DOCSLIB.ORG

Supplementary Data

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplementary Data Supplementary Information Supplementary Materials and Methods Multiple myeloma specimens Primary bone marrow samples from 116 MM patients and 12 patients without tumors were obtained from the 4th Department of Internal Medicine, Hiroshima Atomic-Bomb Survivors Hospital; the 1st Department of Internal Medicine, Sapporo Medical University Hospital; and the Department of Hematology, Teine Keijinkai Hospital after acquisition of informed consent from each patient. Mononuclear cells were separated from 99 samples using Ficoll-Paque (StemCell Technologies), after which we separated the CD138-positive cells using CD138 MicroBeads (Miltenyi Biotec). There were five patients whose bone marrow specimens were collected before and after treatment. All five of those patients received treatment with Dex. Of those five patients, three received bortezomib and Dex; one received vincristine, adriamysin and Dex; and one received melphalan and Dex followed by peripheral blood stem cell transplantation. Methylation analysis Combined bisulfite restriction analysis (COBRA) were performed as described previously (1). The PCR products were digested with the restriction endonuclease Hinf (TaKaRa) and precipitated with ethanol, after which the resultant DNA fragments were subjected to 2.5% agarose gel electrophoresis and stained with ethidium bromide. Bisulfite-pyrosequencing was carried out as described previously (2). The primers used for COBRA were also used for pyrosequencing. After PCR, the biotinylated PCR product was purified, made single-stranded, and used as a template in the pyrosequencing reaction. Briefly, the PCR products were bound to streptavidin sepharose beads HP (Amersham Biosciences), after which beads containing the immobilized PCR product were purified, washed, and denatured using a 0.2 mol/L NaOH solution. After addition of 0.3 μmol/L sequencing primer to the purified PCR product, pyrosequencing was carried out using a PSQ96MA system (Biotage) and Pyro Q-CpG software (Biotage). MM-related genes were deemed methylated if the level of methylation was above the 75th percentile level found in control bone marrow samples. Statistics Paired t tests were used to compare differences in methylation levels before and after treatments. Pearson’s and Spearman’s correlation coefficients (r and rs, respectively) were calculated to evaluate the correlation between gene expression levels (log-transformed), fold expression levels, and methylation levels. Cell viability was assessed using one way ANOVA with post hoc Dunnett’s test. All statistical calculations were performed using SPSSJ 15.0 (SPSS Japan Inc.). References. 1. Xiong Z, Laird PW. COBRA: a sensitive and quantitative DNA methylation assay. Nucleic Acids Res 1997; 25: 2532-4. 2. Yang AS, Estecio MR, Doshi K, Kondo Y, Tajara EH, Issa JP. A simple method for estimating global DNA methylation using bisulfite PCR of repetitive DNA elements. Nucleic Acids Res 2004; 32: e38. Legends for Supplementary Figures. Supplementary Figure 1. Representative results of real-time PCR analysis of genes upregulated by DAC in MM cell lines. Expression levels of CST1 and IER3 relative to that in normal bone marrow are shown on the Y-axis. Supplementary Figure 2. Expression profile of candidate genes silenced by DNA methylation in MM. The heat map shows the expression profiles in normal colon, normal stomach and three cancer cell lines. Levels of expression are normalized to that in normal bone marrow. Supplementary Figure 3. Representative results of real-time PCR of candidate methylation target genes in MM cell lines treated with