228). Similar to the phenotype seen in FcγRIIb-/- mice, a nonsynonymous

SNP has been identified in FCGR2B affecting B cell inhibitory function that is associated with SLE mainly in Asian populations (229-233). MSH5, mutS homologue 5 encoded in the MHC class III region, showed the highest SLE-associated signal in the 2008 GWAS and is important in Ig class switch recombination

(220, 234). PRDM1, a transcriptional repressor identified in the same region as ATG5, is known to play a role in B cell differentiation into plasma cells and type I IFN signalling (214, 215, 235, 236). ETS1 has been shown to negatively regulate B cell and Th17 cell differentiation and IFN-I-induced transcription

(221, 237-239). Finally, IKZF1, Ikaros family zinc finger 1, a transcription factor essential to B cell development and tolerance, was identified as a strong candidate from European and Chinese GWAS studies (214, 221, 240).

Interactions between T and B cells play a critical role in the pathogenesis of lupus. LY9 (SLAM) regulates T cell signalling and the SLE risk allele may be involved in skewing the T cell populations with increased proportion of CD8+ memory T cell and reduced proportion of CD4+ naïve T cells and activated

T cells (241). Polymorphisms in PTPN22 have been found to be associated with a number of autoimmune disorders such as SLE, type 1 diabetes, rheumatoid arthritis, and Hashimoto’s thyroiditis

(242). PTPN22 is a selective phosphatase that controls T cell signalling, and a nonsynonymous SNP had been identified in the European SLE population, but not in the Asian populations (214, 220, 221, 243).

STAT4 (signal transducer and activator of transcription 4) is required in IL-12-mediated responses and

Th1 differentiation and proliferation, and has been found in multiple GWAS studies to be associated with SLE (220, 244-246). In addition, STAT4 also carries a risk variant that is associated with increased expression of type I IFN regulated genes in SLE patients (247). TNF ligand superfamily 4 (TNFSF4), also known as OX40L, is a costimulatory molecule expressed on APCs that can activate T cells and suppress

IL-10 producing regulatory T cells (248). Several GWAS studies in different populations have found

SNPs in this gene are associated with an increased risk for SLE (214, 221, 249). IL-10 has both activating and inhibitory roles in the pathogenenesis of SLE and IL10 has been identified as a lupus susceptibility locus (214).

Programmed cell death 1 gene (PDCD1 or PD-1) is a member of the B7-CD28 family that provides inhibitory signals to T and B cells that regulate central and peripheral tolerance (250). It was found that a SLE-associated intronic SNP (PD1.3A) in this gene alters the binding site for RUNX1, leading to autoimmunity similar to PD-1 deficient mice (251, 252). UBE2L3, ubiquitin-conjugating enzyme E2L 3 isoform 1, is one of the newly identified lupus-susceptibility loci, however its role in SLE is not well characterized yet (220). Although MRL-lpr mouse model is a classic lymphoproliferative model to study SLE, mutations of FAS or its ligand FASL in human are rare and had only been identified in a few cases (27-30).

Immune complexes are key mediators that can promote and exacerbate end organ damage. As seen in congenic mice with the Sle3 locus and anti-glomerular basement membrane antibody-induced nephritis, SNPs located in the regulatory region between kallikrein genes KLK1 and KLK3 showed significant association to lupus nephritis (202, 203). ITGAM, also known as CD11b or complement

component 3 receptor 3 subunit, encodes the alpha M chain of αMβ2 integrin expressed on monocytes and neutrophils (253). This molecule functions in leukocyte activation, adherence, and migration, and immune complex clearance by binding to C3b-opsonzied particles and complexes. Genetic variations in

ITGAM, leading to reduced complement receptor 3-mediated binding (254), are associated with an increased risk for SLE in many patient populations with most robust association in European-Americans

32 and African-Americans (226, 255). Lastly, FCGR2A, FCGR3A and FCGR3B are activating members of the

Fcγ receptor family involved in IC clearance and processing. There are numerous reports identifying copy number variants, allotypic variants and SNPs in the FCGR locus that are associated with SLE, but these findings have been inconsistent possibly due to ethnic differences and disease heterogeneity (229,

256-262).

1.5 Thesis objectives

SLE is a complex disorder that results from a combination of genetic and environmental factors affecting multiple cell populations within the immune system. Abnormalities in both the innate and adaptive immune response appear to contribute to the breach of tolerance to self antigens in this condition; however, the precise mechanisms by which these two arms of the immune system interact to produce disease and genetic underpinning for these abnormalities have not been fully elucidated.

The aim of this thesis is to investigate the underlying immunologic processes together with the novel lupus susceptibility loci that produce them in the lupus-prone NZB mouse strain, using transgenic and congenic mice. Given that CD40-CD40L interaction is important in B cell class-switch recombination and GC formation, my first hypothesis is to show that CD40 and CD40L is critical in the production of autoAb and development of kidney disease in the NZB mouse strain, where this is tested using the CD40L gene-deleted mice. Because these mice lack IgG autoAb, my objectives are to investigate the requirement CD40-CD40L interactions and/or IgG autoAbs for B and T cell polyclonal activation,

TLR-mediated B cell activation/differentiation, and BAFF and IFN-α production that is observed in NZB mice. My next aim relates to the complexity of the genetic interactions that lead to the development of lupus by studying congenic mice carrying two NZB chromosomes known to carry lupus susceptibility

33 loci. Bicongenic mice were generated carrying both NZB chromosome 1 and 13 intervals, where both

NZB chromosomes have been shown in isolation to produce anti-nuclear Ab. Based upon the nature of the immune abnormalities in the monocongenic mice, and their major role in the production of abnormal B cell phenotypes in NZB mice, I hypothesize that the interactions between these two regions would be sufficient to fully recapitulate the NZB B cell phenotype and lead to augmented autoAb production and renal disease. My objectives are to characterize the bicongenic mice, compare them to their monocongenic counterparts, and discover any novel phenotypes. Finally, continuing our laboratory’s ongoing work on NZB chromosome 13, my focus is to localize the genetic loci that lead to the development of the autoimmune phenotypes on NZB chromosome 13 and determine the corresponding immune functional abnormalities by which they produce disease. Based upon previous work, I hypothesize that impaired clearance of apoptotic debris is contributing to the development of autoimmunity in these mice. My objectives are to produce a series of subcongenic mice carrying truncated NZB chromosome 13 intervals, examine uptake of apoptotic debris by various macrophage populations, and correlate with the autoimmune phenotypes in subcongenic mice, to ultimately determine the role of impaired clearance in the generation of the immune defects.

Chapter 2

Abrogation of pathogenic IgG autoantibody production in CD40L gene- deleted lupus-prone New Zealand Black mice

Evelyn Pau1,2, Nan-Hua Chang1, Christina Loh1,2, Ginette Lajoie3,4, and Joan E.Wither1,2,5

1Arthritis Centre of Excellence, Toronto Western Research Institute, Toronto, Ontario, Canada;

2Department of Immunology and 3Department of Laboratory Medicine and Pathology, University of

Toronto, Toronto, Ontario, Canada; 4Department of Pathology, Mount Sinai Hospital, Toronto, Ontario,

Canada; and 5Department of Medicine, University Health Network, Toronto, Ontario, Canada.

(All experiments were performed by E. Pau with the exception of the Coomb’s tests. Kidney pathology was assessed by G. Lajoie. All other authors provided experimental assistance.)

2.1 Abstract

New Zealand Black (NZB) mice spontaneously develop a lupus-like autoimmune disease. Since CD40-

CD40L interactions are important for B cell class-switch recombination and germinal center formation, we sought to understand the impact of these interactions on the immune abnormalities in NZB CD40L gene-deleted (CD40L-/-) mice in vivo. NZB.CD40L-/- mice demonstrated abrogation of all IgG autoantibodies tested and attenuated kidney disease. However, polyclonal B cell activation in vivo and B cell proliferation and class-switching in response to TLR ligands in vitro were preserved in the absence of

CD40L in NZB mice. Although, plasmacytoid dendritic cell expansion and elevated BAFF production were unaffected by the absence of CD40L, there was some evidence that IFN-α-induced gene expression was reduced in the bone marrow of NZB.CD40L-/- mice. Our results suggest that CD40-CD40L interactions play an important role in promoting pathogenic IgG autoantibody production and kidney disease in NZB mice.

2.2 Introduction

Systemic lupus erythematosus (SLE) is a chronic, multi-organ autoimmune disease characterized by the production of autoantibodies (autoAbs) mainly directed against nuclear antigens (Ag) (1, 2). In this condition, end-organ damage results from deposition of IgG immune complexes (IC) in the kidney, skin, joints and other organs resulting in inflammation. Numerous studies have shown that these pathogenic autoAbs are class-switched and somatically mutated with high affinity for nuclear autoAg (263-265).

However, the immune mechanisms leading to the generation of these autoAbs remain controversial.

CD40 and CD40L are members of the TNF superfamily (266). Interactions between CD40L expressed on activated T cells and CD40 expressed on B cells are well known to be crucial for B cell class-

36 switch recombination and germinal center formation. While this might suggest that these interactions play an important role in the generation of pathogenic IgG autoAbs in lupus, data regarding this have been conflicting. In support of a role of CD40-CD40L interactions in SLE, treatment of lupus-prone

(New Zealand Black (NZB) x New Zealand White) F1 (NZB/W) mice with anti-CD40L delayed disease onset, reduced IC-mediated glomerulonephritis, and prolonged survival (170). Similar results were obtained in human lupus patients treated with anti-CD40L humanized mAb, where a reduction in autoAb levels and severity of renal disease was observed (171, 172). However, these findings contrast with those in the MRL-lpr lupus-prone mouse model, where mice deficient in CD40L continued to produce

IgG class-switched autoAb and treatment with anti-CD40L mAb accelerated kidney disease (174, 175).

To further confound this issue, several studies using various lupus-prone mouse models have provided evidence that the production of pathogenic autoAb may not require T cells. In FcγRIIB knockout, BAFF transgenic, and 56R anti-DNA heavy chain transgenic mice, pathogenic autoAb production persisted despite introduction of TCR β and/or δ chain gene deletions (144, 200, 267). Similar findings have been observed for NZB mice, where introduction of CD4 and CD8 gene deletions had a modest impact on autoAb production (268), and we have obtained similar results in NZB mice with a TCRα chain gene deletion (unpublished observations). Although it is unclear whether residual T cells in these lupus models may provide help for autoreactive B cells to produce autoAb, these findings collectively appear at odds with a possible role for CD40-CD40L interactions in disease pathogenesis, since CD40L is predominantly expressed on activated T cells.

In contrast to the contradictory role of T cells and CD40L in disease genesis, a number of studies have demonstrated that the introduction of a MyD88 gene-deletion that blocks TLR7 and TLR9

37 signalling onto various lupus-prone mouse backgrounds abrogates disease (200, 269, 270). Signalling through these TLRs has been proposed to promote lupus through several mechanisms. Uptake of nuclear antigens following immunoglobulin (Ig) receptor engagement leads to their localization in the endosomal compartment, where RNA or DNA bind to TLR7 or TLR9 respectively, leading to cellular activation and production of IgM and class-switched autoAb (74, 81). In addition, IgG nuclear Ag containing IC have been shown to induce BAFF production by dendritic cells (DC) (201), which promotes increased survival of autoreactive B cells and plasma cells (193). IgG IC can also stimulate plasmacytoid DC (pDC) to secrete IFN-α, promoting DC maturation and autoreactive T and B cell activation through TLR-dependent mechanisms (102, 271).

NZB mice spontaneously develop a lupus-like disease characterized by the production of IgG anti-RBC and anti-ssDNA autoAb, leading to hemolytic anemia and mild glomerulonephritis late in life

(20). One of the characteristic features of these mice is polyclonal B cell activation which results in increased serum IgM levels, increased number of IgM-secreting B cells, spontaneous B cell activation in vivo, and B cell proliferation in vitro (20, 272-275). We previously found that the polyclonal B cell activation phenotype in NZB mice is CD40L-independent (276). In this study, to determine whether

CD40-CD40L interactions are required for the production of pathogenic class-switched autoAb and several of the proposed IgG IC-mediated TLR signalling events in lupus, we backcrossed the CD40L gene deletion (CD40L-/-) onto the NZB background. Production of all IgG anti-nuclear and -RBC antibodies tested was abrogated and kidney disease was attenuated in NZB.CD40L-/- mice. However, the absence of

CD40L had little impact on IgM autoAb production, increases in various B cell subsets, bone marrow pDC expansion, and elevated baff production in NZB mice. Although IFN-α-induced gene expression

38 was not increased in NZB mice, it was significantly reduced in the bone marrow of NZB.CD40L-/- mice, consistent with the possibility that CD40L and/or IgG IC promote type I IFN secretion in NZB mice. The absence of IgG anti-nuclear autoAb in NZB.CD40L-/- mice was not due to altered TLR-signalling in the B cells of these mice, since B cell proliferation and class-switching in response to TLR ligands were not impacted by the absence of CD40L. Therefore, CD40-CD40L interactions play a dominant role in promoting IgG autoAb production and kidney disease in NZB mice, and TLR signals alone or in tandem with BAFF elevations are insufficient to promote lupus autoimmunity in these mice.

2.3 Materials and Methods

2.3.1 Mice

-/- C57BL/6 (B6) and CD40L gene deleted B6 mice (B6.CD40L , (277)) were purchased from the Jackson

Laboratory (Bar Harbor, ME). NZB mice were purchased from Harlan Laboratories (Blackthorn,

England). NZB.CD40L-/- mice were produced using the speed congenic technique. Mice were genotyped at each successive generation using polymorphic microsatellite markers (Invitrogen, San Diego, CA) that discriminate between B6 and NZB DNA, spaced at ~14cM apart (range 1-29 cM), except for regions containing lupus susceptibility genes, where more densely spaced primers were used. Fully backcrossed mice were obtained by the N8 generation and were intercrossed to produce knockout mice. Female mice aged from 2 to 12 months old were examined. Mice were housed in microisolators in the animal facility at the Toronto Western Hospital and were specific pathogen-free. All studies were approved by the

Animal Care Committee of the University Health Network under protocol #123.11.

2.3.2 Flow cytometry staining and analysis

A total of 5 x 105 RBC-depleted splenocytes or bone marrow cells were incubated on ice with 10 μg/ml mouse IgG (Sigma-Aldrich, St. Louis, MO) for 15 min to block FcR and stained with various combinations of directly-conjugated mAbs. Following washing, allophycocyanin-conjugated streptavidin

(SA-APC; BD Biosciences, San Diego, CA) was used to reveal biotin-conjugated Ab staining. Dead cells were excluded by staining with 0.6 μg/ml propidium iodide (Sigma-Aldrich). Flow cytometry of the stained cells was performed using a dual laser FACSCalibur (BD) and analyzed using CellQuest Pro software (BD). The following directly conjugated mAbs were purchased from BD: biotin- and PE- conjugated anti-CD4 (L3T4), PE anti-CD8 (53-6.7), biotin anti-CD11c (N418), PE anti-CD23 (B3B4), PE anti-CD138 (281-2), PE anti-CD44 (IM7), PE anti-B7.2 (GL1), PE anti-MHC (I-Ab,d), PE- and FITC anti-

NK1.1 (PK136), FITC anti-CD21 (7G6), FITC anti-CD3 (145-2C11), FITC and PerCP anti-B220 (RA3-

6B2) mAbs. Biotin- and PE-conjugated anti-B220 (RA3-6B2) and FITC anti-CD11b (M1/70.15) mAbs were purchased from Cedarlane (Burlington, ON). Biotin anti-CD62L (MEL-14) was purchased from eBioscience (San Diego, CA). All isotype controls were purchased from Cedarlane except for hamster IgG controls, which were obtained from BD.

2.3.3 Measurement of antibody production

IgM, IgG and IgA anti-Sm/RNP, -chromatin, -dsDNA, and -ssDNA Abs were measured by ELISA. H1- stripped chromatin was prepared from chicken RBC, as described (278). dsDNA was prepared from calf thymus DNA (Sigma-Aldrich), and ssDNA prepared by boiling dsDNA for 10 min and quick cooling on ice. ELISA plates (Immunolon II) were coated overnight at 4ºC with various Ag diluted in PBS (Sm/RNP,

1 unit/well (ImmunoVision, Springdale, AR); chromatin, 8 μg/ml; dsDNA, 20 μg/ml; ssDNA, 10 μg/ml).

For measurement of total IgM, IgG and IgA, plates were coated overnight with goat anti-mouse IgM

(H+L; Jackson ImmunoResearch Laboratories, West Grove, PA), IgG or IgA (H+L; Southern Biotech,

Birmingham, AL) diluted in PBS. The plates were then washed with PBS/0.05% Tween 20, and blocked with PBS/2% BSA. Serum samples were diluted in PBS/BSA/Tween 20 at a concentration of 1/3000 for total IgM and IgA, 1/10000 for total IgG, 1/100 for anti-chromatin, and 1/50 for anti-Sm/RNP, -dsDNA and -ssDNA Ab measurements. Standard curves were performed using class-specific controls (Southern

Biotech) to quantify Ig with the concentration being calculated from a log-log plot of concentration vs. absorbance. ELISAs were detected with anti-mouse isotype-specific alkaline-phosphatase conjugated anti-IgM, -IgG or -IgA Ab (Invitrogen), and revealed by p-nitrophenyl phosphate disodium hexahydrate substrate (Sigma-Aldrich).

2.3.4 Detection of anti-RBC antibodies

Anti-RBC Ab production was assessed by the direct Coombs test and flow cytometry. Briefly, heparinized blood was obtained by saphenous vein puncture and washed in PBS/1.5% FBS. For the direct Coombs

test, packed RBC were diluted 1/1000 in PBS/1.5% FBS containing serial dilutions of a F(ab’)2 goat anti- mouse IgG Ab (Invitrogen, 5, 1, 0.5, 0.25, 0.125, 0 μg/ml) and incubated for 2 hr at 37°C. Agglutination was scored by light microscopy with no agglutination scored as 0, scattered clumps of agglutination as 1, more densely agglutinated cells as 2, and a single dense clump of agglutinated cells as 3. For flow cytometry, IgG coated RBCs were detected by staining with a FITC-conjugated goat anti-mouse IgG

F(ab’)2 Ab (Invitrogen) and the percent positive cells determined by comparison with an isotype-matched control Ab.

2.3.5 Grading of kidney sections

Kidneys from 12 month old mice were fixed in formalin, paraffin embedded, sectioned (3μm), and stained with periodic acid Schiff (PAS). Grading was performed by a renal pathologist (G. Lajoie) who was blinded as to the strain of origin and genotype of the tissue section. Glomerular staining of kidney sections stained with FITC anti-IgG was graded by immunofluorescence microscopy. Sections with no or only trace deposits were graded as 0; those with mesangial deposits, grade 1; those with mesangial and segmental capillary wall deposits, grade 2; those with diffuse mesangial and capillary wall deposits, grade

3; and those with crescents, grade 4. The grading scale used for light microscopy was as follows: grade 0, normal glomeruli; grade 1, mesangial expansion and/or proliferation; grade 2, focal segmental

(endocapillary) proliferative glomerulonephritis; grade 3, diffuse (endocapillary) proliferative glomerulonephritis; and grade 4, diffuse proliferative glomerulonephritis with crescents.

2.3.6 Quantitative real-time PCR analysis

RNA was isolated from splenocytes and bone marrow cells of 2 to 8 month old mice using the RNeasy

Mini Kit (Qiagen, Basel, Switzerland), treated with DNaseI (Invitrogen), and converted to cDNA using a reverse transcription kit (Applied Biosystems, Forster City, CA). Quantitative real-time PCR was performed with SYBR Green Master Mix (Applied Biosystems) on a 7900HT Fast Real-Time PCR System

(Applied Biosystems) using default cycling conditions. Primer sequences were designed to span exon-to- exon as follows: β-actin (TTGCTGACAGGATGCAGAAG, GTACTTGCGCTCAGGAGGAG), baff

(TTCCATGGCTTCTCAGCTTT, CGTCCCCAAAG-ACGTGTACT), tnf-α

(GCCACCACGCTCTTCTGTCT, TCTGGGCCATAGAACTGATGAGA), pkr

(TGAGCGCCCCCCATCT, TATGCCAAAAGCCAGAGTCCTT), 2’-5’ oas (TGAGCGCCCCCCATCT,

CATGACCCAGGACATCAAAGG), ifn-α4 (CTTGTCTGCTAC-TTGGAATGCAA,

AGGAGGTTCCTGCATCACACA-3’, and ifn-β1 (TGACGGAGAAGATGCA-GAAGAG,

CACCCAGTGCTGGAGAAATTG). Gene expression was analyzed using the relative standard curve method and was normalized to β-actin expression.

2.3.7 In vitro cell proliferation and Ig class-switching

RBC-depleted splenocytes from 4 month old mice were incubated with purified anti-Thy1.2 (HO-9913-

4), anti-CD4 (GK1.5), and anti-CD8 (AD4(15)) mAb followed by guinea pig complement (Cedarlane) to remove T cells. T cell-depleted splenocytes were cultured at 105 cells per well for 72 hours for cell proliferation studies or at 5×105 cells per well for 5 days for Ig class-switching studies. Cells were cultured in complete RPMI 1640 medium containing 10% fetal bovine serum, non-essential amino acids, L- glutamine, β-mercaptoethanol, penicillin, and streptomycin in U-bottom 96-well plates. TLR ligands used were imiquimod R837 (2μM; TLR7) and CpG ODN 1826 (33nM; TLR9) both from InvivoGen (San

Diego, CA). Purified goat anti-mouse (Fab’)2 IgM (10μg/mL; Jackson ImmunoResearch Laboratories) was added with or without TLR ligands to the culture wells. Purified anti-mouse CD40 (10 μg/mL; clone

3/23; BD) and LPS (25 μg/mL; Sigma-Alderich) were used as positive controls. Proliferation was measured by [3H] thymidine incorporation after a 16 hour pulse with 1 μCi/well in a 72 hour culture.

Uptake of [3H] thymidine was quantified by a scintillation counter and expressed as mean counts per minute ± SD of triplicate wells. For each stimulus condition, a stimulation index was calculated by dividing the mean counts per minute in the presence of stimulus by the mean counts per minute in the absence of stimulus. Ig class-switching was measured by flow cytometry after a 5 day culture, where cells were stained with PE anti-B220 (BD), biotin conjugated anti-IgM and FITC anti-IgG (Jackson

ImmunoResearch Laboratories).

2.3.8 Statistical analysis

Comparisons of differences between groups of mice for continuous data were performed using the

Mann-Whitney non-parametric test. Fisher’s exact test was used for comparisons of proportions between groups of mice.

2.4 Results

2.4.1 Abrogated IgG autoAb and attenuated kidney disease in NZB.CD40L-/- mice.

Autoimmune disease in NZB mice is characterized by production of anti-RNA, -DNA and -red blood cell

(RBC) antibodies (Ab), together with a glomerulonephritis that develops late in life (20). To determine the role of CD40-CD40L interactions in production of these phenotypes, NZB.CD40L+/+, NZB.CD40L+/-, and NZB.CD40L-/- mice were aged to 8 or 12 month. Serum from 8 month old NZB wildtype mice showed elevated levels of total IgM, and IgM anti-Sm/RNP, -chromatin, -dsDNA and -ssDNA Ab as compared to B6 control mice (Fig. 2.1). NZB.CD40L-/- mice maintained the increased levels of all types of

IgM autoAb, except for IgM anti-chromatin Ab, suggesting that most IgM autoAb production is independent of CD40-CD40L interactions. However, in the absence of CD40L, total serum levels of IgG and IgA, and the IgG and IgA anti-nuclear antibodies tested were markedly reduced in NZB mice, in most cases to levels comparable to corresponding B6 controls. This suggests that CD40-CD40L interactions are required for the production of IgG and IgA anti-nuclear autoAb in NZB mice.

At 12 months of age, IgG anti-RBC autoAb production was abrogated in NZB.CD40L-/- mice

(Fig. 2.2A-B). To determine the impact of CD40L on the development of glomerulonephritis in NZB mice, glomerular IgG deposition and light microscopic changes were graded using a four-point scale as outlined in the Materials and Methods. Consistent with the lack of IgG autoAb production in

Figure 2.1. IgG and IgA autoAb production is abrogated in NZB.CD40L-/- mice. The levels of IgM, IgG and IgA total, anti-Sm/RNP, -chromatin, -dsDNA and -ssDNA Ab were determined by ELISA in sera collected from 8 month old B6 and NZB CD40L+/+, +/-, -/- mice. Each point represents the determination from an individual mouse. Horizontal lines indicate the mean of each group examined. Significance levels were determined by the Mann-Whitney non-parametric test. Intra-strain comparisons of B6 or NZB strains are shown using p values and inter-strain comparison of +/+, +/- or -/- between B6 and NZB mice are shown using asterisks: *p<0.05, **p<0.005 and ***p<0.0005.

Figure 2.2. Abrogated hemolytic anemia and attenuated kidney disease in NZB.CD40L-/- mice. A. Percentage of IgG positive RBC was assayed by flow cytometry and B. Direct IgG Coomb’s test results, quantified as outlined in the Materials and Methods, for 12 month old B6 and NZB CD40L+/+, +/- ,-/- mice. Each point represents the determination from an individual mouse. Horizontal lines indicate the mean of each group examined. Significance levels were determined by the Mann-Whitney non-parametric test. Intra-strain comparisons of B6 or NZB strains are shown using p values and inter-strain comparison of +/+, +/- or -/- between B6 and NZB mice are shown using asterisks: *p<0.05, **p<0.005 and ***p<0.0005. C. Immunofluorescence (IF) scores of frozen kidney sections stained with FITC anti-IgG from 12 month old mice. Sections were graded as described in materials and methods. D. Light microscopy (LM) scores of 12 month old kidneys fixed in formalin, paraffin embedded, sectioned and stained with periodic acid-Schiff. Sections were graded as described in Materials and Methods. Significance levels were determined by Fisher’s exact test. Intra-strain comparisons of B6 or NZB strains are shown using p values and inter-strain comparison of +/+, +/- or -/- between B6 and NZB mice are shown using asterisks: *p<0.05, **p<0.005 and ***p<0.0005.

NZB.CD40L-/- mice, no deposition of IgG was seen within the capillary walls of the glomeruli (Fig. 2.2C).

Nevertheless, mild residual nephritis was seen in these mice (Fig. 2.2D), which may result from IgM- mediated damage, as IgM but not IgA, was deposited in the mesangium and to lesser extent capillary loops of these mice (data not shown). Notably, the levels of autoAb tested and severity of kidney disease in NZB.CD40L+/- mice were intermediate between those observed in wildtype and CD40L-/- mice, which likely represents a gene dosage effect. Taken together, the data indicate that CD40-CD40L interactions play a critical role in the production of pathogenic class-switched IgG autoAb and the development of kidney disease in NZB mice.

2.4.2 Variable effects of CD40L on the cellular phenotypic abnormalities seen in NZB mice.

The impact of CD40-CD40L interactions on various splenic and bone marrow cell populations was also examined in the NZB.CD40L-/- mice. Although 4 month old NZB.CD40L-/- mice had slightly reduced spleen sizes compared to NZB.CD40L+/+ and NZB.CD40L+/- mice, the spleens of these mice remained significantly larger than those seen in their B6 counterparts (Table 2.1). Compared to wildtype NZB mice, NZB.CD40L-/- mice demonstrated significantly reduced expansion of the CD21loCD23- compartment, which is known to contain transitional 1, germinal center, CD5+ and plasmablast B cell populations (49). NZB.CD40L-/- mice had a decreased proportion of plasmablasts (B220+CD21-/loCD138+,

Table 2.1) and lacked germinal centers (data not shown), suggesting that the reduced proportion of

CD21loCD23- cells in these mice arises at least in part from changes in these populations. A characteristic feature of the B cell phenotype in NZB mice is the relative expansion of marginal zone (MZ;

CD21hiCD23-) B cells and their precursors (MZP; CD21hiCD23+), together with contraction of the follicular B cell subset (CD21intCD23+) (49, 274). This phenotype was retained in NZB.CD40L+/- and

Table 2.1. Splenic cell populations of B and T cells in B6 and NZB CD40L+/+, +/- and -/- mice at 4 months. B6.CD40L NZB.CD40L

+/+ +/- -/- +/+ +/- -/-

Spleen weight (mg) 91.8 ± 24.1 (19)a 84.1 ± 13.9 (25) 89.9 ± 14.5 (22) 149.2 ± 30.4 (14) 151.4 ± 42.8 (19)a 131.9 ± 64.7 (21)a

No. splenocytes per spleen × 106 47.5 ± 14.7 (20)b 34.9 ± 15.1 (25) 34.6 ± 13.8 (22)b 39.5 ± 13.5 (14)a 29.4 ± 12.2 (19) 30.6 ± 10.9 (21)a

B cells

% CD21lo CD23- of B220+ cells 8.2 ± 1.7 (13) 7.4 ± 1.2 (9)b 5.2 ± 1.7 (14)b 17.2 ± 1.7 (11)a 12.8 ± 3.0 (16)b 8.9 ± 3.3 (12)c

% CD21hi CD23- of B220+ cells 9.3 ± 1.2 (13)a 6.7 ± 2.6 (9) 7.8 ± 2.1 (14)a 13.7 ± 4.4 (11) 13.8 ± 3.4 (16)a 17.8 ± 3.0 (12)a

% CD21hi CD23+ of B220+ cells 4.0 ± 2.2 (13) 5.9 ± 2.2 (9) 5.8 ± 3.0 (14) 7.1 ± 2.8 (11) 5.6 ± 2.3 (16)c 10.4 ± 2.8 (12)a

% CD21int CD23+ of B220+ cells 73.4 ± 2.0 (13) 76.4 ± 4.8 (9) 77.8 ± 4.5 (14) 48.8 ± 4.8 (11) 51.0 ± 4.3 (16) 47.4 ± 6.5 (12)

% B220+ CD21-/lo CD138+ cells 1.5 ± 0.5 (15)c 1.1 ± 0.3 (20)a 0.7 ± 0.2 (18)b 1.5 ± 0.6 (10) 1.5 ± 0.3 (12)b 1.0 ± 0.4 (14)b

% B220-/lo CD138+ cells 1.6 ± 0.3 (15) 1.5 ± 0.3 (20) 1.4 ± 0.3 (18) 3.3 ± 0.8 (10) 3.4 ± 0.4 (12) 3.9 ± 0.9 (14)

T cells

% CD4+ cells 19.4 ± 3.4 (20)a 17.1 ± 2.5 (25)b 14.8 ± 1.5 (22)c 27.2 ± 2.2 (13) 27.0 ± 3.2 (19)b 23.4 ± 3.0 (21)b

% CD8+ cells 14.3 ± 2.0 (20)a 12.9 ± 1.6 (25)c 10.9 ± 0.8 (22)c 12.9 ± 1.3 (13) 12.7 ± 2.3 (19) 14.9 ± 2.9 (21)

% CD69+ of CD4+ cells 15.0 ± 3.0 (8) 15.8 ± 2.9 (9)b 11.1 ± 2.1 (14)a 20.1 ± 4.2 (11) 17.6 ± 4.0 (15)b 11.6 ± 1.7 (11)c

% CD62Llo CD44hi of CD4+ cells 20.9 ± 5.0 (8) 20.8 ± 7.1 (9) 16.7 ± 3.7 (14)a 33.4 ± 4.3 (11) 31.5 ± 4.8 (16)a 24.2 ± 8.0 (11)a

Results are mean ± SD. Numbers in parentheses denote number of mice tested. Significance level was determined by Mann-Whitney non-parametric test. a p<0.05, b p<0.005, c p<0.0005 represent intra-strain comparison within B6 or NZB mice between +/+ vs. +/- (symbol on +/+ strain), +/- vs -/- (symbol on +/- strain) and +/+ vs -/- (symbol on -/- strain). Bold and italics represent inter-strain comparison of p<0.05 between corresponding +/+, +/- or -/- B6 and NZB counterparts.

NZB.CD40L-/- mice. Indeed, in the absence of CD40L, the expanded proportions of MZ and MZP B cells were significantly more pronounced, suggesting that CD40-CD40L interactions prevent entry of B cells into or facilitate exit of B cells from these compartments (Table 2.1). Despite the impact of CD40L on the size of the plasmablast population in NZB mice, the proportion of plasma cells (B220-/loCD138+) in the spleen or bone marrow of NZB mice was unaffected by the absence of CD40L (Table 2.1, data not shown). Taken together, the data indicate that many of the abnormal B cell phenotypes are retained in

NZB.CD40L-/- mice and are consistent with our previous results indicating that polyclonal B cell activation is maintained in NZB.CD40L-/- mice (276).

NZB mice have increased proportions of total, memory effector (CD62LloCD44hi), and recently activated (CD69+) CD4+ T cells, consistent with increased T cell activation in vivo (Table 2.1). In contrast to the findings for B cells, all of these phenotypes were significantly reduced in NZB.CD40L-/- as compared to NZB.CD40L+/- mice, indicating that the altered T cell activation is normalized in the absence of CD40L.

Since NZB.CD40L-/- mice showed abrogated IgG autoAb production, the impact of CD40-CD40L interactions and/or IgG IC on the macrophage and dendritic cells (DC) subsets was investigated.

