DOCSLIB.ORG

In Vivo Effects on the Intestinal Microflora of Physalis Alkekengi Var

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
In Vivo Effects on the Intestinal Microflora of Physalis Alkekengi Var Fitoterapia 87 (2013) 43–48 Contents lists available at SciVerse ScienceDirect Fitoterapia journal homepage: www.elsevier.com/locate/fitote In vivo effects on the intestinal microflora of Physalis alkekengi var. francheti extracts Xinli Li, Cuili Zhang, Weiling Li, Dachang Wu, Jianjun Liu, Li Tang, Yi Xin ⁎ Department of Biotechnology, Dalian Medical University, Dalian China article info abstract Article history: This study aimed to investigate the effects on the intestinal microflora balance of Physalis Received 6 December 2012 alkekengi var. francheti extracts (PE) using in vivo mouse model. Luteolin-7-O-β-glycoside, Accepted in revised form 15 March 2013 Physalin J, Physalin D, and Physalin P were isolated from PE extracts and identified. Bacteroides, Available online 2 April 2013 Lactobacillus, Helicobacter, Prevotella, Odoribacter and Oribacterium were detected as dominant organisms in the intestinal tract of mice by denaturing gradient gel electrophoresis (DGGE) Keywords: analysis. The quality and quantity of Lactobacillus genus increased significantly with increasing Physalis alkekengi var. francheti concentration of PE. This study shows that the intestinal microflora balance could be improved Isolation by PE, and thus, it has the significant potential to be used as a natural agent for restoring the Intestinal microflora balance intestinal microflora balance. DGGE Crown Copyright © 2013 Published by Elsevier B.V. All rights reserved. 1. Introduction analysis to give insights into the microbial similarity and diversity of the sites, while UPGMA dendrogram construc- Physalis alkekengi var. francheti of the family of Solanaceae tion [8,9] and sequencing [10] were done to test for DGGE is a well-known edible and medicinal plant in the northeast- motifs and taxa. The results clearly indicated that the intestinal ern part of China. Its fruit calyx has been used in traditional microflora balance was improved, and therefore, P. alkekengi Chinese medicine as a therapeutic agent to remove heat, detoxify var. francheti has a significant potential to be used as a natural the body and relieve sore-throat [1].Ithasgreatmedicinal agent for improving the intestinal microflora balance. potential, and a stable form of P. alkekengi var. francheti product could be developed to fulfill the health food market. Studies on P. alkekengi var. francheti have attracted more attention in recent 2. Materials and methods years due to its potential biological functions. In addition its active components, such as physalins, polysaccharides and 2.1. Materials and chemicals flavones have been widely studied [2–6]. However, to the best of our knowledge, no studies on effects P. alkekengi var. francheti was purchased from Dalian of P. alkekengi var. francheti on the intestinal microflora balance Traditional Chinese Medicine Market, China in October 2011 and have been carried out. We therefore specifically evaluated the identified according to the identification standard of the People's effects of PE on intestinal bacterium in vitro and in vivo.PEwas Republic of China's Pharmacopeia. A voucher specimen (No. extracted with EtOH, refined by macroporous resin and analyzed LP201102) is deposited in the Department of Biotechnology, by HPLC. It showed stimulative effect on the growth of probiotics Dalian Medical University, China. AB-8 macroporous adsorptive but inhibitory effect on the pathogenic bacterium [7].Denaturing resin was purchased from the chemical plant of Nankai Uni- gradient gel electrophoresis (DGGE) was combined with image versity, China. E.Z.N.A® Stool DNA Kit was purchased from Omega (Bio-tek, USA). ExTaq polymerase was purchased from TaKaRaBiotechnologyCo.,Ltd.