Garden Eel Leptocephali: Characters, Generic Identification, Distribution, and Relationships
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Pacific Plate Biogeography, with Special Reference to Shorefishes
Pacific Plate Biogeography, with Special Reference to Shorefishes VICTOR G. SPRINGER m SMITHSONIAN CONTRIBUTIONS TO ZOOLOGY • NUMBER 367 SERIES PUBLICATIONS OF THE SMITHSONIAN INSTITUTION Emphasis upon publication as a means of "diffusing knowledge" was expressed by the first Secretary of the Smithsonian. In his formal plan for the Institution, Joseph Henry outlined a program that included the following statement: "It is proposed to publish a series of reports, giving an account of the new discoveries in science, and of the changes made from year to year in all branches of knowledge." This theme of basic research has been adhered to through the years by thousands of titles issued in series publications under the Smithsonian imprint, commencing with Smithsonian Contributions to Knowledge in 1848 and continuing with the following active series: Smithsonian Contributions to Anthropology Smithsonian Contributions to Astrophysics Smithsonian Contributions to Botany Smithsonian Contributions to the Earth Sciences Smithsonian Contributions to the Marine Sciences Smithsonian Contributions to Paleobiology Smithsonian Contributions to Zoo/ogy Smithsonian Studies in Air and Space Smithsonian Studies in History and Technology In these series, the Institution publishes small papers and full-scale monographs that report the research and collections of its various museums and bureaux or of professional colleagues in the world cf science and scholarship. The publications are distributed by mailing lists to libraries, universities, and similar institutions throughout the world. Papers or monographs submitted for series publication are received by the Smithsonian Institution Press, subject to its own review for format and style, only through departments of the various Smithsonian museums or bureaux, where the manuscripts are given substantive review. -
A Review of Congrid Eels of the Genus Ariosoma from Taiwan, With
Zoological Studies 37(1): 7-12 (1998) A Review of Congrid Eels of the Genus Ariosoma from Taiwan, with Description of a New Species Shih-Chieh Shen Department of Zoology, National Taiwan University, Taipei, Taiwan 106, R.O.C. Tel: 886-2-23630231 ext. 2353. Fax: 886-2-23636837. E-mail: [email protected] (Accepted September 10, 1997) Shih-Chieh Shen (1998) A review of congrid eels of the genus Ariosoma from Taiwan, with description of a new species. Zoological Studies 37(1): 7-12. Diagnosis, description, and figures are presented for the 4 Formosan species of Ariosoma which include A. anago (Temminck and Schlegel, 1842), A. anagoides (Bleeker, 1864), A. shiroanago major (Asano, 1958) and a new species A. nancyae. Ariosoma nancyae is distinctive in its combination of a stout body; 157 total vertebrae; 53 preanal lateral-line pores, and 95 pores behind anus to tail; upper end of gill opening at level of 1/4 upper end of pectoral-fin base; black spots on head, and black bands on body, tail, and fins. Key words: Fish taxonomy, Congridae, Fish fauna, New species, Taiwan. The congrid eel genus Ariosoma Swainson, gate; preanal length more than 40% of total; tip of 1838 is not a well-known group of fishes because tail blunt and stiff, caudal fin reduced; dorsal fin of its small size and unusual habitats. It is, how- insertion origin near level of pectoral fin base; pec- ever, one of the most abundant and diverse toral fin well developed; snout rounded, projecting congrid genera in the world. -
Metadata for Hawaii Environmental Sensitivity Index (ESI)
HYDRO Hawaii ESI: HYDRO (Hydrology Polygons and Lines) Metadata: Identification_Information Data_Quality_Information Spatial_Data_Organization_Information Spatial_Reference_Information Entity_and_Attribute_Information Distribution_Information Metadata_Reference_Information Identification_Information: Citation: Citation_Information: Originator: National Oceanic and Atmospheric Administration (NOAA), National Ocean Service, Office of Response and Restoration, Hazardous Materials Response Division, Seattle, Washington Publication_Date: 200111 Title: Hawaii ESI: HYDRO (Hydrology Polygons and Lines) Edition: Second Geospatial_Data_Presentation_Form: Vector digital data Series_Information: Series_Name: None Issue_Identification: Hawaii Publication_Information: Publication_Place: Seattle, Washington Publisher: National Oceanic and Atmospheric Administration (NOAA), National Ocean Service, Office of Response and Restoration, Hazardous Materials Response Division, Seattle, Washington Other_Citation_Details: Prepared by Research Planning, Inc., Columbia, South Carolina for the National Oceanic and Atmospheric Administration (NOAA), National Ocean Service, Office of Response and Restoration, Hazardous Materials Response Division, Seattle, Washington Description: Abstract: This data set contains vector arcs and polygons representing coastal hydrography used in the creation of the Environmental Sensitivity Index (ESI) for Hawaii. The HYDRO data layer contains all annotation used in producing the atlas. The annotation features are categorized into -
Copyrighted Material
06_250317 part1-3.qxd 12/13/05 7:32 PM Page 15 Phylum Chordata Chordates are placed in the superphylum Deuterostomia. The possible rela- tionships of the chordates and deuterostomes to other metazoans are dis- cussed in Halanych (2004). He restricts the taxon of deuterostomes to the chordates and their proposed immediate sister group, a taxon comprising the hemichordates, echinoderms, and the wormlike Xenoturbella. The phylum Chordata has been used by most recent workers to encompass members of the subphyla Urochordata (tunicates or sea-squirts), Cephalochordata (lancelets), and Craniata (fishes, amphibians, reptiles, birds, and mammals). The Cephalochordata and Craniata form a mono- phyletic group (e.g., Cameron et al., 2000; Halanych, 2004). Much disagree- ment exists concerning the interrelationships and classification of the Chordata, and the inclusion of the urochordates as sister to the cephalochor- dates and craniates is not as broadly held as the sister-group relationship of cephalochordates and craniates (Halanych, 2004). Many excitingCOPYRIGHTED fossil finds in recent years MATERIAL reveal what the first fishes may have looked like, and these finds push the fossil record of fishes back into the early Cambrian, far further back than previously known. There is still much difference of opinion on the phylogenetic position of these new Cambrian species, and many new discoveries and changes in early fish systematics may be expected over the next decade. As noted by Halanych (2004), D.-G. (D.) Shu and collaborators have discovered fossil ascidians (e.g., Cheungkongella), cephalochordate-like yunnanozoans (Haikouella and Yunnanozoon), and jaw- less craniates (Myllokunmingia, and its junior synonym Haikouichthys) over the 15 06_250317 part1-3.qxd 12/13/05 7:32 PM Page 16 16 Fishes of the World last few years that push the origins of these three major taxa at least into the Lower Cambrian (approximately 530–540 million years ago). -
A New Congrid Eel (Teleostei: Anguilliformes: Congridae) from the Western Pacific, with an Analysis of Its Relationships
Zootaxa 4845 (2): 191–210 ISSN 1175-5326 (print edition) https://www.mapress.com/j/zt/ Article ZOOTAXA Copyright © 2020 Magnolia Press ISSN 1175-5334 (online edition) https://doi.org/10.11646/zootaxa.4845.2.2 http://zoobank.org/urn:lsid:zoobank.org:pub:B2DA6D79-874E-48C1-B054-FEC08546223C A new congrid eel (Teleostei: Anguilliformes: Congridae) from the Western Pacific, with an analysis of its relationships DAVID G. SMITH1*, EMMA S. KARMOVSKAYA2 & JOÃO PAULO CAPRETZ BATISTA DA SILVA3 1Smithsonian Institution, Museum Support Center, MRC-534, 4210 Silver Hill Road, Suitland, MD 20746 [email protected]; https://orcid.org/0000-0002-6354-2427 2Shirshov Institute of Oceanology, Russian Academy of Sciences, Moscow, 117218, Russia [email protected]; https://orcid.org/0000-0002-0636-4265 3Departamento de Sistemática e Ecologia, Centro de Ciências Exatas e da Natureza, Universidade Federal da Paraíba, Castelo Branco, 58051-900, João Pessoa, PB, Brazil [email protected]; https://orcid.org/0000-0002-2373-3421 *Corresponding author Abstract A new species of congrid eel, Bathycongrus villosus sp. nov., is described from the Philippines and Vanuatu. It is similar to some of the small-toothed species currently placed in Bathycongrus and to the species of Bassanago. In this paper we compare the new species to Bassanago albescens (Barnard, 1923) and to Bathycongrus parviporus Karmovskaya, 2011, which it most closely resembles. An analysis of 19 characters shows that it agrees with Bat. parviporus in 16 characters and with Bas. albescens in one. In two characters, the three species are all different. We therefore place it in Bathycongrus. Key words: Taxonomy, Pisces, Bathycongrus, new species Introduction The species described here was discovered independently by two of the authors. -