Consistent with previous reports (49), NZB mice had increased proportions of splenic macrophages

(CD11c-CD11b+). As shown in Table 2.2, this expansion was independent of CD40L. In contrast, the sizes of the splenic DC (CD11c+) and myeloid DC (CD11c+CD11b+) cell subsets were similar across all strains, with the same findings being observed for the CD4+ DC (CD11c+CD11b+CD4+) and CD8+ DC

(CD11c+CD11b-CD8+) subsets (data not shown). Similar proportions of splenic plasmacytoid DC (pDC;

CD11c+B220+NK1.1-) were also found across all strains with the exception of a slight reduction in

NZB.CD40L-/- mice; however, there was a significant expansion of pDC in the bone marrow of wildtype

NZB mice (Table 2.2), as has been previously published (108). The majority of pDC in the spleen and bone marrow, as defined above, also expressed PDCA-1 (data not shown), with equivalent proportions of these cells in both B6 and NZB mice. Surprisingly, the pDC expansion in the bone marrow of NZB mice is unaffected by the absence of CD40L and/or IgG IC. These findings demonstrate that CD40-CD40L interactions and/or IgG IC do not promote the expansion of splenic macrophages and bone marrow pDC in NZB mice.

To determine whether the absence of CD40L and/or IgG IC affected macrophage or DC activation, expression of B7.2 and MHC II was assessed on these populations. Although the levels of B7.2 and MHC II were not increased in NZB as compared to B6 mice, MHC II expression in the DC cell populations was significantly reduced in the absence of CD40L (Fig. 2.3). This finding suggests that one of the mechanisms by which the absence of CD40L may impair T cell activation is through effects on DC activation/maturation.

2.4.3 Elevated levels of baff, but not bone marrow type I IFN production, are independent of CD40L in NZB mice.

IgG IC have been proposed to drive cytokine dysregulation in lupus through FcγR- and TLR- mediated signalling in DC and macrophages, leading to the production of BAFF, TNF-α and IFN-α/β (102, 201,

271, 279). We therefore investigated whether the absence of IgG autoAb in NZB.CD40L-/- mice affected production of these cytokines through investigation of splenic and bone marrow gene expression profiles. baff mRNA expression was significantly elevated in the splenocytes of NZB as compared to B6 mice and strikingly, this increase was independent of CD40L at both 4 and 8 months of age (Fig. 2.4A). mRNA expression of april was also measured and trends similar to those seen for baff were noted (data

Table 2.2. Splenic (Sp) and bone marrow (Bm) cell populations of macrophage and dendritic cell in B6 and NZB CD40L+/+, +/- and -/- mice at 4 months. B6.CD40L NZB.CD40L +/+ +/- -/- +/+ +/- -/-

Macrophages

% CD11c- CD11b+ cells Sp 4.9 ± 1.4 (20) 5.0 ± 1.5 (25) 5.1 ± 1.5 (22) 14.8 ± 11.1 (14) 12.3 ± 3.4 (19) 13.4 ± 3.4 (21)

Dendritic cells

% CD11c+ cells Sp 11.0 ± 2.2 (20) 10.9 ± 1.6 (25) 10.0 ± 1.6 (22) 12.0 ± 2.8 (14) 11.9 ± 2.5 (19) 12.3 ± 1.9 (21)

% CD11c+ CD11b+ cells Sp 7.0 ± 2.0 (20) 7.1 ± 1.4 (25) 6.6 ± 1.5 (22) 7.3 ± 2.0 (14) 7.2 ± 1.8 (19) 7.9 ± 1.6 (21)

% CD11c+ B220+ NK1.1- cells Sp 5.1 ± 2.4 (20) 4.5 ± 2.0 (25) 4.9 ± 2.9 (22) 3.8 ± 1.5 (14) 3.9 ± 1.5 (19)a 2.8 ± 1.2 (21)a

% CD11c+ B220+ NK1.1- cells Bm 3.6 ± 0.9 (19)a 3.0 ± 0.6 (25) 2.9 ± 0.5 (22)a 5.4 ± 0.9 (13) 5.6 ± 1.0 (19) 5.3 ± 1.0 (21)

Results are mean ± SD. Numbers in parentheses denote number of mice tested. N.D. represents not determined. Significance level was determined by Mann-Whitney non-parametric test. a p<0.05 represents intra-strain comparison within B6 or NZB mice between +/+ vs. +/- (symbol on +/+ strain), +/- vs -/- (symbol on +/- strain) and +/+ vs -/- (symbol on -/- strain). Bold and italics represent inter-strain comparison of p<0.05 between corresponding +/+, +/- or -/- B6 and NZB counterparts.

Figure 2.3. CD40L affects MHC II expression on dendritic cell subsets. Scatterplot showing the mean fluorescent intensity (MFI) of B7.2 and MHCII expression on CD11c- CD11b+, CD11c+CD11b+ and CD11c+NK1.1-B220+ cells, gated on PI- cells, in the A. spleens and B. bone marrow of 8 month old B6 and NZB CD40L+/+, +/- ,-/- mice. Each point represents the determination from an individual mouse. Horizontal lines indicate the mean of each group examined. Significance levels were determined by the Mann-Whitney non-parametric test. Intra-strain comparisons of B6 or NZB strains are shown using p values and inter-strain comparison of +/+, +/- or -/- between B6 and NZB mice are shown using asterisks: *p<0.05, and **p<0.005.

52 not shown). At 4 months, no notable differences in tnf-α expression were seen across all strains; however

NZB.CD40L-/- mice showed significantly increased levels of tnf-α expression, as compared to NZB wildtype mice at 8 months of age.

To investigate whether the absence of CD40L and/or IgG IC affects type I IFN production in

NZB.CD40L-/- mice, the expression of type I IFN genes ifnα4 and ifnβ1 was initially studied. Low expression levels of these genes were observed which showed no major differences across all the strains for both the spleen and bone marrow of 4 month old mice (Fig. 2.5). However, there was a 6-fold reduction in the expression of ifn-β1 in the bone marrow of 8 month old NZB CD40L deficient mice compared to NZB CD40L sufficient mice (mean ± S.D.; NZB.CD40L+/+ 0.090 ± 0.150, n=12; NZB.CD40L-

/- 0.014 ± 0.027, n=8). To further explore whether there were differences in type I IFN production, type I

IFN-inducible gene expression was examined to evaluate whether splenocytes and bone marrow cells had been exposed to IFN-α/β. Two well-characterized genes in the IFN-inducible antiviral pathway, PKR

(IFN-inducible dsRNA-dependent protein kinase) and 2’-5’ OAS (2’-5’ oligoadenylate synthetase) were investigated, both of which demonstrate a preferential response to IFN-α as compared to IFN-γ (280,

281). Expression of these IFN-inducible genes in the spleens of NZB mice at 4 or 8 months of age was similar to that observed for B6 mice and appeared to be CD40L independent (Fig. 2.4A). In contrast,

~25% of NZB wildtype mice demonstrated increased levels of both IFN-inducible genes in the bone marrow at 4 months of age, whereas this was not observed in either NZB.CD40L+/- or NZB.CD40L-/- mice

(p=0.0157 using Fisher's exact test, Figure 2.4B). Although lower levels of IFN-inducible gene expression were seen at 8 months of age, a 1.9 fold reduction in expression of pkr was seen in NZB.CD40L-/- mice compared to NZB.CD40L+/+ mice (mean ± S.D.; NZB.CD40L+/+ 0.42 ± 0.20, n=12; NZB.CD40L-/- 0.22 ±

0.02, n=8). The lack of increased type I IFN and IFN-inducible gene expression in NZB mice was not due to insensitivity of our assay, because all of the values were above the threshold of detection. Furthermore, a similar lack of differences was observed for renal tissue and purified bone marrow plasmacytoid DC

(Fig. 2.6). Taken together, the findings indicate that production of pro-inflammatory cytokines is largely unaffected by the absence of CD40L and/or IgG IC, with the possible exception of bone marrow type I

IFN.

2.4.4 B cell CD40L expression is not required for proliferation and Ig class-switching in response to TLR signals.

Murine B cells upregulate CD40L on their cell surface and/or secrete CD40L following stimulation (168,

169). Since disruption of the TLR signalling pathway has also been shown to attenuate class-switched autoantibody production (144, 200), and in some mouse models this is T cell independent, we questioned whether TLR-induced class-switching might require CD40L expression on B cells. To assess this possibility, T cell-depleted splenocytes from 4 month old CD40L sufficient and deficient mice were cultured in the presence of the nucleic-acid sensing TLR ligands, imiquimod R837 (TLR7) and CpG

ODN type B 1826 (TLR9), alone or in combination with (Fab’)2 anti-IgM. As shown in Figure 2.7A, proliferation of B6 or NZB T cell-depleted splenocytes was unaffected by the absence of CD40L for all conditions tested. The reduced stimulation index for the NZB mouse strains with several conditions was the result of increased background proliferation in unstimulated controls as compared to B6 mice.

Results for B cell IgG class-switching after 5 days of culture are shown in Figure 2.5B. Stimulation with

the TLR ligands or (Fab’)2 anti-IgM alone induced little IgG class-switching in either B6 or NZB mouse strains, which was not significantly affected by the absence of CD40L. However, TLR and IgM costimulation induced a ~ 2 to 5 fold increase in class-switched IgG+ B220+ cells as compared to TLR

54 stimulation alone for both B6 and NZB cells, irrespective of CD40L. Similar findings were obtained with purified IgG- B cell populations (data not shown). Thus, the class-switching induced by TLR signals in vitro does not require B cell CD40L expression.

Figure 2.4. Elevated levels of baff in NZB mice are independent of CD40L. Relative mRNA expression of baff, tnf-α, and IFN-α inducible genes pkr and 2’-5’ oas normalized to β- actin mRNA expression in freshly isolated A. splenocytes and B. bone marrow cells of 4 and 8 month old B6 and NZB CD40L+/+, +/-, -/- mice. Each point represents the determination from an individual mouse. Horizontal lines indicate the mean of each group examined. Significance levels were determined by the Mann-Whitney non-parametric test. Intra-strain comparisons of B6 or NZB strains are shown using p values and inter-strain comparison of +/+, +/- or -/- between B6 and NZB mice are shown using asterisks: *p<0.05, **p<0.005 and ***p<0.0005.

Figure 2.5. Reduced type I IFN gene expression in the bone marrow of 8 month old NZB.CD40L-/- mice. Relative mRNA expression of type I IFN genes ifnα4 and ifnβ1 normalized to β-actin mRNA expression in freshly isolated splenocytes and bone marrow cells of 4 and 8 month old B6 and NZB, CD40L+/+, +/- and -/- mice. Each point represents the determination from an individual mouse. Horizontal lines indicate the mean of each group examined. Significance levels were determined by the Mann-Whitney non-parametric test. Intra-strain comparisons of B6 or NZB strains are shown using p values and inter-strain comparison of +/+, +/- or -/- between B6 and NZB mice are shown using asterisks: *p<0.05, **p<0.005 and ***p<0.0005.

Figure 2.6. Similar gene expression in the kidneys and purified bone marrow plasmacytoid dendritic cells of B6 and NZB wildtype mice. Relative mRNA expression of tnf-α, IFN-α inducible genes, pkr and 2’-5’ oas, and type I IFN genes, ifnα4 and ifnβ1, normalized to β-actin mRNA expression. A, Gene expression in the kidneys of 8 month old B6 and NZB CD40L+/+ mice. Each point represents the determination from an individual mouse. Horizontal lines indicate the mean of each group examined. No significant differences were observed determined by Mann-Whitney non-parametric test. B, Gene expression in purified bone marrow plasmacytoid dendritic cells from 4 month old B6 and NZB CD40L+/+ mice. Purified bone marrow pDC were isolated using a MACS plasmacytoid dendritic cell negative isolation kit with >85% of the resultant cells being PDCA-1+ CD11c+ NK1.1- B220+. 1-2 mice were used per group.

Figure 2.7. CD40L does not play a role in proliferation and class-switching in response to TLR signals. Freshly isolated T cell-depleted splenocytes were cultured in the media alone or in the presence of imiquimod R837 or CpG ODN 1826 alone or in combination with (Fab’)2 anti-IgM. Stimulation with LPS and anti-CD40 were used as positive controls. A. For proliferation studies, cells were cultured for 72 hours and pulsed for the last 16 hours with [3H] thymidine. For each stimulus condition, a stimulation index was calculated by dividing the mean counts per minute in the presence of stimulus by the mean counts per minute in the absence of stimulus (media alone). B. For Ig class-switching studies, cells were cultured for 5 days and Ig class-switching was measured by flow cytometry using anti-B220, anti-IgM and anti-IgG mAb. Fold increase of the proportion of B220+IgG+ cells relative to media alone was calculated by the proportion of B220+IgG+ cells in the presence of stimulus relative to the proportion of B220+IgG+cells in media alone control. Data shown are mean ± S.D. for at least three experiments for each stimulus condition.

2.5 Discussion

Several recent studies have highlighted the importance of TLR signalling in mouse models of lupus (32,

74). Here we demonstrate that signals mediated by CD40-CD40L interactions are necessary and that TLR signals alone are insufficient to induce pathogenic autoAb production in NZB mice. Indeed, production of all IgG and IgA autoAb tested, including anti-Sm/RNP and -chromatin, two specificities that have been shown in other studies to be driven by TLR signalling, was abrogated in NZB.CD40L-/- mice. These findings indicate that, despite the ability of TLR signals to induce class-switching in vitro, additional signals are required to sustain autoAb production in vivo.

Although the major population of cells expressing CD40L is T cells, the role of T cells has recently been questioned in several lupus-prone mouse strains, where sustained autoAb production was seen in TCR β and/or δ gene deleted mice (200, 282). While the pathogenesis of autoAb production could differ in NZB mice, we have also noted IgG autoAb production in NZB and B6.NZBc1(35-106) congenic mice with TCRα gene deletion, raising the possibility that other CD40L-expressing populations, such as

B cells or NK cells, drive autoAb production (37). To determine whether B cell expression of CD40L is required for B cell proliferation and/or class-switching in NZB mice, we contrasted these processes in

CD40L sufficient and deficient cells following stimulation with various TLR ligands and anti-IgM. No differences were observed, suggesting that the impact of the CD40L knockout on pathogenic autoAb production in vivo is unlikely to result from altered B cell CD40L expression. NK cells also upregulate

CD40L following activation and have been shown to play an important role in other autoimmune diseases (283). Although the role of this cell population in NZB mice has not been addressed, CD40L expression on NK cells has been shown to induce differentiation of monocytes to DC (174), and NK cells

60 have been shown to augment IFN-α production by pDC, suggesting a potential role in the etiology of lupus (284).

In contrast to the effects of CD40L gene deletion on IgG autoAb production, IgM autoAb production remained elevated in NZB.CD40L-/- mice and similar findings were observed for IgM antibody-forming cells as measured by ELISpot (data not shown). In addition, the proportion of plasma cells in the spleen and bone marrow was unaffected by the CD40L gene deletion. These observations are compatible with previous work by Hoyer et al., demonstrating that the expanded population of plasma cells in NZB/W mice mostly secretes IgM Ab, and further indicate that generation of these cells does not require CD40L and/or germinal centers (285). Thus, the differentiation of IgM-secreting plasma cells in

NZB mice appears to occur in extra-follicular sites. Extra-follicular T cells have been shown to provide support for IgG autoAb production in the MRL-lpr mouse model, which is dependent upon expression of

ICOS (282, 286). Increased numbers of extra-follicular T cells are also seen in NZB/W mice, and blockade of ICOS activation using an anti-B7RP-1 Ab ameliorates disease, raising the possibility that extra-follicular ICOS expression can drive expansion of IgM-expressing plasma cells in NZB mice (287).

Alternatively, the increased expression of baff and april in NZB mice can lead to extra-follicular differentiation of plasma cells in a T cell-independent fashion (288). It is currently unclear whether the differentiation of IgM-secreting plasmablasts is similarly CD40L- and germinal center-independent.

Although the proportion of plasmablasts was reduced in NZB.CD40L-/- mice, it is possible that this difference results from reduced numbers of IgG-, but not IgM-, secreting plasmablasts.

CD40L gene deletion had variable effects on DC expansion and activation in NZB mice.

Consistent with a previous report by Lian et al., pDC were expanded in the bone marrow but not spleens

61 of NZB mice (108) and this expansion was CD40L and/or IgG IC independent. Apoptotic debris- mediated TLR signalling in pDC has been proposed to require uptake by Fc receptors (32, 100, 102, 289).

Our findings suggest that the expansion of pDC in these mice is unlikely to be driven solely by IgG IC- mediated TLR activation. There also appeared to be no effect of IgG IC on pDC and mDC activation in

NZB mice, since the levels of B7.2 and MHC II on these cells were similar between NZB and B6 mice.

Nevertheless, activation of pDC, and to a lesser extent mDC, was dependent upon CD40L in both strains of mice, and this may be responsible for the reduced CD4+ T cell activation observed in CD40L gene deleted mice (290).

It has been previously shown that the autoimmune disease in NZB mice is significantly attenuated in IFNAR1-/- mice (111), suggesting that type I IFNs play an important role in the pathogenesis of disease. Despite this, we were unable to detect evidence of increased levels of this cytokine in the spleens of NZB mice at any point from 2 months (data not shown) to 8 months of age.

Nevertheless, sporadic elevations of IFN-induced genes were seen in the bone marrow, which appeared to be absent in CD40L-gene deleted mice and expression of ifnβ1 and pkr was reduced in 8 month old mice. Therefore, it is possible that IgG nuclear Ag containing IC are driving secretion of IFN-α secretion in these mice. However, it is unclear why these would predominantly affect bone marrow rather than splenic pDC. These findings raise the possibility that type I IFNs promote disease in NZB mice through effects on the bone marrow cells. The observation that type I IFN alter B cell development and selection may be relevant to this possibility (291).

In contrast to IFN-induced genes, baff mRNA expression was elevated in NZB mice and unaffected by CD40L gene deletion. These findings dissociate the immune mechanisms leading to

62 secretion of these cytokines from IFN-α secretion, IgG IC, and pDC activation/differentiation. On immunofluorescence microscopy, there are increased numbers of BAFF-producing cells in the spleens of

NZB mice, with majority being mDC (data not shown). As these cells do not have a requirement for uptake of apoptotic debris by Fc receptors for TLR stimulation, it is possible that TLR signals mediate this BAFF secretion in the absence of IgG. Other as yet unappreciated CD40L-independent stimuli may also lead to BAFF secretion in NZB mice. Although increased expression of tnf-α was not observed in wildtype NZB mice, it was paradoxically increased in 8 month old NZB.CD40L-/- mice. While the reasons for this remain to be definitively determined, TNF-α and IFN-α are known to counter-regulate each other (292), raising the possibility that reduced levels of type I IFN in 8 month old CD40L-/- mice, that were below the threshold of detection of our PCR assay, may have led to the increased expression of

TNF-α in these mice.

2.6 Conclusions

CD40-CD40L interactions are required for the generation of pathogenic IgG autoantibodies in lupus- prone NZB mice. Our results suggest that costimulatory signals required for germinal center formation and B cell class-switching, such as CD40-CD40L, serve as excellent candidates for drug blockade targets to reduce disease severity in human lupus.

Chapter 3

TLR tolerance reduces IFN-alpha production despite plasmacytoid dendritic cell expansion and anti-nuclear antibodies in NZB bicongenic mice

Evelyn Pau1,2,#, Yui-Ho Cheung1,2,#, Christina Loh1,2, Ginette Lajoie3, and Joan E. Wither1,2,4

1Arthritis Centre of Excellence, Toronto Western Research Institute; 2Department of Immunology,

University of Toronto; 3Department of Pathology, Mount Sinai Hospital and William Osler Health

Centre; and 4Department of Medicine, University Health Network, Toronto, Ontario, M5T 2S8, Canada

# These authors contributed equally to the work.

(E. Pau performed experiments for results in Figures 3.3, 3.5, 3.7, 3.9, 3.10, and 3.11. Y. Cheung performed experiments for results in Tables 3.1 and 3.2, and Figures 3.1, 3.2, and 3.4. Y. Cheung’s tables and figures were adapted from his dissertation thesis (Cheung Y. H. (2010). Functional dissection of lupus susceptibility loci on the New Zealand black mouse chromosome 1. Ph.D. Thesis. University of Toronto:

Canada). E. Pau and Y. Cheung contributed equally to the results for Figures 3.6 and 3.8. Kidney pathology was assessed by G. Lajoie. All other authors provided experimental assistance.)

3.1 Abstract

Genetic loci on New Zealand Black (NZB) chromosomes 1 and 13 play a significant role in the development of lupus-like autoimmune disease. We have previously shown that C57BL/6 (B6) congenic mice with homozygous NZB chromosome 1 (B6.NZBc1) or 13 (B6.NZBc13) intervals develop anti- nuclear antibodies and mild glomerulonephritis (GN), together with increased T and B cell activation.

Here, we produced B6.NZBc1c13 bicongenic mice with both intervals, and demonstrate several novel phenotypes including: marked plasmacytoid and myeloid dendritic cell expansion, and elevated IgA production. Despite these changes, only minor increases in anti-nuclear antibody production were seen, and the severity of GN was reduced as compared to B6.NZBc1 mice. Although bicongenic mice had increased levels of baff and tnf-α mRNA in their spleens, the levels of IFN-α-induced gene expression were reduced. Splenocytes from bicongenic mice also demonstrated reduced secretion of IFN-α following TLR stimulation in vitro. This reduction was not due to inhibition by TNF-α and IL-10, or regulation by other cellular populations. Because pDC in bicongenic mice are chronically exposed to nuclear antigen-containing immune complexes in vivo, we examined whether repeated stimulation of mouse pDC with TLR ligands leads to impaired IFN-α production, a phenomenon termed TLR tolerance. Bone marrow pDC from both B6 and bicongenic mice demonstrated markedly inhibited secretion of IFN-α following repeated stimulation with a TLR9 ligand. Our findings suggest that the expansion of pDC and production of anti-nuclear antibodies need not be associated with increased IFN-

α production and severe kidney disease, revealing additional complexity in the regulation of autoimmunity in systemic lupus erythematosus.

3.2 Introduction

Systemic lupus erythematosus (SLE) is a multisystem autoimmune disease of unknown etiology. One of the hallmarks of this condition is the loss of tolerance to self-antigens, particularly nuclear Ag, leading to production of anti-nuclear antibodies (ANA) and formation of immune complexes (IC) (293).

Deposition of these IC in the glomeruli, skin, joints, and other organs induces tissue damage resulting in the manifestations of disease including; glomerulonephritis (GN), skin rash, and arthritis (2).

The New Zealand Black (NZB) mouse and its F1 cross with the New Zealand White mouse

(NZB/W) closely mimic SLE and characterization of the immune defects in these mice has led to a number of fundamental insights into the human disease (15). To facilitate identification of NZB lupus susceptibility loci, we have produced congenic mouse strains, in which homozygous NZB chromosomal intervals containing a single or cluster of susceptibility alleles have been introgressed onto the non- autoimmune C57BL/6 (B6) background. We have previously shown that congenic mice with NZB chromosome 1 (B6.NZBc1) or chromosome 13 (B6.NZBc13) intervals develop ANA and mild GN (36,

188). In both mouse strains, this was accompanied by several cellular phenotypic abnormalities including splenomegaly and increased proportions of activated T and B cells; however, the nature of the autoantibody (autoAb) produced and immune defects in these mice differed (37, 188). B6.NZBc1 mice demonstrate a breach of tolerance to nuclear antigens that is characterized by the presence of histone- reactive T cells and high levels of IgG anti-chromatin, -ssDNA and -dsDNA antibodies (37), whereas

B6.NZBc13 have impaired macrophage clearance of apoptotic debris and produce predominantly IgM and IgG anti-chromatin antibodies (188, 294). In this study, we examined B6.NZBc1c13 bicongenic mice that contain both chromosomal intervals. Although these mice were originally produced to investigate

66 the impact of genetic interactions between these loci on autoimmune phenotypes, the most striking finding in these mice was the marked expansion of their splenic myeloid (mDC) and plasmacytoid DC

(pDC) populations. Despite these changes, only minor increases in ANA production were seen, and the severity of GN was reduced as compared to B6.NZBc1 mice.

As production of type I interferons (IFN) by IgG nuclear-antigen containing IC-stimulated plasmacytoid dendritic (pDC) has been proposed to play an important pathogenic role in SLE (32), we examined whether increased levels of IFN-α were seen in bicongenic mice. Surprisingly, splenic IFN-α levels remained low in bicongenic mice and production of IFN-α by pDC appeared to be reduced in older mice. This reduction in IFN-α production was not due to inhibition by other cytokines, such as TNF-α and IL-10, or regulation by other cellular populations. Instead, the pDC of older mice appeared to be refractory to TLR activation. Notably, both B6 and bicongenic bone marrow-derived pDC became refractory to TLR activation following repetitive stimulation with TLR ligands in vitro, demonstrating reduced secretion of IFN-α. This finding suggests that the lack of IFN-α production in vivo might arise from chronic activation due to nuclear antigens in the environment. Our results indicate that chronic exposure of pDC to IgG anti-nuclear IC does not necessarily lead to enhanced IFN-α production, and suggests that additional factors contribute to the abnormal production of IFN-α in human SLE.

3.3 Materials and Methods

3.3.1 Ethics statement

Mice were housed in a Canadian Council on Animal Care approved facility at the Toronto Western

Research Institute, part of the University Health Network. All mice used and experiments performed in

67 this study were approved by the Animal Care Committee of the University Health Network (Animal Use

Protocol #123).

3.3.2 Mice

B6 and NZB mice were purchased from Taconic Farms (Germantown, NY) and Harlan-Sprague-Dawley

(Blackthorne, England), respectively, and subsequently bred in our facility. Congenic mice were produced by separately backcrossing NZB chromosome 1 and 13 intervals onto the B6 background, using the speed congenic technique (3). Mice were genotyped at each successive generation using polymorphic microsatellite markers that discriminate between NZB and B6 DNA, spaced at ~ 20 cM intervals throughout the genome, except for regions containing lupus susceptibility genes where more densely spaced markers were used. Fully backcrossed mice were produced within 6 or 7 generations, for chromosome 1 and 13 intervals respectively, and then intercrossed to produce congenic mice that were homozygous for the NZB intervals. For NZB chromosome 1 congenic mice (previously called

B6.NZBc1(35-106) but here denoted as B6.NZBc1 for simplicity) the NZB interval extends from between rs13475886 (61.2Mb) and D1Mit303 (63.0Mb) to between D1Mit223 (190.5Mb) and D1Mit210

(192.1Mb). NZB chromosome 13 congenic mice (B6.NZBc13) have an NZB interval extending from between D13Mit117 (37.7Mb) and D13Mit92 (46.9Mb) to D13Mit78 (119.6Mb). B6.NZBc1c13 bicongenic mice were produced by intercrossing B6.NZBc1 and B6.NZBc13 mice and selecting for homozygous NZB chromosome 1 and 13 intervals in successive crosses. Typing of all polymorphic markers (spaced on average ~5-6 Mb apart) in the NZB chromosome 1 and 13 intervals of bicongenic mice was identical to that of the parental monocongenic mice. The mice were housed in microisolators in the animal facility at the Toronto Western Hospital (Toronto, Canada) and were specific-pathogen free. All of the mice that were examined in this study were female.

3.3.3 Flow cytometry analysis

RBC-depleted splenocytes, bone marrow cells, or BMDC (5 x 105) were incubated with 10 μg/ml mouse

IgG (Sigma-Aldrich, St Louis, MO) for 15 min to block Fc receptors and stained with various combinations of directly-conjugated mAbs. Following washing, allophycocyanin-conjugated streptavidin (BD Biosciences, San Diego, CA) was used to reveal biotin-conjugated Ab staining. Dead cells were excluded by staining with 0.6 μg/ml propidium iodide (PI; Sigma-Aldrich). For intracellular staining, cells were fixed and permeabilized using Cytofix/Cytoperm (BD Biosciences), and washed and stained in Perm/Wash buffer (BD Biosciences), according to the manufacturer’s protocol. Flow cytometry of the stained cells was performed using a FACSCalibur or LSRII (BD Biosciences, Mountain

View, CA) and analyzed using Cell Quest Pro (BD Biosciences) or FlowJo (Treestar) software. Live cells were gated on the basis of PI exclusion and scattering characteristics, with 10,000 or 25,000 events being acquired for each sample. The following directly conjugated mAbs were purchased from BD Biosciences: biotin conjugated anti-CD11c (N418), -CD11b (Mac1), -CD4 (L3T4), -CD8 (53-6.7), and -CD62L (MEL-

14); PerCP conjugated anti-B220 (30-F11); PE conjugated anti-B7.1 (16-10A1), -B7.2 (GL1), -IA/IE

(M5/114.15.2), -CD3 (145-2C11), -CD23 (B3B4), -IgMb (AF6-78), -CD69 (H1.2F3), -CD44 (IM7), -

ICAM-1 (3E2), -NK1.1 (PK136), and -CD4 (H129.19); FITC conjugated anti-CD3 (145-2C11), -CD4

(L3T4), -CD8 (53-6.7), -CD21/CD35 (7G6), -CD25 (7D4), -B220 (RA3-6B2), and -CD11c (N418); PE-

Cy7 conjugated anti-CD19 (1D3); Pacific Blue conjugated anti-B220 (RA3-6B2); and APC-Cy7 conjugated anti-CD11b (M1/70). Allophycocyanin conjugated anti-CD9 (eBioKMC8) was purchased from eBioscience, and Pacific Blue anti-SiglecH (551) and APC-Cy7 anti-IA/IE (M5/114.15.2) were purchased from BioLegend. Biotinylated antibiodies were revealed with streptavidin conjugated with allophycocyanin or PerCP from BD Biosciences. FITC and biotin conjugated PDCA-1 (Miltenyi Biotec)

69 was a generous gift from Dr. Eleanor Fish. FITC anti-CD62L (MEL-14) and anti-CD11b (M1/70.15) were purchased from Cedarlane (Hornby, Ontario, Canada). All isotype controls, with the exception of hamster IgG controls (BD Biosciences), were purchased from Cedarlane.

3.3.4 Measurement of Ab production

Serum levels of IgM, IgG, and IgA anti-chromatin, -dsDNA and -ssDNA Ab were measured by ELISA. ssDNA was prepared by boiling dsDNA (isolated from calf thymus DNA) for 10 min and quick cooling on ice for 2 minutes. H1-stripped chromatin was prepared from chicken RBC, as previously described

(278). ELISA plates were coated overnight with chromatin (8 μg/ml), dsDNA (40 μg/ml) or ssDNA (20

μg/ml) diluted in PBS at 4oC. The plates were then washed with 0.05% Tween 20/PBS, and blocked with

2% BSA/PBS for 1h at room temperature. After further washing, serum samples, diluted 1/100 in 2%

BSA/Tween 20/PBS, were added. Bound Ab were detected using alkaline phosphatase-conjugated anti-

IgG, -IgM or -IgA Ab (Caltag, Burlingame, CA) as secondary reagents. For measurement of total IgM,

IgG, and IgA, plates were coated with goat anti-mouse IgM or IgG (Jackson ImmunoResearch, West

Grove, PA, USA) or rat anti-mouse IgA (BD Biosciences) respectively, and the serum was diluted 1/1000.

The amount of bound IgM, IgG or IgA was calculated from a standard curve using purified class-specific controls, and the Ab concentration was calculated from a plot of concentration versus absorbance.

3.3.5 Bone marrow-derived DC (BMDC) cultures and CD11c+ splenic DC isolation

Bone marrow cells were isolated by flushing femurs of 8-12 week-old mice. After RBC lysis, ex vivo cells were resuspended to 106 cells/mL and cultured for 7 days with recombinant human Flt3L (20ng/mL;

R&D Systems) in complete RPMI 1640 media (10% fetal bovine serum (FBS), non-essential amino acids,

L-glutamine, β-mercaptoethanol, penicillin, and streptomycin). Splenic DC were positively selected using

70 biotin-conjugated anti-CD11c antibody (N418) and Dynabeads Biotin Binder kit (Invitrogen), following the manufacturer’s instructions.

3.3.6 TLR stimulation and cytokine blockade

TLR ligands used were imiquimod R837 (2 μM; TLR7), poly I:C (50 μg/mL; TLR3), CpG ODN 2216 or control (250 nM; TLR9), CpG ODN 1826 or control (250 nM; TLR9) all from InvivoGen (San Diego,

CA), and LPS (25 μg/mL; Sigma-Alderich) as a positive control. For splenocytes cultures, 2 x 106 cells were cultured in 96-well flat-bottom plates for 48 hours with various TLR ligands or in media alone

(0.5% normal mouse serum in complete RPMI 1640 without FBS). For BMDC cultures, 4 x 105 cells were cultured in 96-well flat-bottom plates for 24 or 48 hours with various TLR ligands or in media alone (10%

FBS in complete RPMI 1640). For CD11c+ splenic DC cultures, 2 x 105 cells were cultured in 96-well flat- bottom plates for 24 hours with CpG 2216 or in media alone (10% FBS in complete RPMI 1640). To assess IFN-α, IL-10 and TNF-α production following TLR stimulation, cytokine levels in tissue culture supernatants were measured by ELISA using commercially available kits as follows: IFN-α, PBL

Biomedical Laboratories (Piscataway, NJ); IL-10, SABiosciences Corporation (Frederick, MD) or eBioscience (San Diego, CA); and TNF-α, BD Biosciences or eBioscience. Assays were performed as per the manufacturer’s recommendations with the concentration of cytokine calculated from a standard curve of absorbance versus concentration of recombinant cytokine.

3.3.7 Immunofluorescence staining of tissue sections

Spleens were snap frozen in OCT compound (Sakura Finetek, Torrance, CA) at the time of sacrifice.

Cryostat sections (5 μm) were fixed in acetone, washed with PBS, and blocked with 5% normal goat serum/PBS or 5% fetal bovine serum/PBS. Sections were stained with biotinylated anti-CD11b and FITC

71 anti-CD11c to detect myeloid DC. BAFF production was assessed by staining in tandem with rabbit IgG anti-BAFF (Sigma) followed by AMCA-conjugated goat anti-rabbit IgG Ab (Jackson ImmunoResearch).

