A Mitogenomic Study on the Phylogenetic Position of Snakes

BlackwellA Publishing mitogenomic Ltd study on the phylogenetic position of snakes

DESIRÉE A. DOUGLAS, AXEL JANKE & ULFUR ARNASON

Accepted: 16 August 2006 Douglas, D. A., Janke, A. & Arnason, U. (2006). A mitogenomic study on the phylogenetic doi:10.1111/j.1463-6409.2006.00257.x position of snakes. — Zoologica Scripta, 35, 545–558. Phylogenetic relationships of squamates (lizards, amphisbaenians and snakes) have received considerable attention, although no consensus has been reached concerning some basal divergences. This paper focuses on the Serpentes (snakes), whose phylogenetic position within the Squamata remains uncertain despite a number of morphological and molecular studies. Some mitogenomic studies have suggested a sister-group relationship between snakes and varanid lizards, while other studies have identiﬁed snakes and lizards as sister groups. However, recent studies using nuclear data have presented a different scenario, with snakes being more closely related to anguimorph and iguanian lizards. In this mitogenomic study we have examined the above hypotheses with the inclusion of amphisbaenians, one gekkotan and one acrodont lizard, taxa not represented in previous mitogenomic studies. To this end we have also extended the representation of snakes by sequencing ﬁve additional snake genomes: two scolecophidians (Ramphotyphlops australis and Typhlops mirus) two henophidians (Eunectes notaeus and Boa constrictor) and one caenophidian (Elaphe guttata). The phylogenetic analysis recovered snakes and amphisbaenians as sister groups, thereby differing from previous hypotheses. In addition to a discussion on previous morphological and molecular studies in light of the results presented here, the current study also provides some details regarding features of the new snake mitochondrial genomes described. Desirée Douglas, ,Division of Evolutionary Molecular Systematics, Department of Cell and Organism Biology, University of Lund, Sölvegatan 29, 22362 Lund, Sweden. E-mail: [email protected] Axel Janke, Division of Evolutionary Molecular Systematics, Department of Cell and Organism Biology, University of Lund, Sölvegatan 29, 22362 Lund, Sweden. E-mail: [email protected] Ulfur Arnason, Division of Evolutionary Molecular Systematics, Department of Cell and Organism Biology, University of Lund, Sölvegatan 29, 22362 Lund, Sweden. E-mail: [email protected]

Introduction Caldwell, 2000; Lee et al. 1999; Caldwell and dal Sasso 2004). The position of Serpentes (snakes) within the Squamata has On the grounds that these fossils possess hindlimbs, and are been debated since the 19th century (e.g. Cope 1869). The therefore taken to be primitive, they have been placed as the traditional view is that snakes arose from within the lizards, sister group to all living snakes (Caldwell & Lee 1997; Lee & although Underwood (1970) suggested that lizards and snakes Caldwell 2000; Scanlon & Lee 2000). could have separate origins. While the traditional view has An alternative hypothesis is that snakes evolved from gained almost universal acceptance, opinion has differed as to terrestrial lizards (Greene 1997; Greene & Cundall 2000; which group of lizards is most closely related to snakes. One Rieppel et al. 2003), more speciﬁcally those with a nocturnal hypothesis posits that the closest living relatives of snakes are and/or burrowing habit resembling that of blind snakes varanid (monitor) lizards, which belong to the infraorder (scolecophidians), which are traditionally thought to be the Anguimorpha. Some morphological studies have, with the most basal of living snakes (Bellairs & Underwood 1951; inclusion of fossil data, placed snakes within the Mosasauroidea Underwood 1970; Pough et al. 2005). Some authors have argued — a group of large, marine, extinct varanoids that lived during that fossil snakes also possessed more advanced characters the Cretaceous period. This grouping is supported by skeletal (e.g. in the skull), and that this justiﬁes a more derived placement characters common to both mosasauroids and fossil snakes than that of scolecophidians, which would mean that fossil purported to have been marine (Caldwell & Lee 1997, Lee & snakes do not have any bearing on snake origins (Zaher

Phylogenetic position of snakes • D. A. Douglas et al.

1998; Coates & Ruta 2000; Tchernov et al. 2000; Greene & new snake genomes that include representatives from all Cundall 2000; Zaher & Rieppel 2002; Rieppel et al. 2003). three major lineages of snakes: two scolecophidians ( Jan’s Previous molecular studies based on mitochondrial (mt) blind snake, Typhlops mirus and the southern blind snake, gene data (Forstner et al. 1995; Rest et al. 2003) have placed Ramphotyphlops australis), two henophidians (the yellow varanid lizards as the sister group of snakes, in support of the anaconda, Eunectes notaeus and the Columbian red-tailed snake−mosasauroid hypothesis. Other molecular studies boa, Boa constrictor imperator), and one caenophidian (the corn based on one or two nuclear genes (c-mos and RAG-1) have snake, Elaphe guttata) (see Table 1). This was done to increase all recovered a group containing snakes, anguimorphs and the taxon sampling across Serpentes for which, prior to this iguanians (Saint et al. 1998; Harris 2003; Vidal & Hedges study, only two mt genomes — Leptotyphlops dulcis and Dinodon 2004; Townsend et al. 2004). In addition, a study by Vidal & semicarinatus — had been sequenced. Hedges (2005), based on nine nuclear genes, also produced Six additional alethinophidian (i.e. all snakes with the the same result, with snakes as the sister group to anguimorphs exception of scolecophidians) snake genomes were recently and iguanids. In comparison, two recent studies based on all described (Dong & Kumazawa 2005). This included another mt genes (Kumazawa 2004; and Dong & Kumazawa 2005) Boa constrictor. However, for the purposes of this study it was have placed snakes as the sister group of lizards. However, no important to increase the sampling of the most basal group — amphisbaenians, gekkotans or acrodonts were included in the Scolecophidia — as it was apparent from this, and previous, these studies. studies (Kumazawa 2004; Dong & Kumazawa 2005) that In this study we aimed to test the above hypotheses on the snake mt genes have a much faster rate of evolution than position of snakes using heavy-strand protein-coding mt those of other squamates. Although the mt genomes of some genes for phylogenetic analysis. The sampling included ﬁve lizard families have not been sequenced, the current study

