DOCSLIB.ORG

Garden Eel Leptocephali: Characters, Generic Identification, Distribution, and Relationships

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Garden Eel Leptocephali: Characters, Generic Identification, Distribution, and Relationships BULLETIN OF MARINE SCIENCE, 60(1): 6-22, 1997 GARDEN EEL LEPTOCEPHALI: CHARACTERS, GENERIC IDENTIFICATION, DISTRIBUTION, AND RELATIONSHIPS P. H. J. Castle ABSTRACT More than 30 species of garden eels (AnguilIiformes, Congridae, Heterocongrinae) are now known. worldwide, including several that are undescribed. The leptocephali of Hetero- conger Bleeker have been described from the Atlantic and East Pacific, but little is otherwise known of the early life history of these eels. Study of the large collection of garden eel larvae in the Dana collections, Copenhagen (around 600 specimens), and other material, now allows the larval form of Gorgasia Meek and Hildebrand to be identified, and the distribution of several Indo-west Pacific species to be mapped. Heteroconger leptocephali have midlateral melanophores on the myotomes as in the larvae of most genera of Congrinae, and Paraconger and Chiloconger in the Bathymyrinae. Those of Gorgasia have a different pigmentation pattern consisting mainly of compact melanophores on the myosepta below the midlateral level. A third larval type, l.eptocephalus maculatus Della Croce and Castle, 1966 has scat- tered melanophores over the body surface and is identified with Heteroconger hassi (Klau- sewitz and Eibl-Eibesfeldt, 1959), The pigment pattern of Gorgasia, though distinctive, is similar to that of the bathymyrine Ariosoma and its closer allies, to Benthenchelys and other Ophichthidae and unexpectedly to Muraenesox, Additionally, some skeletal characters and the common use of tail-first burrowing behavior suggest that a more comprehensive study of the relationship between the heterocongrines, the bathymyrines and the Ophichthidae in par- ticular, is warranted, Garden eels are generally agreed to comprise their own subfamily, the Heter- ocongrinae and have distinctive form and habits that separate them from the two other larger subfamilies of the Congridae, the Bathymyrinae and Congrinae, Smith (1989a) summarises what is known about these eels. They occur almost exclusively in the tropical to subtropical ocean, mostly in relatively shallow water, though they have been collected in water as deep as 200-300 m. They are usually observed in groups of several individuals to hundreds, though they may form aggregations of several thousand. They are most often seen burrowed tail-first in, but semi-emergent from loose, coral "sand" off the outer edge of reefs or shores, in localities of some current, though they are also known from mixed broken rubble and sand. Although some 35 or so garden eel species are known worldwide, some of these have yet to be formally described. Most species occur in the Indo-Pacific, with several in the East Pacific and two or three in the Atlantic. The species are clearly separated into the two genera Heteroconger Bleeker, 1853 with its type species H. polyzona Bleeker from central Indonesia, and Gorgasia Meek and Hildebrand, 1923, with type species G. punctata Meek and Hildebrand from Pa- cific Panama. Several other genera have been described but were judged by Bohlke and Randall (1981) to be synonyms of Heteroconger because the principal distinctions were made on the degree of reduction (or absence) of the pectoral and caudal fins. This character is not consistent enough to be used. A thorough appraisal of species inter-·relationships within this remarkable subfamily and its position relative to the other Congridae, has yet to be made. Garden eels are very slender, long-bodied fishes in which the snout is very short and the mouth is terminal and markedly oblique. The eyes are relatively 6 CASTLE: GARDEN EEL LEPTOCEPHALI 7 Gorgasia pll1lctata ~ ~. .,,;a . (L.J'-= .. _<::---=----~ --- •• •~.