Training Manual Series No.15/2018
View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by CMFRI Digital Repository DBTR-H D Indian Council of Agricultural Research Ministry of Science and Technology Central Marine Fisheries Research Institute Department of Biotechnology CMFRI Training Manual Series No.15/2018 Training Manual In the frame work of the project: DBT sponsored Three Months National Training in Molecular Biology and Biotechnology for Fisheries Professionals 2015-18 Training Manual In the frame work of the project: DBT sponsored Three Months National Training in Molecular Biology and Biotechnology for Fisheries Professionals 2015-18 Training Manual This is a limited edition of the CMFRI Training Manual provided to participants of the “DBT sponsored Three Months National Training in Molecular Biology and Biotechnology for Fisheries Professionals” organized by the Marine Biotechnology Division of Central Marine Fisheries Research Institute (CMFRI), from 2nd February 2015 - 31st March 2018. Principal Investigator Dr. P. Vijayagopal Compiled & Edited by Dr. P. Vijayagopal Dr. Reynold Peter Assisted by Aditya Prabhakar Swetha Dhamodharan P V ISBN 978-93-82263-24-1 CMFRI Training Manual Series No.15/2018 Published by Dr A Gopalakrishnan Director, Central Marine Fisheries Research Institute (ICAR-CMFRI) Central Marine Fisheries Research Institute PB.No:1603, Ernakulam North P.O, Kochi-682018, India. 2 Foreword Central Marine Fisheries Research Institute (CMFRI), Kochi along with CIFE, Mumbai and CIFA, Bhubaneswar within the Indian Council of Agricultural Research (ICAR) and Department of Biotechnology of Government of India organized a series of training programs entitled “DBT sponsored Three Months National Training in Molecular Biology and Biotechnology for Fisheries Professionals”. -
Congrid Eels of the Eastern Pacific and Key to Their Leptocephali
22 NOAA Technical Report NMFS 22 Congrid Eels of the Eastern Pacific and Key to Their Leptocephali Solomon N. Raju February 1985 u.S. DEPARTMENT OF COMMERCE National Oceanic and Atmospheric Administration National Marine Fisheries Service NOAA TECHNICAL REPORTS NMFS The major responsibilities of the National Marine Fisheries Service (NMFS) are to monitor and assess the abundance and geographic distrihution of fishery resources, to understand and predict fluctuations in the quantity and distribution of these resources, and to establish levels for optimum use of the resources. NMFS is also charged with the development and implemen tation of policies for managing national fishing grounds, development and enforcement of domestic fisheries regulations, surveillance of foreign fishing off United States coastal waters, and the development and enforcement of international fishery agreements and policies. NMFS also assists the fishing industry through marketing service and economic analysis programs, and mortgage insurance and vessel construction subsidies. It collects. analyzes. and publishes statistics on various phases of the industry. The NOAA Technical Report NMFS series was established in 1983 to replace two subcategories of the Technical Reports series: "Special Scientific Report-Fisheries" and "Circular." The series contains the following types of reports: Scientific investigations thai document long-term continuing programs of NMFS, intensive scientific reports on studies of restricted scope, papers on applied fishery problems. technical reports of general jntere~t intended 10 aid conservation and management, reports that review in considerable detail and at a high technical level certain broad areas of research, and technical papers originating in economics studies and from management investigations. Copies of NOAA Technical Report NMFS are available free in limited numbers to governmental agencies, both Federal and State. -
Nagasaki University's Academic Output SITE