Biotin staining was revealed using rhodamine-conjugated streptavidin as a secondary reagent (Molecular

Probes, Eugene, OR). Stained sections were mounted with Mowiol (Calbiochem, La Jolla, CA) and tissue fluorescence visualized using a Zeiss Axioplan 2 imaging microscope (Oberkochen, Germany). Digital images were obtained using the manufacturer’s imaging system.

3.3.8 Grading of kidney sections

For immunofluorescence score, kidneys were snap frozen in OCT compound (Sakura Finetek) and sectioned (3 μm). For glomerular score, kidneys were fixed in formalin, paraffin embedded, sectioned (3

μm), and stained with periodic acid-Schiff. Grading was performed by a renal pathologist (G. Lajoie) who was blinded as to the strain of origin of the tissue section. Glomerular staining of kidney sections stained with FITC anti-IgG was graded by immunofluorescence microscopy. Sections with no or only trace deposits were graded as 0; those with mesangial deposits, grade 1 (B more extensive than A); those with mesangial and segmental capillary wall deposits, grade 2; those with diffuse mesangial and capillary wall deposits, grade 3; and those with crescents, grade 4. The grading scale used for glomerular score using light microscopy was as follows: grade 0, normal glomeruli; grade 1, mesangial expansion and/or proliferation; grade 2, focal segmental (endocapillary) proliferative glomerulonephritis; grade 3, diffuse

(endocapillary) proliferative glomerulonephritis; and grade 4, diffuse proliferative glomerulonephritis with crescents.

3.3.9 Measurement of mRNA expression

RNA was purified from splenocytes and bone marrow cells of 8-month-old mice using the RNeasy Mini

Kit (Qiagen, Basel, Switzerland), treated with DNaseI (Invitrogen, Canada), and converted to cDNA using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Forster City, CA), according to the manufacturer’s instructions. Quantitative real-time PCR was performed with SYBR

Green Master Mix on a 7900HT Fast Real-Time PCR System (Applied Biosystems) using default cycling conditions. Primer sequences were designed to span exon-to-exon and were as follows: β-actin forward,

TTGCTGACAGGATGCAGAAG, β-actin reverse, GTACTTGCGCTCAGGAGGAG; baff forward,

CAGGAACAGACGCGCTTTC, baff reverse, GTTGAGAATGGCGGCATCC; tnf-α forward,

GCCACCACGCTCTTCTGTCT, tnf-α reverse, TCTGGGCCATAGAACTGATGAGA; pkr forward,

TGAGCGCCCCCCATCT, pkr reverse, TATGCCAAAAGCCAGAGTCCTT; 2’-5’ oas forward,

TGAGCGCCCCCCATCT, 2’-5’ oas reverse, CATGACCCAGGACATCAAAGG; ifn-α4 forward,

CTTGTCTGCTACTTGGAATGCAA, ifn-α4 reverse, AGGAGGTTCCTGCATCACACA; and ifn-β1 forward, TGACGGAGAAGATGCAGAAGAG, ifn-β1 reverse CACCCAGTGCTGGAGAAATTG. Gene expression was analyzed using the relative standard curve method and was normalized to β-actin expression.

3.3.10 Statistics

Statistical significance of comparisons between groups of mice was determined using the Mann-Whitney non-parametric two-tailed test with the exception of comparisons between kidney tissue section grades where Fisher’s exact test was used.

3.4 Results

3.4.1 B6.NZBc1c13 mice demonstrate a dramatic expansion of DC populations

We have previously shown that B6.NZBc1 and/or B6.NZBc13 mice have a number of cellular abnormalities including splenomegaly, increased B and T cell activation, and expansion of mDC (36,

188). Therefore, the impact of genetic interactions between loci on chromosomes 1 and 13 on these phenotypes was assessed in bicongenic mice. As shown in Table 3.1, the splenic weight and number of splenocytes were significantly greater in 8-month-old bicongenic mice than their monocongenic counterparts, indicating that chromosomes 1 and 13 loci contribute additively to this phenotype.

While the proportions of B220+, CD4+, CD8+ and CD11b+CD11c- cells were similar in bicongenic mice to those observed in one or both monocongenic mouse strains, there was a marked increase in the proportion of CD11c+ cells (Table 3.1). In bicongenic mice, the proportion of CD11c+ cells was increased

~2 fold as compared to both monocongenic strains and represented almost a quarter of splenocytes. To further characterize the phenotype of the expanded CD11c+ population(s), splenocytes were stained with anti-CD11c Ab together with anti-B220 and -NK1.1, or anti-CD11b to identify CD11c+B220+NK1.1- pDC or CD11c+CD11b+ mDC, respectively. As shown in Figure3.1, expansions of both pDC and mDC compartments contributed to the increased proportion of DC in bicongenic mice. This increase was most pronounced for pDC where there was a ~5 fold increase in bicongenic mice as compared to monocongenic mice. As previously reported (108), increases in the splenic pDC and mDC compartment were not seen in NZB mice, suggesting that additional genetic loci present in NZB mice suppress this phenotype.

Table 3.1. Comparison of the splenic phenotype in 8 month old B6.NZBc1c13 bicongenic mice with B6.NZBc1 and B6.NZBc13 congenic strains.

B6 B6.NZBc1 B6.NZBc13 B6.NZBc1c13 NZB

N = 18 N = 28 N = 9 N = 31 N = 9

Spleen weight 246.4 ± 109.5 ± 33.8 222.4 ± 56.7*** 376.5 ± 161.1 508.9 ± 310.6 (mg) 130.9** # Splenocytes 58.94 ± 19.45 100.3 ± 48.32* 83.28 ± 25.25* 131.8 ± 65.49 136.5 ± 84.07 (x 106)

% B220+ 56.48 ± 9.02 58.16 ± 8.28 59.78 ± 7.61 51.65 ± 10.01 29.25 ± 12.49***

% CD21lowCD23– 6.97 ± 2.33 8.14 ± 3.05 8.46 ± 2.59 7.69 ± 3.26 9.35 ± 2.63

% CD21intCD23+ 38.61 ± 10.09 40.49 ± 9.15 35.36 ± 8.03 34.15 ± 11.90 10.58 ± 6.06***

% CD21hiCD23+ 2.86 ± 1.75 2.60 ± 1.68 2.52 ± 1.60 2.34 ± 1.32 0.30 ± 0.38***

% CD21hiCD23- 3.67 ± 1.22 2.36 ± 1.66 6.20 ± 2.96*** 1.69 ± 0.81 1.58 ± 1.47

% CD4+ 19.68 ± 3.96 20.61 ± 2.76 18.77 ± 3.25 20.70 ± 3.75 23.16 ± 5.00

% CD8+ 10.91 ± 5.43 6.67 ± 3.41 8.96 ± 1.13* 5.77 ± 2.18 6.07 ± 2.61

10.33 ± 4.47 14.36 ± 6.53** 23.22 ± 9.81 % CD11c+ 12.91 ± 4.69* 10.66 ± 1.34*** (14) (21) (23) 11.59 ± 8.25* % CD11b+CD11c- 2.38 ± 1.06 (11) 3.52 ± 1.45 (13) 1.54 ± 0.73 (4) 2.42 ± 1.08 (11) (8)

Results are mean ± SD as determined by weight or flow cytometry. Significance level for comparison of B6.NZBc1c13 mice with other mouse strains was determined by Mann-Whitney non-parametric test, *p < 0.05, **p < 0.005, ***p < 0.0005. Numbers of 8 month old mice examined in each group are shown on the top unless otherwise indicated in brackets. Numbers shown in bold and italics indicate significant difference p < 0.05 from B6 control mice.

Figure 3.1. Expansion of dendritic cell populations in the bicongenic mice. Freshly isolated splenocytes from 8 month old female B6, B6.NZBc1, B6.NZBc13, B6.NZBc1c13 and NZB mice were stained with anti-CD11c in combination with anti-B220 and -NK1.1 or anti -CD11b antibodies to assess the proportion of plasmacytoid and myeloid DC. Shown are the (A) absolute number of splenic CD11c+ DC, and proportion of (B) B220+CD11c+NK1.1- pDC and (C) CD11b+CD11c+ mDC. Each symbol represents the determination from an individual mouse. Horizontal lines indicate the mean for each population examined. The p values for significant differences between the congenic mouse strains are shown above bars, whereas asterisks represent significant differences between various congenic mice and B6 controls, *p<0.05, **p<0.005, ***p<0.0005. (D) Representative dot plots show the gating regions for NK1.1- gated B220+CD11c+ pDC (top panel) and CD11b+CD11c+ mDC (bottom panel). Numbers inside the box indicate the proportion of each population.

Expansion of the pDC population was not seen in the bone marrow of 8-month-old bicongenic mice (%CD11c+B220+NK1.1- cells, B6 = 2.85% ± 1.34, n = 13; B6.NZBc1 = 2.72% ± 1.41, n = 18;

B6.NZBc13 = 2.79% ± 1.51, n = 4; B6.NZBc1c13 = 2.29% ± 1.44, n = 17; NZB = 2.34% ± 1.09, n = 6; all p >

0.05 as compared to B6 mice). However, moderate expansion of the bone marrow mDC compartment was observed (%CD11c+CD11b+ cells, B6 = 2.20% ± 1.24, n = 13; B6.NZBc1 = 4.01% ± 1.68, n = 18, p =

0.0035; B6.NZBc13 = 2.44% ± 1.35, n = 4, p > 0.05; B6.NZBc1c13 = 5.57% ± 3.29, n = 17, p = 0.0002; NZB

= 1.69% ± 0.59, n = 6, p > 0.05, all p values as compared to B6). Differences in the proportions of pDC and mDC in the spleen, and for mDC in the bone marrow, were already seen in 2-month-old

B6.NZBc1c13 mice but were much less marked (spleen pDC, B6 = 0.79% ± 0.33, n = 9; B6.NZBc1c13 =

1.34% ± 0.47, n = 11; p < 0.05; spleen mDC, B6 = 2.53% ± 0.86, n = 9; B6.NZBc1c13 = 5.33% ± 1.49, n =

11; p < 0.0005; bone marrow pDC, B6 = 2.09% ± 0.27, n = 6; B6.NZBc1c13 = 2.03% ± 0.49, n = 8; p > 0.05; bone marrow mDC, B6 = 2.37% ± 0.29, n = 6; B6.NZBc1c13 = 3.36% ± 1.15, n = 8; p < 0.05).

We have previously shown that 8-month-old B6.NZBc13 mice have B cell phenotypic changes similar to 4-month-old NZB mice, with reduced proportions of follicular (CD21intermediate(int)CD23+) and increased proportions of MZ (CD21high(hi)CD23-) and B1a (CD21low(lo)CD5+) B cells (188). Surprisingly, in contrast to the DC changes, these phenotypes were not more pronounced in the bicongenic mice (Table

3.2). Indeed, B6.NZBc1c13 mice had reduced proportions of MZ B cells similar to B6.NZBc1 mice. This was not due to an age-associated loss of the MZ B cell population (as seen in NZB mice), because 4- month-old bicongenic mice demonstrated a similar reduction in their MZ B cell population

(%CD21hiCD23- cells, B6 = 5.89% ± 0.98, n = 15; B6.NZBc1 = 3.98% ± 1.84, n = 9, p = 0.0200; B6.NZBc13

= 9.76% ± 1.47, n = 2, p = N.D.; B6.NZBc1c13 = 4.38% ± 1.90, n = 11, p = 0.0430, all p values as compared

Table 3.2. Comparison of the B and T cell phenotypes in 8 month old B6.NZBc1c13 bicongenic mice with B6.NZBc1 and B6.NZBc13 congenic strains.

B6 B6.NZBc1 B6.NZBc13 B6.NZBc1c13 NZB

N = 18 N = 28 N = 9 N = 31 N = 9

1.79 ± 0.50 3.49 ± 1.04** 1.54 ± 0.58 2.41 ± 0.60* % B220+CD5+ 1.46 ± 0.28 (9) (10) (5) (18) (3)

B220+ %CD21lowCD23– 6.97 ± 2.33 8.14 ± 3.05 8.46 ± 2.59 7.69 ± 3.26 9.35 ± 2.63

B220+ %CD21intCD23+ 38.61 ± 10.09 40.49 ± 9.15 35.36 ± 8.03 34.15 ± 11.90 10.58 ± 6.06***

B220+ %CD21hiCD23+ 2.86 ± 1.75 2.60 ± 1.68 2.52 ± 1.60 2.34 ± 1.32 0.30 ± 0.38***

B220+ %CD21hiCD23- 3.67 ± 1.22 2.36 ± 1.66 6.20 ± 2.96*** 1.69 ± 0.81 1.58 ± 1.47

15.80 ± 12.14 19.97 ± 4.58 24.42 ± 6.75 23.48 ± 12.30 30.51 ± 6.03 B220+CD21int % B7.1+ (9) (15) (5) (22) (5) 28.93 ± 20.53 29.11 ± 14.30 45.22 ± 10.30 33.09 ± 15.91 36.06 ± 11.92 B220+CD21hi % B7.1+ (9) (15) (5) (22) (5) 26.73 ± 16.14 37.38 ± 10.89 42.84 ± 6.97 36.47 ± 12.63 53.57 ± 12.59 B220+CD21int B7.2 MFI (9) (15) (5) (22) (5) 64.01 ± 58.87 83.87 ± 50.13 77.74 ± 17.72 82.73 ± 52.19 91.98 ± 17.26 B220+CD21hi B7.2 MFI (9) (15) (5) (22) (5)

B220+ %CD69+ 6.06 ± 4.41 9.01 ± 2.90** 9.70 ± 4.25 14.62 ± 7.19 5.52 ± 2.19***

CD4+ %CD69+ 26.97 ± 6.61 51.04 ± 9.26 40.35 ± 3.95** 53.92 ± 9.23 36.15 ± 13.73***

CD4+ %CD44hiCD62Llo 38.48 ± 7.80 64.56 ± 15.35 51.52 ± 16.23 * 66.03 ± 12.62 66.85 ± 14.00 (Memory) CD4+ %CD44loCD62Lhi 40.65 ± 10.71 12.85 ± 9.14 19.36 ± 11.26 12.08 ± 7.04 16.79 ± 11.96 (Naïve)

Results are mean ± SD as determined by flow cytometry. Significance level for comparison of B6.NZBc1c13 mice with other mouse strains was determined by Mann-Whitney non-parametric test, *p < 0.05, **p < 0.005, ***p < 0.0005. Numbers of 8 month old mice examined in each group are shown on the top unless otherwise indicated in brackets. Numbers shown in bold and italics indicate significant difference p < 0.05 from B6 control mice.

78 to B6 mice). Nor was this reduction due to the presence of contaminating B220+ pDC, because the same changes were seen when this population was expressed as a proportion of total splenocytes (data not shown). Similar findings were observed for the splenic B1a cell population, where the proportion of cells in 8-month-old bicongenic mice was similar to that observed in B6.NZBc1 mice and was significantly reduced as compared to both B6.NZBc13 and NZB mice. Thus, the distribution of B cells in bicongenic mice appears to be driven predominantly by genetic loci on NZB chromosome 1, whereas genetic loci on chromosomes 1 and 13 interact additively to produce marked DC expansion in bicongenic mice.

Given the expansion of DC in bicongenic mice and the potential role of these populations in stimulation of B and T cells, we examined whether activation of these populations was increased in bicongenic mice. As shown in Table 3.2, activation of the CD21int, predominantly follicular, and CD21hi, precursor and mature MZ, B cell compartments was similar in bicongenic mice to that in parental monocongenic mouse strains. We were not able to examine activation in the CD21lo B cell compartment, because this population was contaminated with pDC in our stains. The proportions of recently activated

CD69+ and memory/effector CD44hiCD62Llo CD4+ T cells in bicongenic mice were also not increased as compared to B6.NZBc1 mice. These findings indicate that the expansion of DC in bicongenic mice does not appear to lead to enhanced B or T cell activation.

3.4.2 Clinical autoimmune disease is not amplified in bicongenic mice despite altered autoAb production

To determine whether the expansion of DC in bicongenic mice is associated with more severe disease, autoAb levels and kidney disease were contrasted between the monocongenic and bicongenic mouse strains. Six- to 7-month-old B6.NZBc1 congenic mice produce significantly higher titers of IgG anti- histone, -chromatin and -ssDNA Ab than age-matched B6 controls, whereas IgM and IgG anti-

79 chromatin Ab are predominantly produced in B6.NZBc13 mice (36, 188). As shown in Figure 3.2A, bicongenic mice demonstrated features of both strains, with elevated levels of IgG autoAb that approximated those seen in the B6.NZBc1 mouse strain and the increased levels of IgM anti-chromatin

Ab seen in the B6.NZBc13 strain. In general, the levels of IgM autoAb in bicongenic mice exceeded those seen in the monocongenic mouse strains, which achieved statistical significance for anti-chromatin Ab.

However, with the exception of anti-chromatin Ab, the levels of IgM autoAb remained lower than those seen in NZB mice. Notably, B6.NZBc1c13 mice produced moderate to high titers of IgA anti-chromatin

Ab and low titers of IgA anti-ssDNA and -dsDNA Ab, which were markedly increased as compared to those seen in the monocongenic mice. Thus, genetic interactions between NZB chromosomes 1 and 13 result in the novel generation of IgA ANA.

Despite the development of these novel autoAb phenotypes and levels of IgG ANA similar to those observed in B6.NZBc1 mice, light microscopic changes and the amount of IgG deposition in the kidneys of bicongenic mice were significantly reduced compared to B6.NZBc1 and were similar to those observed for B6.NZBc13 mice (Figure 3.2B-C). Furthermore, although NZB chromosome 1 is reported to contain a genetic locus that facilitates anti-RBC Ab production in crosses with other lupus susceptibility loci (295), anti-RBC Abs were not produced in either B6.NZBc1 or B6.NZBc1c13 mice

(%RBC IgM+, B6 = 1.39% ± 0.95 n = 4; B6.NZBc1 = 2.10% ± 0.87, n = 7; B6.NZBc1c13 = 2.23% ± 0.92, n

= 8; all p > 0.05 as compared to B6: %RBC IgG+, B6 = 0.67% ± 0.29, n =4; B6.NZBc1 = 0.73% ± 0.46, n = 7;

B6.NZBc1c13 = 0.77% ± 0.26, n = 8; all p > 0.05 as compared to B6). Taken together, these findings indicate that the expansion of DC in bicongenic mice is not associated with a significant increase in the severity of the clinical disease phenotype.

Figure 3.2. AutoAb levels and renal involvement in various congenic mouse strains. (A) Serum samples from 8 month old female B6, B6.NZBc1, B6.NZBc13, B6.NZBc1c13 and NZB mice were assayed for the presence of total IgM, IgG and IgA as well as IgM, IgG or IgA anti-chromatin, - ssDNA and -dsDNA Ab. (B) Immunofluorescence scores of frozen kidney sections stained with anti-IgG. Sections were graded as follows: grade 0, no or only trace deposits; grade 1, mesangial deposits (B more extensive than A); grade 2, mesangial and segmental capillary wall deposits; grade 3, diffuse mesangial and capillary wall deposits; grade 4, crescents. (C) Glomerular scores of kidneys fixed in formalin, paraffin embedded, sectioned, and stained with PAS. Sections were graded as: grade 0, normal glomeruli; grade 1, mesangial expansion and/or proliferation; grade 2, focal segmental proliferative glomerulonephritis; grade 3, diffuse proliferative glomerulonephritis; and grade 4, diffuse proliferative glomerulonephritis with crescents. Each symbol represents the determination from an individual mouse. Horizontal lines indicate the mean for each population examined. The p values for significant differences between the congenic mouse strains are shown above bars, whereas asterisks represent significant differences between the various congenic mice and B6 controls, *p<0.05, **p<0.005, ***p<0.0005.

3.4.3 In vivo cytokine production in bicongenic mice

One of the consequences of DC activation is the production of cytokines. Given the dichotomy between the expansion of the DC subsets and lack of exacerbated clinical autoimmunity in bicongenic mice, we examined the production of several pro-inflammatory cytokines, BAFF, TNF-α, and IFN-α, which are produced by DC and have been shown to play an important role in autoimmunity (75, 111, 112). Since serum BAFF levels correlate poorly with BAFF production (197), splenic BAFF production was assessed by the measurement of baff mRNA levels using qRT-PCR and BAFF protein expression assessed using immunofluorescence microscopy. There was a ~6 fold increase in baff mRNA levels in bicongenic as compared to B6 mice (Figure 3.3A, B6 = 2.58 ± 2.24, n = 12; B6.NZBc1c13 = 14.93 ± 20.31, n = 8), which was not seen in the parental congenic strains. Consistent with this observation, there were increased numbers of BAFF-producing cells in the spleens of bicongenic mice that were predominantly mDC

(Figure 3.4). Similar to BAFF, there were increased levels of tnf-α mRNA in the spleens of bicongenic as compared to B6 mice (Figure 3.3A). However, the increase in tnf-α levels was only ~2 fold (B6 = 0.43 ±

0.17, n = 9; B6.NZBc1c13 = 0.81 ± 0.45, n = 8). This appeared to arise from the B6.NZBc13 parental strain.

In contrast to BAFF and TNF-α, splenic levels of type I IFN and IFN-α-induced genes were normal or reduced in 8-month-old bicongenic as compared to B6 mice (Figure 3.3B). Similar findings were seen in the B6.NZBc1 parental strain. Thus, although pDC, the major producers of type I IFN, are increased in 8-month-old bicongenic mice, the levels of type I IFN are not increased. The lack of increased type I IFN and IFN-inducible gene expression in bicongenic mice was not due to insensitivity

Figure 3.3. Production of excess BAFF and TNF-α, but reduced levels of IFN-α in the spleens of B6.NZBc1c13 mice. (A) Increased BAFF and TNF-α mRNA expression in B6.NZBc1c13 (c1c13) and B6.NZBc13 (c13) splenocytes and (B) reduced IFN-α/β and IFN-α-induced gene (PKR and 2’-5’ OAS) expression in c1c13 and B6.NZBc1 (c1) splenocytes. Relative mRNA expression of genes of interest normalized to β-actin mRNA expression in freshly isolated splenocytes from 8-month-old female mice. Each point represents the determination from an individual mouse. The p values for significant differences between various congenic mice and B6 controls and various congenic mice are shown, *p<0.05, **p<0.005, as determined by Mann-Whitney non-parametric test.

Figure 3.4. Splenic BAFF expression in B6 and c1c13 bicongenic mice. Cell populations producing BAFF were characterized by staining with biotinylated anti-CD11b, and FITC anti-CD11c with rabbit IgG anti-BAFF followed by AMCA-conjugated goat anti-rabbit IgG Ab. Biotin staining was revealed using rhodamine-conjugated streptavidin as a secondary reagent. Arrows indicate the same BAFF-producing CD11b+CD11c+ mDC in each image. The BAFF-producing CD11c+ cells did not stain with B220 (data not shown). Scale bar, 100µm.

85 of the RT-PCR assay, because all of the values were well above the threshold of detection. A similar lack of increased expression of type I IFN or IFN-α-induced genes was also observed in the spleens of younger bicongenic mice (2-month-old) as well as the kidney and bone marrow of 9-month-old mice (Figure 3.5).

However, a significant increase in 2’-5’ oas was seen in the bone marrow of 2 month-old bicongenic mice.

3.4.4 Reduced in vitro cytokine production by pDC from bicongenic mice

In lupus, pDC uptake of IgG IC containing DNA or RNA, results in TLR engagement and secretion of

IFN-α (32, 201, 296, 297). Thus, the relative absence of IFN-α secretion in bicongenic mice could reflect reduced activation of these cells as a consequence of low levels of anti-nuclear IC or an impaired ability of pDC to be stimulated by these complexes. Since bicongenic mice have increased levels of ANA and deposition of IC in their kidneys, it seemed unlikely that the absence of pDC IFN-α secretion in older mice resulted from a lack of IC; therefore, the ability of pDC to respond to TLR stimulation was assessed.

To this end, freshly isolated splenocytes from 8-week- and 8-month-old mice were incubated with the

TLR9 ligand, CpG 2216, which has been shown to induce IFN-α and TNF-α secretion by pDC (298), or

CpG 1826, which has been shown to induce TNF-α and IL-10 secretion in a variety of cell types, as a control (Figure 3.6). Although there was considerable variability in the ability of splenocytes to secrete

IFN-α following stimulation with CpG 2216 in both mouse strains, IFN-α production was generally reduced in bicongenic as compared to B6 mice. This was most marked in 8 month old mice, where reduced levels were seen despite a ~5 fold expansion of the pDC population (Figure 3.6A). The variations in cytokine production between mice were not due to variations in the proportions of pDC, as reduced IFN-α secretion was seen in bicongenic mice with increased proportions of pDC, indicating reduced production on a per cell basis. Furthermore, reduced IFN-α secretion was still seen in some bicongenic mice when DC were isolated by positive selection (Figure 3.6C). Secretion of TNF-α by pDC

Figure 3.5. IFN-α/β and IFN-α-induced gene expression in various organs of 2 and 9 month-old B6 and bicongenic mice. Expression of IFN-α/β and IFN-α-induced (PKR and 2’-5’ OAS) genes was measured by qRT-PCR in B6 and B6.NZBc1c13 (c1c13) spleen (A) and bone marrow cells (B) at 2 months of age, and in the bone marrow cells (C) and kidneys (D) at 9 months of age. Relative mRNA expression of genes of interest normalized to β-actin mRNA expression. Each point represents the determination from an individual mouse. The p values for significant differences between B6.NZBc1c13 and B6 controls by Mann-Whitney non-parametric test were shown, *p<0.05.

Figure 3.6. Reduced IFN-α, but not TNF-α and IL-10 production following stimulation of splenocytes with TLR ligands in bicongenic mice. Freshly isolated splenocytes from 8 week or 8 month old female B6 or B6.NZBc1c13 (c1c13) mice were stimulated with (A) CpG 2216 or (B) CpG 1826 for 48 h. Stimulation with CpG 2216 control or CpG 1826 control did not show differences between B6 and c1c13 mice (data not shown). (C) CD11c+ splenic DC from B6 and c1c13 mice were stimulated with CpG 2216 for 24 h. Levels of IFN-α, TNF-α and IL-10 in the culture supernatants were determined using ELISA. Each symbol represents the determination from an individual mouse. The p values for significant differences between B6 and B6.NZBc1c13 mice are shown above bars.

88 was also reduced but this did not achieve statistical significance (Figure 3.6A). In contrast to the findings with CpG 2216, secretion of TNF-α and IL-10 secretion following CpG 1826 stimulation was preserved in

8 month-old bicongenic mice (Figure 3.6B).

To determine whether an intrinsic DC functional abnormality leads to the altered secretion of

IFN-α by splenic DC stimulated with CpG 2216, bone marrow cells were obtained from 8-12-week-old

B6 and pre-autoimmune bicongenic mice and cultured in the presence of Flt3L for 7 days to expand bone marrow-derived DC (BMDC). Although there were similar proportions of mDC and pDC in the bone marrow of young B6 and bicongenic mice pre-culture, and similar numbers of BMDC post-culture, there was a slight increase in the proportion of pDC and decrease in the proportion of mDC in BMDC cultures from bicongenic as compared to B6 mice (% pDC, B6 = 41.44% ± 1.20, n = 5; B6.NZBc1c13 = 46.33%

±2.64, n=5, p = 0.0278; % mDC, B6 = 38.77% ± 2.31, n = 5; B6.NZBc1c13 = 31.10% ± 1.12, p = 0.0079).

Immediately following expansion, basal levels of TLR (TLR3, TLR7, TLR9), MHCII, and B7.2 molecules were found to be similar for pDC and mDC derived from both strains (data not shown). Furthermore,

BMDC from B6 and B6.NZBc1c13 mice produced similar amounts of IFN-α and IL-10 following stimulation with various TLR ligands, but demonstrated minor differences in the secretion of TNF-α with R837 and CpG 1826 (Fig. 3.7A-C). pDC from these strains of mice also demonstrated similar upregulation of B7.2 following stimulation with the TLR ligands (Fig. 3.7E). In contrast, B7.2 upregulation with the TLR3 ligand poly I:C and TLR9 ligands CpG 1826 and 2216 was reduced in mDC

(Fig. 3.7F). Thus, pDC from BMDC appear to function normally, whereas some minor functional differences in mDC were observed between the two mouse strains. These findings suggest that the altered function of splenic pDC in bicongenic mice develops in response to the bicongenic environment.

Figure 3.7. Similar levels of cytokine production, but reduced B7.2 expression in myeloid dendritic cells from bicongenic mice upon TLR stimulation. BMDC from 8-12 week-old mice were expanded in the presence of Flt3L for 7days and then cultured in the presence or absence of imiquimod R837, poly I:C, CpG 1826, CpG 2216 and LPS. (A) IFN-α, (B) TNF-α, and (C) IL-10 production in the culture supernatant was measured by ELISA. Each symbol represents the determination from an individual mouse, with background levels of cytokine with media alone subtracted. MFI for B7.2 expression on (D) CD11c+ total dendritic cells, (E) CD11c+B220+CD11b- plasmacytoid dendritic cells, and (F) CD11c+CD11b+B220- myeloid dendritic cells, as determined by flow cytometry. The p values for significant differences are shown, where *p<0.05, **p<0.005, ***p<0.0005, and were determined by the Mann-Whitney non-parametric test. Horizontal lines indicate the mean for each population examined.

3.4.5 Reduced IFN-α secretion by pDC does not result from cytokine or cellular inhibition

Both IL-10 and TNF-α have been shown to inhibit IFN-α secretion by pDC (292, 299), therefore it is possible that elevated levels of these cytokines in bicongenic mice inhibit IFN-α production. To investigate this possibility, IFN-α production was assessed in splenocyte cultures that were stimulated with CpG 2216 in the presence or absence of blocking antibodies against TNF-α and/or IL-10. As shown in Figure 3.8A and 3.8B, IL-10 blockade leads to a slight increase in IFN-α production in some mice, however this was similar in B6 and B6.NZBc1c13, and present in both young and old mice. In contrast,

TNF-α blockade resulted in a slight decrease in IFN-α production in some mice. Blockade of both cytokines did not result in further augmentation of IFN-α production in either young or old mice. Thus, the reduction in IFN-α production by the splenocytes of older B6.NZBc1c13 mice does not appear to arise from inhibition by these cytokines.

As various cellular populations have also been shown to inhibit production of IFN-α by IgG IC- stimulated human pDC in vitro (284), we assessed whether splenocytes from older mice that demonstrated reduced production of IFN-α in vitro could inhibit production of IFN-α by splenocytes from young mice. To this end, splenocytes from young and old mice were mixed (1:1) and IFN-α production was assessed following stimulation with ODN 2216 (Fig. 3.8C). In mixed cultures, cytokine production exceeded the average of those seen for splenocytes from young and old mice for both B6 and

B6.NZBc1c13 strains, indicating that old cells were not inhibiting IFN-α production by young splenocytes. These findings suggest that other factors may be causing the reduced IFN production in old bicongenic mice.

Figure 3.8. Cytokines or other cellular populations do not inhibit IFN-α production by CpG 2216 stimulated splenocytes from older c1c13 bicongenic mice. Freshly isolated splenocytes from (A) 8 week or (B) 8 month old female B6 or B6.NZBc1c13 (c1c13) mice were stimulated with CpG 2216 for 48h in the presence or absence of anti-IL-10 and anti-TNF-α blocking antibodies. Levels of IFN-α in the culture supernatants were determined using ELISA. Each symbol represents the determination from an individual mouse. (C) Freshly isolated splenocytes from 8 to 12 week (young) and 8 month (old) B6 or c1c13 mice were stimulated alone or mixed at a 1:1 ratio with CpG 2216 for 48 h. Levels of IFN-α production were determined by ELISA. The dotted lines represent the average IFN-α production by the young and old splenocytes when stimulated separately by CpG 2216. Shown in the figure are representative mice from two separate experiments.

3.4.6 Bone marrow-derived pDC from bicongenic mice demonstrate normal cytokine production and tolerance following TLR stimulation in vitro

Previous work on human pDC indicates that IFN-α secretion is inhibited by repetitive stimulation with

TLR ligands or Ig IC-containing nuclear antigens, a phenomenon that has been termed TLR tolerance

(132, 133). Thus, given the high titers of ANA together with the evidence of IC deposition in bicongenic mice, it is possible that the pDCs from older bicongenic mice are refractory to TLR stimulation as a consequence of chronic stimulation by IgG nuclear antigen-containing IC. To explore this possibility, we examined activation of BMDC following single and repetitive stimulation with CpG 2216. To this end,

BMDC were cultured for 24 hours in the presence or absence of CpG 2216, washed and then stimulated again with CpG 2216. Supernatants were harvested at 24 (before washing) and 48 hours, with cell viability and cellular activation (upregulation of B7.2) being measured at the endpoint by flow cytometry

(Fig. 3.9A). Although pDC stimulated after 24 hours secreted significantly lower levels of IFN-α than those stimulated at the onset of culture period, the levels of IFN-α secreted by pDC from all mouse strains tested were comparable (Fig. 3.9B). Notably, IFN-α secretion in the second 24-hour period of culture was completely abrogated by incubation with CpG 2216 in the first 24 hours, with similar findings for B6 and B6.NZBc1c13 pDC. In contrast, B7.2 expression was maintained or further increased by a second stimulation with CpG 2216, suggesting that the cells are not refractory to activation but that cytokine secretion may be specifically inhibited (Fig. 3.9C). The reduced cytokine production was not secondary to reduced cell viability because the proportion of live cells was similar in both cultures. Thus, murine pDC like their human counterparts, demonstrated impaired IFN-α production following repeated TLR stimulation and this process is intact in bicongenic mice.