--8';;--"=-- -- anterior nostril upper lip Figure 1. External differences between Gorgasia and Heteroconger. Ethmoid pore is arrowed. large and face more or less directly forwards. The pectoral fin is short, minute or even absent and the caudal fin is also short or fleshy and pointed. The principal skeletal features are the strong, forwardly-directed jaw support associated with the terminal mouth, and the reduction of the neural arches and spines along most of the vertebral column, except for the first few and the penultimate 10-12. The immediate postcranial region and the end of the tail are concerned, respectively, with the flexing horizontally forwards of the anterior part of the body as it emerg- es from the burrow in which the eel lives, and the action of the caudal region in digging tail-first into sediments. Species of Heteroconger have upper lips that form a single, prominent, conflu- ent flange across the face of the snout that encloses tiny, subtubular, forwardly- directed anterior nostrils and the ethmoid sensory pores (Fig. 1). The snout is very short or pug-nosed and the oblique mouth barely reaches to below the an- terior margin of eye. The teeth form broad bands on all surfaces, except that the posterior half of the maxilla is curved outwards and has teeth that tend to be uniserial and enlarged. There are few head pores and the pectoral fin is a tiny, fleshy flap (or absent in H. polyzona except for the occasional specimen in which it is a small tab of skin). The Heteroconger species are typically spotted, speckled or banded in body coloration. In contrast, species of Gorgasia have upper lips that are separate medially and do not enclose the anterior nostrils and ethmoid pores (Fig. 1). The snout is somewhat longer and less blunt, the gape is oblique but longer, reaching to below middle of pupil, and the teeth form narrower bands or are even uniserial on the vomer. The complement of head pores is mOrecomplete though those of the lateral line proper may be rather widely spaced and fewer than the number of vertebrae. With one or two notable exceptions the body color of the Gorgasia species is dull or nondescript. 8 BULLETINOFMARINESCIENCE,VOL.60, NO.I, 1997 The Heterocongrinae is currently regarded as a highly specialized congrid sub- family lineage, more closely related to the Bathymyrinae (Ariosoma, Bathymyrus etc,) than to the Congrinae (Conger and its many allies). This view was developed more thoroughly by Smith (1989a) from comprehensive studies on adults of all but a few congrid genera, Larval characters were apparently not explored to any extent by Smith (l989a). Though the larvae of Heteroconger had been known for some time (Blache, 1977; Raju, 1974, 1985; Smith, 1989b), those of Gorgasia had not been described under that name, except incidentally and without detailed comment by Castle (1984). As will be made clear later, Gorgasia larvae were in fact described earlier by D'Ancona (1928) from the Red Sea, by Blache (1977) from the East Atlantic and by Smith (1989b) from the western Atlantic, but not identified as such. Raju (1974, 1985) erred in referring his 65-95 mm TL specimens from the Pacific coast of Mexico (SIO 61·-248, 75-249) that had midlateral melanophores, to Gor- gasia punctata. These were apparently Heteroconger larvae with regenerated tails and the metamorphic larva of G, obtusa (Garman, 1899) from Pacific Panama was apparently that of the bathymyrine eel Chiloconger labiatus Myers and Wade, 1941 (D. G, Smith, pers. comm.). The discovery of metamorphic specimens of Gorgasia maculata Klausewitz and Eibl-Eibesfeldt, 1959, allows Gorgasia larvae to be identified, collections of garden eel larvae to be adequately sorted, and an assessment of the contribution that larval characters might make to exploring relationships of the Heterocongri- nae to proceed. Accordingly, this paper distinguishes between the larvae of the two garden eel genera, describes the distribution of larvae of several species in the Indo-Pacific and attempts to evaluate the relationships of the garden eels based on larval and some adult characters, MATERIALS AND METHODS Specimens discussed in this paper were derived from a variety of sources. Leptocephali were mostly from the Danish DANAExpedition Round the World 1928-1930 collections now held in the University Zoological Museum, Copenhagen (ZMUC). A few others were from the western South Pacific col- lections of ORSTOM, Noumea. A range of adult specimens and species were loaned mainly from United States institutions. Institutional acronyms, where available, are as given in Leviton et a1.