(Dalian,China).Polymerase ⁎ Corresponding author. Tel./fax: +86 411 86110296. Chain Reaction primers GC-357f, 518r and 357f (Table 1)were E-mail address: [email protected] (Y. Xin). synthesized by TaKaRa Biotechnology Co., Ltd. LiZhu ChangLe 0367-326X/$ – see front matter. Crown Copyright © 2013 Published by Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.fitote.2013.03.018 44 X. Li et al. / Fitoterapia 87 (2013) 43–48 capsule (Approval Number: S10960040) and levofloxacin standardized conditions at a temperature of 22–24 °C, and capsule (Approval Number: H20066206) were purchased 20% humidity with a 12 h light/dark cycle, and they had free from Dalian Pharmacy of China. All other chemical reagents access to standard diet and water ad libitum. They were used were analytical grade. allowed to acclimatize for five days before the experiments were started. 2.2. Extraction and isolation 2.4.2. Antibiotic-induced intestinal microflora imbalance model The air dried P alkekengi var. francheti (3 kg) were extracted in mice two times in refluxing EtOH (70%) for 2 h at 60 °C. The solvent Intestinal microflora imbalance was induced by intragastric was evaporated to dryness, and the dry residue (1.5 kg) was (i.g.) administration with levofloxacin at the dose of 65 mg/kg subjected to AB-8 macroporous adsorptive resin (12 kg), eluted dissolved in water [11]. with water (14 L), 50% EtOH (22 L), and 95% EtOH (15 L) successively to yieldthreefractions(H2O fr., 50% fr. and 95% fr.). 2.4.3. Experimental design 50% fr. was collected and dried to form PE (yield, 165.0 g). Eighty mice were randomly divided into eight groups PE was further fractionated by column chromatography on (ten mice in each group). silica gel eluting with CH2Cl2/MeOH (10:1 → 1:1, v/v) to give seven fractions (SG fr. 1– 7). SG fr. 2 (20.3 g) was recrystallized Group 1 Normal control (NC), normal mice treated with water. from MeOH to give 4 (0.32 g). SG fr. 7 (48.0 g) was recrystallized Group 2 Levofloxacin control (LC), normal mice treated with from MeOH to give 1 (2.02g).SGfr.4(33.8g)wasseparatedby levofloxacin. column chromatography on silica gel eluting with CH2Cl2/MeOH Group 3 PE-L, levofloxacin-treated mice with 80 mg/kg of PE. (8:1 → 1:1, v/v) to give four fractions (SG fr. 4.1–SG fr. 4.4). SG Group 4 PE-M, levofloxacin-treated mice with 160 mg/kg of fr.4.3wasfurtherseparatedbyHPLConareverse-phasecolumn PE. (10 × 250 mm with a particle size of 5 μm, Tokyo, Japan) using Group 5 PE-H, levofloxacin-treated mice with 330 mg/kg of MeOH/H2O (4:6) to give 2 (0.51 g) and 3 (0.88 g). PE. Group 6 LZ-L, levofloxacin-treated mice with 50 mg/kg of 2.3. High performance liquid chromatography (HPLC) analysis LiZhu ChangLe capsule. Group 7 LZ-M, levofloxacin-treated mice with 100 mg/kg of The sample PE (18 mg) was dissolved in distilled water LiZhu ChangLe capsule. (2 ml) and filtered with a 0.22 μm filter. Then the flow-through Group 8 LZ-H, levofloxacin-treated mice with 200 mg/kg of solution was analyzed by HPLC system (LC-2010A, Shimadzu, LiZhu ChangLe capsule. Japan) with a reversed-phase Waters Symmetry® C18 column (4.6 × 150 mm with a particle size of 5 μm). The mobile phase Every drug (or water for NC) was administered by i.g. once consisted of solvent A (acetonitrile) and solvent B (0.05% a day. The consumption of diet and water, and body weight phosphoric acid) with gradient program of 0–15 min, 5–8% A; were recorded daily. After 7 consecutive days of treatment, 15–25 min, 8–18% A; and 25–60 min, 18–35% A. The flow rate fecal were collected and preserved at −80 °C. was maintained at 1.0 ml/min and the injection volume was 10 μl. Ultraviolet detection was carried out at 230 nm. The 2.4.4. Deoxyribonucleic acid (DNA) extraction column temperature