Figure 3.9. TLR tolerance impacts on IFN-α production, but not B7.2 upregulation, in BMDC from B6 and c1c13 bicongenic mice after repeated TLR9 stimulation. (A) Experimental design to investigate TLR tolerance of BMDC to TLR9. BMDC were cultured for 24 hours in the presence or absence of CpG 2216, washed and then stimulated again with CpG 2216. Supernatants were harvested at 24 (before washing) and 48 hours, and cellular profiles were assessed by flow cytometry after 48 hours. (B) IFN-α production by stimulated BMDC was measured by ELISA and (C) the mean fluorescence intensity (MFI) for B7.2 expression was quantified in various DC subsets (CD11c+ DC, CD11c+B220+CD11b- pDC and CD11c+CD11b+B220- mDC) using flow cytometry. Each symbol represents the determination from an individual female B6, B6.NZBc1 (c1), B6.NZBc13 (c13) or B6.NZBc1c13 (c1c13) mouse. Horizontal lines indicate the mean for each population examined. The p values for significant differences between various congenic mice and B6 control mice are shown, *p<0.05, **p<0.005.

3.4.7 Splenic pDC in older bicongenic mice have a phenotype suggesting chronic activation in vivo

The findings outlined above raised the possibility that chronic stimulation of pDC by nuclear antigen- containing IC in bicongenic mice leads to their failure to secrete IFN-α in bicongenic mice. To address this possibility, expression of B7.2 and MHC Class II (MHC II), two molecules that are increased with activation, was examined in freshly isolated splenocytes from young and old mice. Since the CD11c+

B220+ NK1.1- population that was used to gate pDC could be contaminated with age-associated B cells

(ABCs), which have been shown to express similar markers and express high levels of B7.2 and MHC II, additional stains were performed to determine the proportion of these cells within the gated population and to enable examination of activation of pDC in the absence of the contaminating ABCs (300). By definition the ABC subset is CD11cintCD11bint and expresses CD19 and IgM. Approximately 10-20 % of the cells gated within the conventional pDC gate expressed these markers, which was similar for both B6 and bicongenic, young and old mice (Fig. 3.10A). An increased proportion of pDC (CD11c+ B220+

CD11b-) was still seen in old bicongenic mice when CD11b+ cells, including the ABC subset, were excluded from the analysis (Fig. 3.10B). As shown in Figure 3.11A, increased levels of MHC II, but not

B7.2, were seen on the pDC of older bicongenic mice, using this more restrictive gating. Interestingly, the

ABC subset was also elevated in older bicongenic mice (Fig. 3.10C-D).

Previous studies have also shown that there are distinct subpopulations within the pDC subset that vary in their capacity to secrete IFN-α. Thus, the impaired ability of splenic pDC from bicongenic mice to secrete IFN-α following stimulation might reflect over-representation of pDC populations that cannot secrete IFN-α. To examine this possibility, freshly isolated splenocytes from young and old mice were stained with anti-CD11c, B220, CD11b, IgM, and CD19, to permit gating of pDC free of ABCs, in

Figure 3.10. Examination of the splenic age-associated B cell population. (A) Similar proportion of contaminating IgM+ CD19+ CD11bint cells within the CD11c+ B220+ cell population across all strains and age groups. (B) Elevated levels of pDC in older bicongenic mice gated as CD11c+ B220+ CD11b- and excluding CD11bint ABC subset. (C) Increased proportion of ABCs is seen only in older bicongenic mice. ABCs were gated as IgM+ CD19+ B220+ CD11cint CD11bint and are expressed as a percentage of live cells. (D) Representative contour plots showing the gating and proportion of CD11cint CD11bint cells as a percentage of live cells in young and old B6 and bicongenic mice. The p values for significant differences are shown, where *p<0.05, ***p<0.0005, and were determined by the Mann-Whitney non-parametric test.

96 tandem with anti-CD9 and SiglecH. It has been shown that the less mature CD9+ SiglecH- pDC can secrete IFN-α, whereas the more mature SiglecH+ CD9- pDC cannot (301). As shown in Figure 3.11B and

3.11C, older bicongenic mice have an increased number and proportion of immature pDC, a phenotype suggesting they should have the capacity to secrete IFN-α. The PDCA-1 staining in each of these populations, was similar to that previously reported, and did not differ between the mouse strains (Figure

3.11D). Notably, both the CD9+ SiglecH- and SiglecH+ CD9- subpopulations of pDC showed evidence of increased activation in older bicongenic mice (Figure 3.11E & 3.11F). As shown in Figure 3.11G &

3.11H, increased expression of B7.2 and MHC II was seen also in the CD11b- subset of these subpopulations. Thus, the reduced levels of IFN-α in bicongenic mice appear to result from an impaired ability of previously stimulated immature pDC to secrete IFN-α.

Figure 3.11. Increased activation of cells in the immature and mature pDC subsets of older bicongenic mice. Expression of the activation markers (A) B7.2 and MHCII was quantified by mean fluorescent intensity (MFI) on splenic pDC gated as CD11c+ B220+ CD11b- in 8 week old (young; Yng) and 8 month old (Old) B6 and bicongenic mice. pDC populations were further characterized with additional surface markers to remove contaminating IgM+ CD19+ ABCs and to determine the maturity of pDC. Immature (CD9+ SiglecH- ) and mature (SiglecH+ CD9-) pDC were gated on the CD11c+ B220+ CD11b- IgM- CD19- splenic pDC population and the data expressed as a proportion of total live splenocytes (B) and as a proportion of total pDC (C). (D) PDCA-1 was highly expressed on mature (SiglecH+ CD9-) but not immature (CD9+ SiglecH-) pDC subsets. Elevated expression of activation markers (E) B7.2 and (F) MHCII was seen in older bicongenic mice in both pDC subsets gated from the CD11c+ B220+ cell population. Representative histogram plots for older B6 (grey dotted line) and bicongenic mice (solid black line) for (G) B7.2 and (H) MHCII were gated on the CD11c+ B220+ CD11b- cells population excluding ABCs, in both the CD9+SiglecH- and SiglecH+CD9- populations. Results from this figure show representative data from one of three independent experiments. The p values for significant differences between B6 and bicongenic mice are shown, *p<0.05.

3.5 Discussion

In this paper, bicongenic mice with NZB chromosome 1 and 13 intervals were produced to determine whether genetic interactions between these two chromosomes lead to exacerbated autoimmunity. While autoimmunity was not more pronounced in these mice than in parental monocongenic strains, several novel phenotypes were seen that were either absent in the monocongenic strains or markedly exacerbated in bicongenic mice. These included dramatic increases in the size of the mDC and pDC populations, and elevated levels of total and anti-nuclear IgA antibodies.

Although there are small but significant increases in the proportions of mDC and pDC for

B6.NZBc1 and mDC in B6.NZBc13 mice, these were markedly augmented in the bicongenic mice. As yet, the precise mechanisms leading to this increased expansion in bicongenic mice have not been determined. However, similar expansions of these subsets have been seen in mice with increased TLR responses and/or impaired clearance of apoptotic debris such as TLR7 transgenic (86), Tir8 knockout

(96), and MerKd (302) mouse strains. Increased TLR signalling can produce expansion of DC populations either by directly inducing activation or migration of DC into the spleen (303, 304), or indirectly by increasing pro-inflammatory factors that have been shown to recruit and/or promote survival of DC

(305-307). It is likely that the expansion of DC in bicongenic mice results from a combination of these factors. Recent experiments in our laboratory indicate that B6.NZBc13 mice have a defect in clearance of apoptotic debris by macrophages, resulting in increased availability of TLR-stimulating nuclear antigens

(294). Although splenic pDC from mice with a shorter NZB chromosome 1 interval encompassed within the interval studied here have been reported to secrete augmented levels of IFN-α and IL-10 in response to TLR-9 stimulation suggesting an increased TLR response (148), this phenotype was not seen in

100 bicongenic mice. However, bicongenic mice have increased amounts of a variety of pro-inflammatory factors including IFN-γ, TNF-α and BAFF, raising the possibility that the expansion of DC in these mice may arise from increased amounts of pro-inflammatory factors rather than TLR-hyper-responsiveness.

It is possible that this capacity to produce pro-inflammatory factors arises from genetic loci on chromosome 1, as increased levels of these cytokines, with the possible exception of TNF-α, were not seen in B6.NZBc13 mice. Thus, the expansion of pDC and mDC in bicongenic mice may arise from increased amounts of apoptotic debris arising from a genetic locus on NZB chromosome 13, acting in tandem with increased production of pro-inflammatory factors arising from genetic loci on NZB chromosome 1.

BAFF levels were markedly increased in bicongenic mice as compared to B6 mice and were at least as high as those seen in NZB mice. This increase appeared to require genetic loci from both chromosomes 1 and 13, as it is seen in neither B6.NZBc1 nor B6.NZBc13 8-month-old mice. In BAFF transgenic mice, there are increased levels of total serum IgA and IgA autoAb, and BAFF has been shown to facilitate class switching to IgA production (186, 200). Thus, it is likely that the increased IgA levels in

NZB and bicongenic mice arise, at least in part, from increased BAFF. However, the elevated levels of

BAFF in bicongenic mice were not sufficient to overcome the reduction in the MZ B cell population mediated by genetic loci on chromosome 1. At present, it is unclear what is driving this BAFF production in bicongenic mice. Although IFN-α has been shown to enhance BAFF production (195), the low levels of IFN-α and IFN-induced gene expression in bicongenic mice suggest that IFN-α does not play a significant role in BAFF induction. Uptake of circulating Ag, such as apoptotic debris, has also been shown to promote localization of mDC-like cells to the spleen (308) and induce their BAFF expression (201, 308). These cells have been shown to localize initially to the MZ, where they cluster with

101

B cells, inducing their Ab secretion. In bicongenic mice, BAFF-producing cells are scattered throughout the red pulp and are not found in clusters with Ab-producing B cells (Fig. 3.4), however it is possible that their localization in the MZ was a transient state or that they were already localized in the spleen and became activated in situ.

Despite the marked expansion of the pDC subset in bicongenic mice, levels of type I IFN did not appear to be increased. This may be relevant to the lack of severe GN in the bicongenic mice, since even modest increases in IFN-α have been shown to markedly accelerate kidney disease (112). Several possible mechanisms were explored for the lack of IFN-α in older bicongenic mice. Both cytokines and direct cellular interactions have been shown to modulate IFN-α secretion by pDC. However, blocking studies with monoclonal antibodies directed against TNF-α and IL-10, two cytokines shown to inhibit IFN-α secretion by pDC (292, 299), did not restore the capacity of pDC from older mice to secrete IFN-α. In mixing experiments, splenic cellular populations from older mice also had no impact on IFN-α production by pDC from young mice. Thus, the secretion of IFN-α in older bicongenic mice does not appear to be actively suppressed by either cytokines or cellular interactions. Chronic activation of human pDC by TLR ligands has been shown to lead to desensitization to TLR-signalling, resulting in impaired production of IFN-α. To determine whether murine pDC can be rendered similarly refractory to activation, BMDC were stimulated repeatedly with a TLR9 ligand. Similar to their human counterparts, repeated stimulation of pDC led to markedly impaired IFN-α secretion. This raised the possibility that chronic stimulation of pDC by nuclear antigen-containing IC in bicongenic mice leads to their failure to secrete IFN-α in bicongenic mice. Consistent with this possibility, pDC of older bicongenic mice showed evidence of previous activation in vivo, with increased expression of MHCII, as compared to B6 mice.

102

This increased activation was seen both in the immature and mature pDC populations. In contrast to

MHCII, the levels of B7.2 were either not or only marginally increased on pDC in older bicongenic mice.

As shown in Figure 3.9, pDC from bicongenic mice are impaired in their ability to upregulate B7.2 following TLR stimulation as compared to those from B6 mice. Thus the relative lack of increased B7.2 expression in older bicongenic mice could reflect this signalling difference. Notably, there was an increased proportion and number of immature pDC in older bicongenic mice. This finding suggests that the impaired ability of pDC to secrete IFN-α in older bicongenic mice does not result from a decreased proportion of immature pDC, but instead appears to reflect the prior activation of these cells in vivo. In further support of the concept, the only site at which there is evidence of an IFN-α signature in bicongenic or NZB mice (309) is in the bone marrow, the organ at which pDC are first exposed to apoptotic debris.

Regardless of the mechanisms leading to impaired IFN-α secretion in bicongenic mice, the data reported herein indicate that expansion of pDC and the presence of anti-DNA Ab need not be associated with increases in IFN-α production. In humans with SLE, IgG anti-DNA immune complexes have been proposed to drive the abnormal production of IFN-α by pDC. However, our findings suggest that there must be additional complexity in the generation and regulation of IFN-α beyond this mechanism.

Further characterization of these processes may provide important insights into the immune dysregulation that promotes SLE.

103

Chapter 4

Identification of a lupus-susceptibility locus leading to impaired clearance of apoptotic debris on New Zealand Black chromosome 13

Evelyn Pau1,2, Christina Loh1,2, Gillian E.S. Minty1,2, Nan-Hua Chang1, Joan E. Wither1,2,3

1Arthritis Centre of Excellence, Toronto Western Research Institute, University Health Network,

Toronto, Ontario, M5T 2S8, Canada; Departments of 2Immunology and 3Medicine, University of

Toronto, Toronto, Ontario, M5S 1A8, Canada.

(E. Pau performed all experiments and C. Loh provided 80% of the results for Figure 4.5. All other authors provided experimental assistance.)

Publishers Limited.

104

4.1 Abstract

Systemic lupus erythematosus is a chronic multi-organ autoimmune disease marked mainly by the production of anti-nuclear antibodies. Nuclear antigens become accessible to the immune system following apoptosis and defective clearance of apoptotic debris has been shown in several knockout mouse models to promote lupus. However, genetic loci associated with defective clearance are not well defined in spontaneously arising lupus models. We previously showed that introgression of the chromosome 13 interval from lupus-prone New Zealand Black (NZB) mice onto a non-autoimmune B6 genetic background (B6.NZBc13) recapitulated many of the NZB autoimmune phenotypes. Here, we show that B6.NZBc13 mice have impaired clearance of apoptotic debris by peritoneal and tingible-body macrophages and have narrowed down the chromosomal interval of this defect using subcongenic mice with truncated NZB chromosome 13 intervals. This chromosomal region (81-94 Mb) is sufficient to produce polyclonal B and T cell activation, and expansion of dendritic cells. To fully recapitulate the autoimmune phenotypes seen in B6.NZBc13 mice, at least one additional locus located in the centromeric portion of the interval is required. Thus, we have identified a novel lupus susceptibility locus on NZB chromosome 13 that is associated with impaired clearance of apoptotic debris.

4.2 Introduction Systemic lupus erythematosus (SLE) is a chronic, multi-organ autoimmune disease marked by the loss of tolerance to nuclear antigens, leading to the production of autoantibodies (autoAb) (reviewed in (1)).

The New Zealand Black (NZB) mouse spontaneously develops a lupus-like autoimmune disease similar to the human disease. Specifically, NZB mice have abnormal cellular activation and produce antibodies against nuclear antigens and red blood cells, leading to the development of glomerulonephritis and hemolytic anemia (reviewed in (20)). Although kidney disease is mild in NZB mice, replacement of the

105

NZB H-2d MHC haplotype with a H-2bm12 haplotype results in severe nephritis, suggesting that the NZB background bears a full complement of non-MHC lupus susceptibility genes (21).

Congenic mice with homozygous NZB chromosomal intervals containing one or a small cluster of these susceptibility loci introgressed onto the non-autoimmune C57BL/6 (B6) background have been very useful in dissecting the contribution of these loci to the development of lupus (reviewed in (15)). We previously showed that genetic loci on NZB chromosome (c) 13 were associated with many of the abnormal B cell phenotypes in this mouse strain. Consistent with these findings, B6 congenic mice with an introgressed NZB chromosome 13 interval (B6.NZBc13(47-120 Mb); denoted as B6.NZBc13 or c13) recapitulated many of these phenotypes, including increased B cell activation and an altered B cell subset distribution (49). In addition, these mice produced high levels of IgM and IgG anti-chromatin autoAb, developed mild renal disease, and demonstrated expansion of activated T cells and dendritic cells (DC), suggesting that genetic loci on this chromosome produce a generalized immunologic abnormality sufficient to develop lupus-like autoimmunity (49). To further characterize the nature of the immune alterations in these mice, hematopoietic chimeric mice were produced in which B6.NZBc13 bone marrow alone or a mixture of B6.NZBc13 and B6.Thy1aIgHa bone marrow was transferred into B6.Thy1aIgHa recipient mice (52). Reconstitution of B6 mice with B6.NZBc13 bone marrow transferred most of the immunologic phenotypes characteristic of B6.NZBc13 mice including B cell activation, DC expansion, and autoAb production, indicating that bone marrow derived populations carry the immunologic defects leading to these phenotypes. However, in mice with a mixture of B6.Thy1aIgHa and B6.NZBc13 bone marrow cells, both B6.Thy1aIgHa and B6.NZBc13 B and T cells were equivalently activated (52). This led us to postulate that an immune defect extrinsic to these populations was contributing to development of autoimmunity in B6.NZBc13 mice.

106

Ineffective clearance of apoptotic debris resulting in the accumulation of dying cells is thought to be one of the initiating steps in the breach of tolerance to nuclear antigens in SLE (reviewed in (58, 310)).

Several knockout mouse models including C1q, Dnase1, Mer, LXR, PPARδ, and Mfg-e8 gene-deleted mice, are characterized by defective clearance of apoptotic debris by macrophages and lead to a lupus-like phenotype (60, 61, 65, 69-71). Although genetic loci associated with defective clearance of apoptotic debris have rarely been identified in spontaneously arising lupus models, B6.NZBc13 mice share many of features observed in knockout mice with impaired clearance of apoptotic debris including: abnormal activation of T and B cells and production of anti-chromatin autoAb. This similarity raised the possibility that there is impaired macrophage clearance of apoptotic debris in B6.NZBc13 mice.

In this study, we show that the peritoneal and tingible-body macrophages of B6.NZBc13 mice are indeed impaired in their ability to uptake apoptotic debris. We further demonstrate that the genetic locus producing this defect is localized to an 81-94 Mb interval. Using subcongenic mice with truncated

NZB c13 intervals, we show that this region appears to be sufficient to produce polyclonal B and T cell activation, together with DC expansion. However, full reconstitution of the c13 autoimmune phenotype, including autoAb production and splenomegaly, required the presence of one or more genes localized to the centromeric region on the NZB c13 interval. Our data constitute one of the first reports to identity a susceptibility locus in a spontaneous lupus-arising model that is associated with a defect in the clearance of apoptotic debris, and provide insight into how this locus interacts with other susceptibility loci on

NZB c13 to promote autoimmunity.

107

4.3 Materials and Methods

4.3.1 Mice

B6 mice were purchased from the Jackson Laboratory (Bar Harbor, ME) and subsequently bred in our facility. The full length NZB chromosome 13 congenic mouse strain was generated as previously described, and contains a homozygous NZB interval extending 47-120 Mb (49). Subcongenic mice with truncated NZB chromosome 13 intervals were derived from mice with the full length interval by backcrossing with B6 mice and selecting offspring with informative crossovers. The mice were then intercrossed to produce homozygous subcongenic mice (Figure 4.2). Polymorphic microsatellite markers used to discriminate the B6 and NZB genomic DNA in subcongenic mice were spaced on average 4 Mb apart throughout the c13 gene segment. All experiments were performed with 4 week to 6 month old female mice. Mice were housed in microisolators in the animal facility at the Toronto Western

Research Institute. The experiments performed in this study were approved by the Animal Care

Committee of the University Health Network (Animal Use Protocol #123).

4.3.2 Flow cytometry

Cells were prepared for flow cytometric analysis as previously described (49). Dead cells were excluded by staining with propidium iodide (PI; Sigma-Aldrich, St. Louis, MO) at a final concentration of 0.6 μg/mL.

Flow cytometry of stained cells was performed using FACSCalibur (Becton Dickenson; BD, Franklin

Lakes, NJ) and LSRII (BD) instruments and analyzed using Cell Quest Pro (BD) and FlowJo (Tree Star), respectively. The following mAbs were purchased from BD Biosciences: biotin conjugated anti-B220

(RA3-6B2), -CD4 (L3T4), -CD11c (HL3); PE conjugated anti-B7.1 (16-10A1), -CD69 (H1.2F3), -B220

(RA3-6B2); and FITC conjugated anti-CD21 (7G6). Other mAbs used included biotin conjugated anti-

F4/80 (BM8; eBioscience, San Diego, CA), -PNA (Sigma-Aldrich) and FITC conjugated anti-CD11b

108

(M1/70.15; Cedarlane Laboratories, Burlington, Ontario, Canada). Biotin staining was revealed with allophycocyanin or PerCP conjugated streptavidin (BD). Staining for active caspase-3 was performed using the CaspGlow Fluorescein Active Caspase-3 Staining Kit (BioVision, Milpitas, CA).

4.3.3 Measurement of Ab production

IgM and IgG anti-chromatin Abs were measured by ELISA, as described previously (52). Bound IgM or

IgG Abs were detected using alkaline-phosphatase conjugated anti-IgM or -IgG as a secondary reagent

(Southern Biotech, Birmingham, AL). Substrate (4-nitrophenyl phosphate disodium salt hexahydrate,

Sigma-Aldrich) was added, and the O.D. of each well was measured at a wavelength of 405 nm.

4.3.4 Preparation of apoptotic cells

Thymocytes were harvested from 4-6 week old B6 mice. For induction of apoptosis, RBC were removed by lysis and the remaining cells were exposed to 600 rad γ-irradiation. The cells were then cultured at 5 ×

7 10 cells/mL in serum-free RPMI 1640 for up to 20 hours at 37°C in a humidified atmosphere of 5% CO2, yielding ≥ 80% PI-positive late apoptotic thymocytes(311). For in vivo uptake assays, apoptotic cells were labelled at 5 × 107 cells/mL with CellTracker Orange CMTMR (1 μM; Invitrogen, Carlsbad, CA) in serum-free RPMI for 30 minutes at 37°C. For in vitro uptake assays, apoptotic cells were labelled at 106 cells/mL with pHrodo succinimidyl ester (20 ng/mL; Invitrogen) in PBS for 30 minutes at room temperature. All labelled apoptotic cells were washed twice in PBS before resuspending in complete media (10% fetal bovine serum in RPMI 1640 containing non-essential amino acids, L-glutamine, β- mercaptoethanol, penicillin, and streptomycin) for use in uptake assays.

109

4.3.5 Apoptotic cell uptake assays in vivo and in vitro

For in vivo uptake assays using peritoneal macrophages (PM), 5 × 107 CMTMR-labelled apoptotic cells in

PBS were injected i.p. into 8-12 week old mice. After 30 minutes, PEC were harvested from the lavage and stained with anti-F4/80. For in vitro uptake assays using PM, 106 PEC were resuspended in 1 mL complete media and rested at 37°C for 2 hours in 24-well plates. Adherent cells were washed twice in PBS before co-culturing with 4 × 106 pHrodo-labelled apoptotic cells for 2 hours in complete media. For uptake assays using BMM, bone marrow cells were harvested by flushing out femurs from 8-12 week old mice. Following red blood cell lysis, the cells were plated at 2 × 106 cells/mL in complete media supplemented with recombinant mouse M-CSF (10 ng/mL, R&D Systems, Minneapolis, MN). Fresh media supplemented with M-CSF was replaced on day 3. On day 6, BMM were harvested using trypsin and seeded at 5 × 105 cells in 1 mL of 10% FBS/RPMI without M-CSF in 24-well plates overnight at 37°C.

The cells were then washed twice in PBS before co-culturing with 5 × 107 pHrodo-labelled apoptotic cells for 2 hours. After co-culture with apoptotic cells in vitro, labelled apoptotic cells that were not engulfed were removed by washing with PBS, and the remaining macrophages detached from the well by scrapping. For both in vitro assays, all cells were stained with anti-F4/80 and -CD11b before analysis by flow cytometry. To measure the uptake of apoptotic cells by PM or BMM, an uptake index was defined as

CMTMR+ or pHrodo+ CD11b+ F4/80+ cells divided by total number of CD11b+ F4/80+ cells, normalized to the mean of B6 control mice used in the same experiment.

4.3.6 Immunization

Mice at 8-12 weeks of age were immunized once i.p. with 200 μg of hapten 4-hydroxy-3-nitrophenyl conjugated to chicken gamma globulin (NP-CGG; Biosearch Technologies, Novato, CA) precipitated in a

110

1:1 ratio with alum (Pierce Biotechnology, Rockford, IL). Mice were sacrificed 11 days post- immunization.

4.3.7 Immunofluorescent staining & TUNEL analysis

Spleens were snap-frozen in Shandon Cryomatrix compound (Thermo Scientific, Rockford, IL). Cryostat sections (5 μm) were fixed in 1% paraformaldehyde, washed in PBS, and treated with 2:1 ratio of ethanol to acetic acid solution for 5 minutes at -20°C. Slides were then blocked with 5% goat serum (Invitrogen) in PBS for 2 hours, and stained with various antibodies. Purified uncongugated rat anti-mouse CD68

(FA-11; AbD Serotec, Oxford, UK) was used to detect TBM and biotin-conjugated PNA to detect GC.

Goat anti-rat aminomethylcoumarin (AMCA; Jackson ImmunoResearch, Pennsylvania, PA) and streptavidin rhodamine (Invitrogen) were used as secondary reagents to detect antibody staining.

TUNEL assays were performed with the ApopTag Fluorescein Direct In Situ Apoptosis Detection Kit

(Millipore, Billerica, MA). Stained sections were mounted with Fluoro-Gel with Tris buffer (Electron

Microscopy Sciences, Hatfield, PA) and visualized using a Zeiss Axioplan 2 with deconvolution fluorescence microscope. All GC from each mouse were imaged at 40X magnification, and the number of

TUNEL+ apoptotic bodies per macrophage within the GC, total number of GC, and size of GC were counted and determined using ImageJ software (National Institute of Health, Bethesda, MD).

4.3.8 Statistics

Statistical significance of comparisons between groups of mice was determined using the Mann-Whitney non-parametric two-tailed test for comparisons between two groups. For comparisons with multiple strains, statistical significance was determined by a 1-way ANOVA Kruskal-Wallis test followed by

111

Dunns’ post-test for multiple comparisons. All statistical analyses were performed using GraphPad software (La Jolla, CA).

4.4 Results

4.4.1 Impaired clearance of apoptotic debris by c13 peritoneal macrophages Since c13 congenic mice have autoimmune phenotypes such as production of anti-chromatin Ab and DC expansion that are typically seen in mice with impaired clearance of apoptotic debris (49), we examined uptake of apoptotic debris by macrophages from c13 mice. To this end, B6 apoptotic thymocytes were labelled with CMTMR and 107 cells were injected intraperitoneally (i.p.) into 8-12 week old B6 or pre- autoimmune B6.NZBc13 (denoted here as c13 for simplicity) mice. After 30 minutes, peritoneal exudate cells (PEC) were harvested, stained with the macrophage specific Ab anti-F4/80, and the proportion of

F4/80+ peritoneal macrophages (PM) associated with CMTMR+ apoptotic debris was determined by flow cytometry. Although the number and purity of PM isolated was similar between B6 and c13 mice (data not shown), the proportion of CMTMR+ PM was reduced in c13 as compared to B6 mice (Fig. 4.1B). To further explore the possibility that uptake of apoptotic debris by PM is impaired in c13 mice, PEC were isolated and cultured with apoptotic thymocytes in vitro. This eliminates possible variations in the proportion of CMTMR+ cells due to differences in the number or concentration of PM between the mouse strains, as both mouse strains had similar proportions of PM within their PEC with similar patterns of staining with anti-F4/80 and -CD11b. For these experiments, apoptotic thymocytes were labelled with pHrodo instead of CMTMR. pHrodo is a pH-sensitive dye that increases fluorescence intensity only when cells are engulfed into the acidic environment of the lysosome (312). Thus, any differences observed would represent differences in physiological uptake rather than association of

112

Figure 4.1. Impaired clearance of apoptotic debris by c13 peritoneal, but not in bone marrow- derived, macrophages in vitro. (A) Flow cytometric contour plots of B6 and c13 PM and BMM co-cultured in vitro with media alone (PM only), or pHrodo-labelled apoptotic cells. Plots are gated on CD11b+ cells and F4/80+ cells that have taken up apoptotic debris (pHrodo+) are shown in the top right quadrant. (B) PM and BMM uptake of apoptotic thymocytes in full-length c13 mice. 8-12 week old B6 or pre-autoimmune c13 mice were injected i.p. with CMTMR-labelled apoptotic thymocytes and the peritoneal exudate cells harvested 30 minutes later. Cells were stained with anti-F4/80, and the proportion of F4/80+ PM that stained positively for CMTMR was determined by flow cytometry. Data are expressed as uptake index, which was defined as % CMTMR+ F4/80+ cells divided by the total % F4/80+ cells, normalized to the mean of B6 control mice used in the same experiment. For PM and BMM in vitro assays, pHrodo-labelled apoptotic cells were co- incubated for 2 hours with adherent PM after 2 hours of resting, or BMM expanded using M-CSF for 6 days. All cells were stained with anti-F4/80 and anti-CD11b Ab prior to analysis by flow cytometry. The uptake index was defined as % pHrodo+ CD11b+ F4/80+ cells divided by total % of CD11b+ F4/80+ cells, normalized to the mean of B6 control mice used in the same experiment. Significance levels were determined by Mann-Whitney non-parametric test: * p<0.05, ** p< 0.005. (C) Impaired uptake by PM in vitro was seen in all c13 subcongenic mice examined localizing the defect to region c. Experiments were performed as outlined in (B) on 8-12 week old mice. Each symbol represents the determination from an individual mouse. Horizontal lines indicate the mean for each population examined. Significance levels were determined by 1-way ANOVA with Dunns’ post-test: * p<0.05, ** p< 0.01, *** p<0.001.

113 apoptotic debris with PM. As seen in vivo, there was reduced uptake of apoptotic thymocytes by c13 as compared to B6 F4/80+ CD11b+ PM in vitro (Fig. 4.1A & B). To further explore the nature of the defect in c13 mice, bone marrow was cultured in M-CSF for 6 days to expand bone marrow macrophages

(BMM). The number, purity, and cell surface expression of F4/80 and CD11b of the harvested BMM were similar for both B6 and c13 mice (data not shown). BMM were then cultured with pHrodo-labelled apoptotic cells, as for PM. In contrast to PM, no difference was seen in uptake of apoptotic debris between the BMM from the B6 and c13 mouse strains (Fig. 4.1A & B).

To localize the genetic polymorphism associated with this impaired clearance, a series of subcongenic mice with smaller overlapping c13 intervals were produced (Fig. 4.2). Interestingly, all c13 subcongenic mice demonstrated similarly reduced uptake of apoptotic debris by PM (Fig. 4.1C), tentatively mapping this defect to the 81-94 Mb region (region c shown in Fig. 4.2). Consistent with normal clearance of apoptotic debris by full length c13 BMM, no differences were seen for BMM between

B6 and any of the subcongenic mouse strains examined (data not shown).

4.4.2 Reduced clearance of apoptotic debris in the germinal centers of c13 mice Bone marrow-derived tingible-body macrophages (TBM) have been shown to rapidly phagocytose and clear apoptotic B cells in the GC and mice with defects in this process, such as Mfg-e8 deficient mice, develop a lupus-like autoimmune disease (68, 69). To examine whether TBM in the spontaneously developing GC of c13 mice demonstrate a similar impairment in the clearance of apoptotic debris, spleens from 6 month old mice were stained with PNA to detect GC, anti-CD68 to detect TBM, and

TUNEL reagent to detect apoptotic bodies. As seen in our previous studies, c13 mice had increased numbers of GC per spleen as compared to B6 mice (data not shown; (49)). Similarly to the findings

114

Figure 4.2. Genetic map of chromosome 13 subcongenic mouse strains used in the study. The subcongenic lines generated from the original B6.NZBc13(47-120 Mb) congenic mouse strain, denoted here as c13, are shown. For simplicity, the full length c13 interval has been divided into regions (a-e) based upon the overlap between the different subcongenic mouse strains and the subcongenic strains have been renamed based upon the regions that they contain. Thick and thin black lines denote NZB and B6 regions, respectively. Polymorphic microsatellite markers used to discriminate between the B6 and NZB genome in subcongenic mice were spaced on average 4 Mb apart throughout c13 interval, and the markers used to determine the start and end markers of region are shown at the bottom of the figure. The Mb positions of the markers were determined based on Ensembl release 67 and are rounded up or down to the nearest Mb.

115 observed in Mfg-e8 deficient mice (68), there were increased numbers of TUNEL+ apoptotic bodies associated with each TBM in c13 mice and these were larger and more intact than those seen in B6 mice

(Fig. 4.3A). As shown in Fig. 4.3A, TBM-associated apoptotic bodies demonstrated the same altered morphology in all three subcongenic strains examined, again mapping this abnormality to region c on c13. The number of TUNEL+ apoptotic bodies associated with TBM was further quantified by counting the number of these bodies for each TBM in the spleen section. Significantly increased numbers of apoptotic bodies were associated with TBM in the GC of full-length c13 congenic and c13 c-e and c13c-d subcongenic mice (Fig. 4.3B). The differences observed were not due to reduced numbers of TBM per GC in c13 mice, as the number of TBM were similar or increased in the subcongenic mice and roughly paralleled the increased GC sizes (Fig. 4.3C & D).