Table 1 The names and GenBank accession Taxon (scientiﬁc name) Common name Accession numbers of mt sequences of all species used Snakes Elaphe guttata guttata* Corn snake AM 236349 in this study. Dinodon semicarinatus Ryukyu odd-tooth snake NC 001945 Boa constrictor imperator* Boa constrictor AM 236348 Eunectes notaeus*Yellow anaconda AM 236347 Ramphotyphlops australis* Southern blind snake AM 236346 Typhlops mirus*Jan’s blind snake AM 236345 Leptotyphlops dulcis Texas blind snake NC 005961 Lizards Varanus komodoensis Komodo dragon AB080275 and AB080276 Abronia graminea Green arboreal alligator lizard NC 005958 Shinisaurus crocodilurus Crocodile lizard NC 005959 Cordylus warreni Warren’s spiny-tail lizard NC 005962 Eumeces egregius Mole skink NC 000888 Sceloporus occidentalis Western fence lizard NC 005960 Iguana iguana Common iguana NC 002793 Pogona vitticeps Central bearded dragon NC 006922 Teratoscincus keyserlingii Giant frog-eyed gecko NC 007008 Amphisbaenians Bipes biporus Five-toed worm lizard NC 006287 Amphisbaena schmidti Schmidt’s worm lizard NC 006284 Diplometopon zarudnyi Zarudnyi’s worm lizard NC 006283 Rhineura floridana Florida worm lizard NC 006282 Shpenodontidans Sphenodon punctatus Tuatara NC 004815 Crocodilians Caiman crocodylus Spectacled caiman NC 002744 Alligator mississippiensis American alligator NC 001922 Birds Gallus gallus Chicken NC 001323 Struthio camelus Ostrich NC 002785 Turtles Chelonia mydas Green turtle NC 000886 Chrysemys picta Painted turtle NC 002073 Mammals Mus musculus House mouse NC 005089 Didelphis virginiana North American opossum NC 001610 Amphibians Ranodon sibiricus Siberian salamander NC 004021 Xenopus laevis African clawed frog NC 001573

*Taxa sequenced in this study.

D. A. Douglas et al. • Phylogenetic position of snakes allows examination of recent hypotheses on snake origin as it includes taxa purported to be their closest living sister groups, anguimorphs and iguanians. We also aimed to investigate mitogenomic features in the new genomes sequenced. The mt genomes of snakes are interesting in that they contain gene duplications and rearrangements. Kumazawa (2004) reported a novel position of the tRNA-Gln gene in the mt genome of the Texas blind snake (L. dulcis) and the absence of the origin of light strand replication (OL) that could be characteristic of all scolecophidian genomes. Duplicated control regions have been reported in all alethinophidian snakes (Kumazawa et al. 1998; Dong & Kumazawa 2005). Gene rearrangements and duplication events have been used as potential phylogenetic markers in previous analyses (e.g. Macey et al. 1997, 2000, 2004) and are discussed in this study.

Materials and methods Mitochondrial genome sequencing Fig. 1 The mitochondrial genome map of the anaconda, E. notaeus Total DNA was extracted from liver or muscle tissue of five notaeus. The tRNAs are indicated by their single-letter amino acid code. L , tRNA-Leu (UUR); L , tRNA-Leu (CUN); S , tRNA-Ser snakes (see Table 1). Large fragments were amplified by PCR 1 2 1 (AGY); S , tRNA-Ser (UCN). CRI and II, control regions I and II. using Taq plus Long (Stratagene), Ex Taq and Z-Taq (Takara) 2 polymerases. The majority of the conserved PCR primers used to amplify these fragments were designed for this study (see Table 2). Previously published primers (Kumazawa & sequencing system. The program Tandem Repeat Finder Endo 2004) were used to amplify some regions of the scole- (Benson 1999) was used to scan control regions for any cophidian genomes. Fragments were sequenced from both tandem repeats. All sequences were edited and assembled ends using the primer walking method. Specific primers were using EditView 1.0.1 (Perkin-Elmer). designed from the end regions of each fragment, ensuring that fragments overlapped one another. Sequencing was Phylogenetic analysis carried out using the ABI automated sequencing system. One The sequences of the 12 heavy-strand protein-coding mt of the two control regions (CRI, see Fig. 1) found in the genes of species not sequenced in this study were taken from E. notaeus mt genome was cloned using standard procedures GenBank (see Table 1). The NADH6 gene was omitted from (Sambrook & Russell 2001). Twelve clones were sequenced — the analysis as its nucleotide (nt) composition differs from that six in each orientation — using the LICOR automated of all other protein-coding mt genes. As Sphenodon punctatus lacks the ≈1800 nt long NADH5 gene (Rest et al. 2003), and the cyt b gene of the gecko Teratoscincus keyserlingii is only 854 Table 2 Conserved PCR primers and sequences. nt in length (roughly 150 nt shorter than in other taxa used in this study), these sites were coded as missing data. The Position alignment is available on request. Alignment-ambiguous sites of 5′ ends and third codon positions (3 cp) were removed from the ′ ′ Primer Sequence (5 –3 ) Description in E. notaeus alignment prior to the phylogenetic analysis (Kumazawa & 34 CCCGACTGTTTACCAAAAACAT Universal primer 16SL 1842 Nishida 1993; Kumazawa et al. 2004). The total number of nt 35 GGACTTTAATCGTTGAACAAACG Universal primer 16SH 2375 and amino acid (aa) sites used was 6116 (minus 3 cp) and 76 GGGATTAGATACCCCACTAT Universal primer 12SL 474 3058, respectively. Homogeneity of nt and aa composition 531-03 ACGTCAGGTCAAGGTGTA Snake 12SL 723 was analysed using the χ2 test implemented in the program 532-03 TCACAGGGTCTTCTCGTC Snake 16SH 2088 418-03 GCTATTGGGCCCATACCC Methionine LMet 5110 TREE-PUZZLE (Schmidt et al. 2002). The general-time- 419-03 CATTTTYGGGGTATGGG Methionine HMet 5135 reversible model (Lanave et al. 1984) with invariable sites and 421-03 TTKGGGRCTTTGAAGG Tryptophan HTrp 6228 a gamma model of rate heterogeneity (Gu et al. 1995) with 424-03 CCAKCTTTGGTTTACAAG Threonine HThr 16504 eight classes of variable sites (GTR + I + 8Γ) was chosen by 483-03 TATTCCACTGGTCTTAG Leucine (CUN) LLeu 12912 Modeltest ver. 3.06 (Posada & Crandall 1998) as the best L, light strand. H, heavy strand. fitting model for nt analysis. Amino acid sequences were