was kept at 35 °C. DNA was extracted from fecal samples with E.Z.N.A® Stool Compounds 1 (3.3 mg), 2 (3.08 mg), 3 (4.02 mg), and 4 DNA Kit in accordance with the manufacturer's instructions. (4.0 mg) were dissolved in distilled water (1 ml for each), and The amount and quality of DNA extracts were analyzed by filtered with a 0.22 μm filter. They were analyzed through the electrophoresis of 1% agarose gel containing ethidium bromide, same HPLC conditions as outlined above. andcomparedtoamolecularweightstandard(1kb).TheDNA concentration was measured spectrophotometrically using 2.4. In vivo effects on the intestinal microflora Biophotometer plus (NanoVue, USA) and DAN extracts were preserved at −20 °C until used. 2.4.1. Animals Female BALB/c mice weighing 20 ± 2 g, purchased from 2.4.5. Polymerase chain reaction (PCR) amplification Animal Experimental Center of Dalian Medical University Primers GC-357f and 518r were used to amplify the V3 [Certificate of quality number: SCXK (Liao) 2008-0002] were region of bacterial 16S rRNA. PCR amplification was performed used for all animal experiments. The mice were kept under with an automated thermocycler (Thermo, USA) as follows: 3 μl purified genomic DNA as template (300 ng approximately), 10 × ExTaq buffer (Mg2+ plus) 2.5 μl, dNTP mixture 4 μl, BSA Table 1 (1 mg/ml) 2.5 μl, 10 pmol of each primer, 1.25 U of ExTaq Nucleotide sequences of primers to be used in this study. polymerase, and filled up to a volume of 25 μl with sterile Primer Sequence 5′–3′ Milli-Q water. The thermal program consisted of an initial denaturation step of 94 °C for 5 min, followed by 30 cycles of GC-357fa CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGG ACGGGGGGCCTACGGGAGGCAGCAG 94 °C, 54 °C, and 72 °C for 30 s each, in which the annealing 518rb ATTACCGCGGCTGCTGG temperature was 72 °C for 7 min [12].Amplificationproducts 357fa CCTACGGGAGGCAGCAG were analyzed first by electrophoresis of 1% agarose gel a Forward. containing ethidium bromide, and compared to a molecular b Reverse. weight standard (100 bp). X. Li et al. / Fitoterapia 87 (2013) 43–48 45 2.4.6.
Load more

Recommended publications
  • Colonial Garden Plants
    COLONIAL GARD~J~ PLANTS I Flowers Before 1700 The following plants are listed according to the names most commonly used during the colonial period. The botanical name follows for accurate identification. The common name was listed first because many of the people using these lists will have access to or be familiar with that name rather than the botanical name. The botanical names are according to Bailey’s Hortus Second and The Standard Cyclopedia of Horticulture (3, 4). They are not the botanical names used during the colonial period for many of them have changed drastically. We have been very cautious concerning the interpretation of names to see that accuracy is maintained. By using several references spanning almost two hundred years (1, 3, 32, 35) we were able to interpret accurately the names of certain plants. For example, in the earliest works (32, 35), Lark’s Heel is used for Larkspur, also Delphinium. Then in later works the name Larkspur appears with the former in parenthesis. Similarly, the name "Emanies" appears frequently in the earliest books. Finally, one of them (35) lists the name Anemones as a synonym. Some of the names are amusing: "Issop" for Hyssop, "Pum- pions" for Pumpkins, "Mushmillions" for Muskmellons, "Isquou- terquashes" for Squashes, "Cowslips" for Primroses, "Daffadown dillies" for Daffodils. Other names are confusing. Bachelors Button was the name used for Gomphrena globosa, not for Centaurea cyanis as we use it today. Similarly, in the earliest literature, "Marygold" was used for Calendula. Later we begin to see "Pot Marygold" and "Calen- dula" for Calendula, and "Marygold" is reserved for Marigolds.