(1985). Vertebral counts were made from radiographs. My observations show that garden eels seldom lose their tail tips, as is very common in eels such as species of the congrid eel genus Bathycongrus, so vertebral counts can be considered reliable. There is a likelihood of some small error in estimating total numbers of larval myome:res because of difficulty in counting the last one or two myomeres. This might explain slight differences in mean vertebral counts and myomeres given for the species discussed in this paper, GENERIC CHARACTERS AND IDENTIFICATION OF THE LARVAE The larvae of Heteroconger (Fig. 2), have a short gut (anus placed near mid- length in full grown individuals) and in this respect are like those of Muraenesox in the Muraenesocidae. In contrast, the anus is subterminal in the Ariosoma group, and well back in other congrids. However, in pigmentation Heteroconger larvae are rather like those of several genera of Congrinae. They have a series of paired, ocellate melanophores along the gut and a midlateral series of spaced, ocellate or rather diffuse melanophores on the surface of the myomeres, with one on each myomere in H. longissimus (Gunther, 1970), in Heteroconger sp. (Blache, 1977) and more or less so in H. luteolus Smith, 1989. These are Atlantic species, but in the Indo-west Pacific species the midlateral melanophores are fewer and much more widely spaced. Metamorphic and juvenile specimens were described from the East Pacific by Raju (1985) under the names H. digueti (Pellegrin, 1923) and CASTLE: GARDEN EEL LEPTOCEPHALI 9 Figure 2. Heleroconger sp., leptocephali (A-C) and metamorphic specimen (D-E). A, 39.3 mm TL, ORSTOM station S2, 8 June 1962; B-C, 92.3 mm TL, ORSTOM station S2, 8 June 1962; D-E, 76 mm TL, ZMUC P312678, Vanadoro Harbour, Philippine Islands, 22 July 1908; F, ZMUC P312678 (same as D and E), pigmentation of posterior part of gut.
Load more

Recommended publications
  • Pacific Plate Biogeography, with Special Reference to Shorefishes
    Pacific Plate Biogeography, with Special Reference to Shorefishes VICTOR G. SPRINGER m SMITHSONIAN CONTRIBUTIONS TO ZOOLOGY • NUMBER 367 SERIES PUBLICATIONS OF THE SMITHSONIAN INSTITUTION Emphasis upon publication as a means of "diffusing knowledge" was expressed by the first Secretary of the Smithsonian. In his formal plan for the Institution, Joseph Henry outlined a program that included the following statement: "It is proposed to publish a series of reports, giving an account of the new discoveries in science, and of the changes made from year to year in all branches of knowledge." This theme of basic research has been adhered to through the years by thousands of titles issued in series publications under the Smithsonian imprint, commencing with Smithsonian Contributions to Knowledge in 1848 and continuing with the following active series: Smithsonian Contributions to Anthropology Smithsonian Contributions to Astrophysics Smithsonian Contributions to Botany Smithsonian Contributions to the Earth Sciences Smithsonian Contributions to the Marine Sciences Smithsonian Contributions to Paleobiology Smithsonian Contributions to Zoo/ogy Smithsonian Studies in Air and Space Smithsonian Studies in History and Technology In these series, the Institution publishes small papers and full-scale monographs that report the research and collections of its various museums and bureaux or of professional colleagues in the world cf science and scholarship. The publications are distributed by mailing lists to libraries, universities, and similar institutions throughout the world. Papers or monographs submitted for series publication are received by the Smithsonian Institution Press, subject to its own review for format and style, only through departments of the various Smithsonian museums or bureaux, where the manuscripts are given substantive review.