Phylogenetic position of snakes • D. A. Douglas et al. analysed using the mtREV-24 model of sequence evolution (SH; Shimodaira & Hasegawa 1999) tests as implemented (Adachi & Hasegawa 1996b) assuming a gamma model of rate in TREE-PUZZLE. Both KH and SH tests were also used heterogeneity among sites with one class of invariable sites to compare the favoured topology found in this study with and eight classes of variable sites (mtREV-24 + I + 8Γ). alternative topologies relating to previous hypotheses on Phylogenetic analyses on nt data were performed using snake origins (see Results). maximum parsimony (MP), minimum evolution using the neighbour-joining algorithm (NJ), maximum likelihood Results (ML) and Bayesian analysis. MP and NJ analyses were Snake mt genomes performed using PAUP (Swofford 1998). In NJ analyses The organization of the E. notaeus mt genome, 17 970 nt in both the GTR + I + Γ model and logDet distances were used. length, is shown in Fig. 1. CRI is located in-between the The logDet option is available in PAUP and run using the tRNA-Pro and tRNA-Phe genes, which is the typical position NJ algorithm. Statistical support for internal branches was for the control region in vertebrate genomes. CRII, a duplicate tested using the bootstrap method with 1000 replicates. ML of CRI, is located within the IQM cluster of tRNA genes analyses were performed using the program TREEFINDER between tRNA-Ile and tRNA-Gln. Duplicate control regions (Jobb 2005). Bayesian analyses were performed using are a feature of all alethinophidian snake mt genomes MrBayes ver. 3.1 (Ronquist & Huelsenbeck 2003), each analysis described to date (Kumazawa et al. 1998; Dong & Kumazawa being run for 1 000 000 generations. Tree sampling did not 2005). Also consistent with other alethinophidian genomes, begin until 100 000 generations, after which the logL values the tRNA-Leu (UUR) gene in E. notaeus is located down- appeared to stabilize. Amino acid data was analysed using MP stream of CRII instead of between the 16S rRNA and and ML methods. As with nt data, MP and ML analyses were NADH1 genes, the typical location of this gene in vertebrate performed using PAUP and TREEFINDER, respectively. genomes (Fig. 1). Additional analyses were done in which synonymous sites at Genomes of B. constrictor and E. guttata are complete leucine 1 cps were ignored. except for portions within one or both of the duplicated Further analyses were carried out to test for long-branch control regions. The gene order of both genomes is the attraction (LBA) artefacts. MP, NJ and ML analyses were same as that of E. notaeus. The genes tRNA-Thr, tRNA-Pro, performed on three datasets with either birds, turtles or CRI, tRNA-Phe and the 5′ end of 12S rRNA gene in the S. punctatus as outgroup taxa. Both nt and aa data were mt genome of T. mirus have not been sequenced. In the analysed. In addition, exhaustive ML tree searches were run R. australis genome the genes tRNA-Pro, CRI, tRNA-Phe using the MOLPHY (Adachi & Hasegawa 1996a) program and the 5′ end of 12S rRNA gene have not been sequenced. package. Exhaustive tree searches were made possible by Within the scolecophidian genomes, the tRNA-Leu (UUR) ﬁrst constraining invariable parts of the tree as one OTU. gene is located at the typical position and there is no duplicate The resulting 100 best trees were then further evaluated CR located within the IQM cluster. The gene order in the by TREE-PUZZLE using differences in log-likelihood scolecophidian genomes thus conforms in general to the values (δln L) and their standard errors (S.E. under the above typical vertebrate gene order. However, the origin of L-strand mentioned rate heterogeneity models. The probability of the replication (OL), typically found between the tRNA-Asn and different topologies was estimated by the Kishino–Hasegawa tRNA-Cys genes, is absent. In comparison, the OL is present (KH; Kishino & Hasegawa 1989) and Shimodaira–Hasegawa in E. notaeus, B. constrictor and E. guttata (Fig. 2A–C), each

Fig. 2 A–C. Secondary structure of the OLs in alethinophidian snakes sequenced in this study. —A. E. notaeus. Repeats are indicated in bold. —B. B. constrictor. —C. E. guttata. The boxes indicate the endings of the tRNA- Asn sequence and beginning of tRNA-Cys sequence in each case.

D. A. Douglas et al. • Phylogenetic position of snakes

Fig. 3 tRNA-Leu (UUR) sequences of Typhlops and Ramphotyphlops, with possible matching in the D-stem and two free nucleotides between D- and A/C stems.

having stems that are 12 bp in length. In E. notaeus there is a used. In addition to this, control regions of two viperids and × repeat of 2 8 nt in the OL sequence (Fig. 2A). a partial sequence from a python were aligned. The control Within the scolecophidian genomes, the tRNA-Leu regions of the two viperids showed 33% distance, whereas (UUR) gene has unusual secondary structure as there appear those of D. semicarinatus and E. guttata, both belonging to the to be two nucleotides separating the D- and A/C stems family Colubridae, showed 23% distance. CR sequences of instead of one (Fig. 3), which is usually the case in vertebrate all snakes with the exception of L. dulcis show remarkable tRNAs. The tRNA-Gln gene is found in its typical position conservation for at least 600 nt downstream of the C-rich region within the IQM cluster and not the WANCY region, as has to the first conserved sequence block (CSBI — Kumazawa been reported for L. dulcis (Kumazawa 2004). 1996; Kumazawa et al. 1998). Amphisbaenian, lizard and The mt genomes of E. notaeus, B. constrictor and E. guttata S. punctatus control regions were also aligned, but did not all contain duplicated control regions that are orientated in show the same degree of similarity, either with snakes or with the same direction. In E. notaeus each region is approximately each other. CSBIs of V. komodoensis and S. punctatus were 1335 nt in length. They are nearly identical (98% similarity) highly similar to that of snakes. There was no similarity and contain five repeats, each 96 nt long (the last one is trun- between CSBIIs or CSBIIIs (Kumazawa et al. 1998) among cated). Partial control regions of B. constrictor also confirm any of the squamate groups. several repeats of about the same length (see also Kumazawa et al. 1996; Dong & Kumazawa 2005). Repeats of this kind Phylogenetic analysis have also been reported in Varanus komodoensis (Kumazawa & The Bayesian tree based on nt data and the ML tree based on Endo 2004). Alignments of the partial CR sequences from aa data are shown in Fig. 4A and B, respectively. Support both B. constrictor and E. guttata revealed that the duplicates values for nodes labelled A to H in Fig. 4A are listed in are identical, which is also the case for other alethinophidian mt Table 3. The Bayesian and ML nt trees were identical, and genomes (Kumazawa et al. 1998; Dong & Kumazawa 2005). the aa ML tree differs only in the placing of T. keyserlingii. An The cloning of CRI in E. notaeus revealed two heteroplasmic analysis in which synonymous changes at leucine 1st cps were regions; in each region a single base differed between clones. ignored recovered a topology identical to Fig. 4A. All analyses The one control region of the E. guttata mt genome that was recovered a sister-group relationship between snakes and the completely sequenced — CRI (see Fig. 1) — did not contain acrodont lizard Pogona vitticeps with strong support. There any repeats. No repetitive elements were identified in the was also good support for a sister-group relationship between CRs of E. guttata and D. semicarinatus. Serpentes−P. vitticeps and amphisbaenians in ML and Bayesian The control regions of all snakes in which at least one analyses. A clade containing anguimorphs, iguanids and complete control region had been sequenced were aligned scincomorphs was well supported by the Bayesian tree and using ClustalW in the program Gene Jockey II (Biosoft). ML analysis based on aa data, but only weakly by the ML Where two duplicate genomes were available, both were analysis based on nt data and NJ analyses. With the exception