Since B6 mice do not spontaneously develop autoimmunity, it was possible that the differences observed between the GC of B6 and c13 congenic mice arose from differences in the specificity of their

GC reactions at 6 months. To control for this possibility, 8-12 week old B6 and pre-autoimmune c13 and subcongenic mice were immunized with a T-dependent antigen, NP-CGG, in alum to induce GC formation. Spleen sections from mice sacrificed 11 days after immunization were then analyzed as outlined in the previous section. Similar numbers of GC were present in all immunized mice and little to no GC were found in unimmunized B6 and c13 mice (data not shown). As seen in spontaneously arising

GC at 6 months, more TUNEL+ apoptotic bodies were associated with TBM in the GC of all c13 congenic and subcongenic mice compared to B6 control mice (Fig. 4.4A & B). The increased number of TUNEL+ bodies per TBM in the c13 mouse strains was not due to reduced numbers of CD68+ TBM in the GC, since there were same number or more TBM per GC in the c13 mouse strains as compared to B6 control mice and this correlated with the average size of their GC (Fig. 4.4C & D). Nor was this the result of an

116

Figure 4.3. Increased numbers of large and more intact TUNEL+ apoptotic bodies associated with spontaneously arising TBM in the GC of c13 congenic and subcongenic mice. (A) Apoptotic bodies, TBM, and GC were visualized by TUNEL (green), anti-CD68 (blue), and PNA (red) immunofluorescent staining respectively, on 5 µm thick splenic sections of 6 month old mice and large and intact TUNEL+ bodies were seen in all c13 congenic mice. Scale bar, 10 µm. (B) Increased number of TUNEL+ apoptotic bodies per TBM were seen in the GC of c13, c13c-e, and c13c-d mice. (C) Number of TBM per GC and (D) GC size in the mouse strains examined. GC size was determined by outlining the shape of the GC in PNA-stained spleen sections using the freehand tool in Image J software. GC area was converted from px2 to μm2 for the respective magnification. Each symbol represents the determination from an individual GC. Number of mice used is as follows: B6, n=9; c13, n=5; c13a-c, n=4; c13c-e, n=10; c13c-d, n=5. Significance levels were determined by 1-way ANOVA with Dunns’ post-test: *** p<0.001.

117

118

Figure 4.4. Impaired clearance of apoptotic debris in the germinal centers of NP-CGG immunized young c13 mice. (A) Apoptotic bodies, TBM, and GC were visualized by TUNEL (green), anti-CD68 (blue), and PNA (red) immunofluorescent staining respectively, on 5 µm thick splenic sections of NP-CGG immunized 8-12 week old mice and large and intact TUNEL+ bodies were also seen in all c13 congenic mice. Scale bar, 10µm. (B) Increased numbers of TUNEL+ apoptotic bodies per TBM were seen in the GC of all c13 congenic mice. (C) Number of TBM per GC and (D) GC size in the mouse strains examined. GC size was determined by outlining the shape of the GC in PNA-stained spleen sections using the freehand tool in Image J software. GC area was converted from px2 to μm2 for the respective magnification. Each symbol represents the determination from an individual GC. Number of mice used is as follows: B6, n=12; c13, n=8; c13a-c, n=4; c13c-e, n=10; c13c-d, n=7. (E) Mean fluorescent intensity (MFI) of caspase-3 in GC B cells in the spleens of 8-12 week old B6, c13, and c13c-e mice with or without NP-CGG immunization. GC B cells were gated as PNAhi CD21-/lo B220+ cells. Horizontal lines indicate the mean for each population examined. Significance levels were determined by 1-way ANOVA with Dunns’ post-test: * p<0.05, ** p< 0.01, *** p<0.001.

119 increased rate of apoptosis of GC B cells in c13 mice, as levels of caspase-3 in these cells were similar across all mouse strains tested (Fig. 4.4E). Taken together, our findings suggest that the TBM of all c13 congenic and subcongenic mice have a defect in clearance of apoptotic debris and that the locus associated with this defect lies within in the 81 to 94 Mb interval (region c) of NZB c13.

4.4.3 Autoimmune phenotypes in c13 subcongenic mice require at least two distinct genetic loci To determine the role of the impaired clearance of apoptotic debris in the development of lupus in c13 mice, subcongenic mice were aged to 6 months and their phenotypes were compared to those of age- matched B6 and c13 congenic mice. As shown in Fig. 4.5, only the c13a-c subcongenic mouse strain produced levels of IgM and IgG anti-chromatin autoAb approaching those seen in c13 mice, with the other subcongenic strains making these autoAb to a variable extent. Notably, the c13c-d interval was not associated with significant levels of IgM or IgG anti-chromatin Ab, indicating that the apoptotic clearance defect is insufficient to produce this phenotype. This suggests the presence of a second lupus susceptibility locus in the c13 mouse strain that, based upon the similarity between full-length c13 and c13a-c mice, is most likely in region a. However, full recapitulation of the c13 phenotype may also require a locus in region b, as intermediate levels of IgG anti-chromatin Ab and increased proportions of

GC B cells were seen in c13b-e mice. Nevertheless, a number of cellular phenotypes were seen in c13c-d mice, including: increased expression of B cell activation markers (Fig. 4.5C and data not shown for B7.2 and ICAM-1), increased expression of T cell activation markers (Fig. 4.5E), and expansion of DC (Fig.

4.5F). These phenotypes were also observed in c13a-c mice, localizing the genetic locus producing them to the overlapping region c containing the clearance defect. Although we have previously described expansion of the marginal zone B cell population in the c13 mouse strain, this phenotype was not seen in

120 the current study, possibly because of the younger age of the mice examined. However, as we had previously reported, modest increases in the splenic B1a population were seen in the c13 mice, which also localized to the c region (B6 = 4.34 ± 0.47, c13a-c = 5.89 ± 1.10, c13c-e = 6.14 ± 0.52, mean ± S.D., p =

0.0095 and 0.0061, respectively). Consistent with the presence of a second susceptibility locus, splenomegaly was only seen in c13a-c mice within all the subcongenic mice (Fig. 4.4G), which also displayed increased cellular activation and DC expansion as compared to the other subcongenic mouse strains.

121

122

Figure 4.5. Autoimmune phenotypes seen in original c13 congenic mice were maintained in c13 subcongenic mouse strains. (A) IgM and (B) IgG anti-chromatin autoAb production in the serum as measured by ELISA. Increased proportions of (C) B7.1+ B cells, (D) GC B cells, (E) CD69+ CD4+ CD3+ T cells, and (F) CD11c+ DC cells in the spleens of c13 congenic and subcongenic mice determined by flow cytometry. (G) Splenomegaly was only observed in c13 congenic and c13a-c subcongenic mice. All mice used were aged to 6 months. Each symbol represents the determination from an individual mouse. Horizontal lines indicate the mean for each population examined. Significance levels were determined by 1-way ANOVA with Dunns’ post-test: * p<0.05, ** p< 0.01, *** p<0.001.

123

4.5 Discussion

In this study, we sought to localize lupus susceptibility loci on NZB c13 and characterize the underlying immune mechanisms that lead to the development of lupus in mice with this interval. We found that the autoimmune disease in these mice arises from at least two susceptibility loci, one of which is associated with impaired clearance of apoptotic cells by PM and TBM.

Although there are a number of reports of gene deletions that lead to reduced uptake of apoptotic debris resulting in lupus-like autoimmunity in mice, there is only one other report of a genetic region in a spontaneously-arising lupus mouse model being associated with this type of defect (73). It is unlikely that this reflects an absence of such genetic loci in these mouse models, since impaired clearance of apoptotic debris has been noted in lupus-prone MRL-lpr, NZB, and NZB/W mice and an abnormal response to the nuclear antigens contained in apoptotic debris is a central feature of both mouse and human lupus (58, 313, 314). Instead, the difficulty in identifying these loci may result from the experimental approach that has been used to localize and characterize lupus susceptibility loci in mice.

In general, these experiments have identified lupus susceptibility loci by mapping the chromosomal regions associated with autoAb production or renal disease, and then creating congenic mice with the mapped regions introgressed onto a non-autoimmune strain (33). There is abundant evidence to suggest that these congenic intervals usually contain multiple susceptibility loci that facilitated their initial detection in mapping studies and led to the development of an autoimmune phenotype in the congenic mouse strain (3, 17). In several of the knockout mouse strains that have impaired clearance of apoptotic debris, such as C1q and DNaseI gene-deleted mice, the ability to promote lupus has been shown to be dependent upon the presence of other susceptibility loci (60, 65, 315). Thus, it is probable that only those

124 susceptibility loci associated with clearance defects in close proximity to other susceptibility loci will be found by this approach. In our study, identification of the region associated with the clearance defect was likely facilitated by the presence of a second susceptibility locus located nearby, as on its own, the region associated with the impaired clearance of apoptotic debris produces only low titer anti-chromatin

Ab. Similarly, the genetic locus linking to impaired clearance that was identified in the BXSB mouse strain was found in a region of chromosome 1 that contained multiple susceptibility loci (73). However, unlike the genetic locus reported in this study, the BXSB locus affects BMM and results in reduced uptake of antigens as well as apoptotic debris.

In c13 mice, PM and TBM, but not BMM demonstrated reduced uptake of apoptotic debris.

Previous work suggests that expression of the receptors involved in the uptake of apoptotic debris differs between BMM and PM (316-318). This differential expression may lead to functional differences between these two populations. Most notably, engulfment of apoptotic cells by PM and TBM is phosphatidylserine (PS)-dependent, whereas uptake by non-activated BMM is not (316, 318). Thus, it is possible that the clearance defect in c13 mice specifically affects the PS-dependent pathway. In this pathway, exposure of PS on the surface of apoptotic cells provides an “eat me” signal that promotes uptake of the cells by macrophages (319). This uptake involves two stages: a first stage in which exposed

PS on apoptotic cells binds to Tim-4 on the macrophage, resulting in adherence, and a second stage where uptake is facilitated by expression of bridging molecules that provide links between the apoptotic cells and receptors on the macrophage. Knockout of Tim-4 or the bridging molecules, C1q or Mfg-e8, are associated with impaired uptake of apoptotic debris by PM and/or TBM, and have been shown to promote development of lupus (59, 60, 68, 69, 320). While defects in either the adherence or engulfment

125 stage of clearance by TBM can lead to increased numbers of apoptotic bodies in the GC, the close association between the increased numbers of apoptotic bodies and TBM observed in our mice suggests that the adherence stage of this process is intact. This phenotype closely mimics that seen in Lxr and

Mfg-e8 knockout mice, whereas in Tim-4-deficient mice, apoptotic bodies were mostly located adjacent to B cells (68, 70, 320). We do not think that the reduced uptake of apoptotic debris by PM and TBM results from prior activation in vivo, as our preliminary data suggest that there are no differences in the expression of MHC class II and B7.1, or the basal levels of cytokine expression, between the resident PM of B6 and c13 mice (data not shown). Nor does this appear to arise as a consequence of the disease in c13 mice, as these changes were seen in young mice prior to production of autoAb and in subcongenic c13 mice that lack autoAb.

Although the clearance defect observed in our mice closely resembles that observed in Mfg-e8 gene-deleted mice, there are several important differences. Mfg-e8 is expressed in inflammatory subsets of macrophages, such as thioglycolate-stimulated PM, and follicular DC (68, 69). Mfg-e8 is not expressed in TBM or resident PM, the cell subsets that demonstrated impaired clearance in c13 mice.

Hematopoietic chimeras showed that the MFG-E8 associated with TBM in vivo is produced by the follicular DC of the recipient mice (68). Examination of hematopoietic chimeras where B6 or c13 bone marrow was transferred into B6 or c13 recipients indicated that transfer of the c13 bone marrow was associated with increased numbers of TBM apoptotic bodies regardless of the recipient (unpublished observations). This suggests that the defect in c13 mice may be intrinsic to TBM.

Notably, developmental endothelial locus-1 (Del-1 or Edil3), a gene that is highly homologous to

Mfg-e8 in structure and function, is located in the 81-94 Mb region containing the clearance defect (317).

126

Evidence suggests that Del-1 is expressed in a reciprocal fashion to Mfg-e8. Although there is limited data on its expression levels in primary macrophages, it has been proposed that Del-1 is predominantly expressed in resident macrophage populations, with the exception of BMM where it is only weakly expressed. This pattern of cell expression is compatible with the cell populations that exhibit impaired clearance in c13 congenic mice, and ongoing experiments are examining this candidate gene in c13 mouse strains.

Another attractive candidate gene in the 81-94 Mb interval is autophagy-related protein 10

(Atg10). This is an E2-like enzyme that helps to catalyze the transfer of Atg12 to Atg5 in the initial stages of autophagosome formation (reviewed in (321)). Recently, a polymorphism in the PRDM1-ATG5 intergenic region has been associated with SLE in a Chinese population (16, 215). Interestingly, embryos from Atg5 knockout mice have increased amounts of apoptotic debris in their tissues (322). Further experiments revealed that this increase resulted from impaired generation of “eat me” and “come and get me” signals by apoptotic cells. It is possible that Atg10 may function similarly to Atg5, affecting apoptotic cells in the GC leading to impaired uptake by TBM. However, it is unclear how this could lead to impaired clearance of B6 apoptotic cells by c13 PM, unless defective autophagy indirectly affects PM clearance function.

Although the 81-94 Mb interval appears to be sufficient to produce a number of the cellular abnormalities in c13 congenic mice, development of high titer autoAb production and splenomegaly requires the presence of the centromeric region a-b, suggesting the presence of another lupus susceptibility locus. Previously, we showed that full-length c13 mice have an intrinsic B cell defect, resulting in enhanced survival and proliferation in response to the TLR3 ligand, dsRNA analogue

127 poly(I:C) (52). We hypothesized that this defect leads to the activation nuclear antigen-reactive B cells in these mice, promoting their differentiation to autoAb- producing cells. This defect also contributed to the abnormal cellular activation and DC expansion observed in these mice, since replacement of the B cell repertoire in c13 with an anti-hen egg white lysozyme Ig transgene resulted in significant attenuation of these phenotypes. Nevertheless, c13 Ig transgenic mice still demonstrated increases in cellular activation suggesting that another abnormality contributes to these phenotypes. Our preliminary experiments suggest that the intrinsic B cell signalling abnormality in c13 mice is not localized to region c, and is likely located in the centromeric region of the c13 interval (unpublished observations). Thus, the immune mechanism leading to the residual activation in c13 Ig transgenic mice may be the impaired clearance of apoptotic debris, as the phenotype of these mice is similar to that seen for subcongenic mice with the c13 region c, but lacking the c13 region a-b.

A genetic locus leading to increased serum levels of endogenous retrovirus envelope protein gp70 in NZB or NZW mice, Sgp3 (serum gp70 production 3), has also been mapped to chromosome 13 (50).

This locus has been localized to the 64.5-70 Mb interval (323), which is located in the region in c13 interval that is associated with B cell TLR3 hyper-responsiveness but outside the region associated with apoptotic debris clearance. It is unlikely that endogenous retrovirus is the source of dsRNA for stimulating the c13 B cells, since Sgp3 controls the expression of gp70 from a modified polytropic ssRNA provirus (55).

In summary, we have identified a novel lupus susceptibility locus on NZB chromosome 13 that impairs clearance of apoptotic debris. As stretches of dsRNA are found in mammalian apoptotic debris, it is likely that this clearance defect interacts directly with this B cell defect located within the c13 to

128 augment the autoimmune phenotype, by providing a source of endogenous TLR3 ligands. Identification of candidate genes contributing to these abnormalities will provide new understanding of the complex genetic interactions leading to the development of lupus.

129

Chapter 5

Discussion and future directions

The focus of this thesis was to dissect the immune mechanisms and genetic susceptibility loci that lead to

SLE using lupus-prone NZB mice. This thesis contributes to the overall working knowledge in understanding the disease (as described in Chapter 1) and the current proposed model of the pathogenesis of lupus (summarized in Fig. 5.1).

The proposed initiating step (1) is the failure to efficiently clear endogenous nuclear antigens released by apoptotic or necrotic cell debris. In support of this concept, studies performed in Chapter 4 have identified a novel lupus susceptibility locus on NZB chromosome 13 in the 81-94 Mb interval that leads to impaired clearance of apoptotic debris by peritoneal and tingible-body macrophages. As an extension to this mapping result, congenic mice containing only this 81-94 Mb interval on NZB chromosome 13 can be generated using a targeted breeding approach and can be tested for the clearance defect. Although the precise genes contributing to this defect have not yet been fully identified in this thesis, ongoing candidate gene studies in the 81-94Mb region are currently underway (Fig. 5.2).

Developmental endothelial locus-1 (Del-1; Edil3) is located at 89Mb on chromosome 13, and is highly homologous in structure and function to Mfg-e8, a gene linked to impaired clearance of apoptotic debris (317). Del-1 is expressed in endothelial cells and macrophages from the fetal liver, fetal thymus, and bone marrow (317, 324). Besides the potential role of Del-1 in the clearance of apoptotic debris by macrophages, it also plays an important role in the removal of platelet microparticles by endothelial cells

130

Figure 5.1. Current proposed model of factors driving SLE autoimmunity The process is initiated when (1) apoptotic or necrotic debris fails to be cleared efficiently. Through (2) BCR and TLR stimulation, this activates autoreactive B cells. (3) With the help of T cells through CD40- CD40L costimulatory signals, autoreactive B cells can differentiate into Ab-producing plasma cells. This leads to the production of class-switched IgG autoAb that can complex with nuclear Ag and complement factors. IgG IC can trigger downstream events one of which is to (4) stimulate pDC to secrete IFN-α mediated by FcγR and TLR signaling. IFN-α (5) has pleiotropic effects on various cells types that exacerbate disease. IgG IC can also activate monocytes or immature DCs to differentiate into conventional DC. CD40-CD40L interaction between T and DC can promote more cognate T cells to become activated. In addition, IgG IC activate the (6) production of BAFF by follicular DCs, a B cell survival factor that maintains the survival of autoreactive B cells and plasma cells. This results in the amplification of a pathogenic loop, sustaining SLE autoimmunity.

131

Figure 5.2. Genetic map of chromosome 13 subcongenic mouse strains generated to date and candidate genes. The subcongenic lines generated from the original B6.NZBc13(47-120 Mb) congenic mouse strain, denoted here as c13, are shown. Candidate genes are denoted above the scale. For simplicity, the full length c13 interval has been divided into regions (a’-e) based upon the overlap between the different subcongenic mouse strains and the subcongenic strains have been renamed based upon the regions that they contain. Subcongenic strains c13a’ and c13b-c have been generated, but not yet fully characterized. Thick and thin black lines denote NZB and B6 regions, respectively. Polymorphic microsatellite markers used to discriminate between the B6 and NZB genome in subcongenic mice were spaced on average 4 Mb apart throughout c13 interval, and the markers used to determine the start and end markers of region are shown at the bottom of the figure. The Mb positions of the markers and genes were determined based on Ensembl release 67 and are rounded up or down to the nearest Mb.

132

(325), LFA-1-dependent leukocyte endothelial adhesion and recruitment (326), and inhibition of IL-17- mediated inflammation causing neutrophil accumulation and bone loss (327). Investigation of Del-1 gene expression and/or sequencing of this gene in various macrophage subsets will help in identifying whether

Del-1 may play a role in the clearance defect of B6.NZBc13 mice.

Autophagy-related 10 (Atg10) is another notable candidate gene in this interval located at 91Mb

(Fig. 5.2). Recently, increasing number of studies have implicated the involvement of autophagy in the pathogenesis of autoimmunity such as SLE and Crohn’s disease (reviewed in (321)). Autophagy is a lysosomal degradation process that breaks down portions of the cell to recycle nutrients and remove any unnecessary components. This process was initially found to respond to extracellular and intracellular stresses such as nutrient deprivation, hypoxia, and infection, but it is now known that autophagy is involved in various aspects of the immune response, especially in its ability to remove damaged cellular proteins to protect from disease (reviewed in (328)). Atg10 is an E2-like enzyme involved in catalyzing the transfer of Atg12 to Atg5 in the initial formation of autophagsome. In particular, it was found that

Atg5-deficient embryos from mice showed accumulation of apoptotic cells due to impairment of engulfment signals (322). Interestingly, Atg5 appears to also play a role in T and B cell function. CD4+ and CD8+ T cells from Atg5-knockout mice cells failed to proliferate upon CD3 stimulation (329), and

Atg5-deficient B cells demonstrated significant reduction in the proportion of B1a cells in the peritoneum and decreased survival of pre-B cells (330). In SLE, a polymorphism in the PRDM1-ATG5 intergenic region has been recently identified in a Chinese population (16, 215). Although it is currently not clear whether Atg10 has similar functions to Atg5 in promoting inefficient clearance of apoptotic debris or mediating abnormal lymphocyte function, measuring gene expression and sequencing Atg10 in

133 various cell types using subcongenic mice containing this lupus susceptibility interval in region c (Fig.

5.2) will provide insight in understanding its potential functional role.

In the proposed next step of lupus pathogenesis (step 2 in Fig. 5.1), B cells that recognize nuclear antigens through their BCR internalize nuclear Ag leading to intracellular TLR signaling, mainly through

TLR7 and TLR9 (reviewed in (76)). Interestingly, in B6.NZBc13 full-length congenic mice, our laboratory has previously shown that these mice have an intrinsic B cell defect with increased survival and proliferation to the poly(I:C) TLR3 ligand (52). This defect is associated with the activation of nuclear Ag-reactive B cells and promoted their differentiation to autoAb-producing plasma cells. Our preliminary results using B6.NZBc13 subcongenic mice have localized this B cell hyperresponsiveness defect to the centromeric region of NZB c13 interval, and not to the 81-94 Mb interval with the clearance defect (unpublished observations). Consistent with this idea, Sgp3, serum gp70 production 3, has been previously mapped to the 64.5-70Mb interval on chromosome 13 in NZB or NZW mice, resulting in elevated serum levels of endogenous retrovirus envelope protein gp70 (50, 323) (Fig. 5.2). Although it is unlikely that the endogenous retrovirus serves as the natural source of dsRNA in activating autoreactive

B6.NZBc13 B cells since it is a modified polytropic ssRNA provirus (55), it can still indirectly contribute to the abnormal B cell phenotypes seen in this congenic mice. To further address the role of TLR in the development of autoimmunity in B6.NZBc13 mice, our laboratory has been generating TLR3- and

MyD88-knockout mice in the B6.NZBc13 genetic background where B cells, macrophages, and DC will be characterized to study their impact in disease pathogensis. The generation of new subcongenic mice carrying only region a (Fig. 5.2) may also provide a better tool to understand the role of Sgp3 in disease development.

134

Chapter 2 focused on understanding the role of CD40-CD40L interaction and the downstream mediated effects in NZB mice (step 3 in Fig. 5.1). BCR/TCR signalling either alone or in tandem with

CD40-CD40L costimulatory signals from T cells, induce autoreactive B cells to proliferate and differentiate into Ab-producing plasma cells, secreting class-switched pathogenic IgG autoAbs (reviewed in (161)). In the absence of CD40L, IgG autoAb production as well as kidney disease was abrogated in

NZB mice. Although TLR signals have the ability to induce class-switching in vitro, TLR signals alone in vivo are insufficient to induce pathogenic class-switched autoAb production in NZB mice. In addition,

CD40-CD40L interactions between T and DC can promote more cognate T cells to become activated.

Indeed, the expansion of total, memory effector (CD62LloCD44hi), and recently activated (CD69+) CD4+

T cells seen in wildtype NZB mice was significantly reduced in NZB.CD40L-/- mice, suggesting the critical role of CD40L in altered T cell activation phenotype. Although IgG autoAb was abrogated in these mice, elevated levels of IgM autoAb and IgM Ab-forming cells were maintained in the absence of CD40L in

NZB mice, similar to findings observed in NZB/W mice (285). Our experiments did not fully explore the requirements for the generation of IgM-secreting plasmablasts besides CD40L and GC; however the results suggest that other factors are involved in this process. It is possible that the differentiation of IgM- secreting plasma cells in NZB mice can occur in extra-follicular sites mediated by ICOS and/or can be promoted by increased levels of BAFF seen in these mice (287, 288). To investigate this further, B7RP-1 blockade and TACI-Ig can be used to block these interactions in vivo in NZB.CD40L-/- mice to see if IgM autoAb levels and polyclonal B cell activation are still maintained.

In the current working model of SLE pathogenesis, IgG autoAb complexed with Ag can trigger multiple downstream events including IC deposition in the kidney causing inflammation and damage.

135

One of the key steps in exacerbating this process is the activation of pDC through FcγR and TLR signalling by IgG IC, leading to the production of IFN-α (step 4). Due to the lack of IgG autoAb and IC in

NZB.CD40L-/- mice, we have used this mouse as a model to investigate the role of IgG IC in the development of autoimmunity. We found that the expansion of pDC in the Bm of NZB mice is not solely dependent on IgG IC-mediated TLR activation as the proportion of pDC was unaffected in NZB.CD40L-

/- mice. However, activation of pDC measured by MHCII was dependent on the presence of CD40L.

Although the proportion of mDC and pDC was not significantly expanded in NZB, both of these populations were increased in the spleens of the B6.NZBc1c13 bicongenic mice. The precise mechanism causing this phenotype was not fully explored. Previously, it was found that increased TLR signalling can contribute to expansion of DC subsets, as seen in TLR7 transgenic (86), Tir8 knockout (96), and MerKd mice (302). It is possible that in the bicongenic mice, enhanced activation of cells can promote DC subsets to move into the spleen directly, and/or secrete pro-inflammatory factors to indirectly recruit cells into the spleen and increase survival (303-307). Given that there are increased levels of pro- inflammatory cytokines such as TNF-α and BAFF in the bicongenic mice, and that the B6.NZBc13 mice may provide a source of nuclear antigens due to the clearance defect (294), these two phenotypes may work in concert to augment the DC expansion. The role of TLR signaling in this process could be futher explored by generating MyD88 knockout mice or by blocking TLR signaling with an antagonistic mimic.

IFN-α production by pDC (step 5) has been repeatedly implicated as a key mediator in lupus autoimmunity (reviewed in (74, 331)), and it has been previously demonstrated that IFNAR-1-deficient mice in the NZB background showed abrogation of disease (111). IFN-α can stimulate autoreactive B cells to secrete more autoAb, promotes DC and pDC activation, augments T cell polarization into Th1

136 effector cells, and indirectly causes cell death due to inflammatory cells and cytotoxic effector cells

(reviewed in (32, 75, 76, 98, 271)).

We found a dichotomy between the expanded splenic pDC population and the low levels of IFN-

α and IFN-α -induced genes in the B6.NZBc1c13 bicongenic mice (Chapter 3). We reported that pDC from older bicongenic mice are refractory to chronic TLR activation. Despite the low secretion of IFN-α, pDC from older bicongenic mice still showed signs of previous stimulation in vivo with elevated MHCII expression in both immature and mature populations, as compared to B6 mice. Although the levels of

B7.2 expression on the pDC of older bicongenic mice were similar to those seen in B6 mice (Fig. 3.11), it is likely that this reflects differences in the induction of B7.2 between bicongenic and B6 mice following

TLR signaling. We further demonstrated that upon repeated TLR stimulation of pDC in vitro they become refractory to activation, resulting in reduced production of IFN-α. We therefore suggest that persistence of nuclear antigen containing immune complexes in the bicongenic environment, as a result of the impaired clearance of apoptotic debris in B6.NZBc13 mice that was demonstrated in Chapter 4, leads to the reduced IFN-α production. This phenomenom, which is termed TLR tolerance, is also seen in SLE patients (132), in viral infections (133, 332), and more recently in Wiskott-Aldrich syndrome, an

X-linked immunodeficiency disorder with autoimmune phenotypes (333).

The observation that chronic production of nuclear antigen containing immune complexes leads to pDC that are impaired in their IFN-α production raises important questions about the mechanisms leading to the high levels of IFN-α in lupus patients, where many patients have chronically elevated levels of nuclear Ag containing IC. One possibility is that only immature pDC produce IFN-α and that the bulk of the IFN-α production therefore occurs in the bone marrow where these cells are first generated.

137

Consistent with this possibility, we found that there was increased IFN-α -induced gene signature in the bone marrow of bicongenic and NZB mice. Increased IFN-signatures have also been observed in the bone marrow of human lupus patients and have been proposed to lead to altered bone marrow development of B cells (291, 334). Another possibility is that additional signals present in pro- inflammatory environments, such as the kidney and skin, bypass TLR tolerance leading to activation of pDC even when they are chronically stimulated. In lupus patients, increased levels of IFN-α are seen in skin pDC (107). One of the proinflammatory factors driving this production of IFN-α in SLE could be neutrophil extracellular traps (NETs), which can stimulate TLR9 in pDC (335). Lupus patients have increased levels of low density neutrophils which are more sensitive to NETosis, a novel form of neutrophil cell death that releases of a meshwork of chromatin fibers with antimicrobial proteins

(reviewed in (336)). NETosis leads to exposure of a number of proteins including LL37, a proteolytic product of human cationic antimicrobial peptide, that can promote IFN-α production by pDCs. It is currently unknown whether this can bypass TLR tolerance. Alternatively, genetic polymorphisms that impact on TLR function, might lead to a relatively impaired TLR tolerance in a subset of lupus patients.

Ultimately, identification of precise mechanisms regulating IFN-α production by pDC may assist in developing new drug targets and better defining biomarkers for active SLE.

On the other arm of this pathogenic autoimmunity loop, IgG IC can induce monocytes or immature DCs to differentiate into conventional DC and stimulate production of BAFF by DC, maintaining the survival of autoreactive B cells and plasma cells (step 6) ((102, 201, 279), reviewed in

(193, 194, 271)). Using the NZB.CD40L-/- mice as an animal model in the absence of IgG autoAb, we found that BAFF was indeed elevated in wildtype NZB mice, but this increase was independent of IgG IC

138 as NZB.CD40L-/- mice showed equivalently high levels of baff expression in the spleen. Future work in this pathway could focus on understanding the precise mechanism(s) mediating CD40L and/or IgG IC- independent production of BAFF in NZB mice. Elevated levels of BAFF were also seen in the

B6.NZBc1c13 bicongenic mice, which was not previously observed in the parental c1 or c13 full-length mice. This phenotype also correlates well with increase titer of IgA autoAb, similar to the BAFF- transgenic mice (186, 200). To further explore the mechanisms leading to increased production of BAFF in NZB and bicongenic mice, total splenocytes or various splenic subpopulations from these mice could be isolated and cultured in the presence of TLR ligands and/or apoptotic debris, to determine whether intrinsic functional defects of any of these populations lead to increased production of BAFF.

Alternatively, bicongenic and/or B6 labelled cells could be transferred into bicongenic and their ability to produce BAFF protein can be contrasted using immunofluorescence microscopy or flow cytometry.

The results of these experiments could have important implication for patients with SLE. In the human disease, as in mice, BAFF levels are elevated. Importantly, Benlysta, a fully human anti-BAFF mAb, in 2011 became the first drug to demonstrate efficacy and be approved for the treatement of lupus in the past 50 years. However, not all patients respond equivalently to the medication and thus elucidation of the mechanisms regulating of BAFF production may lead to the identification of new predicative or prognostic biomarkers to better stratify the hetergenous SLE patient population for this treatment.

139

References

1. Kotzin, B. L. 1996. Systemic lupus erythematosus. Cell 85:303-306.

2. Hahn, B. H. 1998. Antibodies to DNA. The New England journal of medicine 338:1359-1368.

3. Wakeland, E. K., K. Liu, R. R. Graham, and T. W. Behrens. 2001. Delineating the genetic basis of systemic lupus erythematosus. Immunity 15:397-408.

4. Tsokos, G. C. 2011. Systemic lupus erythematosus. N Engl J Med 365:2110-2121.

5. D'Cruz, D. P., M. A. Khamashta, and G. R. Hughes. 2007. Systemic lupus erythematosus. Lancet 369:587-596.

6. Hochberg, M. C. 1997. Updating the American College of Rheumatology revised criteria for the classification of systemic lupus erythematosus. Arthritis Rheum. 40:1725.

7. Deapen, D., A. Escalante, L. Weinrib, D. Horwitz, B. Bachman, P. Roy-Burman, A. Walker, and T. M. Mack. 1992. A revised estimate of twin concordance in systemic lupus erythematosus. Arthritis Rheum. 35:311-318.

8. Alarcon-Segovia, D., M. E. Alarcon-Riquelme, M. H. Cardiel, F. Caeiro, L. Massardo, A. R. Villa, B. A. Pons-Estel, and E. Grupo Latinoamericano de Estudio del Lupus. 2005. Familial aggregation of systemic lupus erythematosus, rheumatoid arthritis, and other autoimmune diseases in 1,177 lupus patients from the GLADEL cohort. Arthritis Rheum 52:1138-1147.

9. Harley, I. T., K. M. Kaufman, C. D. Langefeld, J. B. Harley, and J. A. Kelly. 2009. Genetic susceptibility to SLE: new insights from fine mapping and genome-wide association studies. Nat Rev Genet 10:285-290.

10. Sarzi-Puttini, P., F. Atzeni, L. Iaccarino, and A. Doria. 2005. Environment and systemic lupus erythematosus: an overview. Autoimmunity 38:465-472.

11. Klein, R. S., R. M. Sayre, J. C. Dowdy, and V. P. Werth. 2009. The risk of ultraviolet radiation exposure from indoor lamps in lupus erythematosus. Autoimmun Rev 8:320-324.

12. Zandman-Goddard, G., Y. Berkun, O. Barzilai, M. Boaz, M. Blank, M. Ram, Y. Sherer, J. M. Anaya, and Y. Shoenfeld. 2009. Exposure to Epstein-Barr virus infection is associated with mild systemic lupus erythematosus disease. Ann N Y Acad Sci 1173:658-663.

13. Petri, M. 2008. Sex hormones and systemic lupus erythematosus. Lupus 17:412-415.

14. Jonsen, A., A. A. Bengtsson, O. Nived, L. Truedsson, and G. Sturfelt. 2007. Gene-environment interactions in the aetiology of systemic lupus erythematosus. Autoimmunity 40:613-617.