    [Show full text]
  • A Review of Congrid Eels of the Genus Ariosoma from Taiwan, With
    Zoological Studies 37(1): 7-12 (1998) A Review of Congrid Eels of the Genus Ariosoma from Taiwan, with Description of a New Species Shih-Chieh Shen Department of Zoology, National Taiwan University, Taipei, Taiwan 106, R.O.C. Tel: 886-2-23630231 ext. 2353. Fax: 886-2-23636837. E-mail: [email protected] (Accepted September 10, 1997) Shih-Chieh Shen (1998) A review of congrid eels of the genus Ariosoma from Taiwan, with description of a new species. Zoological Studies 37(1): 7-12. Diagnosis, description, and figures are presented for the 4 Formosan species of Ariosoma which include A. anago (Temminck and Schlegel, 1842), A. anagoides (Bleeker, 1864), A. shiroanago major (Asano, 1958) and a new species A. nancyae. Ariosoma nancyae is distinctive in its combination of a stout body; 157 total vertebrae; 53 preanal lateral-line pores, and 95 pores behind anus to tail; upper end of gill opening at level of 1/4 upper end of pectoral-fin base; black spots on head, and black bands on body, tail, and fins. Key words: Fish taxonomy, Congridae, Fish fauna, New species, Taiwan. The congrid eel genus Ariosoma Swainson, gate; preanal length more than 40% of total; tip of 1838 is not a well-known group of fishes because tail blunt and stiff, caudal fin reduced; dorsal fin of its small size and unusual habitats. It is, how- insertion origin near level of pectoral fin base; pec- ever, one of the most abundant and diverse toral fin well developed; snout rounded, projecting congrid genera in the world.
    [Show full text]
  • Metadata for Hawaii Environmental Sensitivity Index (ESI)
    HYDRO Hawaii ESI: HYDRO (Hydrology Polygons and Lines) Metadata: Identification_Information Data_Quality_Information Spatial_Data_Organization_Information Spatial_Reference_Information Entity_and_Attribute_Information Distribution_Information Metadata_Reference_Information Identification_Information: Citation: Citation_Information: Originator: National Oceanic and Atmospheric Administration (NOAA), National Ocean Service, Office of Response and Restoration, Hazardous Materials Response Division, Seattle, Washington Publication_Date: 200111 Title: Hawaii ESI: HYDRO (Hydrology Polygons and Lines) Edition: Second Geospatial_Data_Presentation_Form: Vector digital data Series_Information: Series_Name: None Issue_Identification: Hawaii Publication_Information: Publication_Place: Seattle, Washington Publisher: National Oceanic and Atmospheric Administration (NOAA), National Ocean Service, Office of Response and Restoration, Hazardous Materials Response Division, Seattle, Washington Other_Citation_Details: Prepared by Research Planning, Inc., Columbia, South Carolina for the National Oceanic and Atmospheric Administration (NOAA), National Ocean Service, Office of Response and Restoration, Hazardous Materials Response Division, Seattle, Washington Description: Abstract: This data set contains vector arcs and polygons representing coastal hydrography used in the creation of the Environmental Sensitivity Index (ESI) for Hawaii. The HYDRO data layer contains all annotation used in producing the atlas. The annotation features are categorized into
    [Show full text]
  • Copyrighted Material
    06_250317 part1-3.qxd 12/13/05 7:32 PM Page 15 Phylum Chordata Chordates are placed in the superphylum Deuterostomia. The possible rela- tionships of the chordates and deuterostomes to other metazoans are dis- cussed in Halanych (2004). He restricts the taxon of deuterostomes to the chordates and their proposed immediate sister group, a taxon comprising the hemichordates, echinoderms, and the wormlike Xenoturbella. The phylum Chordata has been used by most recent workers to encompass members of the subphyla Urochordata (tunicates or sea-squirts), Cephalochordata (lancelets), and Craniata (fishes, amphibians, reptiles, birds, and mammals). The Cephalochordata and Craniata form a mono- phyletic group (e.g., Cameron et al., 2000; Halanych, 2004). Much disagree- ment exists concerning the interrelationships and classification of the Chordata, and the inclusion of the urochordates as sister to the cephalochor- dates and craniates is not as broadly held as the sister-group relationship of cephalochordates and craniates (Halanych, 2004). Many excitingCOPYRIGHTED fossil finds in recent years MATERIAL reveal what the first fishes may have looked like, and these finds push the fossil record of fishes back into the early Cambrian, far further back than previously known. There is still much difference of opinion on the phylogenetic position of these new Cambrian species, and many new discoveries and changes in early fish systematics may be expected over the next decade. As noted by Halanych (2004), D.-G. (D.) Shu and collaborators have discovered fossil ascidians (e.g., Cheungkongella), cephalochordate-like yunnanozoans (Haikouella and Yunnanozoon), and jaw- less craniates (Myllokunmingia, and its junior synonym Haikouichthys) over the 15 06_250317 part1-3.qxd 12/13/05 7:32 PM Page 16 16 Fishes of the World last few years that push the origins of these three major taxa at least into the Lower Cambrian (approximately 530–540 million years ago).