© 2006 The Authors. Journal compilation © 2006 The Norwegian Academy of Science and Letters • Zoologica Scripta, 35, 6, November 2006, pp545–558 549 Phylogenetic position of snakes • D. A. Douglas et al.

Fig. 4 A, B. Results of the phylogenetic analysis using 12 mt genes. Support for labelled nodes from trees produced by different methods are shown in Table 3. —A. Bayesian tree based on nt data. —B. Best ML tree based on aa data.

of the MP nt tree, a clade recovering scincomorphs and sister to all other squamates, with amphisbaenians branching iguanids was well supported. The MP tree based on aa data off next, both with low (< 50%) bootstrap support (data supported a clade containing Eumeces egregius and Iguanidae not shown). As there was a signiﬁcant difference in base with a bootstrap value of 88%, while the placing of Cordylus composition in the dataset, logDet distances were also applied. warreni was unresolved (data not shown). However, relationships between Serpentes, Amphisbaenia Squamate relationships were poorly resolved in MP and and lizards were not resolved in the logDet tree, which NJ analyses. MP was unable to resolve relationships of the indicated that the position of Serpentes−P. vitticeps in the NJ three major squamate groups. The NJ tree differed from the tree is tentative. Lizard relationships were identical in both ML and MB trees in that the Serpentes−P. vitticeps clade was trees. Of the ingroup taxa, the aa composition of snakes and

550 Zoologica Scripta, 35, 6, November 2006, pp545–558 • © 2006 The Authors. Journal compilation © 2006 The Norwegian Academy of Science and Letters D. A. Douglas et al. • Phylogenetic position of snakes

Fig. 4 Continued

Bipes biporus differed significantly from all other species. it is conceivable that these branches may have attracted each However, these taxa grouped together as expected in all trees. other. ML tree evaluations showed that the sister-group Thus composition heterogeneity was thought to play a minor relationship between snakes and P. vitticeps was dependent role in influencing the topology. on the inclusion of S. punctatus; the position of P. vitticeps It is probable that the joining of snakes and P. vitticeps is was unstable when the S. punctatus was absent, in which due to long-branch attraction (LBA). A study of pairwise case it also clustered within the amphisbaenians or with distances among squamate taxa revealed that P. vitticeps had crocodilians. The difference in logL between these trees the largest distances relative to all other squamate taxa. The was only slight and not significantly worse relative to the long branches leading to P. vitticeps in the trees shown in tree recovering snakes and P. vitticeps as sister groups (data Fig. 4 are indicative of this. As snakes also have a long branch, not shown). However, as this relationship was stable when

© 2006 The Authors. Journal compilation © 2006 The Norwegian Academy of Science and Letters • Zoologica Scripta, 35, 6, November 2006, pp545–558 551 Phylogenetic position of snakes • D. A. Douglas et al.

Table 3 Bootstrap support values for nodes (labelled A–H in Fig. 4A) Table 4 Bootstrap support values from various nodes recovered from on trees produced by different methods from analyses using all taxa. trees produced when analysing the effect of ingroup topology using different outgroups. Node support Node support Data Methods ABCDEF GH Data Method Outgroup taxa S−AS−I Ang SI−Ang Nucleotides MP 100 92 — — 90 57 — — NJ 100 100 — 54 100 95 — 86 Nucleotides MP S. punctatus —779771 NJ logDet 100 100 — 62 99 85 — 64 Turtles 89 59 94 58 ML 100 100 100 61 100 80 65 99 Birds 77 63 93 55 Bayesian 100 100 100 99 100 100 96 100 NJ S. punctatus 71 75 97 98 Amino acids MP 100 92 — — 82 — — — Turtles 100 91 95 73 ML 100 100 72 71 100 77 — 99 Birds 99 89 97 70 ML S. punctatus —91100 — Turtles 99 94 100 — Birds 94 88 100 55 S. punctatus was included, further evaluations were done with the Amino acids MP S. punctatus —908261 snakes excluded. In this case, P. vitticeps consistently clustered Turtles 87 84 81 — Birds 82 88 81 54 within amphisbaenians, which also possess relatively long ML S. punctatus —85100 55 branches. This rather points towards LBA, as P. vitticeps is Turtles 96 92 100 60 clearly an agamid lizard. As the long branch leading to P. vitticeps Birds 87 96 100 75 may have affected support for other ingroup relationships, Key for nodes: S−A, snakes−amphisbaenians; S−I, scincomorphs−iguanids; P. vitticeps was removed from subsequent analyses. Ang, anguimorphs; SI−Ang, scincomorphs−iguanids plus anguimorphs. We tested for further LBA artefacts by evaluating the robustness of ingroup relationships. This was carried out by rooting using three different outgroups in turn: birds, turtles and S. punctatus. Only ML analyses yielded fully resolved (as in Fig. 4A) in the majority of trees. However, MP support squamate relationships, the resulting topologies consistent values for lizard relationships in general were not compelling with those shown in Fig. 4. Additional analysis was carried due to a difference in the position of C. warreni. out to find out which taxa were responsible for the lack of When S. punctatus was chosen as the outgroup this taxon resolution in MP and NJ analyses. The positions of two taxa joined with the Serpentes. As S. punctatus was found to be — T. keyserlingii and Rhineura floridana — were unresolved in the closest outgroup to the squamates in previous molecular MP and NJ analyses and differed in ML analyses: in nt ML analyses (e.g. Rest et al. 2003; Townsend et al. 2004; Vidal & and Bayesian analyses, T. keyserlingii is placed at the base of the Hedges 2005), we wanted to test whether or not ingroup ingroup whereas in the aa ML analysis it is the sister group to topology was affected by its removal. ML and Bayesian snakes, P. vitticeps and amphisbaenians (see Fig. 4A,B). Whereas analyses were carried out on nt and aa data. The nt Bayesian all other amphisbaenians grouped together consistently in tree and aa ML tree are shown in Fig. 5A and B, respectively. all trees, R. floridana is either sister to other amphisbaenians, Trees show no change in ingroup topology, even with the P. vitticeps and snakes (Fig. 4A) or the basal taxon within exclusion of S. punctatus. Again, the only discrepancy was the Amphisbaenia (Fig. 4B). MP and NJ trees were only fully position of T. keyserlingii. This may have affected the support resolved with both taxa removed, and tree topologies in this of the (Anguimorpha (Iguanidae + Scincomorpha)) clade in case were consistent with those from ML analyses with the aa tree (Fig. 5B), where support had decreased compared T. keyserlingii and R. floridana included. Bootstrap values of to the earlier aa analysis (Fig. 4B). clades recovered in trees produced by all three methods are Exhaustive ML tree searches were run with either birds or shown in Table 4. turtles as outgroups. The best 100 trees were evaluated as When either birds or turtles were chosen as outgroups, described in Materials and Methods. The trees with the snakes and amphisbaenians formed a clade, with support highest likelihood in each case had the same topology as that ranging from 77% to 100% (Table 4). The trees were also shown in Fig. 5B. In trees rooted with turtles, all 100 best trees largely congruent with respect to lizard relationships. grouped together amphisbaenians and snakes, with lizard Scincomorphs and iguanids grouped together in all trees, relationships differing only in the placing of T. keyserlingii either as sister groups or with scincomorphs paraphyletic to and R. floridana. When only birds were used as outgroup, iguanids, with good support in the majority of cases (see topologies differed considerably, with likelihood scores Table 4). Anguimorphs formed a clade with scincomorphs differing by only a few log L units. This lack of signal may be and iguanids, with T. keyserlingii sister to all other squamates due to the long branch leading to the ingroup, such that