140

15. Cheung, Y. H., C. Loh, E. Pau, J. Kim, and J. Wither. 2009. Insights into the genetic basis and immunopathogenesis of systemic lupus erythematosus from the study of mouse models. Semin.Immunol. 21:372-382.

16. Kono, D. H., and A. N. Theofilopoulos. 2006. Genetics of SLE in mice. Springer seminars in immunopathology 28:83-96.

17. Morel, L. 2010. Genetics of SLE: evidence from mouse models. Nat Rev Rheumatol 6:348-357.

18. Perry, D., A. Sang, Y. Yin, Y. Y. Zheng, and L. Morel. 2011. Murine models of systemic lupus erythematosus. J Biomed Biotechnol 2011:271694.

19. Andrews, B. S., R. A. Eisenberg, A. N. Theofilopoulos, S. Izui, C. B. Wilson, P. J. McConahey, E. D. Murphy, J. B. Roths, and F. J. Dixon. 1978. Spontaneous murine lupus-like syndromes. Clinical and immunopathological manifestations in several strains. J Exp Med. 148:1198-1215.

20. Theofilopoulos, A. N., and F. J. Dixon. 1985. Murine models of systemic lupus erythematosus. Adv.Immunol. 37:269-390.

21. Chiang, B. L., E. Bearer, A. Ansari, K. Dorshkind, and M. E. Gershwin. 1990. The BM12 mutation and autoantibodies to dsDNA in NZB.H-2bm12 mice. J Immunol. 145:94-101.

22. Santiago-Raber, M. L., C. Laporte, L. Reininger, and S. Izui. 2004. Genetic basis of murine lupus. Autoimmun.Rev. 3:33-39.

23. Morel, L., and E. K. Wakeland. 2000. Lessons from the NZM2410 model and related strains. Int.Rev.Immunol. 19:423-446.

24. Waters, S. T., S. M. Fu, F. Gaskin, U. S. Deshmukh, S. S. Sung, C. C. Kannapell, K. S. Tung, S. B. McEwen, and M. McDuffie. 2001. NZM2328: a new mouse model of systemic lupus erythematosus with unique genetic susceptibility loci. Clin Immunol. 100:372-383.

25. Waters, S. T., M. McDuffie, H. Bagavant, U. S. Deshmukh, F. Gaskin, C. Jiang, K. S. Tung, and S. M. Fu. 2004. Breaking tolerance to double stranded DNA, nucleosome, and other nuclear antigens is not required for the pathogenesis of lupus glomerulonephritis. J Exp Med. 199:255- 264.

26. Cohen, P. L., and R. A. Eisenberg. 1991. Lpr and gld: single gene models of systemic autoimmunity and lymphoproliferative disease. Annu.Rev.Immunol. 9:243-269.

27. Rieux-Laucat, F., D. F. Le, C. Hivroz, I. A. Roberts, K. M. Debatin, A. Fischer, and J. P. de Villartay. 1995. Mutations in Fas associated with human lymphoproliferative syndrome and autoimmunity. Science 268:1347-1349.

141

28. Fisher, G. H., F. J. Rosenberg, S. E. Straus, J. K. Dale, L. A. Middleton, A. Y. Lin, W. Strober, M. J. Lenardo, and J. M. Puck. 1995. Dominant interfering Fas gene mutations impair apoptosis in a human autoimmune lymphoproliferative syndrome. Cell 81:935-946.

29. Wu, J., J. Wilson, J. He, L. Xiang, P. H. Schur, and J. D. Mountz. 1996. Fas ligand mutation in a patient with systemic lupus erythematosus and lymphoproliferative disease. J Clin Invest 98:1107-1113.

30. Worth, A., A. J. Thrasher, and H. B. Gaspar. 2006. Autoimmune lymphoproliferative syndrome: molecular basis of disease and clinical phenotype. Br.J Haematol. 133:124-140.

31. Pisitkun, P., J. A. Deane, M. J. Difilippantonio, T. Tarasenko, A. B. Satterthwaite, and S. Bolland. 2006. Autoreactive B cell responses to RNA-related antigens due to TLR7 gene duplication. Science 312:1669-1672.

32. Christensen, S. R., and M. J. Shlomchik. 2007. Regulation of lupus-related autoantibody production and clinical disease by Toll-like receptors. Seminars in immunology 19:11-23.

33. Wakeland, E., L. Morel, K. Achey, M. Yui, and J. Longmate. 1997. Speed congenics: a classic technique in the fast lane (relatively speaking). Immunology today 18:472-477.

34. Vyse, T. J., S. J. Rozzo, C. G. Drake, S. Izui, and B. L. Kotzin. 1997. Control of multiple autoantibodies linked with a lupus nephritis susceptibility locus in New Zealand black mice. J Immunol. 158:5566-5574.

35. Wither, J. E., A. D. Paterson, and B. Vukusic. 2000. Genetic dissection of B cell traits in New Zealand black mice. The expanded population of B cells expressing up-regulated costimulatory molecules shows linkage to Nba2. Eur J Immunol. 30:356-365.

36. Wither, J. E., G. Lajoie, S. Heinrichs, Y. C. Cai, N. Chang, A. Ciofani, Y. H. Cheung, and R. MacLeod. 2003. Functional dissection of lupus susceptibility loci on the New Zealand black mouse chromosome 1: evidence for independent genetic loci affecting T and B cell activation. J Immunol. 171:1697-1706.

37. Cheung, Y. H., N. H. Chang, Y. C. Cai, G. Bonventi, R. MacLeod, and J. E. Wither. 2005. Functional interplay between intrinsic B and T cell defects leads to amplification of autoimmune disease in New Zealand black chromosome 1 congenic mice. J Immunol. 175:8154-8164.

38. Cheung, Y. H., C. Landolt-Marticorena, G. Lajoie, and J. E. Wither. 2011. The lupus phenotype in B6.NZBc1 congenic mice reflects interactions between multiple susceptibility loci and a suppressor locus. Genes Immun 12:251-262.

39. Mohan, C., E. Alas, L. Morel, P. Yang, and E. K. Wakeland. 1998. Genetic dissection of SLE pathogenesis. Sle1 on murine chromosome 1 leads to a selective loss of tolerance to H2A/H2B/DNA subnucleosomes. J Clin Invest 101:1362-1372.

142

40. Morel, L., K. R. Blenman, B. P. Croker, and E. K. Wakeland. 2001. The major murine systemic lupus erythematosus susceptibility locus, Sle1, is a cluster of functionally related genes. Proc.Natl.Acad.Sci.U.S.A 98:1787-1792.

41. Boackle, S. A., V. M. Holers, X. Chen, G. Szakonyi, D. R. Karp, E. K. Wakeland, and L. Morel. 2001. Cr2, a candidate gene in the murine Sle1c lupus susceptibility locus, encodes a dysfunctional protein. Immunity. 15:775-785.

42. Chen, Y., C. Cuda, and L. Morel. 2005. Genetic determination of T cell help in loss of tolerance to nuclear antigens. J Immunol. 174:7692-7702.

43. Chen, Y., D. Perry, S. A. Boackle, E. S. Sobel, H. Molina, B. P. Croker, and L. Morel. 2005. Several genes contribute to the production of autoreactive B and T cells in the murine lupus susceptibility locus Sle1c. J Immunol. 175:1080-1089.

44. Cuda, C. M., S. Wan, E. S. Sobel, B. P. Croker, and L. Morel. 2007. Murine lupus susceptibility locus Sle1a controls regulatory T cell number and function through multiple mechanisms. J Immunol. 179:7439-7447.

45. Rahman, Z. S., H. Niu, D. Perry, E. Wakeland, T. Manser, and L. Morel. 2007. Expression of the autoimmune Fcgr2b NZW allele fails to be upregulated in germinal center B cells and is associated with increased IgG production. Genes Immun. 8:604-612.

46. Cuda, C. M., L. Zeumer, E. S. Sobel, B. P. Croker, and L. Morel. 2010. Murine lupus susceptibility locus Sle1a requires the expression of two sub-loci to induce inflammatory T cells. Genes Immun.

47. Hogarth, M. B., J. H. Slingsby, P. J. Allen, E. M. Thompson, P. Chandler, K. A. Davies, E. Simpson, B. J. Morley, and M. J. Walport. 1998. Multiple lupus susceptibility loci map to chromosome 1 in BXSB mice. J Immunol. 161:2753-2761.

48. Haywood, M. E., N. J. Rogers, S. J. Rose, J. Boyle, A. McDermott, J. M. Rankin, V. Thiruudaian, M. R. Lewis, L. Fossati-Jimack, S. Izui, M. J. Walport, and B. J. Morley. 2004. Dissection of BXSB lupus phenotype using mice congenic for chromosome 1 demonstrates that separate intervals direct different aspects of disease. J Immunol. 173:4277-4285.

49. Wither, J. E., C. Loh, G. Lajoie, S. Heinrichs, Y. C. Cai, G. Bonventi, and R. MacLeod. 2005. Colocalization of expansion of the splenic marginal zone population with abnormal B cell activation and autoantibody production in B6 mice with an introgressed New Zealand Black chromosome 13 interval. J Immunol 175:4309-4319.

50. Laporte, C., B. Ballester, C. Mary, S. Izui, and L. Reininger. 2003. The Sgp3 locus on mouse chromosome 13 regulates nephritogenic gp70 autoantigen expression and predisposes to autoimmunity. J Immunol. 171:3872-3877.

143

51. Rankin, J., J. J. Boyle, S. J. Rose, L. Gabriel, M. Lewis, V. Thiruudaian, N. J. Rogers, S. Izui, and B. J. Morley. 2007. The Bxs6 locus of BXSB mice is sufficient for high-level expression of gp70 and the production of gp70 immune complexes. J Immunol. 178:4395-4401.

52. Loh, C., E. Pau, N. H. Chang, and J. E. Wither. 2011. An intrinsic B-cell defect supports autoimmunity in New Zealand black chromosome 13 congenic mice. Eur J Immunol 41:527-536.

53. Baudino, L., K. Yoshinobu, N. Morito, M. L. Santiago-Raber, and S. Izui. 2010. Role of endogenous retroviruses in murine SLE. Autoimmun Rev 10:27-34.

54. Izui, S., P. J. McConahey, A. N. Theofilopoulos, and F. J. Dixon. 1979. Association of circulating retroviral gp70-anti-gp70 immune complexes with murine systemic lupus erythematosus. J Exp Med. 149:1099-1116.

55. Yoshinobu, K., L. Baudino, M. L. Santiago-Raber, N. Morito, I. Dunand-Sauthier, B. J. Morley, L. H. Evans, and S. Izui. 2009. Selective up-regulation of intact, but not defective env RNAs of endogenous modified polytropic retrovirus by the Sgp3 locus of lupus-prone mice. J Immunol. 182:8094-8103.

56. Fadok, V. A., D. L. Bratton, A. Konowal, P. W. Freed, J. Y. Westcott, and P. M. Henson. 1998. Macrophages that have ingested apoptotic cells in vitro inhibit proinflammatory cytokine production through autocrine/paracrine mechanisms involving TGF-beta, PGE2, and PAF. J Clin Invest 101:890-898.

57. Voll, R. E., M. Herrmann, E. A. Roth, C. Stach, J. R. Kalden, and I. Girkontaite. 1997. Immunosuppressive effects of apoptotic cells. Nature 390:350-351.

58. Munoz, L. E., K. Lauber, M. Schiller, A. A. Manfredi, and M. Herrmann. 2010. The role of defective clearance of apoptotic cells in systemic autoimmunity. Nat Rev Rheumatol 6:280-289.

59. Botto, M., C. Dell'Agnola, A. E. Bygrave, E. M. Thompson, H. T. Cook, F. Petry, M. Loos, P. P. Pandolfi, and M. J. Walport. 1998. Homozygous C1q deficiency causes glomerulonephritis associated with multiple apoptotic bodies. Nature genetics 19:56-59.

60. Taylor, P. R., A. Carugati, V. A. Fadok, H. T. Cook, M. Andrews, M. C. Carroll, J. S. Savill, P. M. Henson, M. Botto, and M. J. Walport. 2000. A hierarchical role for classical pathway complement proteins in the clearance of apoptotic cells in vivo. J Exp Med. 192:359-366.

61. Cohen, P. L., R. Caricchio, V. Abraham, T. D. Camenisch, J. C. Jennette, R. A. Roubey, H. S. Earp, G. Matsushima, and E. A. Reap. 2002. Delayed apoptotic cell clearance and lupus-like autoimmunity in mice lacking the c-mer membrane tyrosine kinase. J Exp Med. 196:135-140.

62. Miura-Shimura, Y., K. Nakamura, M. Ohtsuji, H. Tomita, Y. Jiang, M. Abe, D. Zhang, Y. Hamano, H. Tsuda, H. Hashimoto, H. Nishimura, S. Taki, T. Shirai, and S. Hirose. 2002. C1q

144

regulatory region polymorphism down-regulating murine c1q protein levels with linkage to lupus nephritis. J Immunol. 169:1334-1339.

63. Gaipl, U. S., T. D. Beyer, I. Baumann, R. E. Voll, C. M. Stach, P. Heyder, J. R. Kalden, A. Manfredi, and M. Herrmann. 2003. Exposure of anionic phospholipids serves as anti- inflammatory and immunosuppressive signal--implications for antiphospholipid syndrome and systemic lupus erythematosus. Immunobiology 207:73-81.

64. Munoz, L. E., C. Janko, G. E. Grossmayer, B. Frey, R. E. Voll, P. Kern, J. R. Kalden, G. Schett, R. Fietkau, M. Herrmann, and U. S. Gaipl. 2009. Remnants of secondarily necrotic cells fuel inflammation in systemic lupus erythematosus. Arthritis Rheum. 60:1733-1742.

65. Napirei, M., H. Karsunky, B. Zevnik, H. Stephan, H. G. Mannherz, and T. Moroy. 2000. Features of systemic lupus erythematosus in Dnase1-deficient mice. Nat.Genet. 25:177-181.

66. Bickerstaff, M. C., M. Botto, W. L. Hutchinson, J. Herbert, G. A. Tennent, A. Bybee, D. A. Mitchell, H. T. Cook, P. J. Butler, M. J. Walport, and M. B. Pepys. 1999. Serum amyloid P component controls chromatin degradation and prevents antinuclear autoimmunity. Nat.Med. 5:694-697.

67. Hanayama, R., M. Tanaka, K. Miwa, A. Shinohara, A. Iwamatsu, and S. Nagata. 2002. Identification of a factor that links apoptotic cells to phagocytes. Nature 417:182-187.

68. Kranich, J., N. J. Krautler, E. Heinen, M. Polymenidou, C. Bridel, A. Schildknecht, C. Huber, M. H. Kosco-Vilbois, R. Zinkernagel, G. Miele, and A. Aguzzi. 2008. Follicular dendritic cells control engulfment of apoptotic bodies by secreting Mfge8. J Exp Med. 205:1293-1302.

69. Hanayama, R., M. Tanaka, K. Miyasaka, K. Aozasa, M. Koike, Y. Uchiyama, and S. Nagata. 2004. Autoimmune disease and impaired uptake of apoptotic cells in MFG-E8-deficient mice. Science 304:1147-1150.

70. A-Gonzalez, N., S. J. Bensinger, C. Hong, S. Beceiro, M. N. Bradley, N. Zelcer, J. Deniz, C. Ramirez, M. Diaz, G. Gallardo, C. R. de Galarreta, J. Salazar, F. Lopez, P. Edwards, J. Parks, M. Andujar, P. Tontonoz, and A. Castrillo. 2009. Apoptotic cells promote their own clearance and immune tolerance through activation of the nuclear receptor LXR. Immunity 31:245-258.

71. Mukundan, L., J. I. Odegaard, C. R. Morel, J. E. Heredia, J. W. Mwangi, R. R. Ricardo-Gonzalez, Y. P. Goh, A. R. Eagle, S. E. Dunn, J. U. Awakuni, K. D. Nguyen, L. Steinman, S. A. Michie, and A. Chawla. 2009. PPAR-delta senses and orchestrates clearance of apoptotic cells to promote tolerance. Nat Med 15:1266-1272.

72. Xue, D., H. Shi, J. D. Smith, X. Chen, D. A. Noe, T. Cedervall, D. D. Yang, E. Eynon, D. E. Brash, M. Kashgarian, R. A. Flavell, and S. L. Wolin. 2003. A lupus-like syndrome develops in mice lacking the Ro 60-kDa protein, a major lupus autoantigen. Proc.Natl.Acad.Sci.U.S.A 100:7503- 7508.

145

73. Rogers, N. J., M. J. Lees, L. Gabriel, E. Maniati, S. J. Rose, P. K. Potter, and B. J. Morley. 2009. A defect in Marco expression contributes to systemic lupus erythematosus development via failure to clear apoptotic cells. J Immunol 182:1982-1990.

74. Marshak-Rothstein, A. 2006. Toll-like receptors in systemic autoimmune disease. Nature reviews.Immunology 6:823-835.

75. Baccala, R., K. Hoebe, D. H. Kono, B. Beutler, and A. N. Theofilopoulos. 2007. TLR-dependent and TLR-independent pathways of type I interferon induction in systemic autoimmunity. Nature medicine 13:543-551.

76. Green, N. M., and A. Marshak-Rothstein. 2011. Toll-like receptor driven B cell activation in the induction of systemic autoimmunity. Semin Immunol 23:106-112.

77. Barrat, F. J., T. Meeker, J. H. Chan, C. Guiducci, and R. L. Coffman. 2007. Treatment of lupus- prone mice with a dual inhibitor of TLR7 and TLR9 leads to reduction of autoantibody production and amelioration of disease symptoms. Eur J Immunol 37:3582-3586.

78. Kono, D. H., M. K. Haraldsson, B. R. Lawson, K. M. Pollard, Y. T. Koh, X. Du, C. N. Arnold, R. Baccala, G. J. Silverman, B. A. Beutler, and A. N. Theofilopoulos. 2009. Endosomal TLR signaling is required for anti-nucleic acid and rheumatoid factor autoantibodies in lupus. Proc Natl Acad Sci U S A 106:12061-12066.

79. Shlomchik, M. J. 2009. Activating systemic autoimmunity: B's, T's, and tolls. Curr Opin Immunol 21:626-633.

80. Rifkin, I. R., E. A. Leadbetter, B. C. Beaudette, C. Kiani, M. Monestier, M. J. Shlomchik, and A. Marshak-Rothstein. 2000. Immune complexes present in the sera of autoimmune mice activate rheumatoid factor B cells. J Immunol 165:1626-1633.

81. Leadbetter, E. A., I. R. Rifkin, A. M. Hohlbaum, B. C. Beaudette, M. J. Shlomchik, and A. Marshak-Rothstein. 2002. Chromatin-IgG complexes activate B cells by dual engagement of IgM and Toll-like receptors. Nature 416:603-607.

82. Christensen, S. R., J. Shupe, K. Nickerson, M. Kashgarian, R. A. Flavell, and M. J. Shlomchik. 2006. Toll-like receptor 7 and TLR9 dictate autoantibody specificity and have opposing inflammatory and regulatory roles in a murine model of lupus. Immunity. 25:417-428.

83. Reeves, W. H., P. Y. Lee, J. S. Weinstein, M. Satoh, and L. Lu. 2009. Induction of autoimmunity by pristane and other naturally occurring hydrocarbons. Trends Immunol 30:455-464.

84. Savarese, E., C. Steinberg, R. D. Pawar, W. Reindl, S. Akira, H. J. Anders, and A. Krug. 2008. Requirement of Toll-like receptor 7 for pristane-induced production of autoantibodies and development of murine lupus nephritis. Arthritis Rheum 58:1107-1115.

146

85. Subramanian, S., K. Tus, Q. Z. Li, A. Wang, X. H. Tian, J. Zhou, C. Liang, G. Bartov, L. D. McDaniel, X. J. Zhou, R. A. Schultz, and E. K. Wakeland. 2006. A Tlr7 translocation accelerates systemic autoimmunity in murine lupus. Proceedings of the National Academy of Sciences of the United States of America 103:9970-9975.

86. Deane, J. A., P. Pisitkun, R. S. Barrett, L. Feigenbaum, T. Town, J. M. Ward, R. A. Flavell, and S. Bolland. 2007. Control of toll-like receptor 7 expression is essential to restrict autoimmunity and dendritic cell proliferation. Immunity 27:801-810.

87. Bolland, S., Y. S. Yim, K. Tus, E. K. Wakeland, and J. V. Ravetch. 2002. Genetic modifiers of systemic lupus erythematosus in FcgammaRIIB(-/-) mice. J Exp Med. 195:1167-1174.

88. Demaria, O., P. P. Pagni, S. Traub, A. de Gassart, N. Branzk, A. J. Murphy, D. M. Valenzuela, G. D. Yancopoulos, R. A. Flavell, and L. Alexopoulou. 2010. TLR8 deficiency leads to autoimmunity in mice. J Clin Invest 120:3651-3662.

89. Lartigue, A., P. Courville, I. Auquit, A. Francois, C. Arnoult, F. Tron, D. Gilbert, and P. Musette. 2006. Role of TLR9 in anti-nucleosome and anti-DNA antibody production in lpr mutation- induced murine lupus. J Immunol 177:1349-1354.

90. Santiago-Raber, M. L., I. Dunand-Sauthier, T. Wu, Q. Z. Li, S. Uematsu, S. Akira, W. Reith, C. Mohan, B. L. Kotzin, and S. Izui. 2010. Critical role of TLR7 in the acceleration of systemic lupus erythematosus in TLR9-deficient mice. J Autoimmun 34:339-348.

91. Losman, M. J., T. M. Fasy, K. E. Novick, and M. Monestier. 1992. Monoclonal autoantibodies to subnucleosomes from a MRL/Mp(-)+/+ mouse. Oligoclonality of the antibody response and recognition of a determinant composed of histones H2A, H2B, and DNA. J Immunol 148:1561- 1569.

92. Gururajan, M., J. Jacob, and B. Pulendran. 2007. Toll-like receptor expression and responsiveness of distinct murine splenic and mucosal B-cell subsets. PLoS One 2:e863.

93. Reeves, J. P., J. D. Taurog, and A. D. Steinberg. 1981. Polyclonal B-cell activation of autoantibodies (CBA/N x NZB)F1 mice by polyinosinic polycytidylic acid. Clin Immunol Immunopathol 19:170-180.

94. Christensen, S. R., M. Kashgarian, L. Alexopoulou, R. A. Flavell, S. Akira, and M. J. Shlomchik. 2005. Toll-like receptor 9 controls anti-DNA autoantibody production in murine lupus. J Exp Med 202:321-331.

95. Dorner, M., S. Brandt, M. Tinguely, F. Zucol, J. P. Bourquin, L. Zauner, C. Berger, M. Bernasconi, R. F. Speck, and D. Nadal. 2009. Plasma cell toll-like receptor (TLR) expression differs from that of B cells, and plasma cell TLR triggering enhances immunoglobulin production. Immunology 128:573-579.

147

96. Lech, M., O. P. Kulkarni, S. Pfeiffer, E. Savarese, A. Krug, C. Garlanda, A. Mantovani, and H. J. Anders. 2008. Tir8/Sigirr prevents murine lupus by suppressing the immunostimulatory effects of lupus autoantigens. J Exp Med. 205:1879-1888.

97. Jacob, C. O., J. Zhu, D. L. Armstrong, M. Yan, J. Han, X. J. Zhou, J. A. Thomas, A. Reiff, B. L. Myones, J. O. Ojwang, K. M. Kaufman, M. Klein-Gitelman, D. McCurdy, L. Wagner-Weiner, E. Silverman, J. Ziegler, J. A. Kelly, J. T. Merrill, J. B. Harley, R. Ramsey-Goldman, L. M. Vila, S. C. Bae, T. J. Vyse, G. S. Gilkeson, P. M. Gaffney, K. L. Moser, C. D. Langefeld, R. Zidovetzki, and C. Mohan. 2009. Identification of IRAK1 as a risk gene with critical role in the pathogenesis of systemic lupus erythematosus. Proc.Natl.Acad.Sci.U.S.A 106:6256-6261.

98. Theofilopoulos, A. N., R. Baccala, B. Beutler, and D. H. Kono. 2005. Type I interferons (alpha/beta) in immunity and autoimmunity. Annual Review of Immunology 23:307-336.

99. Vallin, H., S. Blomberg, G. V. Alm, B. Cederblad, and L. Ronnblom. 1999. Patients with systemic lupus erythematosus (SLE) have a circulating inducer of interferon-alpha (IFN-alpha) production acting on leucocytes resembling immature dendritic cells. Clin Exp Immunol 115:196-202.

100. Bave, U., G. V. Alm, and L. Ronnblom. 2000. The combination of apoptotic U937 cells and lupus IgG is a potent IFN-alpha inducer. J Immunol 165:3519-3526.

101. Ronnblom, L., and G. V. Alm. 2001. An etiopathogenic role for the type I IFN system in SLE. Trends Immunol 22:427-431.

102. Lovgren, T., M. L. Eloranta, U. Bave, G. V. Alm, and L. Ronnblom. 2004. Induction of interferon- alpha production in plasmacytoid dendritic cells by immune complexes containing nucleic acid released by necrotic or late apoptotic cells and lupus IgG. Arthritis and Rheumatism 50:1861- 1872.

103. Vollmer, J., S. Tluk, C. Schmitz, S. Hamm, M. Jurk, A. Forsbach, S. Akira, K. M. Kelly, W. H. Reeves, S. Bauer, and A. M. Krieg. 2005. Immune stimulation mediated by autoantigen binding sites within small nuclear RNAs involves Toll-like receptors 7 and 8. J Exp Med 202:1575-1585.

104. Bave, U., M. Magnusson, M. L. Eloranta, A. Perers, G. V. Alm, and L. Ronnblom. 2003. Fc gamma RIIa is expressed on natural IFN-alpha-producing cells (plasmacytoid dendritic cells) and is required for the IFN-alpha production induced by apoptotic cells combined with lupus IgG. J Immunol 171:3296-3302.

105. Theofilopoulos, A. N., R. Gonzalez-Quintial, B. R. Lawson, Y. T. Koh, M. E. Stern, D. H. Kono, B. Beutler, and R. Baccala. 2010. Sensors of the innate immune system: their link to rheumatic diseases. Nat Rev Rheumatol 6:146-156.

106. Chan, V. S., Y. J. Nie, N. Shen, S. Yan, M. Y. Mok, and C. S. Lau. 2012. Distinct roles of myeloid and plasmacytoid dendritic cells in systemic lupus erythematosus. Autoimmun Rev.

148

107. Farkas, L., K. Beiske, F. Lund-Johansen, P. Brandtzaeg, and F. L. Jahnsen. 2001. Plasmacytoid dendritic cells (natural interferon- alpha/beta-producing cells) accumulate in cutaneous lupus erythematosus lesions. The American journal of pathology 159:237-243.

108. Lian, Z. X., K. Kikuchi, G. X. Yang, A. A. Ansari, S. Ikehara, and M. E. Gershwin. 2004. Expansion of bone marrow IFN-alpha-producing dendritic cells in New Zealand Black (NZB) mice: high level expression of TLR9 and secretion of IFN-alpha in NZB bone marrow. J Immunol. 173:5283-5289.

109. Hooks, J. J., H. M. Moutsopoulos, S. A. Geis, N. I. Stahl, J. L. Decker, and A. L. Notkins. 1979. Immune interferon in the circulation of patients with autoimmune disease. The New England journal of medicine 301:5-8.

110. Kirou, K. A., C. Lee, S. George, K. Louca, I. G. Papagiannis, M. G. Peterson, N. Ly, R. N. Woodward, K. E. Fry, A. Y. Lau, J. G. Prentice, J. G. Wohlgemuth, and M. K. Crow. 2004. Coordinate overexpression of interferon-alpha-induced genes in systemic lupus erythematosus. Arthritis and Rheumatism 50:3958-3967.

111. Santiago-Raber, M. L., R. Baccala, K. M. Haraldsson, D. Choubey, T. A. Stewart, D. H. Kono, and A. N. Theofilopoulos. 2003. Type-I interferon receptor deficiency reduces lupus-like disease in NZB mice. J Exp Med 197:777-788.

112. Mathian, A., A. Weinberg, M. Gallegos, J. Banchereau, and S. Koutouzov. 2005. IFN-alpha induces early lethal lupus in preautoimmune (New Zealand Black x New Zealand White) F1 but not in BALB/c mice. J Immunol. 174:2499-2506.

113. Nacionales, D. C., K. M. Kelly, P. Y. Lee, H. Zhuang, Y. Li, J. S. Weinstein, E. Sobel, Y. Kuroda, J. Akaogi, M. Satoh, and W. H. Reeves. 2006. Type I interferon production by tertiary lymphoid tissue developing in response to 2,6,10,14-tetramethyl-pentadecane (pristane). Am J Pathol 168:1227-1240.

114. Nacionales, D. C., K. M. Kelly-Scumpia, P. Y. Lee, J. S. Weinstein, R. Lyons, E. Sobel, M. Satoh, and W. H. Reeves. 2007. Deficiency of the type I interferon receptor protects mice from experimental lupus. Arthritis Rheum 56:3770-3783.

115. Braun, D., P. Geraldes, and J. Demengeot. 2003. Type I Interferon controls the onset and severity of autoimmune manifestations in lpr mice. J Autoimmun. 20:15-25.

116. Hron, J. D., and S. L. Peng. 2004. Type I IFN protects against murine lupus. J Immunol 173:2134- 2142.

117. Jorgensen, T. N., E. Roper, J. M. Thurman, P. Marrack, and B. L. Kotzin. 2007. Type I interferon signaling is involved in the spontaneous development of lupus-like disease in B6.Nba2 and (B6.Nba2 x NZW)F(1) mice. Genes and immunity 8:653-662.

149

118. Rozzo, S. J., J. D. Allard, D. Choubey, T. J. Vyse, S. Izui, G. Peltz, and B. L. Kotzin. 2001. Evidence for an interferon-inducible gene, Ifi202, in the susceptibility to systemic lupus. Immunity. 15:435-443.

119. Xin, H., S. D'Souza, T. N. Jorgensen, A. T. Vaughan, P. Lengyel, B. L. Kotzin, and D. Choubey. 2006. Increased expression of Ifi202, an IFN-activatable gene, in B6.Nba2 lupus susceptible mice inhibits p53-mediated apoptosis. J Immunol. 176:5863-5870.

120. Yamauchi, M., M. Hashimoto, K. Ichiyama, R. Yoshida, T. Hanada, T. Muta, S. Komune, T. Kobayashi, and A. Yoshimura. 2007. Ifi202, an IFN-inducible candidate gene for lupus susceptibility in NZB/W F1 mice, is a positive regulator for NF-kappaB activation in dendritic cells. Int.Immunol. 19:935-942.

121. Green, N. M., A. Laws, K. Kiefer, L. Busconi, Y. M. Kim, M. M. Brinkmann, E. H. Trail, K. Yasuda, S. R. Christensen, M. J. Shlomchik, S. Vogel, J. H. Connor, H. Ploegh, D. Eilat, I. R. Rifkin, J. M. van Seventer, and A. Marshak-Rothstein. 2009. Murine B cell response to TLR7 ligands depends on an IFN-beta feedback loop. J Immunol 183:1569-1576.

122. Le Bon, A., G. Schiavoni, G. D'Agostino, I. Gresser, F. Belardelli, and D. F. Tough. 2001. Type i interferons potently enhance humoral immunity and can promote isotype switching by stimulating dendritic cells in vivo. Immunity 14:461-470.

123. Jego, G., A. K. Palucka, J. P. Blanck, C. Chalouni, V. Pascual, and J. Banchereau. 2003. Plasmacytoid dendritic cells induce plasma cell differentiation through type I interferon and interleukin 6. Immunity 19:225-234.

124. Poeck, H., M. Wagner, J. Battiany, S. Rothenfusser, D. Wellisch, V. Hornung, B. Jahrsdorfer, T. Giese, S. Endres, and G. Hartmann. 2004. Plasmacytoid dendritic cells, antigen, and CpG-C license human B cells for plasma cell differentiation and immunoglobulin production in the absence of T-cell help. Blood 103:3058-3064.

125. Montoya, M., G. Schiavoni, F. Mattei, I. Gresser, F. Belardelli, P. Borrow, and D. F. Tough. 2002. Type I interferons produced by dendritic cells promote their phenotypic and functional activation. Blood 99:3263-3271.

126. Brinkmann, V., T. Geiger, S. Alkan, and C. H. Heusser. 1993. Interferon alpha increases the frequency of interferon gamma-producing human CD4+ T cells. J Exp Med 178:1655-1663.

127. Marrack, P., J. Kappler, and T. Mitchell. 1999. Type I interferons keep activated T cells alive. J Exp Med 189:521-530.

128. Dalpke, A. H., M. D. Lehner, T. Hartung, and K. Heeg. 2005. Differential effects of CpG-DNA in Toll-like receptor-2/-4/-9 tolerance and cross-tolerance. Immunology 116:203-212.

150

129. Perry, J. A., C. S. Olver, R. C. Burnett, and A. C. Avery. 2005. Cutting edge: the acquisition of TLR tolerance during malaria infection impacts T cell activation. J Immunol 174:5921-5925.

130. Parker, L. C., E. C. Jones, L. R. Prince, S. K. Dower, M. K. Whyte, and I. Sabroe. 2005. Endotoxin tolerance induces selective alterations in neutrophil function. J Leukoc Biol 78:1301-1305.

131. Lotz, M., D. Gutle, S. Walther, S. Menard, C. Bogdan, and M. W. Hornef. 2006. Postnatal acquisition of endotoxin tolerance in intestinal epithelial cells. J Exp Med 203:973-984.