    [Show full text]
  • A Molecular Phylogeny of the Solanaceae
    TAXON 57 (4) • November 2008: 1159–1181 Olmstead & al. • Molecular phylogeny of Solanaceae MOLECULAR PHYLOGENETICS A molecular phylogeny of the Solanaceae Richard G. Olmstead1*, Lynn Bohs2, Hala Abdel Migid1,3, Eugenio Santiago-Valentin1,4, Vicente F. Garcia1,5 & Sarah M. Collier1,6 1 Department of Biology, University of Washington, Seattle, Washington 98195, U.S.A. *olmstead@ u.washington.edu (author for correspondence) 2 Department of Biology, University of Utah, Salt Lake City, Utah 84112, U.S.A. 3 Present address: Botany Department, Faculty of Science, Mansoura University, Mansoura, Egypt 4 Present address: Jardin Botanico de Puerto Rico, Universidad de Puerto Rico, Apartado Postal 364984, San Juan 00936, Puerto Rico 5 Present address: Department of Integrative Biology, 3060 Valley Life Sciences Building, University of California, Berkeley, California 94720, U.S.A. 6 Present address: Department of Plant Breeding and Genetics, Cornell University, Ithaca, New York 14853, U.S.A. A phylogeny of Solanaceae is presented based on the chloroplast DNA regions ndhF and trnLF. With 89 genera and 190 species included, this represents a nearly comprehensive genus-level sampling and provides a framework phylogeny for the entire family that helps integrate many previously-published phylogenetic studies within So- lanaceae. The four genera comprising the family Goetzeaceae and the monotypic families Duckeodendraceae, Nolanaceae, and Sclerophylaceae, often recognized in traditional classifications, are shown to be included in Solanaceae. The current results corroborate previous studies that identify a monophyletic subfamily Solanoideae and the more inclusive “x = 12” clade, which includes Nicotiana and the Australian tribe Anthocercideae. These results also provide greater resolution among lineages within Solanoideae, confirming Jaltomata as sister to Solanum and identifying a clade comprised primarily of tribes Capsiceae (Capsicum and Lycianthes) and Physaleae.
    [Show full text]
  • Iconography of the Solanaceae from Antiquity to the Xviith Century: a Rich Source of Information on Genetic Diversity and Uses
    Iconography of the Solanaceae from Antiquity to the XVIIth Century: a Rich Source of Information on Genetic Diversity and Uses Marie-Christine Daunay and Henri Laterrot Jules Janick INRA, Unité de Génétique & Amélioration Department of Horticulture des Fruits et Légumes Landscape Architecture Domaine St. Maurice, BP 94 Purdue University 84143 Montfavet cedex 625 Agriculture Mall Drive France West Lafayette, IN 47907–2010 USA Keywords: alkekenge, belladonna, capsicum pepper, datura, eggplant, henbane, husk tomato, mandrake, nightshades, potato, tobacco, tomato, Renaissance herbals Abstract The systematic study of solanaceous plant iconography has been a neglected source of information although historical records (ceramics, painted and printed images in manuscripts, and printed documents) are numerous. Many wild and domesticated solanaceous species have been associated with human culture from antiquity, as medicinal, ritual or magical herbs and/or food crops in the Old World (alkekenge, belladonna, eggplant, henbane, mandrake) and New World (capsicum pepper, datura, husk tomato, potato, tobacco, tomato). Mandrake (Mandragora spp.) images can be found in Egyptian sources in the second millennium BCE, and along with alkekenge (Physalis alkekengi) and black nightshade (Solanum nigrum aff.) are found in the oldest extant copy of the Materia Medica of Dioscorides (Codex Vindobonensis, Aniciae Julianae, 512 CE), as well as in many later Medieval and Renaissance sources. Images of henbane (Hyocyamus spp.) appears in the VIIIth century while belladonna (Atropa belladonna) first appears in the Renaissance. Images of eggplant (Solanum melongena), an Asian crop, are found in Asian and European manuscripts from the XIVth century onwards. Images of New World species are present in pre-Columbian sources, attesting to their wide use by native populations.