    [Show full text]
  • A New Congrid Eel (Teleostei: Anguilliformes: Congridae) from the Western Pacific, with an Analysis of Its Relationships
    Zootaxa 4845 (2): 191–210 ISSN 1175-5326 (print edition) https://www.mapress.com/j/zt/ Article ZOOTAXA Copyright © 2020 Magnolia Press ISSN 1175-5334 (online edition) https://doi.org/10.11646/zootaxa.4845.2.2 http://zoobank.org/urn:lsid:zoobank.org:pub:B2DA6D79-874E-48C1-B054-FEC08546223C A new congrid eel (Teleostei: Anguilliformes: Congridae) from the Western Pacific, with an analysis of its relationships DAVID G. SMITH1*, EMMA S. KARMOVSKAYA2 & JOÃO PAULO CAPRETZ BATISTA DA SILVA3 1Smithsonian Institution, Museum Support Center, MRC-534, 4210 Silver Hill Road, Suitland, MD 20746 [email protected]; https://orcid.org/0000-0002-6354-2427 2Shirshov Institute of Oceanology, Russian Academy of Sciences, Moscow, 117218, Russia [email protected]; https://orcid.org/0000-0002-0636-4265 3Departamento de Sistemática e Ecologia, Centro de Ciências Exatas e da Natureza, Universidade Federal da Paraíba, Castelo Branco, 58051-900, João Pessoa, PB, Brazil [email protected]; https://orcid.org/0000-0002-2373-3421 *Corresponding author Abstract A new species of congrid eel, Bathycongrus villosus sp. nov., is described from the Philippines and Vanuatu. It is similar to some of the small-toothed species currently placed in Bathycongrus and to the species of Bassanago. In this paper we compare the new species to Bassanago albescens (Barnard, 1923) and to Bathycongrus parviporus Karmovskaya, 2011, which it most closely resembles. An analysis of 19 characters shows that it agrees with Bat. parviporus in 16 characters and with Bas. albescens in one. In two characters, the three species are all different. We therefore place it in Bathycongrus. Key words: Taxonomy, Pisces, Bathycongrus, new species Introduction The species described here was discovered independently by two of the authors.
    [Show full text]
  • Training Manual Series No.15/2018
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by CMFRI Digital Repository DBTR-H D Indian Council of Agricultural Research Ministry of Science and Technology Central Marine Fisheries Research Institute Department of Biotechnology CMFRI Training Manual Series No.15/2018 Training Manual In the frame work of the project: DBT sponsored Three Months National Training in Molecular Biology and Biotechnology for Fisheries Professionals 2015-18 Training Manual In the frame work of the project: DBT sponsored Three Months National Training in Molecular Biology and Biotechnology for Fisheries Professionals 2015-18 Training Manual This is a limited edition of the CMFRI Training Manual provided to participants of the “DBT sponsored Three Months National Training in Molecular Biology and Biotechnology for Fisheries Professionals” organized by the Marine Biotechnology Division of Central Marine Fisheries Research Institute (CMFRI), from 2nd February 2015 - 31st March 2018. Principal Investigator Dr. P. Vijayagopal Compiled & Edited by Dr. P. Vijayagopal Dr. Reynold Peter Assisted by Aditya Prabhakar Swetha Dhamodharan P V ISBN 978-93-82263-24-1 CMFRI Training Manual Series No.15/2018 Published by Dr A Gopalakrishnan Director, Central Marine Fisheries Research Institute (ICAR-CMFRI) Central Marine Fisheries Research Institute PB.No:1603, Ernakulam North P.O, Kochi-682018, India. 2 Foreword Central Marine Fisheries Research Institute (CMFRI), Kochi along with CIFE, Mumbai and CIFA, Bhubaneswar within the Indian Council of Agricultural Research (ICAR) and Department of Biotechnology of Government of India organized a series of training programs entitled “DBT sponsored Three Months National Training in Molecular Biology and Biotechnology for Fisheries Professionals”.