132. Kwok, S. K., J. Y. Lee, S. H. Park, M. L. Cho, S. Y. Min, H. Y. Kim, and Y. G. Cho. 2008. Dysfunctional interferon-alpha production by peripheral plasmacytoid dendritic cells upon Toll- like receptor-9 stimulation in patients with systemic lupus erythematosus. Arthritis Res Ther 10:R29.

133. Ito, T., H. Kanzler, O. Duramad, W. Cao, and Y. J. Liu. 2006. Specialization, kinetics, and repertoire of type 1 interferon responses by human plasmacytoid predendritic cells. Blood 107:2423-2431.

134. Merino, R., L. Fossati, M. Lacour, R. Lemoine, M. Higaki, and S. Izui. 1992. H-2-linked control of the Yaa gene-induced acceleration of lupus-like autoimmune disease in BXSB mice. Eur J Immunol 22:295-299.

135. O'Keefe, T. L., G. T. Williams, F. D. Batista, and M. S. Neuberger. 1999. Deficiency in CD22, a B cell-specific inhibitory receptor, is sufficient to predispose to development of high affinity autoantibodies. J Exp Med. 189:1307-1313.

136. Pani, G., K. A. Siminovitch, and C. J. Paige. 1997. The motheaten mutation rescues B cell signaling and development in CD45-deficient mice. J Exp Med. 186:581-588.

137. Pao, L. I., K. P. Lam, J. M. Henderson, J. L. Kutok, M. Alimzhanov, L. Nitschke, M. L. Thomas, B. G. Neel, and K. Rajewsky. 2007. B cell-specific deletion of protein-tyrosine phosphatase Shp1 promotes B-1a cell development and causes systemic autoimmunity. Immunity. 27:35-48.

138. Hibbs, M. L., D. M. Tarlinton, J. Armes, D. Grail, G. Hodgson, R. Maglitto, S. A. Stacker, and A. R. Dunn. 1995. Multiple defects in the immune system of Lyn-deficient mice, culminating in autoimmune disease. Cell 83:301-311.

139. Cornall, R. J., J. G. Cyster, M. L. Hibbs, A. R. Dunn, K. L. Otipoby, E. A. Clark, and C. C. Goodnow. 1998. Polygenic autoimmune traits: Lyn, CD22, and SHP-1 are limiting elements of a biochemical pathway regulating BCR signaling and selection. Immunity. 8:497-508.

140. Silver, K. L., T. L. Crockford, T. Bouriez-Jones, S. Milling, T. Lambe, and R. J. Cornall. 2007. MyD88-dependent autoimmune disease in Lyn-deficient mice. Eur J Immunol 37:2734-2743.

151

141. Inaoki, M., S. Sato, B. C. Weintraub, C. C. Goodnow, and T. F. Tedder. 1997. CD19-regulated signaling thresholds control peripheral tolerance and autoantibody production in B lymphocytes. J Exp Med. 186:1923-1931.

142. Tedder, T. F., M. Inaoki, and S. Sato. 1997. The CD19-CD21 complex regulates signal transduction thresholds governing humoral immunity and autoimmunity. Immunity. 6:107-118.

143. Bolland, S., and J. V. Ravetch. 2000. Spontaneous autoimmune disease in Fc(gamma)RIIB- deficient mice results from strain-specific epistasis. Immunity 13:277-285.

144. Ehlers, M., H. Fukuyama, T. L. McGaha, A. Aderem, and J. V. Ravetch. 2006. TLR9/MyD88 signaling is required for class switching to pathogenic IgG2a and 2b autoantibodies in SLE. J Exp Med 203:553-561.

145. Jiang, Y., S. Hirose, R. Sanokawa-Akakura, M. Abe, X. Mi, N. Li, Y. Miura, J. Shirai, D. Zhang, Y. Hamano, and T. Shirai. 1999. Genetically determined aberrant down-regulation of FcgammaRIIB1 in germinal center B cells associated with hyper-IgG and IgG autoantibodies in murine systemic lupus erythematosus. Int.Immunol. 11:1685-1691.

146. Xiu, Y., K. Nakamura, M. Abe, N. Li, X. S. Wen, Y. Jiang, D. Zhang, H. Tsurui, S. Matsuoka, Y. Hamano, H. Fujii, M. Ono, T. Takai, T. Shimokawa, C. Ra, T. Shirai, and S. Hirose. 2002. Transcriptional regulation of Fcgr2b gene by polymorphic promoter region and its contribution to humoral immune responses. J Immunol. 169:4340-4346.

147. Rahman, Z. S., and T. Manser. 2005. Failed up-regulation of the inhibitory IgG Fc receptor Fc gamma RIIB on germinal center B cells in autoimmune-prone mice is not associated with deletion polymorphisms in the promoter region of the Fc gamma RIIB gene. J Immunol. 175:1440-1449.

148. Jorgensen, T. N., J. Alfaro, H. L. Enriquez, C. Jiang, W. M. Loo, S. Atencio, M. R. Bupp, C. M. Mailloux, T. Metzger, S. Flannery, S. J. Rozzo, B. L. Kotzin, M. Rosemblatt, M. R. Bono, and L. D. Erickson. 2010. Development of murine lupus involves the combined genetic contribution of the SLAM and FcgammaR intervals within the Nba2 autoimmune susceptibility locus. J Immunol. 184:775-786.

149. Le, L. Q., J. H. Kabarowski, Z. Weng, A. B. Satterthwaite, E. T. Harvill, E. R. Jensen, J. F. Miller, and O. N. Witte. 2001. Mice lacking the orphan G protein-coupled receptor G2A develop a late- onset autoimmune syndrome. Immunity. 14:561-571.

150. Salvador, J. M., M. C. Hollander, A. T. Nguyen, J. B. Kopp, L. Barisoni, J. K. Moore, J. D. Ashwell, and A. J. Fornace, Jr. 2002. Mice lacking the p53-effector gene Gadd45a develop a lupus-like syndrome. Immunity. 16:499-508.

152

151. Linterman, M. A., R. J. Rigby, R. K. Wong, D. Yu, R. Brink, J. L. Cannons, P. L. Schwartzberg, M. C. Cook, G. D. Walters, and C. G. Vinuesa. 2009. Follicular helper T cells are required for systemic autoimmunity. J Exp Med. 206:561-576.

152. Espinosa, A., V. Dardalhon, S. Brauner, A. Ambrosi, R. Higgs, F. J. Quintana, M. Sjostrand, M. L. Eloranta, G. J. Ni, O. Winqvist, B. Sundelin, C. A. Jefferies, B. Rozell, V. K. Kuchroo, and M. Wahren-Herlenius. 2009. Loss of the lupus autoantigen Ro52/Trim21 induces tissue inflammation and systemic autoimmunity by disregulating the IL-23-Th17 pathway. J Exp Med. 206:1661-1671.

153. Wandstrat, A. E., C. Nguyen, N. Limaye, A. Y. Chan, S. Subramanian, X. H. Tian, Y. S. Yim, A. Pertsemlidis, H. R. Garner, Jr., L. Morel, and E. K. Wakeland. 2004. Association of extensive polymorphisms in the SLAM/CD2 gene cluster with murine lupus. Immunity. 21:769-780.

154. Kumar, K. R., L. Li, M. Yan, M. Bhaskarabhatla, A. B. Mobley, C. Nguyen, J. M. Mooney, J. D. Schatzle, E. K. Wakeland, and C. Mohan. 2006. Regulation of B cell tolerance by the lupus susceptibility gene Ly108. Science 312:1665-1669.

155. Chan, A. Y., J. M. Westcott, J. M. Mooney, E. K. Wakeland, and J. D. Schatzle. 2006. The role of SAP and the SLAM family in autoimmunity. Current opinion in immunology 18:656-664.

156. Cannons, J. L., S. G. Tangye, and P. L. Schwartzberg. 2011. SLAM family receptors and SAP adaptors in immunity. Annu Rev Immunol 29:665-705.

157. Haraldsson, M. K., C. A. Louis-Dit-Sully, B. R. Lawson, G. Sternik, M. L. Santiago-Raber, N. R. Gascoigne, A. N. Theofilopoulos, and D. H. Kono. 2008. The lupus-related Lmb3 locus contains a disease-suppressing Coronin-1A gene mutation. Immunity. 28:40-51.

158. Foger, N., L. Rangell, D. M. Danilenko, and A. C. Chan. 2006. Requirement for coronin 1 in T lymphocyte trafficking and cellular homeostasis. Science 313:839-842.

159. Mueller, P., J. Massner, R. Jayachandran, B. Combaluzier, I. Albrecht, J. Gatfield, C. Blum, R. Ceredig, H. R. Rodewald, A. G. Rolink, and J. Pieters. 2008. Regulation of T cell survival through coronin-1-mediated generation of inositol-1,4,5-trisphosphate and calcium mobilization after T cell receptor triggering. Nat.Immunol. 9:424-431.

160. Grewal, I. S., and R. A. Flavell. 1998. CD40 and CD154 in cell-mediated immunity. Annual Review of Immunology 16:111-135.

161. Peters, A. L., L. L. Stunz, and G. A. Bishop. 2009. CD40 and autoimmunity: the dark side of a great activator. Semin Immunol 21:293-300.

162. Koshy, M., D. Berger, and M. K. Crow. 1996. Increased expression of CD40 ligand on systemic lupus erythematosus lymphocytes. J Clin Invest 98:826-837.

153

163. Duffau, P., J. Seneschal, C. Nicco, C. Richez, E. Lazaro, I. Douchet, C. Bordes, J. F. Viallard, C. Goulvestre, J. L. Pellegrin, B. Weil, J. F. Moreau, F. Batteux, and P. Blanco. 2010. Platelet CD154 potentiates interferon-alpha secretion by plasmacytoid dendritic cells in systemic lupus erythematosus. Sci Transl Med 2:47ra63.

164. Kato, K., E. Santana-Sahagun, L. Z. Rassenti, M. H. Weisman, N. Tamura, S. Kobayashi, H. Hashimoto, and T. J. Kipps. 1999. The soluble CD40 ligand sCD154 in systemic lupus erythematosus. J Clin Invest 104:947-955.

165. Grammer, A. C., R. D. McFarland, J. Heaney, B. F. Darnell, and P. E. Lipsky. 1999. Expression, regulation, and function of B cell-expressed CD154 in germinal centers. J Immunol 163:4150- 4159.

166. Grammer, A. C., R. Slota, R. Fischer, H. Gur, H. Girschick, C. Yarboro, G. G. Illei, and P. E. Lipsky. 2003. Abnormal germinal center reactions in systemic lupus erythematosus demonstrated by blockade of CD154-CD40 interactions. J Clin Invest 112:1506-1520.

167. Higuchi, T., Y. Aiba, T. Nomura, J. Matsuda, K. Mochida, M. Suzuki, H. Kikutani, T. Honjo, K. Nishioka, and T. Tsubata. 2002. Cutting Edge: Ectopic expression of CD40 ligand on B cells induces lupus-like autoimmune disease. J Immunol 168:9-12.

168. Wykes, M., J. Poudrier, R. Lindstedt, and D. Gray. 1998. Regulation of cytoplasmic, surface and soluble forms of CD40 ligand in mouse B cells. Eur J Immunol. 28:548-559.

169. Blossom, S., E. B. Chu, W. O. Weigle, and K. M. Gilbert. 1997. CD40 ligand expressed on B cells in the BXSB mouse model of systemic lupus erythematosus. J Immunol 159:4580-4586.

170. Early, G. S., W. Zhao, and C. M. Burns. 1996. Anti-CD40 ligand antibody treatment prevents the development of lupus-like nephritis in a subset of New Zealand black x New Zealand white mice. Response correlates with the absence of an anti-antibody response. J Immunol 157:3159-3164.

171. Huang, W., J. Sinha, J. Newman, B. Reddy, L. Budhai, R. Furie, A. Vaishnaw, and A. Davidson. 2002. The effect of anti-CD40 ligand antibody on B cells in human systemic lupus erythematosus. Arthritis Rheum 46:1554-1562.

172. Boumpas, D. T., R. Furie, S. Manzi, G. G. Illei, D. J. Wallace, J. E. Balow, and A. Vaishnaw. 2003. A short course of BG9588 (anti-CD40 ligand antibody) improves serologic activity and decreases hematuria in patients with proliferative lupus glomerulonephritis. Arthritis Rheum 48:719-727.

173. Law, C. L., and I. S. Grewal. 2009. Therapeutic interventions targeting CD40L (CD154) and CD40: the opportunities and challenges. Adv Exp Med Biol 647:8-36.

174. Ma, J., J. Xu, M. P. Madaio, Q. Peng, J. Zhang, I. S. Grewal, R. A. Flavell, and J. Craft. 1996. Autoimmune lpr/lpr mice deficient in CD40 ligand: spontaneous Ig class switching with dichotomy of autoantibody responses. J Immunol 157:417-426.

154

175. Russell, J. Q., T. Mooney, P. L. Cohen, B. MacPherson, R. J. Noelle, and R. C. Budd. 1998. Anti- CD40L accelerates renal disease and adenopathy in MRL-lpr mice in parallel with decreased thymocyte apoptosis. J Immunol 161:729-739.

176. Vazgiourakis, V. M., M. I. Zervou, C. Choulaki, G. Bertsias, M. Melissourgaki, N. Yilmaz, P. Sidiropoulos, D. Plant, L. A. Trouw, R. E. Toes, D. Kardassis, S. Yavuz, D. T. Boumpas, and G. N. Goulielmos. 2011. A common SNP in the CD40 region is associated with systemic lupus erythematosus and correlates with altered CD40 expression: implications for the pathogenesis. Ann Rheum Dis 70:2184-2190.

177. Majeti, R., Z. Xu, T. G. Parslow, J. L. Olson, D. I. Daikh, N. Killeen, and A. Weiss. 2000. An inactivating point mutation in the inhibitory wedge of CD45 causes lymphoproliferation and autoimmunity. Cell 103:1059-1070.

178. Nishimura, H., M. Nose, H. Hiai, N. Minato, and T. Honjo. 1999. Development of lupus-like autoimmune diseases by disruption of the PD-1 gene encoding an ITIM motif-carrying immunoreceptor. Immunity 11:141-151.

179. Savino, M. T., B. Ortensi, M. Ferro, C. Ulivieri, D. Fanigliulo, E. Paccagnini, S. Lazzi, D. Osti, G. Pelicci, and C. T. Baldari. 2009. Rai acts as a negative regulator of autoimmunity by inhibiting antigen receptor signaling and lymphocyte activation. J Immunol. 182:301-308.

180. Finetti, F., M. Pellegrini, C. Ulivieri, M. T. Savino, E. Paccagnini, C. Ginanneschi, L. Lanfrancone, P. G. Pelicci, and C. T. Baldari. 2008. The proapoptotic and antimitogenic protein p66SHC acts as a negative regulator of lymphocyte activation and autoimmunity. Blood 111:5017-5027.

181. Nagata, S., and T. Suda. 1995. Fas and Fas ligand: lpr and gld mutations. Immunol.Today 16:39- 43.

182. Bouillet, P., D. Metcalf, D. C. Huang, D. M. Tarlinton, T. W. Kay, F. Kontgen, J. M. Adams, and A. Strasser. 1999. Proapoptotic Bcl-2 relative Bim required for certain apoptotic responses, leukocyte homeostasis, and to preclude autoimmunity. Science 286:1735-1738.

183. Oliver, P. M., T. Vass, J. Kappler, and P. Marrack. 2006. Loss of the proapoptotic protein, Bim, breaks B cell anergy. J Exp Med. 203:731-741.

184. Fischer, S. F., P. Bouillet, K. O'Donnell, A. Light, D. M. Tarlinton, and A. Strasser. 2007. Proapoptotic BH3-only protein Bim is essential for developmentally programmed death of germinal center-derived memory B cells and antibody-forming cells. Blood 110:3978-3984.

185. Smith, K. G., A. Light, L. A. O'Reilly, S. M. Ang, A. Strasser, and D. Tarlinton. 2000. bcl-2 transgene expression inhibits apoptosis in the germinal center and reveals differences in the selection of memory B cells and bone marrow antibody-forming cells. J Exp Med. 191:475-484.

155

186. Mackay, F., S. A. Woodcock, P. Lawton, C. Ambrose, M. Baetscher, P. Schneider, J. Tschopp, and J. L. Browning. 1999. Mice transgenic for BAFF develop lymphocytic disorders along with autoimmune manifestations. J Exp Med. 190:1697-1710.

187. Kozono, Y., B. L. Kotzin, and V. M. Holers. 1996. Resting B cells from New Zealand Black mice demonstrate a defect in apoptosis induction following surface IgM ligation. J Immunol. 156:4498-4503.

188. Roy, V., N. H. Chang, Y. Cai, G. Bonventi, and J. Wither. 2005. Aberrant IgM signaling promotes survival of transitional T1 B cells and prevents tolerance induction in lupus-prone New Zealand black mice. J Immunol. 175:7363-7371.

189. Chang, N. H., Y. H. Cheung, C. Loh, E. Pau, V. Roy, Y. C. Cai, and J. Wither. 2010. B cell activating factor (BAFF) and T cells cooperate to breach B cell tolerance in lupus-prone New Zealand Black (NZB) mice. PLoS One 5:e11691.

190. Di, C. A., P. Kotsi, Y. F. Peng, C. Cordon-Cardo, K. B. Elkon, and P. P. Pandolfi. 1999. Impaired Fas response and autoimmunity in Pten+/- mice. Science 285:2122-2125.

191. Suzuki, H., T. M. Kundig, C. Furlonger, A. Wakeham, E. Timms, T. Matsuyama, R. Schmits, J. J. Simard, P. S. Ohashi, and H. Griesser. 1995. Deregulated T cell activation and autoimmunity in mice lacking interleukin-2 receptor beta. Science 268:1472-1476.

192. Stohl, W., N. Jacob, W. J. Quinn, III, M. P. Cancro, H. Gao, C. Putterman, X. Gao, L. Pricop, and M. N. Koss. 2008. Global T cell dysregulation in non-autoimmune-prone mice promotes rapid development of BAFF-independent, systemic lupus erythematosus-like autoimmunity. J Immunol. 181:833-841.

193. Mackay, F., P. A. Silveira, and R. Brink. 2007. B cells and the BAFF/APRIL axis: fast-forward on autoimmunity and signaling. Current opinion in immunology 19:327-336.

194. Stadanlick, J. E., and M. P. Cancro. 2008. BAFF and the plasticity of peripheral B cell tolerance. Current opinion in immunology.

195. Litinskiy, M. B., B. Nardelli, D. M. Hilbert, B. He, A. Schaffer, P. Casali, and A. Cerutti. 2002. DCs induce CD40-independent immunoglobulin class switching through BLyS and APRIL. Nature immunology 3:822-829.

196. Mackay, F., and J. L. Browning. 2002. BAFF: a fundamental survival factor for B cells. Nature reviews.Immunology 2:465-475.

197. Stohl, W., S. Metyas, S. M. Tan, G. S. Cheema, B. Oamar, D. Xu, V. Roschke, Y. Wu, K. P. Baker, and D. M. Hilbert. 2003. B lymphocyte stimulator overexpression in patients with systemic lupus erythematosus: longitudinal observations. Arthritis and Rheumatism 48:3475-3486.

156

198. Thien, M., T. G. Phan, S. Gardam, M. Amesbury, A. Basten, F. Mackay, and R. Brink. 2004. Excess BAFF rescues self-reactive B cells from peripheral deletion and allows them to enter forbidden follicular and marginal zone niches. Immunity 20:785-798.

199. Gross, J. A., J. Johnston, S. Mudri, R. Enselman, S. R. Dillon, K. Madden, W. Xu, J. Parrish- Novak, D. Foster, C. Lofton-Day, M. Moore, A. Littau, A. Grossman, H. Haugen, K. Foley, H. Blumberg, K. Harrison, W. Kindsvogel, and C. H. Clegg. 2000. TACI and BCMA are receptors for a TNF homologue implicated in B-cell autoimmune disease. Nature 404:995-999.

200. Groom, J. R., C. A. Fletcher, S. N. Walters, S. T. Grey, S. V. Watt, M. J. Sweet, M. J. Smyth, C. R. Mackay, and F. Mackay. 2007. BAFF and MyD88 signals promote a lupuslike disease independent of T cells. J Exp Med. 204:1959-1971.

201. Boule, M. W., C. Broughton, F. Mackay, S. Akira, A. Marshak-Rothstein, and I. R. Rifkin. 2004. Toll-like receptor 9-dependent and -independent dendritic cell activation by chromatin- immunoglobulin G complexes. J Exp Med. 199:1631-1640.

202. Li, Q. Z., J. Zhou, R. Yang, M. Yan, Q. Ye, K. Liu, S. Liu, X. Shao, L. Li, X. J. Zhou, E. K. Wakeland, and C. Mohan. 2009. The lupus-susceptibility gene kallikrein downmodulates antibody-mediated glomerulonephritis. Genes Immun. 10:503-508.

203. Liu, K., Q. Z. Li, A. M. gado-Vega, A. K. Abelson, E. Sanchez, J. A. Kelly, L. Li, Y. Liu, J. Zhou, M. Yan, Q. Ye, S. Liu, C. Xie, X. J. Zhou, S. A. Chung, B. Pons-Estel, T. Witte, R. E. de, S. C. Bae, N. Barizzone, G. D. Sebastiani, J. T. Merrill, P. K. Gregersen, G. G. Gilkeson, R. P. Kimberly, T. J. Vyse, I. Kim, S. D'Alfonso, J. Martin, J. B. Harley, L. A. Criswell, E. K. Wakeland, M. E. arcon- Riquelme, and C. Mohan. 2009. Kallikrein genes are associated with lupus and glomerular basement membrane-specific antibody-induced nephritis in mice and humans. J Clin Invest 119:911-923.

204. Moser, K. L., J. A. Kelly, C. J. Lessard, and J. B. Harley. 2009. Recent insights into the genetic basis of systemic lupus erythematosus. Genes Immun. 10:373-379.

205. Deng, Y., and B. P. Tsao. 2010. Genetic susceptibility to systemic lupus erythematosus in the genomic era. Nat Rev Rheumatol 6:683-692.

206. Walport, M. J., K. A. Davies, and M. Botto. 1998. C1q and systemic lupus erythematosus. Immunobiology 199:265-285.

207. Slingsby, J. H., P. Norsworthy, G. Pearce, A. K. Vaishnaw, H. Issler, B. J. Morley, and M. J. Walport. 1996. Homozygous hereditary C1q deficiency and systemic lupus erythematosus. A new family and the molecular basis of C1q deficiency in three families. Arthritis Rheum. 39:663- 670.

208. Racila, D. M., C. J. Sontheimer, A. Sheffield, J. J. Wisnieski, E. Racila, and R. D. Sontheimer. 2003. Homozygous single nucleotide polymorphism of the complement C1QA gene is associated

157

with decreased levels of C1q in patients with subacute cutaneous lupus erythematosus. Lupus 12:124-132.

209. Ghebrehiwet, B., and E. I. Peerschke. 2004. Role of C1q and C1q receptors in the pathogenesis of systemic lupus erythematosus. Curr.Dir.Autoimmun. 7:87-97.

210. Truedsson, L., A. A. Bengtsson, and G. Sturfelt. 2007. Complement deficiencies and systemic lupus erythematosus. Autoimmunity 40:560-566.

211. Edberg, J. C., J. Wu, C. D. Langefeld, E. E. Brown, M. C. Marion, G. McGwin, Jr., M. Petri, R. Ramsey-Goldman, J. D. Reveille, S. G. Frank, K. M. Kaufman, J. B. Harley, G. S. Alarcon, and R. P. Kimberly. 2008. Genetic variation in the CRP promoter: association with systemic lupus erythematosus. Hum.Mol.Genet. 17:1147-1155.

212. Stetson, D. B., J. S. Ko, T. Heidmann, and R. Medzhitov. 2008. Trex1 prevents cell-intrinsic initiation of autoimmunity. Cell 134:587-598.

213. Lee-Kirsch, M. A., M. Gong, D. Chowdhury, L. Senenko, K. Engel, Y. A. Lee, S. U. de, S. L. Bailey, T. Witte, T. J. Vyse, J. Kere, C. Pfeiffer, S. Harvey, A. Wong, S. Koskenmies, O. Hummel, K. Rohde, R. E. Schmidt, A. F. Dominiczak, M. Gahr, T. Hollis, F. W. Perrino, J. Lieberman, and N. Hubner. 2007. Mutations in the gene encoding the 3'-5' DNA exonuclease TREX1 are associated with systemic lupus erythematosus. Nat.Genet. 39:1065-1067.

214. Gateva, V., J. K. Sandling, G. Hom, K. E. Taylor, S. A. Chung, X. Sun, W. Ortmann, R. Kosoy, R. C. Ferreira, G. Nordmark, I. Gunnarsson, E. Svenungsson, L. Padyukov, G. Sturfelt, A. Jonsen, A. A. Bengtsson, S. Rantapaa-Dahlqvist, E. C. Baechler, E. E. Brown, G. S. Alarcon, J. C. Edberg, R. Ramsey-Goldman, G. McGwin, Jr., J. D. Reveille, L. M. Vila, R. P. Kimberly, S. Manzi, M. A. Petri, A. Lee, P. K. Gregersen, M. F. Seldin, L. Ronnblom, L. A. Criswell, A. C. Syvanen, T. W. Behrens, and R. R. Graham. 2009. A large-scale replication study identifies TNIP1, PRDM1, JAZF1, UHRF1BP1 and IL10 as risk loci for systemic lupus erythematosus. Nat Genet 41:1228- 1233.

215. Zhou, X. J., X. L. Lu, J. C. Lv, H. Z. Yang, L. X. Qin, M. H. Zhao, Y. Su, Z. G. Li, and H. Zhang. 2011. Genetic association of PRDM1-ATG5 intergenic region and autophagy with systemic lupus erythematosus in a Chinese population. Ann Rheum Dis 70:1330-1337.

216. Webb, R., J. D. Wren, M. Jeffries, J. A. Kelly, K. M. Kaufman, Y. Tang, M. B. Frank, J. Merrill, R. P. Kimberly, J. C. Edberg, R. Ramsey-Goldman, M. Petri, J. D. Reveille, G. S. Alarcon, L. M. Vila, M. E. arcon-Riquelme, J. A. James, T. J. Vyse, K. L. Moser, P. M. Gaffney, G. S. Gilkeson, J. B. Harley, and A. H. Sawalha. 2009. Variants within MECP2, a key transcription regulator, are associated with increased susceptibility to lupus and differential gene expression in patients with systemic lupus erythematosus. Arthritis Rheum. 60:1076-1084.

217. Kaufman, K. M., J. Zhao, J. A. Kelly, T. Hughes, A. Adler, E. Sanchez, J. O. Ojwang, C. D. Langefeld, J. T. Ziegler, A. H. Williams, M. E. Comeau, M. C. Marion, S. B. Glenn, R. M. Cantor,

158

J. M. Grossman, B. H. Hahn, Y. W. Song, C. Y. Yu, J. A. James, J. M. Guthridge, E. E. Brown, G. S. Alarcon, R. P. Kimberly, J. C. Edberg, R. Ramsey-Goldman, M. A. Petri, J. D. Reveille, L. M. Vila, J. M. Anaya, S. A. Boackle, A. M. Stevens, B. I. Freedman, L. A. Criswell, A. P.-E. o. b. o. t. A. C. G. Bernardo, J. H. Lee, J. S. Lee, D. M. Chang, R. H. Scofield, G. S. Gilkeson, J. T. Merrill, T. B. Niewold, T. J. Vyse, S. C. Bae, E. A.-R. o. b. o. t. B. n. Marta, C. O. Jacob, K. Moser Sivils, P. M. Gaffney, J. B. Harley, A. H. Sawalha, and B. P. Tsao. 2013. Fine mapping of Xq28: both MECP2 and IRAK1 contribute to risk for systemic lupus erythematosus in multiple ancestral groups. Ann Rheum Dis 72:437-444.

218. Ma, A., and B. A. Malynn. 2012. A20: linking a complex regulator of ubiquitylation to immunity and human disease. Nat Rev Immunol 12:774-785.

219. Graham, R. R., C. Cotsapas, L. Davies, R. Hackett, C. J. Lessard, J. M. Leon, N. P. Burtt, C. Guiducci, M. Parkin, C. Gates, R. M. Plenge, T. W. Behrens, J. E. Wither, J. D. Rioux, P. R. Fortin, D. C. Graham, A. K. Wong, T. J. Vyse, M. J. Daly, D. Altshuler, K. L. Moser, and P. M. Gaffney. 2008. Genetic variants near TNFAIP3 on 6q23 are associated with systemic lupus erythematosus. Nat.Genet. 40:1059-1061.

220. Harley, J. B., M. E. arcon-Riquelme, L. A. Criswell, C. O. Jacob, R. P. Kimberly, K. L. Moser, B. P. Tsao, T. J. Vyse, C. D. Langefeld, S. K. Nath, J. M. Guthridge, B. L. Cobb, D. B. Mirel, M. C. Marion, A. H. Williams, J. Divers, W. Wang, S. G. Frank, B. Namjou, S. B. Gabriel, A. T. Lee, P. K. Gregersen, T. W. Behrens, K. E. Taylor, M. Fernando, R. Zidovetzki, P. M. Gaffney, J. C. Edberg, J. D. Rioux, J. O. Ojwang, J. A. James, J. T. Merrill, G. S. Gilkeson, M. F. Seldin, H. Yin, E. C. Baechler, Q. Z. Li, E. K. Wakeland, G. R. Bruner, K. M. Kaufman, and J. A. Kelly. 2008. Genome-wide association scan in women with systemic lupus erythematosus identifies susceptibility variants in ITGAM, PXK, KIAA1542 and other loci. Nat.Genet. 40:204-210.

221. Han, J. W., H. F. Zheng, Y. Cui, L. D. Sun, D. Q. Ye, Z. Hu, J. H. Xu, Z. M. Cai, W. Huang, G. P. Zhao, H. F. Xie, H. Fang, Q. J. Lu, X. P. Li, Y. F. Pan, D. Q. Deng, F. Q. Zeng, Z. Z. Ye, X. Y. Zhang, Q. W. Wang, F. Hao, L. Ma, X. B. Zuo, F. S. Zhou, W. H. Du, Y. L. Cheng, J. Q. Yang, S. K. Shen, J. Li, Y. J. Sheng, X. X. Zuo, W. F. Zhu, F. Gao, P. L. Zhang, Q. Guo, B. Li, M. Gao, F. L. Xiao, C. Quan, C. Zhang, Z. Zhang, K. J. Zhu, Y. Li, D. Y. Hu, W. S. Lu, J. L. Huang, S. X. Liu, H. Li, Y. Q. Ren, Z. X. Wang, C. J. Yang, P. G. Wang, W. M. Zhou, Y. M. Lv, A. P. Zhang, S. Q. Zhang, D. Lin, H. Q. Low, M. Shen, Z. F. Zhai, Y. Wang, F. Y. Zhang, S. Yang, J. J. Liu, and X. J. Zhang. 2009. Genome-wide association study in a Chinese Han population identifies nine new susceptibility loci for systemic lupus erythematosus. Nat Genet 41:1234-1237.

222. Han, S., J. M. Guthridge, I. T. Harley, A. L. Sestak, X. Kim-Howard, K. M. Kaufman, B. Namjou, H. Deshmukh, G. Bruner, L. R. Espinoza, G. S. Gilkeson, J. B. Harley, J. A. James, and S. K. Nath. 2008. Osteopontin and systemic lupus erythematosus association: a probable gene-gender interaction. PLoS.One. 3:e0001757.

159

223. Kariuki, S. N., J. G. Moore, K. A. Kirou, M. K. Crow, T. O. Utset, and T. B. Niewold. 2009. Age- and gender-specific modulation of serum osteopontin and interferon-alpha by osteopontin genotype in systemic lupus erythematosus. Genes Immun. 10:487-494.

224. Goldberg, M. A., F. C. Arnett, W. B. Bias, and L. E. Shulman. 1976. Histocompatibility antigens in systemic lupus erythematosus. Arthritis Rheum 19:129-132.

225. Fernando, M. M., C. R. Stevens, P. C. Sabeti, E. C. Walsh, A. J. McWhinnie, A. Shah, T. Green, J. D. Rioux, and T. J. Vyse. 2007. Identification of two independent risk factors for lupus within the MHC in United Kingdom families. PLoS.Genet. 3:e192.

226. Hom, G., R. R. Graham, B. Modrek, K. E. Taylor, W. Ortmann, S. Garnier, A. T. Lee, S. A. Chung, R. C. Ferreira, P. V. Pant, D. G. Ballinger, R. Kosoy, F. Y. Demirci, M. I. Kamboh, A. H. Kao, C. Tian, I. Gunnarsson, A. A. Bengtsson, S. Rantapaa-Dahlqvist, M. Petri, S. Manzi, M. F. Seldin, L. Ronnblom, A. C. Syvanen, L. A. Criswell, P. K. Gregersen, and T. W. Behrens. 2008. Association of systemic lupus erythematosus with C8orf13-BLK and ITGAM-ITGAX. N.Engl.J Med. 358:900-909.

227. Vasconcelos, C., C. Carvalho, B. Leal, C. Pereira, A. Bettencourt, P. P. Costa, A. Marinho, P. Barbosa, I. Almeida, F. Farinha, T. Mendonca, J. A. Correia, D. Mendonca, and B. Martins. 2009. HLA in Portuguese systemic lupus erythematosus patients and their relation to clinical features. Ann.N.Y.Acad.Sci. 1173:575-580.