NAOSITE: Nagasaki University's Academic Output SITE Record body size of the beach conger Conger japonicus (Anguilliformes: Title Congridae) in the East China Sea Yagi, Mitsuharu; Shimoda, Masako; Uchida, Jun; Shimizu, Kenichi; Author(s) Aoshima, Takashi; Kanehara, Hisao Citation Marine Biodiversity Records, 6, e110; 2013 Issue Date 2013-10-11 URL http://hdl.handle.net/10069/33898 Right © Marine Biological Association of the United Kingdom 2013 This document is downloaded at: 2017-12-22T05:20:34Z http://naosite.lb.nagasaki-u.ac.jp Marine Biodiversity Records, page 1 of 5. # Marine Biological Association of the United Kingdom, 2013 doi:10.1017/S1755267213000882; Vol. 6; e110; 2013 Published online Record body size of the beach conger Conger japonicus (Anguilliformes: Congridae) in the East China Sea mitsuharu yagi, masako shimoda, jun uchida, kenichi shimizu, takashi aoshima and hisao kanehara Faculty of Fisheries, Nagasaki University, 1-14 Bunkyo, Nagasaki 852-8521, Japan A record body size, length of 1520 mm and weight of 12,600 g for the beach conger, Conger japonicus was recorded, which is approximately 120 mm and 2600 g larger than the previous international record. The specimen was female and obtained during an otter trawl survey on 4 April 2013 in the East China Sea (31852.16′N 127842.94′E) at a depth of approximately 140 m on the slope of the continental shelf. Morphometric measurements and meristic counts are reported in this paper. We also report profiles of water temperature, salinity, dissolved oxygen and chlorophyll-a taken immediately prior to the trawl, and species composition of concurrent catch with the otter trawling as environmental and biological characteristics of the habitat. -
Röhrenaale Im Aquarium Des Hauses Der Natur 11
©Haus der Natur, Salzburg, download unter www.biologiezentrum.at Röhrenaale im Aquarium des Hauses der Natur 11 Dr. Inge Wich Heteroconger hassi (links) und Gorgasia preclara (rechts) Röhrenaale (Unterfamilie Heterocongri- Populationsgröße und - dichte: hassi erkennbar. Allerdings wurde im nae) sind hochspezialisierte Fische, die 8 Individuen pro Quadratmeter, davon Tagesverlauf nie beobachtet, dass eine weltweit in tropischen Meeren auf Sand- 13 Heteroconger hassi und 5 Gorgasia Wohnröhre verlassen wurde. Es wird grund vom Flachwasser bis in 50 m Tiefe preclara. daher vermutet, dass neue Wohnröhren leben. Die Kolonien können bis zu 5000 während der Nacht angelegt werden. Individuen erreichen (CLARK 1980 und Verteilungsmuster: Die Röhrenaale passen sehr genau in CLARK et al 1990). Röhrenaale bauen Die Verteilung der Wohnröhren ist mit ihre leicht gekurvt angelegte Wohnröh- sich im Sand senkrechte Röhren, die einer maximalen Distanz von 40 cm re (siehe Abb. 2). mit kurzen Stoßbewegungen mit dem und einer minimalen Distanz von 2 cm spitzen, harten Schwanzende gegraben zueinander ungleichmäßig (Abb. 1). Populationsstruktur, Reproduktion werden (FRICKE 1970). Hautdrüsen Manchmal wird eine neue Wohnröhre und Verhalten: produzieren ein Sekret, mit dem die gebaut. Ein solcher Positionswechsel ist Die meiste Zeit sind mindestens drei, Wohnröhre verfestigt wird (CASIMIR an dem individuell erkennbaren Zeich- meistens aber vier oder fünf Päarchen et al. 1971). Bei Gefahr ziehen sie sich nungsmuster speziell bei Heteroconger von Röhrenaalen sichtbar. Die Loch- blitzschnell in die Röhre zurück. Als distanz von Männchen und Weibchen Planktonfresser sind Röhrenaale auf beträgt 2 - 12 cm. Röhrenaale haben eine ständige Strömung angewiesen. pelagische Leptocephalus-Larven Aus dieser schnappen sie sich mit wie- (SMITH 2002). -
Congridae: Heterocongrinae) from West Papua, Indonesia
aqua International Journal of Ichthyology Vol. 15 (3), 20 July 2009 Aquapress ISSN 0945-9871 aqua - International Journal of Ichthyology Managing Editor: Scope HeikO Bleher aqua is an internatiOnal jOurnal which publishes Original Via G. FalcOne 11, scientific articles in the fields Of systematics, taxOnOmy, 27010 MiradOlO Terme (PV), Italy biOgeOgraphy, ethOlOgy, ecOlOgy, and general biOlOgy Of Tel.: +39-0382-754707 fishes. Papers On freshwater, brackish, and marine fishes Fax: +39-0382-754129 will be cOnsidered. aqua is fully refereed and aims at pub - E-mail: [email protected] lishing manuscripts within 2-4 mOnths Of acceptance. In www.aqua-aquapress.com view Of the impOrtance Of cOlOr patterns in species iden - tificatiOn and animal ethOlOgy, authOrs are encOuraged tO submit cOlOr illustratiOns in additiOn tO descriptiOns Of cOlOratiOn. It is Our aim tO prOvide the internatiOnal sci - Scientific Editor: entific cOmmunity with an efficiently published jOurnal meeting high scientific and technical standards. Friedhelm Krupp CuratOr Of Fishes Senckenberg Research Institute Call for papers and Natural HistOry Museum The editOrs welcOme the submissiOn Of Original manu - Senckenberganlage 25 scripts which shOuld be sent in digital fOrmat tO the scien - 60325 Frankfurt am Main, Germany tific editOr. Full length research papers and shOrt nOtes will Tel: +49-69-7542.1255 be cOnsidered fOr publicatiOn. There are nO page charges Fax: +49-69-7542.1253 and cOlOr illustratiOns will be published free Of charge. E-mail: [email protected] AuthOrs will receive One free cOpy Of the issue in which their paper is published and an e-print in PDF fOrmat. -