552 Zoologica Scripta, 35, 6, November 2006, pp545–558 • © 2006 The Authors. Journal compilation © 2006 The Norwegian Academy of Science and Letters D. A. Douglas et al. • Phylogenetic position of snakes

Fig. 5 A, B. Results of phylogenetic analysis using 12 mt genes, P. vitticeps and S. punctatus excluded (see text). —A. Bayesian tree based on nt data. —B. Best ML tree based on aa data.

relationships in the latter may have become randomized. An amphisbaenian relationships. ML analyses on nt and aa data additional ML analysis on nt and aa data was performed with were performed with all snakes excluded. Lizard and amphis- only ingroup taxa included. The resulting unrooted trees baenian relationships were consistent with previous analyses. in both cases were consistent with other analyses, also with As amphisbaenians also have long branches, additional regards to the labile positions of T. keyserlingii and R. ﬂoridana. ML analyses were done with this group removed. In both This thus showed that no matter where the root is placed in nt and aa analyses S. punctatus joined with the snakes. With the tree, ingroup relationships are not affected. S. punctatus removed snakes and lizards were recovered as Two further tests were carried out to investigate whether sister-groups. It is possible that this result could be inﬂuenced or not the long branch of the snakes affected lizard and by the difference in sampling.

© 2006 The Authors. Journal compilation © 2006 The Norwegian Academy of Science and Letters • Zoologica Scripta, 35, 6, November 2006, pp545–558 553 Phylogenetic position of snakes • D. A. Douglas et al.

Fig. 5 Continued

Alternative topologies refers to the topology shown in Fig. 5B. In tree 2, snakes The current results do not credibly support any of the recent are sister to all other squamates, as suggested in studies by hypotheses being tested, as snakes have grouped consistently Kumazawa (2004) and Dong & Kumazawa (2005). This was with amphisbaenians (with P. vitticeps removed) and never with also recovered by the NJ analysis in this study, albeit tenta- any of the anguimorphs or both anguimorphs and iguanids tively. In tree 3, snakes and varanid lizards (i.e. V. komodoensis together. The trees shown in Fig. 5A and B (the only difference in this study) are sister groups, the topology being based on being the position of T. keyserlingii) were tested statistically that shown by Lee & Caldwell (2000). In trees 4 and 5, snakes against previous hypotheses regarding the placing of snakes using are sister to iguanians and anguimorphs, respectively. These both nt and aa data. Results are shown in Tables 5 and 6. relationships were tentatively suggested in Saint et al. (1998), Tree 1 in the nt-based comparisons refers to the topology Vidal & Hedges (2004) and Townsend et al. (2004). In tree 6, shown in Fig. 5A; likewise, tree 1 in the aa-based comparisons snakes are sister to a clade containing both iguanians and

554 Zoologica Scripta, 35, 6, November 2006, pp545–558 • © 2006 The Authors. Journal compilation © 2006 The Norwegian Academy of Science and Letters D. A. Douglas et al. • Phylogenetic position of snakes

Table 5 Log likelihood and pKH and pSH values taken from an regards to inferring relationships (Kumazawa & Nishida evaluation of trees with alternative topologies (see text) based on nt 1995; Kumazawa et al. 1996; Macey et al. 1997, 2000, 2004) data. and can be used here to determine support for a particular hypothesis on snake origin. The snake−varanoid hypothesis Tree log L Difference S.E. pKH pSH (i.e. snake−mosasauroid hypothesis; see Introduction) does not 1 −58423.64 0 best 1.000 1.000 appear to be supported by gene rearrangements. Although 2 −58455.27 31.63 15.06 0.016 0.166 both V. komodoensis and alethinophidian snakes have duplicate − 3 58510.79 87.15 23.59 0.000 0.000 control regions (Kumazawa 2004; Kumazawa & Endo 2004; 4 −58466.51 42.86 19.09 0.021 0.073 5 −58472.59 48.95 18.74 0.004 0.033 Dong & Kumazawa 2005), they are found in different regions of 6 −58464.96 41.32 17.87 0.008 0.080 the genome, suggesting independent evolution rather than a syn- apomorphy. There is also no evidence in scolecophidians, the most basal living snakes, that the same duplication has taken place. However, some iguanians (P. vitticeps) and amphisbae- Table 6 Log likelihood and pKH and pSH values taken from an evaluation of trees with alternative topologies (see text) based on aa nians also have mt genomes that contain rearrangements, data. whereas, with the data sequenced in this study, no evidence is yet apparent that scolecophidians possess the same rearrange- Tree log L Difference S.E. pKH pSH ments. Therefore, it seems more likely that gene rearrangements arose independently in the different lineages mentioned. Gene 1 −53316.85 0 best 1.000 1.000 2 −53345.32 28.47 17.23 0.059 0.419 rearrangements may only be useful as phylogenetic markers 3 −53402.53 85.68 24.39 0.001 0.000 within different squamate lineages especially in snakes, 4 −53359.14 42.29 23.45 0.042 0.254 where the duplicated control regions within and between − 5 53363.81 46.95 23.32 0.023 0.194 species appear to be remarkably conserved (see also Dong & 6 −53360.45 43.60 23.09 0.028 0.234 Kumazawa 2005).