    [Show full text]
  • Congrid Eels of the Eastern Pacific and Key to Their Leptocephali
    22 NOAA Technical Report NMFS 22 Congrid Eels of the Eastern Pacific and Key to Their Leptocephali Solomon N. Raju February 1985 u.S. DEPARTMENT OF COMMERCE National Oceanic and Atmospheric Administration National Marine Fisheries Service NOAA TECHNICAL REPORTS NMFS The major responsibilities of the National Marine Fisheries Service (NMFS) are to monitor and assess the abundance and geographic distrihution of fishery resources, to understand and predict fluctuations in the quantity and distribution of these resources, and to establish levels for optimum use of the resources. NMFS is also charged with the development and implemen­ tation of policies for managing national fishing grounds, development and enforcement of domestic fisheries regulations, surveillance of foreign fishing off United States coastal waters, and the development and enforcement of international fishery agreements and policies. NMFS also assists the fishing industry through marketing service and economic analysis programs, and mortgage insurance and vessel construction subsidies. It collects. analyzes. and publishes statistics on various phases of the industry. The NOAA Technical Report NMFS series was established in 1983 to replace two subcategories of the Technical Reports series: "Special Scientific Report-Fisheries" and "Circular." The series contains the following types of reports: Scientific investigations thai document long-term continuing programs of NMFS, intensive scientific reports on studies of restricted scope, papers on applied fishery problems. technical reports of general jntere~t intended 10 aid conservation and management, reports that review in considerable detail and at a high technical level certain broad areas of research, and technical papers originating in economics studies and from management investigations. Copies of NOAA Technical Report NMFS are available free in limited numbers to governmental agencies, both Federal and State.
    [Show full text]
  • Nagasaki University's Academic Output SITE
    NAOSITE: Nagasaki University's Academic Output SITE Record body size of the beach conger Conger japonicus (Anguilliformes: Title Congridae) in the East China Sea Yagi, Mitsuharu; Shimoda, Masako; Uchida, Jun; Shimizu, Kenichi; Author(s) Aoshima, Takashi; Kanehara, Hisao Citation Marine Biodiversity Records, 6, e110; 2013 Issue Date 2013-10-11 URL http://hdl.handle.net/10069/33898 Right © Marine Biological Association of the United Kingdom 2013 This document is downloaded at: 2017-12-22T05:20:34Z http://naosite.lb.nagasaki-u.ac.jp Marine Biodiversity Records, page 1 of 5. # Marine Biological Association of the United Kingdom, 2013 doi:10.1017/S1755267213000882; Vol. 6; e110; 2013 Published online Record body size of the beach conger Conger japonicus (Anguilliformes: Congridae) in the East China Sea mitsuharu yagi, masako shimoda, jun uchida, kenichi shimizu, takashi aoshima and hisao kanehara Faculty of Fisheries, Nagasaki University, 1-14 Bunkyo, Nagasaki 852-8521, Japan A record body size, length of 1520 mm and weight of 12,600 g for the beach conger, Conger japonicus was recorded, which is approximately 120 mm and 2600 g larger than the previous international record. The specimen was female and obtained during an otter trawl survey on 4 April 2013 in the East China Sea (31852.16′N 127842.94′E) at a depth of approximately 140 m on the slope of the continental shelf. Morphometric measurements and meristic counts are reported in this paper. We also report profiles of water temperature, salinity, dissolved oxygen and chlorophyll-a taken immediately prior to the trawl, and species composition of concurrent catch with the otter trawling as environmental and biological characteristics of the habitat.