    [Show full text]
  • The Therapeutic Efficacy of Physalis Alkekengi Hydro Alcoholic Extract on Estrogen Receptor-Positive Breast Cancer Mice Model in an Autophagy Manner
    Sys Rev Pharm 2020;11(8):118-122 A multifaceted review journal in the field of pharmacy The Therapeutic Efficacy of Physalis Alkekengi Hydro alcoholic Extract on Estrogen Receptor-Positive Breast Cancer Mice Model in an Autophagy Manner 1 2 Ghaith Ali Jasim , Abdolmajid Ghasemian 1Department of Pharmacology and Toxicology, College of Pharmacy, Mustansiriyah University, Baghdad, Iraq, Emails: [email protected] 2Department of Biology, Central Tehran Branch Islamic Azad University, Tehran, Iran, Email: [email protected] Corresponding author: Ghaith Ali Jasim, Email: [email protected] ABSTRACT Objective: Physalis Alkekengi has several biological activities. Our aim was to Keywords: Physalis Alkekengi, ER+ breast cancer, BALB/c mice, Autophagy assess the anti-cancer effect of hydro alcoholic extract of Physalis Alkekengi on the estrogen receptor-positive breast cancer in mice model. Correspondence: Methods: Twenty-eight ER+ breast cancer BALB/c mice (four groups each Ghaith Ali Jasim including seven members) were enrolled. The P. Alkekengi hydro alcoholic 1Department of Pharmacology and Toxicology, College of Pharmacy, extract (10, 50 and 100 mg/kg) was administered for two weeks against EGFR2 Mustansiriyah University, Baghdad, Iraq, Emails: [email protected] cancerous cells. The tumor size, histopathological features, and mRNA expression amount of ATG5 Autophagy-specific gene were investigated. Results: At the two higher doses (50 and 100 mg/kg), the P. Alkekengi hydro alcoholic extract inhibited the breast cancer growth. Consequently, there was a significant histopathological change in the breast cancer among the groups treated with P. Alkekengi compared to the control group (p=0.0189). Additionally, the P. Alkekengi hydro alcoholic extract significantly enhanced the mRNA expression level of theATG5at 50 mg/kg.
    [Show full text]
  • (Trnf) Pseudogenes Defines a Distinctive Clade in Solanaceae Péter Poczai* and Jaakko Hyvönen
    Poczai and Hyvönen SpringerPlus 2013, 2:459 http://www.springerplus.com/content/2/1/459 a SpringerOpen Journal SHORT REPORT Open Access Discovery of novel plastid phenylalanine (trnF) pseudogenes defines a distinctive clade in Solanaceae Péter Poczai* and Jaakko Hyvönen Abstract Background: The plastome of embryophytes is known for its high degree of conservation in size, structure, gene content and linear order of genes. The duplication of entire tRNA genes or their arrangement in a tandem array composed by multiple pseudogene copies is extremely rare in the plastome. Pseudogene repeats of the trnF gene have rarely been described from the chloroplast genome of angiosperms. Findings: We report the discovery of duplicated copies of the original phenylalanine (trnFGAA) gene in Solanaceae that are specific to a larger clade within the Solanoideae subfamily. The pseudogene copies are composed of several highly structured motifs that are partial residues or entire parts of the anticodon, T- and D-domains of the original trnF gene. Conclusions: The Pseudosolanoid clade consists of 29 genera and includes many economically important plants such as potato, tomato, eggplant and pepper. Keywords: Chloroplast DNA (cpDNA); Gene duplications; Phylogeny; Plastome evolution; Tandem repeats; trnL-trnF; Solanaceae Findings of this region. If this is ignored, it will easily lead to situa- The plastid trnT-trnF region has been widely applied to tions where basic requirement of homology of the charac- resolve phylogeny of embryophytes (Quandt and Stech ters used for phylogenetic analyses is compromised. This 2004; Zhao et al. 2011) and to address various questions of might lead to false hypotheses of phylogeny, especially population genetics since the development of universal when they are based on the analyses of only this region.