FIS-P7 Kei Nakaya
Seasonal occurrence pattern of leptocephali in the north Satsunan area, southern Japan FIS-P-14042 Gen Kume1, Satoru Jinno1, Toru Kobari1, Kazuhiro Shiozaki2, Atsushi Narumi1, Shuya Ito1, Kei Nakaya1, Mutsuo Ichinomiya3 and Tomohiro Komorita3 1 Aquatic Sciences, Faculty of Fisheries, Kagoshima University, 4-50-20 Shimoarata, Kagoshima 890-0056, Japan. Email: [email protected] 2 Food and Life Sciences, Faculty of Fisheries, Kagoshima University, 4-50-20 Shimoarata, Kagoshima 890-0056, Japan. 3 Faculty of Environmental and Symbiotic Sciences, Prefectural University of Kumamoto, Kumamoto, Japan. Introduction nMany leptocephali are found in the Satsunan area, southern Japan throughout the year. nThey may include important fishery-targeting species. (e.g. Anguilla spp., Conger spp., Muraenesox spp.) nThe purpose is to clarify the seasonal and spatial occurrence pattern of leptocephali in the north Satsunan area in relation to the Kuroshio. Materials and methods n Field surveys • Field surveys were condected from February in 2015 to August in 2018 by RV Nansei-maru and in November in 2015 and November in 2017 by RV Kagoshima-maru. • Study stations were fixed 15 stations in the inshore of Kuroshio path, 2 stations in Kuroshio path and 2 stations in the offshore of Kuroshio path. A. .Inshore of Kuroshio path • Specimens were collected by the ORI net (diameter, 160 cm; mesh size, 335 µm) which was obliquely towed from the bottom (ca. 10 m above the depth) to the surface at approximately 2 knots for 30 min. • Specimens were preserved in 99.5 % ethanol. B. Kuroshio path n Analyses Kuroshio • Species identification by morphological and genetic methods (16SrRNA)* and morphological measurements *16Sar-L (CGCCTGTTTATCAAAAACAT), 16Sbr-H (GGTCTGAACTCAGATCACGT) (Kurogi et al. -
Anguilliformes, Saccopharyngiformes, and Notacanthiformes (Teleostei: Elopomorpha)
* Catalog of Type Specimens of Recent Fishes in the National Museum of Natural History, Smithsonian Institution, 6: Anguilliformes, Saccopharyngiformes, and Notacanthiformes (Teleostei: Elopomorpha) DAVID G. SMITH I SMITHSONIAN CONTRIBUTIONS TO ZOOLOGY • NUMBER 566 SERIES PUBLICATIONS OF THE SMITHSONIAN INSTITUTION Emphasis upon publication as a means of "diffusing knowledge" was expressed by the first Secretary of the Smithsonian. In his formal plan for the Institution, Joseph Henry outlined a program that included the following statement: "It is proposed to publish a series of reports, giving an account of the new discoveries in science, and of the changes made from year to year in all branches of knowledge." This theme of basic research has been adhered to through the years by thousands of titles issued in series publications under the Smithsonian imprint, commencing with Smithsonian Contributions to Knowledge in 1848 and continuing with the following active series: Smithsonian Contributions to Anthropology Smithsonian Contributions to Astrophysics Smithsonian Contributions to Botany Smithsonian Contributions to the Earth Sciences Smithsonian Contributions to the Marine Sciences Smithsonian Contributions to Paleobiology Smithsonian Contributions to Zoology Smithsonian Folklife Studies Smithsonian Studies in Air and Space Smithsonian Studies in History and Technology In these series, the Institution publishes small papers and full-scale monographs that report the research and collections of its various museums and bureaux or of professional colleagues in the world of science and scholarship. The publications are distributed by mailing lists to libraries, universities, and similar institutions throughout the world. Papers or monographs'submitted for series publication are received by the Smithsonian Institution Press, subject to its own review for format and style, only through departments of the various Smithsonian museums or bureaux, where the manuscripts are given substantive review.