    [Show full text]
  • Röhrenaale Im Aquarium Des Hauses Der Natur 11
    ©Haus der Natur, Salzburg, download unter www.biologiezentrum.at Röhrenaale im Aquarium des Hauses der Natur 11 Dr. Inge Wich Heteroconger hassi (links) und Gorgasia preclara (rechts) Röhrenaale (Unterfamilie Heterocongri- Populationsgröße und - dichte: hassi erkennbar. Allerdings wurde im nae) sind hochspezialisierte Fische, die 8 Individuen pro Quadratmeter, davon Tagesverlauf nie beobachtet, dass eine weltweit in tropischen Meeren auf Sand- 13 Heteroconger hassi und 5 Gorgasia Wohnröhre verlassen wurde. Es wird grund vom Flachwasser bis in 50 m Tiefe preclara. daher vermutet, dass neue Wohnröhren leben. Die Kolonien können bis zu 5000 während der Nacht angelegt werden. Individuen erreichen (CLARK 1980 und Verteilungsmuster: Die Röhrenaale passen sehr genau in CLARK et al 1990). Röhrenaale bauen Die Verteilung der Wohnröhren ist mit ihre leicht gekurvt angelegte Wohnröh- sich im Sand senkrechte Röhren, die einer maximalen Distanz von 40 cm re (siehe Abb. 2). mit kurzen Stoßbewegungen mit dem und einer minimalen Distanz von 2 cm spitzen, harten Schwanzende gegraben zueinander ungleichmäßig (Abb. 1). Populationsstruktur, Reproduktion werden (FRICKE 1970). Hautdrüsen Manchmal wird eine neue Wohnröhre und Verhalten: produzieren ein Sekret, mit dem die gebaut. Ein solcher Positionswechsel ist Die meiste Zeit sind mindestens drei, Wohnröhre verfestigt wird (CASIMIR an dem individuell erkennbaren Zeich- meistens aber vier oder fünf Päarchen et al. 1971). Bei Gefahr ziehen sie sich nungsmuster speziell bei Heteroconger von Röhrenaalen sichtbar. Die Loch- blitzschnell in die Röhre zurück. Als distanz von Männchen und Weibchen Planktonfresser sind Röhrenaale auf beträgt 2 - 12 cm. Röhrenaale haben eine ständige Strömung angewiesen. pelagische Leptocephalus-Larven Aus dieser schnappen sie sich mit wie- (SMITH 2002).
    [Show full text]
  • Congridae: Heterocongrinae) from West Papua, Indonesia
    aqua International Journal of Ichthyology Vol. 15 (3), 20 July 2009 Aquapress ISSN 0945-9871 aqua - International Journal of Ichthyology Managing Editor: Scope HeikO Bleher aqua is an internatiOnal jOurnal which publishes Original Via G. FalcOne 11, scientific articles in the fields Of systematics, taxOnOmy, 27010 MiradOlO Terme (PV), Italy biOgeOgraphy, ethOlOgy, ecOlOgy, and general biOlOgy Of Tel.: +39-0382-754707 fishes. Papers On freshwater, brackish, and marine fishes Fax: +39-0382-754129 will be cOnsidered. aqua is fully refereed and aims at pub - E-mail: [email protected] lishing manuscripts within 2-4 mOnths Of acceptance. In www.aqua-aquapress.com view Of the impOrtance Of cOlOr patterns in species iden - tificatiOn and animal ethOlOgy, authOrs are encOuraged tO submit cOlOr illustratiOns in additiOn tO descriptiOns Of cOlOratiOn. It is Our aim tO prOvide the internatiOnal sci - Scientific Editor: entific cOmmunity with an efficiently published jOurnal meeting high scientific and technical standards. Friedhelm Krupp CuratOr Of Fishes Senckenberg Research Institute Call for papers and Natural HistOry Museum The editOrs welcOme the submissiOn Of Original manu - Senckenberganlage 25 scripts which shOuld be sent in digital fOrmat tO the scien - 60325 Frankfurt am Main, Germany tific editOr. Full length research papers and shOrt nOtes will Tel: +49-69-7542.1255 be cOnsidered fOr publicatiOn. There are nO page charges Fax: +49-69-7542.1253 and cOlOr illustratiOns will be published free Of charge. E-mail: [email protected] AuthOrs will receive One free cOpy Of the issue in which their paper is published and an e-print in PDF fOrmat.