    [Show full text]
  • Physalis Angulata (L.)
    Innovare International Journal of Pharmacy and Pharmaceutical Sciences Academic Sciences ISSN- 0975-1491 Vol 7, Issue 8, 2015 Review Article A PHARMACOLOGICAL COMPREHENSIVE REVIEW ON ‘RASSBHARY’ PHYSALIS ANGULATA (L.) NAVDEEP SHARMA1, ANISHA BANO1, HARCHARAN S. DHALIWAL1, VIVEK SHARMA1* 1Akal College of Agriculture, Eternal University, Baru Sahib 173101 (H. P.) India Email: [email protected] Received: 06 May 2015 Revised and Accepted: 15 Jun 2015 ABSTRACT The present review article reveals the importance of species Physalis angulata (L.) of the genus Physalis (L.) distributed worldwide including India. Physalis species are perennial, erect and variously having toothed or lobed leaves. Physalis angulata (L.) belongs to the family Solanaceae, includes about 120 species with different and specific herbal characters. On the basis of these herbal characters, the plant is traditionally used as medicine to cure various disorders like asthma, kidney, bladder, jaundice, gout, inflammations, cancer, digestive problems and diabetes etc. P. angulata is a source of the variety of phytoconstituents like phytosteroles, withangulatin A, a variety of physalins and flavonol glycoside etc. The plant extracts from the different parts having different pharmacological activities such as anti-cancerous, immunomodulatory, anti-diabetic, diuretic and anti-bacterial. In this article cytomorphological, phytochemical, biological activities and ethnobotanical inputs have been extensively recorded for P. angulata (L.). Keywords: Physalis angulata (L.), Cytomorphology, Phytochemistry, Ethnobotany, Biological activities. INTRODUCTION lands, along roads, in the forest along creeks near sea levels and in cultivated fields [3]. All over the world this plant is used for the From the ancient time plants have been used in preparation of herbal medicine and for the treatment of various human ailments medicines for treatment of various human and animal diseases.
    [Show full text]
  • Southern Garden History Plant Lists
    Southern Plant Lists Southern Garden History Society A Joint Project With The Colonial Williamsburg Foundation September 2000 1 INTRODUCTION Plants are the major component of any garden, and it is paramount to understanding the history of gardens and gardening to know the history of plants. For those interested in the garden history of the American south, the provenance of plants in our gardens is a continuing challenge. A number of years ago the Southern Garden History Society set out to create a ‘southern plant list’ featuring the dates of introduction of plants into horticulture in the South. This proved to be a daunting task, as the date of introduction of a plant into gardens along the eastern seaboard of the Middle Atlantic States was different than the date of introduction along the Gulf Coast, or the Southern Highlands. To complicate maters, a plant native to the Mississippi River valley might be brought in to a New Orleans gardens many years before it found its way into a Virginia garden. A more logical project seemed to be to assemble a broad array plant lists, with lists from each geographic region and across the spectrum of time. The project’s purpose is to bring together in one place a base of information, a data base, if you will, that will allow those interested in old gardens to determine the plants available and popular in the different regions at certain times. This manual is the fruition of a joint undertaking between the Southern Garden History Society and the Colonial Williamsburg Foundation. In choosing lists to be included, I have been rather ruthless in expecting that the lists be specific to a place and a time.