The phylogenetic position of snakes anguimorphs, as tentatively suggested in Harris (2003) and Our results place snakes as the sister group to amphisbaenians, by Vidal & Hedges (2005). suggesting a closer relationship to the latter than to angui- Tree 1 was the preferred tree regardless of whether nt or morphs or iguanians. This was supported by ML and aa data was used. The KH test rejected all other trees with the Bayesian analyses, the majority of exhaustive tree searches exception of tree 2 when using aa data (see Table 6). In nt and tests on ingroup topology using different outgroups. comparisons the SH test rejected trees 3 and 5 but did not Initial analyses in the current study, however, did place the reject trees 2, 4 and 6, despite these trees being more than 2 S.E. acrodont lizard P. vitticeps with snakes (Fig. 4A,B). This worse relative to tree 1. In aa comparisons, SH only rejected surprising result was also recovered by Townsend et al. (2004) tree 3 despite the fact that again, three other trees (4, 5 and when using mitochondrial data and when combining this 6) were almost equal to or greater than 2 S.E. worse relative with nuclear data. This was also put down to LBA. Also, as to the best tree. In the case of aa data, tree 2 was not rejected was mentioned previously, tree evaluations revealed that the by either test and the difference in logL relative to tree 1 was position of P. vitticeps varied considerably in trees that less than 2 S.E. differed by only a few logL units, attaching to other taxa that also had fast evolutionary rates. Apart from that provided by Discussion Townsend et al. (2004), there has not been any evidence, Mitogenomic features molecular or morphological, linking snakes with acrodont

Kumazawa (2004) reported that the OL was absent from the lizards. In addition, this taxon was never recovered with the genome of L. dulcis, suggesting that it may be absent from all relatively slow-evolving iguanids, so the Serpentes−P. vitticeps scolecophidian snakes. As the two scolecophidian genomes grouping cannot be taken at this stage as support for a sister- sequenced in the current study also do not have an OL, this group relationship between snakes and the Iguania (Iguanidae suggestion appears to be corroborated. It has previously been + Acrodonta), especially as a snake−iguanid grouping was not proposed that some feature within the tRNA genes functions statistically supported. More acrodont taxa need to be as the OL when the latter is missing or alternatively, that the included to properly test this relationship. origin lies in the control region as is the case for OH (Clayton MP and NJ analyses were unable to resolve ingroup 1991). relationships in this study. This was most likely due to the As other studies have shown, gene rearrangements found greater susceptibility to LBA of these methods than ML and among certain squamate lineages could be useful with Bayesian analyses (Page & Holmes 1998; Nei & Kumar 2000).

© 2006 The Authors. Journal compilation © 2006 The Norwegian Academy of Science and Letters • Zoologica Scripta, 35, 6, November 2006, pp545–558 555 Phylogenetic position of snakes • D. A. Douglas et al.

Trees were fully resolved only when testing ingroup topology iguanians. However, phylogenetic studies based on each of using the outgroups closest to squamates (i.e. S. punctatus, nine toxin proteins (supplementary data) do not allow con- birds and turtles). Related to this point, it is evident that clusive evidence of a relationship between snakes, iguanians there are short branches grouping the lizard taxa (see Figs 4 and anguimorphs, as no other squamates were present in the and 5), and that support for lizard relationships was not com- analyses. It was not clear whether other lizards or amphisbae- pelling in some analyses (Tables 3 and 4). This may reflect nians had been examined for the presence of these toxins. rapid cladogenesis among some lizard lineages, which may With the exclusion of P. vitticeps, snakes invariably grouped have taken place in a short evolutionary time period as has with amphisbaenians, which means that one cannot rule out been suggested in previous molecular studies (Rest et al. 2003; the possibility of a sister-group relationship between them. Vidal & Hedges 2005) and palaeontological data (Evans 2003). This would be consistent with a fossorial (i.e. burrowing) Our results were inconsistent with previous studies based origin of snakes. A close relationship between snakes and on all mt genes (Kumazawa 2004; Dong & Kumazawa 2005) amphisbaenians had been suggested by some morphological that suggest that snakes are sister to all other squamates. analyses (Kearney 2003; Rieppel & Zaher 2000). In these However, statistical tests could not exclude this hypothesis, studies, the dibamids — a group of fossorial lizards — were which indicates that it requires further consideration. When included and were found to be the immediate sister group of testing whether LBA accounted for the snake−amphisbaenian amphisbaenians, followed by snakes. Lee (1998) also recovered relationship, analyses were run with the amphisbaenian taxa this relationship after the removal of fossil taxa from the removed (see Results). As stated, snakes were placed as the dataset. A snake−amphisbaenian clade has been dismissed as sister group of lizards, consistent with Kumazawa (2004) and being the result of convergent characters associated with Dong & Kumazawa (2005). However, differential sampling a burrowing lifestyle (Lee 1998; Vidal & Hedges 2005). may have caused this. In Kumazawa (2004) and Dong & However, both Kearney (2003) and Rieppel & Zaher (2000) Kumazawa (2005), scincomorphs are basal to anguimorphs removed characters associated with burrowing and still and iguanids, a grouping inconsistent with our results. recovered a clade containing snakes, amphisbaenians and Previous studies that support a sister-group relationship dibamids. In previous analyses, amphisbaenians were recovered between varanid lizards and snakes were based on one protein- in a clade together with lacertid, teiid and gymnopthalmid coding mt gene (NADH4) and three tRNA genes (Forstner lizards (Townsend et al. 2004; Vidal & Hedges 2005). Of et al. 1995) and two protein-coding mt genes (NADH1 and course, our results do not rule out this possibility, or that 2) and eight tRNAs (Rest et al. 2003). The small datasets in other squamate taxa not included in this study are more these studies, in combination with large distances observed closely related to either snakes or amphisbaenians. between squamate lineages, may have influenced the topology so as to force together long branches (V. komodoensis also has Conclusions large distances), especially when taxon sampling is limited The present mitogenomic study does not support a close (Nei & Kumar 2000). In the current study the long branch of relationship between snakes, anguimorphs and/or iguanians. the snakes did not affect lizard and amphisbaenian relation- It supports a fossorial origin of snakes (snakes and amphis- ships. Several morphological studies, with the inclusion of baenians), but does not rule out the possibility that snakes fossil taxa, have supported a relationship between varanoid may be sister to all other squamates. It would be interesting lizards (mosasauroids) and snakes (Caldwell & Lee 1997 and to test this relationship with the inclusion of more squamate references therein). However, a sister-group relationship taxa that have yet to be represented by mt genomes. The between varanids and snakes was rejected in statistical inclusion of more acrodonts would be important in breaking tests. up the long branch of P. vitticeps, as would be the inclusion Studies based on nuclear genes support a close relationship of more gekkotans in helping to establish the position of between snakes, anguimorphs and iguanians (Saint et al. 1998; this group. In most analyses in this study, T. keyserlingii was Harris 2003; Townsend et al. 2004; Vidal & Hedges 2004, recovered basally, which is consistent with nuclear analyses. 2005). Our results do not support this grouping; affinities between snakes and anguimorphs and/or iguanians were Acknowledgements rejected statistically by the KH test. In nuclear analyses, the We would like to thank David Gower at the Natural History scincomorphs are positioned basal to all squamates with Museum, London, for providing the T. mirus sample and Dr the exclusion of gekkotans, which is inconsistent with our Steve Donnellan at the South Australian Museum for pro- results. The snake−anguimorph−iguanian clade appears to be viding the R. australis sample. We thank Morgan Kullberg supported by a recent finding by Fry et al. (2006), which for his help with running phylogenetic analyses and Maria suggests that venom toxins thought previously only to have Nilsson for making helpful comments on an earlier version of been present in snakes are also present in anguimorphs and this manuscript.