    [Show full text]
  • FIS-P7 Kei Nakaya
    Seasonal occurrence pattern of leptocephali in the north Satsunan area, southern Japan FIS-P-14042 Gen Kume1, Satoru Jinno1, Toru Kobari1, Kazuhiro Shiozaki2, Atsushi Narumi1, Shuya Ito1, Kei Nakaya1, Mutsuo Ichinomiya3 and Tomohiro Komorita3 1 Aquatic Sciences, Faculty of Fisheries, Kagoshima University, 4-50-20 Shimoarata, Kagoshima 890-0056, Japan. Email: [email protected] 2 Food and Life Sciences, Faculty of Fisheries, Kagoshima University, 4-50-20 Shimoarata, Kagoshima 890-0056, Japan. 3 Faculty of Environmental and Symbiotic Sciences, Prefectural University of Kumamoto, Kumamoto, Japan. Introduction nMany leptocephali are found in the Satsunan area, southern Japan throughout the year. nThey may include important fishery-targeting species. (e.g. Anguilla spp., Conger spp., Muraenesox spp.) nThe purpose is to clarify the seasonal and spatial occurrence pattern of leptocephali in the north Satsunan area in relation to the Kuroshio. Materials and methods n Field surveys • Field surveys were condected from February in 2015 to August in 2018 by RV Nansei-maru and in November in 2015 and November in 2017 by RV Kagoshima-maru. • Study stations were fixed 15 stations in the inshore of Kuroshio path, 2 stations in Kuroshio path and 2 stations in the offshore of Kuroshio path. A. .Inshore of Kuroshio path • Specimens were collected by the ORI net (diameter, 160 cm; mesh size, 335 µm) which was obliquely towed from the bottom (ca. 10 m above the depth) to the surface at approximately 2 knots for 30 min. • Specimens were preserved in 99.5 % ethanol. B. Kuroshio path n Analyses Kuroshio • Species identification by morphological and genetic methods (16SrRNA)* and morphological measurements *16Sar-L (CGCCTGTTTATCAAAAACAT), 16Sbr-H (GGTCTGAACTCAGATCACGT) (Kurogi et al.
    [Show full text]
  • Anguilliformes, Saccopharyngiformes, and Notacanthiformes (Teleostei: Elopomorpha)
    * Catalog of Type Specimens of Recent Fishes in the National Museum of Natural History, Smithsonian Institution, 6: Anguilliformes, Saccopharyngiformes, and Notacanthiformes (Teleostei: Elopomorpha) DAVID G. SMITH I SMITHSONIAN CONTRIBUTIONS TO ZOOLOGY • NUMBER 566 SERIES PUBLICATIONS OF THE SMITHSONIAN INSTITUTION Emphasis upon publication as a means of "diffusing knowledge" was expressed by the first Secretary of the Smithsonian. In his formal plan for the Institution, Joseph Henry outlined a program that included the following statement: "It is proposed to publish a series of reports, giving an account of the new discoveries in science, and of the changes made from year to year in all branches of knowledge." This theme of basic research has been adhered to through the years by thousands of titles issued in series publications under the Smithsonian imprint, commencing with Smithsonian Contributions to Knowledge in 1848 and continuing with the following active series: Smithsonian Contributions to Anthropology Smithsonian Contributions to Astrophysics Smithsonian Contributions to Botany Smithsonian Contributions to the Earth Sciences Smithsonian Contributions to the Marine Sciences Smithsonian Contributions to Paleobiology Smithsonian Contributions to Zoology Smithsonian Folklife Studies Smithsonian Studies in Air and Space Smithsonian Studies in History and Technology In these series, the Institution publishes small papers and full-scale monographs that report the research and collections of its various museums and bureaux or of professional colleagues in the world of science and scholarship. The publications are distributed by mailing lists to libraries, universities, and similar institutions throughout the world. Papers or monographs'submitted for series publication are received by the Smithsonian Institution Press, subject to its own review for format and style, only through departments of the various Smithsonian museums or bureaux, where the manuscripts are given substantive review.
    [Show full text]