228. Manjarrez-Orduno, N., E. Marasco, S. A. Chung, M. S. Katz, J. F. Kiridly, K. R. Simpfendorfer, J. Freudenberg, D. H. Ballard, E. Nashi, T. J. Hopkins, D. S. Cunninghame Graham, A. T. Lee, M. J. Coenen, B. Franke, D. W. Swinkels, R. R. Graham, R. P. Kimberly, P. M. Gaffney, T. J. Vyse, T. W. Behrens, L. A. Criswell, B. Diamond, and P. K. Gregersen. 2012. CSK regulatory polymorphism is associated with systemic lupus erythematosus and influences B-cell signaling and activation. Nat Genet 44:1227-1230.

229. Gonzalez-Escribano, M. F., F. Aguilar, J. Sanchez-Roman, and A. Nunez-Roldan. 2002. FcgammaRIIA, FcgammaRIIIA and FcgammaRIIIB polymorphisms in Spanish patients with systemic lupus erythematosus. Eur.J Immunogenet. 29:301-306.

230. Siriboonrit, U., N. Tsuchiya, M. Sirikong, C. Kyogoku, S. Bejrachandra, P. Suthipinittharm, K. Luangtrakool, D. Srinak, R. Thongpradit, K. Fujiwara, D. Chandanayingyong, and K. Tokunaga. 2003. Association of Fcgamma receptor IIb and IIIb polymorphisms with susceptibility to systemic lupus erythematosus in Thais. Tissue Antigens 61:374-383.

231. Chu, Z. T., N. Tsuchiya, C. Kyogoku, J. Ohashi, Y. P. Qian, S. B. Xu, C. Z. Mao, J. Y. Chu, and K. Tokunaga. 2004. Association of Fcgamma receptor IIb polymorphism with susceptibility to systemic lupus erythematosus in Chinese: a common susceptibility gene in the Asian populations. Tissue Antigens 63:21-27.

160

232. Tsuchiya, N., and C. Kyogoku. 2005. Role of Fc gamma receptor IIb polymorphism in the genetic background of systemic lupus erythematosus: insights from Asia. Autoimmunity 38:347-352.

233. Chen, J. Y., C. M. Wang, C. C. Ma, S. F. Luo, J. C. Edberg, R. P. Kimberly, and J. Wu. 2006. Association of a transmembrane polymorphism of Fcgamma receptor IIb (FCGR2B) with systemic lupus erythematosus in Taiwanese patients. Arthritis Rheum. 54:3908-3917.

234. Sekine, H., R. C. Ferreira, Q. Pan-Hammarstrom, R. R. Graham, B. Ziemba, S. S. de Vries, J. Liu, K. Hippen, T. Koeuth, W. Ortmann, A. Iwahori, M. K. Elliott, S. Offer, C. Skon, L. Du, J. Novitzke, A. T. Lee, N. Zhao, J. D. Tompkins, D. Altshuler, P. K. Gregersen, C. Cunningham- Rundles, R. S. Harris, C. Her, D. L. Nelson, L. Hammarstrom, G. S. Gilkeson, and T. W. Behrens. 2007. Role for Msh5 in the regulation of Ig class switch recombination. Proc Natl Acad Sci U S A 104:7193-7198.

235. Calame, K. L., K. I. Lin, and C. Tunyaplin. 2003. Regulatory mechanisms that determine the development and function of plasma cells. Annu Rev Immunol 21:205-230.

236. Keller, A. D., and T. Maniatis. 1991. Identification and characterization of a novel repressor of beta-interferon gene expression. Genes Dev 5:868-879.

237. Gallant, S., and G. Gilkeson. 2006. ETS transcription factors and regulation of immunity. Arch Immunol Ther Exp (Warsz) 54:149-163.

238. Moisan, J., R. Grenningloh, E. Bettelli, M. Oukka, and I. C. Ho. 2007. Ets-1 is a negative regulator of Th17 differentiation. J Exp Med 204:2825-2835.

239. Rutherford, M. N., A. Kumar, S. J. Haque, J. Ghysdael, and B. R. Williams. 1997. Specific binding of the ETS-domain protein to the interferon-stimulated response element. J Interferon Cytokine Res 17:1-10.

240. Wojcik, H., E. Griffiths, S. Staggs, J. Hagman, and S. Winandy. 2007. Expression of a non-DNA- binding Ikaros isoform exclusively in B cells leads to autoimmunity but not leukemogenesis. Eur J Immunol 37:1022-1032.

241. Cunninghame Graham, D. S., T. J. Vyse, P. R. Fortin, A. Montpetit, Y. C. Cai, S. Lim, T. McKenzie, L. Farwell, B. Rhodes, L. Chad, T. J. Hudson, A. Sharpe, C. Terhorst, C. M. Greenwood, J. Wither, and J. D. Rioux. 2008. Association of LY9 in UK and Canadian SLE families. Genes Immun. 9:93-102.

242. Criswell, L. A., K. A. Pfeiffer, R. F. Lum, B. Gonzales, J. Novitzke, M. Kern, K. L. Moser, A. B. Begovich, V. E. Carlton, W. Li, A. T. Lee, W. Ortmann, T. W. Behrens, and P. K. Gregersen. 2005. Analysis of families in the multiple autoimmune disease genetics consortium (MADGC) collection: the PTPN22 620W allele associates with multiple autoimmune phenotypes. Am J Hum Genet 76:561-571.

161

243. Yang, W., N. Shen, D. Q. Ye, Q. Liu, Y. Zhang, X. X. Qian, N. Hirankarn, D. Ying, H. F. Pan, C. C. Mok, T. M. Chan, R. W. Wong, K. W. Lee, M. Y. Mok, S. N. Wong, A. M. Leung, X. P. Li, Y. Avihingsanon, C. M. Wong, T. L. Lee, M. H. Ho, P. P. Lee, Y. K. Chang, P. H. Li, R. J. Li, L. Zhang, W. H. Wong, I. O. Ng, C. S. Lau, P. C. Sham, Y. L. Lau, and C. Asian Lupus Genetics. 2010. Genome-wide association study in Asian populations identifies variants in ETS1 and WDFY4 associated with systemic lupus erythematosus. PLoS Genet 6:e1000841.

244. Remmers, E. F., R. M. Plenge, A. T. Lee, R. R. Graham, G. Hom, T. W. Behrens, P. I. de Bakker, J. M. Le, H. S. Lee, F. Batliwalla, W. Li, S. L. Masters, M. G. Booty, J. P. Carulli, L. Padyukov, L. Alfredsson, L. Klareskog, W. V. Chen, C. I. Amos, L. A. Criswell, M. F. Seldin, D. L. Kastner, and P. K. Gregersen. 2007. STAT4 and the risk of rheumatoid arthritis and systemic lupus erythematosus. N.Engl.J Med. 357:977-986.

245. Taylor, K. E., E. F. Remmers, A. T. Lee, W. A. Ortmann, R. M. Plenge, C. Tian, S. A. Chung, J. Nititham, G. Hom, A. H. Kao, F. Y. Demirci, M. I. Kamboh, M. Petri, S. Manzi, D. L. Kastner, M. F. Seldin, P. K. Gregersen, T. W. Behrens, and L. A. Criswell. 2008. Specificity of the STAT4 genetic association for severe disease manifestations of systemic lupus erythematosus. PLoS Genet 4:e1000084.

246. Abelson, A. K., A. M. gado-Vega, S. V. Kozyrev, E. Sanchez, R. Velazquez-Cruz, N. Eriksson, J. Wojcik, M. V. Linga Reddy, G. Lima, S. D'Alfonso, S. Migliaresi, V. Baca, L. Orozco, T. Witte, N. Ortego-Centeno, H. Abderrahim, B. A. Pons-Estel, C. Gutierrez, A. Suarez, M. F. Gonzalez- Escribano, J. Martin, and M. E. arcon-Riquelme. 2009. STAT4 associates with systemic lupus erythematosus through two independent effects that correlate with gene expression and act additively with IRF5 to increase risk. Ann.Rheum.Dis. 68:1746-1753.

247. Kariuki, S. N., K. A. Kirou, E. J. MacDermott, L. Barillas-Arias, M. K. Crow, and T. B. Niewold. 2009. Cutting edge: autoimmune disease risk variant of STAT4 confers increased sensitivity to IFN-alpha in lupus patients in vivo. J Immunol 182:34-38.

248. Croft, M., T. So, W. Duan, and P. Soroosh. 2009. The significance of OX40 and OX40L to T-cell biology and immune disease. Immunol Rev 229:173-191.

249. Cunninghame Graham, D. S., R. R. Graham, H. Manku, A. K. Wong, J. C. Whittaker, P. M. Gaffney, K. L. Moser, J. D. Rioux, D. Altshuler, T. W. Behrens, and T. J. Vyse. 2008. Polymorphism at the TNF superfamily gene TNFSF4 confers susceptibility to systemic lupus erythematosus. Nat.Genet. 40:83-89.

250. Keir, M. E., M. J. Butte, G. J. Freeman, and A. H. Sharpe. 2008. PD-1 and its ligands in tolerance and immunity. Annu Rev Immunol 26:677-704.

251. Prokunina, L., C. Castillejo-Lopez, F. Oberg, I. Gunnarsson, L. Berg, V. Magnusson, A. J. Brookes, D. Tentler, H. Kristjansdottir, G. Grondal, A. I. Bolstad, E. Svenungsson, I. Lundberg, G. Sturfelt, A. Jonssen, L. Truedsson, G. Lima, J. Alcocer-Varela, R. Jonsson, U. B. Gyllensten, J. B. Harley, D. Alarcon-Segovia, K. Steinsson, and M. E. Alarcon-Riquelme. 2002. A regulatory

162

polymorphism in PDCD1 is associated with susceptibility to systemic lupus erythematosus in humans. Nat Genet 32:666-669.

252. Thorburn, C. M., L. Prokunina-Olsson, K. A. Sterba, R. F. Lum, M. F. Seldin, M. E. arcon- Riquelme, and L. A. Criswell. 2007. Association of PDCD1 genetic variation with risk and clinical manifestations of systemic lupus erythematosus in a multiethnic cohort. Genes Immun. 8:279- 287.

253. Anaya, J. M., X. Kim-Howard, S. Prahalad, A. Chernavsky, C. Canas, A. Rojas-Villarraga, J. Bohnsack, R. Jonsson, A. I. Bolstad, J. G. Brun, B. Cobb, K. L. Moser, J. A. James, J. B. Harley, and S. K. Nath. 2012. Evaluation of genetic association between an ITGAM non-synonymous SNP (rs1143679) and multiple autoimmune diseases. Autoimmun Rev 11:276-280.

254. Rhodes, B., B. G. Furnrohr, A. L. Roberts, G. Tzircotis, G. Schett, T. D. Spector, and T. J. Vyse. 2012. The rs1143679 (R77H) lupus associated variant of ITGAM (CD11b) impairs complement receptor 3 mediated functions in human monocytes. Ann Rheum Dis 71:2028-2034.

255. Han, S., X. Kim-Howard, H. Deshmukh, Y. Kamatani, P. Viswanathan, J. M. Guthridge, K. Thomas, K. M. Kaufman, J. Ojwang, A. Rojas-Villarraga, V. Baca, L. Orozco, B. Rhodes, C. B. Choi, P. K. Gregersen, J. T. Merrill, J. A. James, P. M. Gaffney, K. L. Moser, C. O. Jacob, R. P. Kimberly, J. B. Harley, S. C. Bae, J. M. Anaya, M. E. Alarcon-Riquelme, K. Matsuda, T. J. Vyse, and S. K. Nath. 2009. Evaluation of imputation-based association in and around the integrin- alpha-M (ITGAM) gene and replication of robust association between a non-synonymous functional variant within ITGAM and systemic lupus erythematosus (SLE). Hum Mol Genet 18:1171-1180.

256. Salmon, J. E., S. Millard, L. A. Schachter, F. C. Arnett, E. M. Ginzler, M. F. Gourley, R. Ramsey- Goldman, M. G. Peterson, and R. P. Kimberly. 1996. Fc gamma RIIA alleles are heritable risk factors for lupus nephritis in African Americans. J Clin Invest 97:1348-1354.

257. Moser, K. L., B. R. Neas, J. E. Salmon, H. Yu, C. Gray-McGuire, N. Asundi, G. R. Bruner, J. Fox, J. Kelly, S. Henshall, D. Bacino, M. Dietz, R. Hogue, G. Koelsch, L. Nightingale, T. Shaver, N. I. Abdou, D. A. Albert, C. Carson, M. Petri, E. L. Treadwell, J. A. James, and J. B. Harley. 1998. Genome scan of human systemic lupus erythematosus: evidence for linkage on chromosome 1q in African-American pedigrees. Proc Natl Acad Sci U S A 95:14869-14874.

258. Edberg, J. C., C. D. Langefeld, J. Wu, K. L. Moser, K. M. Kaufman, J. Kelly, V. Bansal, W. M. Brown, J. E. Salmon, S. S. Rich, J. B. Harley, and R. P. Kimberly. 2002. Genetic linkage and association of Fcgamma receptor IIIA (CD16A) on chromosome 1q23 with human systemic lupus erythematosus. Arthritis Rheum 46:2132-2140.

259. Karassa, F. B., T. A. Trikalinos, J. P. Ioannidis, and R.-S. L. E. M.-A. I. Fcgamma. 2002. Role of the Fcgamma receptor IIa polymorphism in susceptibility to systemic lupus erythematosus and lupus nephritis: a meta-analysis. Arthritis Rheum 46:1563-1571.

163

260. Willcocks, L. C., P. A. Lyons, M. R. Clatworthy, J. I. Robinson, W. Yang, S. A. Newland, V. Plagnol, N. N. McGovern, A. M. Condliffe, E. R. Chilvers, D. Adu, E. C. Jolly, R. Watts, Y. L. Lau, A. W. Morgan, G. Nash, and K. G. Smith. 2008. Copy number of FCGR3B, which is associated with systemic lupus erythematosus, correlates with protein expression and immune complex uptake. J Exp Med 205:1573-1582.

261. Magnusson, V., B. Johanneson, G. Lima, J. Odeberg, D. arcon-Segovia, and M. E. arcon- Riquelme. 2004. Both risk alleles for FcgammaRIIA and FcgammaRIIIA are susceptibility factors for SLE: a unifying hypothesis. Genes Immun. 5:130-137.

262. Lee, Y. H., J. D. Ji, and G. G. Song. 2009. Fcgamma receptor IIB and IIIB polymorphisms and susceptibility to systemic lupus erythematosus and lupus nephritis: a meta-analysis. Lupus 18:727-734.

263. Reininger, L., T. H. Winkler, C. P. Kalberer, M. Jourdan, F. Melchers, and A. G. Rolink. 1996. Intrinsic B cell defects in NZB and NZW mice contribute to systemic lupus erythematosus in (NZB x NZW)F1 mice. J Exp Med. 184:853-861.

264. Hsu, H. C., Y. Wu, P. Yang, Q. Wu, G. Job, J. Chen, J. Wang, M. A. Accavitti-Loper, W. E. Grizzle, R. H. Carter, and J. D. Mountz. 2007. Overexpression of activation-induced cytidine deaminase in B cells is associated with production of highly pathogenic autoantibodies. J Immunol 178:5357-5365.

265. Jiang, C., M. L. Zhao, and M. Diaz. 2009. Activation-induced deaminase heterozygous MRL/lpr mice are delayed in the production of high-affinity pathogenic antibodies and in the development of lupus nephritis. Immunology 126:102-113.

266. Bishop, G. A., and B. S. Hostager. 2003. The CD40-CD154 interaction in B cell-T cell liaisons. Cytokine Growth Factor Rev 14:297-309.

267. Tsao, P. Y., J. Jiao, M. Q. Ji, P. L. Cohen, and R. A. Eisenberg. 2008. T cell-independent spontaneous loss of tolerance by anti-double-stranded DNA B cells in C57BL/6 mice. J Immunol. 181:7770-7777.

268. Chen, S. Y., Y. Takeoka, A. A. Ansari, R. Boyd, D. M. Klinman, and M. E. Gershwin. 1996. The natural history of disease expression in CD4 and CD8 gene-deleted New Zealand black (NZB) mice. J Immunol. 157:2676-2684.

269. Sadanaga, A., H. Nakashima, M. Akahoshi, K. Masutani, K. Miyake, T. Igawa, N. Sugiyama, H. Niiro, and M. Harada. 2007. Protection against autoimmune nephritis in MyD88-deficient MRL/lpr mice. Arthritis Rheum 56:1618-1628.

270. Lau, C. M., C. Broughton, A. S. Tabor, S. Akira, R. A. Flavell, M. J. Mamula, S. R. Christensen, M. J. Shlomchik, G. A. Viglianti, I. R. Rifkin, and A. Marshak-Rothstein. 2005. RNA-associated

164

autoantigens activate B cells by combined B cell antigen receptor/Toll-like receptor 7 engagement. J Exp Med. 202:1171-1177.

271. Ronnblom, L., and V. Pascual. 2008. The innate immune system in SLE: type I interferons and dendritic cells. Lupus 17:394-399.

272. Izui, S., P. J. McConahey, and F. J. Dixon. 1978. Increased spontaneous polyclonal activation of B lymphocytes in mice with spontaneous autoimmune disease. J Immunol. 121:2213-2219.

273. Cohen, P. L., and M. Ziff. 1977. Abnormal polyclonal B cell activation in NZB/NZW F1 mice. J Immunol. 119:1534-1537.

274. Wither, J. E., V. Roy, and L. A. Brennan. 2000. Activated B cells express increased levels of costimulatory molecules in young autoimmune NZB and (NZB x NZW)F(1) mice. Clin Immunol. 94:51-63.

275. Raveche, E. S., A. D. Steinberg, A. L. DeFranco, and J. H. Tjio. 1982. Cell cycle analysis of lymphocyte activation in normal and autoimmune strains of mice. J Immunol. 129:1219-1226.

276. Roy, V., G. Bonventi, Y. Cai, R. MacLeod, and J. E. Wither. 2007. Immune mechanisms leading to abnormal B cell selection and activation in New Zealand Black mice. Eur.J Immunol. 37:2645- 2656.

277. Renshaw, B. R., W. C. Fanslow, 3rd, R. J. Armitage, K. A. Campbell, D. Liggitt, B. Wright, B. L. Davison, and C. R. Maliszewski. 1994. Humoral immune responses in CD40 ligand-deficient mice. J Exp Med. 180:1889-1900.

278. Yager, T. D., C. T. McMurray, and K. E. van Holde. 1989. Salt-induced release of DNA from nucleosome core particles. Biochemistry 28:2271-2281.

279. Miranda-Carus, M. E., A. D. Askanase, R. M. Clancy, F. Di Donato, T. M. Chou, M. R. Libera, E. K. Chan, and J. P. Buyon. 2000. Anti-SSA/Ro and anti-SSB/La autoantibodies bind the surface of apoptotic fetal cardiocytes and promote secretion of TNF-alpha by macrophages. J Immunol 165:5345-5351.

280. Crow, M. K., and J. Wohlgemuth. 2003. Microarray analysis of gene expression in lupus. Arthritis research & therapy 5:279-287.

281. Stark, G. R., I. M. Kerr, B. R. Williams, R. H. Silverman, and R. D. Schreiber. 1998. How cells respond to interferons. Annual Review of Biochemistry 67:227-264.

282. Herlands, R. A., S. R. Christensen, R. A. Sweet, U. Hershberg, and M. J. Shlomchik. 2008. T cell- independent and toll-like receptor-dependent antigen-driven activation of autoreactive B cells. Immunity. 29:249-260.

165

283. Homann, D., A. Jahreis, T. Wolfe, A. Hughes, B. Coon, M. J. van Stipdonk, K. R. Prilliman, S. P. Schoenberger, and M. G. von Herrath. 2002. CD40L blockade prevents autoimmune diabetes by induction of bitypic NK/DC regulatory cells. Immunity 16:403-415.

284. Eloranta, M. L., T. Lovgren, D. Finke, L. Mathsson, J. Ronnelid, B. Kastner, G. V. Alm, and L. Ronnblom. 2009. Regulation of the interferon-alpha production induced by RNA-containing immune complexes in plasmacytoid dendritic cells. Arthritis Rheum 60:2418-2427.

285. Hoyer, B. F., K. Moser, A. E. Hauser, A. Peddinghaus, C. Voigt, D. Eilat, A. Radbruch, F. Hiepe, and R. A. Manz. 2004. Short-lived plasmablasts and long-lived plasma cells contribute to chronic humoral autoimmunity in NZB/W mice. J Exp Med 199:1577-1584.

286. Odegard, J. M., B. R. Marks, L. D. DiPlacido, A. C. Poholek, D. H. Kono, C. Dong, R. A. Flavell, and J. Craft. 2008. ICOS-dependent extrafollicular helper T cells elicit IgG production via IL-21 in systemic autoimmunity. J Exp Med. 205:2873-2886.

287. Hu, Y. L., D. P. Metz, J. Chung, G. Siu, and M. Zhang. 2009. B7RP-1 blockade ameliorates autoimmunity through regulation of follicular helper T cells. J Immunol 182:1421-1428.

288. Schneider, P. 2005. The role of APRIL and BAFF in lymphocyte activation. Current opinion in immunology 17:282-289.

289. Vallin, H., A. Perers, G. V. Alm, and L. Ronnblom. 1999. Anti-double-stranded DNA antibodies and immunostimulatory plasmid DNA in combination mimic the endogenous IFN-alpha inducer in systemic lupus erythematosus. J Immunol 163:6306-6313.

290. Ma, D. Y., and E. A. Clark. 2009. The role of CD40 and CD154/CD40L in dendritic cells. Semin Immunol 21:265-272.

291. Vasconcellos, R., D. Braun, A. Coutinho, and J. Demengeot. 1999. Type I IFN sets the stringency of B cell repertoire selection in the bone marrow. Int Immunol 11:279-288.

292. Palucka, A. K., J. P. Blanck, L. Bennett, V. Pascual, and J. Banchereau. 2005. Cross-regulation of TNF and IFN-alpha in autoimmune diseases. Proc.Natl.Acad.Sci.U.S.A 102:3372-3377.

293. Burlingame, R. W., M. L. Boey, G. Starkebaum, and R. L. Rubin. 1994. The central role of chromatin in autoimmune responses to histones and DNA in systemic lupus erythematosus. J Clin Invest 94:184-192.

294. Pau, E., C. Loh, G. E. Minty, N. H. Chang, and J. E. Wither. 2013. Identification of a lupus- susceptibility locus leading to impaired clearance of apoptotic debris on New Zealand Black chromosome 13. Genes Immun 14:154-161.

166

295. Kikuchi, S., H. Amano, E. Amano, L. Fossati-Jimack, M. L. Santiago-Raber, T. Moll, A. Ida, B. L. Kotzin, and S. Izui. 2005. Identification of 2 major loci linked to autoimmune hemolytic anemia in NZB mice. Blood 106:1323-1329.

296. Lovgren, T., M. L. Eloranta, B. Kastner, M. Wahren-Herlenius, G. V. Alm, and L. Ronnblom. 2006. Induction of interferon-alpha by immune complexes or liposomes containing systemic lupus erythematosus autoantigen- and Sjogren's syndrome autoantigen-associated RNA. Arthritis Rheum. 54:1917-1927.

297. Savarese, E., O. W. Chae, S. Trowitzsch, G. Weber, B. Kastner, S. Akira, H. Wagner, R. M. Schmid, S. Bauer, and A. Krug. 2006. U1 small nuclear ribonucleoprotein immune complexes induce type I interferon in plasmacytoid dendritic cells through TLR7. Blood 107:3229-3234.

298. Gilliet, M., W. Cao, and Y. J. Liu. 2008. Plasmacytoid dendritic cells: sensing nucleic acids in viral infection and autoimmune diseases. Nature reviews.Immunology 8:594-606.

299. Waibler, Z., M. Anzaghe, A. Konur, S. Akira, W. Muller, and U. Kalinke. 2008. Excessive CpG 1668 stimulation triggers IL-10 production by cDC that inhibits IFN-alpha responses by pDC. Eur.J Immunol. 38:3127-3137.

300. Rubtsov, A. V., K. Rubtsova, A. Fischer, R. T. Meehan, J. Z. Gillis, J. W. Kappler, and P. Marrack. 2011. Toll-like receptor 7 (TLR7)-driven accumulation of a novel CD11c B-cell population is important for the development of autoimmunity. Blood 118:1305-1315.

301. Bjorck, P., H. X. Leong, and E. G. Engleman. 2011. Plasmacytoid dendritic cell dichotomy: identification of IFN-alpha producing cells as a phenotypically and functionally distinct subset. J Immunol 186:1477-1485.

302. Gohlke, P. R., J. C. Williams, B. J. Vilen, S. R. Dillon, R. Tisch, and G. K. Matsushima. 2009. The receptor tyrosine kinase MerTK regulates dendritic cell production of BAFF. Autoimmunity 42:183-197.

303. Asselin-Paturel, C., G. Brizard, K. Chemin, A. Boonstra, A. O'Garra, A. Vicari, and G. Trinchieri. 2005. Type I interferon dependence of plasmacytoid dendritic cell activation and migration. J Exp Med. 201:1157-1167.

304. Nagai, Y., K. P. Garrett, S. Ohta, U. Bahrun, T. Kouro, S. Akira, K. Takatsu, and P. W. Kincade. 2006. Toll-like receptors on hematopoietic progenitor cells stimulate innate immune system replenishment. Immunity 24:801-812.

305. Colonna, M., G. Trinchieri, and Y. J. Liu. 2004. Plasmacytoid dendritic cells in immunity. Nat.Immunol. 5:1219-1226.

306. Iwasaki, A., and R. Medzhitov. 2004. Toll-like receptor control of the adaptive immune responses. Nat.Immunol. 5:987-995.

167

307. Shortman, K., and S. H. Naik. 2007. Steady-state and inflammatory dendritic-cell development. Nature reviews.Immunology 7:19-30.

308. Balazs, M., F. Martin, T. Zhou, and J. Kearney. 2002. Blood dendritic cells interact with splenic marginal zone B cells to initiate T-independent immune responses. Immunity 17:341-352.

309. Pau, E., N. H. Chang, C. Loh, G. Lajoie, and J. E. Wither. 2011. Abrogation of pathogenic IgG autoantibody production in CD40L gene-deleted lupus-prone New Zealand Black mice. Clin Immunol 139:215-227.

310. Nagata, S., R. Hanayama, and K. Kawane. 2010. Autoimmunity and the clearance of dead cells. Cell 140:619-630.

311. Pan, Z. J., K. Davis, S. Maier, M. P. Bachmann, X. R. Kim-Howard, C. Keech, T. P. Gordon, J. McCluskey, and A. D. Farris. 2006. Neo-epitopes are required for immunogenicity of the La/SS-B nuclear antigen in the context of late apoptotic cells. Clin Exp Immunol 143:237-248.

312. Miksa, M., H. Komura, R. Wu, K. G. Shah, and P. Wang. 2009. A novel method to determine the engulfment of apoptotic cells by macrophages using pHrodo succinimidyl ester. J Immunol Methods 342:71-77.

313. Potter, P. K., J. Cortes-Hernandez, P. Quartier, M. Botto, and M. J. Walport. 2003. Lupus-prone mice have an abnormal response to thioglycolate and an impaired clearance of apoptotic cells. J Immunol 170:3223-3232.

314. Licht, R., J. W. Dieker, C. W. Jacobs, W. J. Tax, and J. H. Berden. 2004. Decreased phagocytosis of apoptotic cells in diseased SLE mice. J Autoimmun. 22:139-145.

315. Bygrave, A. E., K. L. Rose, J. Cortes-Hernandez, J. Warren, R. J. Rigby, H. T. Cook, M. J. Walport, T. J. Vyse, and M. Botto. 2004. Spontaneous autoimmunity in 129 and C57BL/6 mice- implications for autoimmunity described in gene-targeted mice. PLoS Biol 2:E243.

316. Fadok, V. A., D. J. Laszlo, P. W. Noble, L. Weinstein, D. W. Riches, and P. M. Henson. 1993. Particle digestibility is required for induction of the phosphatidylserine recognition mechanism used by murine macrophages to phagocytose apoptotic cells. J Immunol 151:4274-4285.

317. Hanayama, R., M. Tanaka, K. Miwa, and S. Nagata. 2004. Expression of developmental endothelial locus-1 in a subset of macrophages for engulfment of apoptotic cells. J Immunol 172:3876-3882.

318. Miyanishi, M., K. Tada, M. Koike, Y. Uchiyama, T. Kitamura, and S. Nagata. 2007. Identification of Tim4 as a phosphatidylserine receptor. Nature 450:435-439.

319. Ravichandran, K. S. 2011. Beginnings of a good apoptotic meal: the find-me and eat-me signaling pathways. Immunity 35:445-455.

168

320. Rodriguez-Manzanet, R., M. A. Sanjuan, H. Y. Wu, F. J. Quintana, S. Xiao, A. C. Anderson, H. L. Weiner, D. R. Green, and V. K. Kuchroo. 2010. T and B cell hyperactivity and autoimmunity associated with niche-specific defects in apoptotic body clearance in TIM-4-deficient mice. Proc Natl Acad Sci U S A 107:8706-8711.

321. Levine, B., and V. Deretic. 2007. Unveiling the roles of autophagy in innate and adaptive immunity. Nat Rev Immunol 7:767-777.

322. Qu, X., Z. Zou, Q. Sun, K. Luby-Phelps, P. Cheng, R. N. Hogan, C. Gilpin, and B. Levine. 2007. Autophagy gene-dependent clearance of apoptotic cells during embryonic development. Cell 128:931-946.

323. Leroy, V., M. Kihara, L. Baudino, G. Brighouse, L. H. Evans, and S. Izui. 2012. Sgp3 and TLR7 stimulation differentially alter the expression profile of modified polytropic retroviruses implicated in murine systemic lupus. J Autoimmun 38:361-368.

324. Chavakis, E., E. Y. Choi, and T. Chavakis. 2009. Novel aspects in the regulation of the leukocyte adhesion cascade. Thromb Haemost 102:191-197.

325. Dasgupta, S. K., A. Le, T. Chavakis, R. E. Rumbaut, and P. Thiagarajan. 2012. Developmental endothelial locus-1 (Del-1) mediates clearance of platelet microparticles by the endothelium. Circulation 125:1664-1672.

326. Choi, E. Y., E. Chavakis, M. A. Czabanka, H. F. Langer, L. Fraemohs, M. Economopoulou, R. K. Kundu, A. Orlandi, Y. Y. Zheng, D. A. Prieto, C. M. Ballantyne, S. L. Constant, W. C. Aird, T. Papayannopoulou, C. G. Gahmberg, M. C. Udey, P. Vajkoczy, T. Quertermous, S. Dimmeler, C. Weber, and T. Chavakis. 2008. Del-1, an endogenous leukocyte-endothelial adhesion inhibitor, limits inflammatory cell recruitment. Science 322:1101-1104.

327. Eskan, M. A., R. Jotwani, T. Abe, J. Chmelar, J. H. Lim, S. Liang, P. A. Ciero, J. L. Krauss, F. Li, M. Rauner, L. C. Hofbauer, E. Y. Choi, K. J. Chung, A. Hashim, M. A. Curtis, T. Chavakis, and G. Hajishengallis. 2012. The leukocyte integrin antagonist Del-1 inhibits IL-17-mediated inflammatory bone loss. Nat Immunol 13:465-473.

328. Wirawan, E., T. Vanden Berghe, S. Lippens, P. Agostinis, and P. Vandenabeele. 2012. Autophagy: for better or for worse. Cell Res 22:43-61.

329. Pua, H. H., I. Dzhagalov, M. Chuck, N. Mizushima, and Y. W. He. 2007. A critical role for the autophagy gene Atg5 in T cell survival and proliferation. J Exp Med 204:25-31.

330. Miller, B. C., Z. Zhao, L. M. Stephenson, K. Cadwell, H. H. Pua, H. K. Lee, N. N. Mizushima, A. Iwasaki, Y. W. He, W. Swat, and H. W. t. Virgin. 2008. The autophagy gene ATG5 plays an essential role in B lymphocyte development. Autophagy 4:309-314.

169

331. Crow, M. K., and K. A. Kirou. 2004. Interferon-alpha in systemic lupus erythematosus. Curr.Opin.Rheumatol. 16:541-547.

332. Bjorck, P. 2004. Dendritic cells exposed to herpes simplex virus in vivo do not produce IFN- alpha after rechallenge with virus in vitro and exhibit decreased T cell alloreactivity. J Immunol 172:5396-5404.

333. Prete, F., M. Catucci, M. Labrada, S. Gobessi, M. C. Castiello, E. Bonomi, A. Aiuti, W. Vermi, C. Cancrini, A. Metin, S. Hambleton, R. Bredius, L. D. Notarangelo, M. van der Burg, U. Kalinke, A. Villa, and F. Benvenuti. 2013. Wiskott-Aldrich syndrome protein-mediated actin dynamics control type-I interferon production in plasmacytoid dendritic cells. J Exp Med Jan. 23 [Epub ahead of print].

334. Anolik, J. H., A. Palanichamy, J. Bauer, J. Barnard, J. Biear, R. Dedrick, I. Sanz, J. Liesveld, and E. Baechler. 2012. B cells at the adaptive-innate immune system interface in SLE. Arthritis Res Ther. 14 (Suppl 3):A24.

335. Lande, R., D. Ganguly, V. Facchinetti, L. Frasca, C. Conrad, J. Gregorio, S. Meller, G. Chamilos, R. Sebasigari, V. Riccieri, R. Bassett, H. Amuro, S. Fukuhara, T. Ito, Y. J. Liu, and M. Gilliet. 2011. Neutrophils activate plasmacytoid dendritic cells by releasing self-DNA-peptide complexes in systemic lupus erythematosus. Sci Transl Med 3:73ra19.

336. Knight, J. S., and M. J. Kaplan. 2012. Lupus neutrophils: 'NET' gain in understanding lupus pathogenesis. Curr Opin Rheumatol 24:441-450.