556 Zoologica Scripta, 35, 6, November 2006, pp545–558 • © 2006 The Authors. Journal compilation © 2006 The Norwegian Academy of Science and Letters D. A. Douglas et al. • Phylogenetic position of snakes

References Kumazawa, Y. (2004). Mitochondrial DNA sequences of five squamates, Adachi, J. & Hasegawa, M. (1996a). MOLPHY version 2.3: programs phylogenetic affiliation of snakes. DNA Research, 11, 137–144. for molecular phylogenetics based on maximum likelihood. Kumazawa, Y. & Endo, H. (2004). Mitochondrial genome of the Computer Science Monographs, 28, 1–150. Komodo dragon, efficient sequencing method with reptile- Adachi, J. & Hasegawa, M. (1996b). Model of amino acid substitution oriented primers and novel gene rearrangements. DNA Research, in proteins encoded by mitochondrial DNA. Journal of Molecular 11, 115–125. Evolution, 42, 459–468. Kumazawa, Y. & Nishida, M. (1993). Sequence evolution of mito- Bellairs, A. D. & Underwood, U. (1951). The origin of snakes. chondrial tRNA genes and deep-branch animal phylogenetics. Biological Reviews of the Cambridge Philosophical Society, 26, Journal of Molecular Evolution, 37, 380–398. 193–237. Kumazawa, Y. & Nishida, M. (1995). Variations in mitochondrial Benson, G. (1999). Tandem repeats finder: a program to analyze tRNA gene organization of reptiles as phylogenetic markers. DNA sequences. Nucleic Acid Research, 27 (2), 573–580. Molecular Biology and Evolution, 12 (5), 759–772. Caldwell, M. W. & del Sasso, C. (2004). Soft-tissue preservation in Kumazawa, Y., Ota, H., Nishida, M. & Ozawa, T. (1996). Gene a 95 million year old marine lizard: form, function and aquatic rearrangements in snake mitochondrial genomes, highly concerted adaptation. Journal of Vertebrate Palaeontology, 24 (4), 980–985. evolution of control-region-like sequences duplicated and inserted Caldwell, M. W. & Lee, M. S. Y. (1997). A snake with legs from the into a tRNA gene cluster. Molecular Biology and Evolution, 13 (9), marine Cretaceous of the Middle East. Nature, 386, 705–709. 1242–1254. Clayton, D. (1991). Replication and transcription of vertebrate Kumazawa, Y., Ota, H., Nishida, M. & Ozawa, T. (1998). The mitochondrial DNA. Annual Reviews of Cell Biology, 7, 453–478. complete nucleotide sequence of a snake (Dinodon semicarinatus) Coates, M. & Ruta, M. (2000). Nice snake, shame about the legs. mitochondrial genome with two identical control regions. Genetics, Trends in Ecology and Evolution, 15 (12), 503–507. 150, 313–329. Cope, E. D. (1869). On the reptilian order Pythonomorpha and Kumazawa, Y., Azuma, Y. & Nishida, M. (2004). Tempo of mito- Streptosauria. Proceedings of the Boston Society of Natural History, 12, chondrial gene evolution: can mitochondrial DNA be used to date 250–261. old divergences? Endocytobiosis Cell Research, 15, 136–142. Dong, S. & Kumazawa, Y. (2005). Complete mitochondrial DNA Lanave, C., Preparata, G., Saccone, C. & Serio, G. (1984). A new sequences of six snakes: phylogenetic relationships and molecular method for calculating evolutionary substitution rates. Journal of evolution of genomic features. Journal of Molecular Evolution, 61 Molecular Evolution, 20 (1), 86–93. (1), 12–22. Lee, M. S. Y. (1998). Convergent evolution and character correlation Evans, S. (2003). At the feet of dinosaurs: the early history and in burrowing reptiles, towards a resolution of squamate relation- radiation of lizards. Biological Reviews, 78, 513–551. ships. Biological Journal of the Linnean Society., 65, 369–453. Forstner, M. R. J., Davis, S. K. & Arévalo, E. (1995). Support for the Lee, M. S. Y. & Caldwell, M. W. (2000). Adriosaurus and the affinities hypothesis of anguimorph ancestry for the suborder Serpentes of mosasaurs, dolichosaurs and snakes. Journal of Palaeontology, 74 from phylogenetic analysis of mitochondrial DNA sequences. (5), 915–937. Molecular Phylogenetics and Evolution, 4 (1), 93–102. Lee, M. S. Y., Bell, G. L. Jr & Caldwell, M. W. (1999). The origin Fry, B. G., Vidal, N., Norman, J. A., Vonk, F. J., Scheib, H., Ramjan, of snake feeding. Nature, 400, 655–659. S. F. R., Kuruppu, S., Fung, K., Hedges, S. B., Richardson, M. K., Macey, J. R., Larson, A., Ananjeva, N. B. & Papenfuss, T. J. (1997). Hodgson, W. C., Ignjatovic, V., Summerhayes, R. & Kochva, E. Evolutionary shifts in three major structural features of the (2006). Early evolution of the venom system in lizards and snakes. mitochondrial genome among iguanian lizards. Journal of Molecular Nature, 439, 584–588. Evolution, 44, 660–674. Greene, H. (1997). Snakes, the Evolution of Mystery in Nature. Berkley Macey, J. R., Schulte, J. A. I. I. & Larson, A. (2000). Evolution and and Los Angeles, California: University of California Press. phylogenetic information content of mitochondrial genomic Greene, H. & Cundall, D. (2000). Limbless tetrapods and snakes structural features illustrated with acrodont lizards. Systematic with legs. Science, 287, 1939–1941. Biology, 49 (2), 257–277. Gu, X., Fu, Y. & Li, W. (1995). Maximum Likelihood estimation of Macey, J. R., Papenfuss, T. J., Kuehl, J. V., Fourcade, H. M. & the heterogeneity of substitution rate among nucleotide sites. Boore, J. L. (2004). Phylogenetic relationships among amphis- Molecular Biology and Evolution, 12 (4), 546–557. baenian reptiles based on complete mitochondrial genomic Harris, D. J. (2003). Codon bias variation in c-mos between sequences. Molecular Phylogenetics and Evolution, 33 (1), 22–31. squamate families might distort phylogenetic inferences. Molecular Nei, M. & Kumar, S. (2000). Molecular Evolution and Phylogenetics. Phylogenetics and Evolution, 27, 540–544. Oxford: Oxford University Press. Jobb, G. (2005). TREEFINDER, version of October 2005. [Computer Page, R. D. M. & Holmes, E. C. (1998). Molecular Evolution, a manual]. Munich, Germany. Distributed by the author at Phylogenetic Approach. Oxford: Blackwell Scientific. www.treefinder.de. Posada, D. & Crandall, K. A. (1998). Modeltest, testing the model Kearney, M. (2003). Systematics of the Amphisbaenia (Lepidosauria, of DNA substitution. Bioinformatics, 14 (9), 817–818. Squamata) based on morphological evidence from recent and Pough, F. H., Janis, C. M. & Heiser, J. B. (2005). Vertebrate Life, 7th fossil forms. Herpetological Monographs, 17, 1–74. edn. Upper Saddle River, New Jersey: Pearson Education Inc. Kishino, H. & Hasegawa, M. (1989). Evaluation of the maximum Rest, J. S., Ast, J. C., Austin, C. C., Waddell, P. J., Tibbetts, E. A., likelihood estimate of the evolutionary tree topologies from DNA Hay, J. M. & Mindell, D. P. (2003). Molecular systematics of sequence data, and the branching order in Hominoidea. Journal of primary reptilian lineages and the tuatara mitochondrial genome. Molecular Evolution, 29, 170–179. Molecular Phylogenetics and Evolution, 29 (2), 289–297.