    [Show full text]
  • Plant Viruses Infecting Solanaceae Family Members in the Cultivated and Wild Environments: a Review
    plants Review Plant Viruses Infecting Solanaceae Family Members in the Cultivated and Wild Environments: A Review Richard Hanˇcinský 1, Daniel Mihálik 1,2,3, Michaela Mrkvová 1, Thierry Candresse 4 and Miroslav Glasa 1,5,* 1 Faculty of Natural Sciences, University of Ss. Cyril and Methodius, Nám. J. Herdu 2, 91701 Trnava, Slovakia; [email protected] (R.H.); [email protected] (D.M.); [email protected] (M.M.) 2 Institute of High Mountain Biology, University of Žilina, Univerzitná 8215/1, 01026 Žilina, Slovakia 3 National Agricultural and Food Centre, Research Institute of Plant Production, Bratislavská cesta 122, 92168 Piešt’any, Slovakia 4 INRAE, University Bordeaux, UMR BFP, 33140 Villenave d’Ornon, France; [email protected] 5 Biomedical Research Center of the Slovak Academy of Sciences, Institute of Virology, Dúbravská cesta 9, 84505 Bratislava, Slovakia * Correspondence: [email protected]; Tel.: +421-2-5930-2447 Received: 16 April 2020; Accepted: 22 May 2020; Published: 25 May 2020 Abstract: Plant viruses infecting crop species are causing long-lasting economic losses and are endangering food security worldwide. Ongoing events, such as climate change, changes in agricultural practices, globalization of markets or changes in plant virus vector populations, are affecting plant virus life cycles. Because farmer’s fields are part of the larger environment, the role of wild plant species in plant virus life cycles can provide information about underlying processes during virus transmission and spread. This review focuses on the Solanaceae family, which contains thousands of species growing all around the world, including crop species, wild flora and model plants for genetic research.
    [Show full text]
  • Phytochemical and Therapeutic Potential of Physalis Species: a Review
    IOSR Journal Of Pharmacy And Biological Sciences (IOSR-JPBS) e-ISSN:2278-3008, p-ISSN:2319-7676. Volume 14, Issue 4 Ser. III (Jul – Aug 2019), PP 34-51 www.Iosrjournals.Org Phytochemical and Therapeutic Potential of Physalis species: a Review Pooja Shah*, Dr. Kundan Singh Bora Department of Pharmacognosy, School of Pharmaceutical Sciences and Technology, Sardar Bhagwan Singh University, Balawala, Dehradun- 248001, Uttarakhand *Corresponding Author: POOJA SHAH ABSTRACT: The present review article disclosed the importance of specific species of genus Physalis Linn which are spreaded in all over the world and this considerable research details on different species is noteworthy for worldwide future researchers. In this article morphological, therapeutic activities phytochemicals and ethnobotanical data have been considerable records for important species of the genus Physalis L. In this extensive exploration on morphologic and phytochemical particulars for important medicinal species of Physalis, the aim of this article is to provide detailed, faithful and comprehensive information of precise species of the genus Physalis L. like; P. peruviana L., P. angulata L., P. pubescens L., P. minima L., P. longifolia Nutt., P. ixocarpa Brot , P. hispida Waterf. P. alkekengi L. According to our awareness, there is no any single or combined, helpful review details available about the specific species of genus Physalis L. estimated by using morphological, phytochemical, ethnobotanical, and therapeutic activities based aspects. Keywords: Physalis species,
    [Show full text]
  • Withanolides and Related Steroids
    Withanolides and Related Steroids Rosana I. Misico, Viviana E. Nicotra, Juan C. Oberti, Gloria Barboza, Roberto R. Gil, and Gerardo Burton Contents 1. Introduction .................................................................................. 00 2. Withanolides in the Plant Kingdom ......................................................... 00 2.1. Solanaceous Genera Containing Withanolides ...................................... 00 2.2. Non-Solanaceous Genera Containing Withanolides ................................. 00 3. Classification of Withanolides .............................................................. 00 3.1. Withanolides with a d-Lactone or d-Lactol Side Chain ............................. 00 3.2. Withanolides with a g-Lactone Side Chain .......................................... 00 4. Withanolides with an Unmodified Skeleton ................................................ 00 4.1. The Withania Withanolides .......................................................... 00 4.2. Other Withanolides with an Unmodified Skeleton .. ................................ 00 5. Withanolides with Modified Skeletons ..................................................... 00 5.1. Withanolides with Additional Rings Involving C-21 ................................ 00 5.2. Physalins and Withaphysalins ........................................................ 00 R.I. Misico • G. Burton (*) Departamento de Quı´mica Orga´nica and UMYMFOR (CONICET-UBA), Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Ciudad Universitaria, Pabello´n