© 2006 The Authors. Journal compilation © 2006 The Norwegian Academy of Science and Letters • Zoologica Scripta, 35, 6, November 2006, pp545–558 557 Phylogenetic position of snakes • D. A. Douglas et al.

Rieppel, O. & Zaher, H. (2000). The intramandibular joint in Swofford, D. L. (1998). Phylogenetic Analysis Using Parsimony (*and squamates, and the phylogenetic relationships of the fossil snake other methods), Version 4. [Computer software and manual]. Pachyrachis problematicus Haas. Fieldiana (Geology), 43, 1–69. Sunderland, MA: Sinauer Associates. Rieppel, O., Zaher, H., Tchernov, E. & Polcyn, M. J. (2003). The Tchernov, E., Rieppel, O., Zaher, H., Polcyn, M. J. & Jacobs, L. L. anatomy and relationships of Haasiophis terrasanctus, a fossil snake (2000). A fossil snake with limbs. Science, 287, 2010–2012. with well-developed hind limbs from the mid-Cretaceous of the Townsend, T. M., Larson, A., Louis, E. & Macey, J. R. (2004). Middle East. Journal of Palaeontology, 77 (3), 536–558. Molecular phylogenetics of Squamata, The position of snakes, Ronquist, F. & Huelsenbeck, J. P. (2003). MRBAYES 3, Bayesian amphisbaenians, and dibamids, and the root of the squamate tree. phylogenetic inference under mixed models. Bioinformatics, 19, Systematic Biology, 53 (3), 735–757. 1572–1574. Underwood, G. (1970). The eye. In C. Gans & T. S. Parsons (Eds) Saint, K. M., Austin, C. C., Donnellan, S. C. & Hutchinson, M. N. Biology of the Reptilia (pp. 1–97). London: Academic Press. (1998). C-mos, a nuclear marker useful for squamate phylogenetic Vidal, N. & Hedges, S. B. (2004). Molecular evidence for a terrestrial analysis. Molecular Phylogenetics and Evolution, 10 (2), 259–263. origin of snakes. Proceedings of the Royal Society of London Series B Sambrook, J. & Russell, D. W. (2001). Molecular Cloning, a Laboratory (Suppl. 4), 271, 226–229. Manual. Cold Spring Harbor, NY: Cold Spring Harbor Press. Vidal, N. & Hedges, S. B. (2005). The phylogeny of squamate reptiles Scanlon, J. D. & Lee, M. S. Y. (2000). The Pleistocene serpent (lizards, snakes and amphisbaenians) inferred from nine nuclear Wonambi and the early evolution of snakes. Nature, 403, 416–420. protein-coding genes. Comptes Rendus Biologies, 328, 1000–1008. Schmidt, H. A., Strimmer, K., Vingron, M. & von Haeseler, A. Zaher, H. (1998). The phylogenetic position of Pachyrachis within (2002). TREE-PUZZLE, maximum likelihood phylogenetic snakes (Squamata, Lepidosauria). Journal of Vertebrate Palaeontology, analysis using quartets and parallel computing. Bioinformatics, 18, 18 (1), 1–3. 502–504. Zaher, H. & Rieppel, O. (2002). On the phylogenetic relationships Shimodaira, H. & Hasegawa, M. (1999). Multiple comparisons of of the Cretaceous snakes with legs, with special reference to log-likelihoods with applications to phylogenetic inference. Pachyrachis problematicus (Squamata, Serpentes). Journal of Molecular Biology and Evolution, 16, 1114–1116. Vertebrate Palaeontology, 22 (1), 104–109.