    [Show full text]
  • Phytochemical Composition and Biological Activity of Physalis Spp.: a Mini-Review
    Food Science and Applied Biotechnology, 2020, 3(1), 56-70 Food Science and Applied Biotechnology Journal home page: www.ijfsab.com https://doi.org/10.30721/fsab2020.v3.i1 Review Phytochemical composition and biological activity of Physalis spp.: A mini-review Nadezhda Mazova1, Venelina Popova1✉, Albena Stoyanova1 1 Department of Tobacco, Sugar, Vegetable and Essential Oils, Technological Faculty,University of Food Technologies, Plovdiv, Bulgaria Abstract The main objective of this mini-review was to synthesize recent data about the phytochemical composition, the nutritional properties, and the biological and pharmacological activities of a now cosmopolitan genus, Physalis (Solanaceae), being in the focus of intensive research over the last two decades. Six Physalis species with nutritional and pharmacological promise are considered in particular – P. peruviana L., P. philadelphica Lam., P. ixocarpa Brot. ex Horm., P. angulata L., P. pubescens L., and P. alkekengi L. Summarized contemporary data on the metabolite profile and the biological activities of Physalis species support their century-long use in traditional medicine and human nutrition. The fruit represent a rich source of minerals, vitamins, fibers, carotenoids, proteins, fructose, sucrose esters, pectins, flavonoids, polyphenols, polyunsaturated fatty acids, phytosterols and many other beneficial nutrients. Individual phytochemicals and complex fractions isolated from Physalis plants demonstrate various biological and pharmacological activities, the most promising of which include antimicrobial, antioxidant, anti-diabetic, hepato- renoprotective, anti-cancer, anti-inflammatory, immunomodulatory and others. Most of these activities are associated with the presence of flavonoids, phenylpropanoids, alkaloids, physalins, withanolides, and other bioactive compounds. The accumulated data disclose the potential of Physalis spp. as highly functional foods, as profitable crops for many regions over the world, and as sources of valuable secondary metabolites for phytopharmacy, novel medicine and cosmetics.
    [Show full text]
  • Clearing Nursery Stock and Flower Bulbs for CBPAS
    United States Department of Clearing Nursery Stock Agriculture Animal and and Flower Bulbs for Plant Health Inspection Service CBPAS Plant Protection and Quarantine Clearing Nursery Stock and Flower Bulbs for CBPAS: The U.S. Department of Agriculture (USDA) prohibits discrimination in all its programs and activities on the basis of race, color, national origin, age, disability, and where applicable, sex, marital status, familial status, parental status, religion, sexual orientation, genetic information, political beliefs, reprisal, or because all or part of an individual’s income is derived from any public assistance program. (Not all prohibited bases apply to all programs.) Persons with disabilities who require alternative means for communication of program information (Braille, large print, audiotape, etc.) should contact USDA’s TARGET Center at (202) 720-2600 (voice and TDD). To file a complaint of discrimination, write to USDA, Director, Office of Civil Rights, 1400 Independence Avenue, S.W., Washington, D.C. 20250-9410, or call (800) 795-3272 (voice) or (202) 720-6382 (TDD). USDA is an equal opportunity provider and employer. Mention of companies or commercial products does not imply recommendation or endorsement by the U.S. Department of Agriculture over others not mentioned. USDA neither guarantees nor warrants the standard of any product mentioned. Product names are mentioned solely to report factually on available data and to provide specific information. This publication reports research involving pesticides. All uses of pesticides must be registered by appropriate State and/or Federal agencies before they can be recommended. CAUTION: Pesticides can be injurious to humans, domestic animals, desirable plants, fish, or other wildlife—if they are not handled or applied properly.
    [Show full text]