DAC. Supplementary Figure 4. Summary of gene expression in MM cells treated with DAC. Levels of expression are normalized to those in mock treated cells. Supplementary Figure 5. Bisulfite-sequencing analysis of BNIP3 and SOCS3 in MM cell lines. Open circles indicate the unmethylated CpG sites; filled circles indicate the methylated CpG sites. Supplementary Table 1. Primer sequences and restriction enzymes used in this study. Primer Gene name Forward Reverse Restriction enzymes COBRA GPR30 GGTYGAGTGTTTTTGGAGGT CCTTTATCCRCTAAATATAAATAATAC TaqI FMR1NB GTTAYGGATTGTTTTGGAAG TTACCAACTCTAAATAAACCACAC MboI CST6 TTYGAGTTTYGTTTTAGTTTTAGGT TAACAACRCCAAAAAACAAAATAC HhaI TNFRSF4 TAYGGTGTTTAGTTTTAGGTTTAGGAGATCCCCRACCTACCACCTTC TaqI SECTM1 GGAGTTTTAGGAAAATGAAAG CCCRTAAAAATAATAAATTCAC HhaI PTRF AGYGGGAGATTYGGAGAGAAGT CCTCCCTTTCTAAAATAAAACCAACC TaqI C16orf30 TTTTTGTTGAGAGTTAGGGAAG ACACCRACCTACTATAAATACCA MboI RASD1 GTTTTTAGTTTTAGTTYGATTTTGGA CCRCCCTTATATACAACCTACTC AfaI DAZL TGAAGAGAAAAGGAAAATTAAGAG AAACRCTACCACCCATTAAC TaqI DDX43 TAATGGTTGYGTGAAATTAGTG CCTCCRTAATAAAACATTATTCC MluI PDIA2 GGTTTTGTTTTTGTTGGGATTG AAATTTCCTCCTCTAAAAACTCCTC MluI FES TTYGGGGTTTGGGTTAATTG ACRCCTACTCTACCCCTACCTAC TaqI COX7A1 GTTTTAGTTTYGTYGYGTTTTTAG AACCCAACCCATAAAAACCTCA TaiI KRTCAP3 GGGGTYGGGTTTAGGTATAG CACRAAAAAAAACAAAATTAAATC HhaI RRAD TTGAGAAGGYGGTGGTTGTAGTAGTACCRAAACCCCTCCRAACCTAA TaqI FGFR3 GGGGTYGGGAYGTAGGAGT RCAAACAAAAACRCCCATAAC TaqI IER3 GYGTTTAGGATTGTGTATGTTAAGT TAAACCRAACRAAATATAAAACCA TaqI TKTL1 ATATTTTAGATTTTTTGATTTGTTTG TTAAAATCTAAAAACCCACTCCT TaqI CMTM3 GGTGGTTAAGAAAGTYGTAAGAAA CCACCCRTCTACCCCTATC MluI SYT11 GYGGAGTTTATTTTTTATTAGGA CTCTAAAAACCCTCRATCAATAC MboI P2RY6 GGATTTTAGYGGTGYGGAG CAACTAATCCRACCCAAATATCACT TaiI GDF15 TTTAGAGTYGTAATTTGTATAGTTATGTCRAAATACAACTCTAAAAATCC TaqI RASD1 pyro-seq1GYGTTTAGAGAGTAGGAGTT Bisulfite-sequencing BNIP3 GATATGGYGTTAGAGGGTAATTG CCCRCCCTACCCTATAAATTC SOCS3 GTTTTTTTTTGTTGYGAGTAGTGAT CRTCCCTCRAACTTCCCCT ABL1 TTGGTTYGGGTTGGTTTTGGAAAG AAACCRAAACCCCTCTCCCAACTC Y=C or T, R=G or A 12/26/20083:09 AM Supplementary Table 2. Genes up-rehulated by DAC in KMS12PE. Gene Name Systematic Name DAC VIM NM_003380 181.2 TNFRSF4 NM_003327 113.0 GPR30 NM_001505 85.6 VASN NM_138440 78.6 CST6 NM_001323 63.7 FMR1NB NM_152578 46.1 CKM NM_001824 45.1 AIF1 NM_004847 44.5 COX7A2 NM_001865 44.0 CMTM3 NM_144601 38.5 GPR68 NM_003485 35.9 VIM NM_003380 35.3 LOC645277 XM_928321 32.0 RAB13 NM_002870 31.7 TAS1R1 NM_138697 31.2 EDNRB NM_003991 30.4 B3GALT4 NM_003782 28.9 CXCL9 NM_002416 28.5 PLAT NM_000930 27.5 CCRL2 NM_003965 27.5 TNFAIP2 NM_006291 27.4 ACRC NM_052957 26.1 LAG3 NM_002286 25.8 A_24_P177634 A_24_P177634 24.6 C16orf30 NM_024600 24.4 THC2333719 THC2333719 23.7 MYO1G NM_033054 23.1 ID2 NM_002166 22.8 M32220 M32220 22.7 P2RY5 NM_005767 22.5 SECTM1 NM_003004 20.7 GPX1 NM_201397 20.6 IFI27 NM_005532 19.8 CCR9 NM_006641 19.4 PEPP-2 NM_032498 18.9 ART3 NM_001179 18.8 IFI27 NM_005532 18.1 ENST00000371388 ENST00000371388 18.0 APOE NM_000041 17.6 PTRF NM_012232 17.4 CHRDL2 NM_015424 17.4 CLDN19 NM_148960 17.3 HAS3 NM_005329 17.0 EPHA2 NM_004431 17.0 THC2337710 THC2337710 17.0 LGALS8 NM_006499 16.9 SPINT1 NM_003710 16.5 IFI27 NM_005532 16.5 ZP1 NM_207341 16.3 LOC440335 BC022385 16.2 THC2373524 THC2373524 15.7 AGMAT NM_024758 15.6 CDKN1C NM_000076 15.3 TNF NM_000594 15.1 CYB5R2 NM_016229 15.0 IFI27 NM_005532 14.9 IFI27 NM_005532 14.8 IFI27 NM_005532 14.8 IFI27 NM_005532 13.8 BTBD14A NM_144653 13.8 CCR7 NM_001838 13.5 TMEM49 BC024020 13.5 AGXT2L1 NM_031279 13.4 ANGPT2 NM_001147 13.4 IFI27 NM_005532 13.4 NGB NM_021257 13.2 CNDP1 NM_032649 13.1 IFI27 NM_005532 13.1 AHNAK NM_001620 13.1 RAMP1 NM_005855 13.0 BM045853 BM045853 12.9 ICOS NM_012092 12.8 RUNX3 NM_004350 12.6 LXN NM_020169 12.2 SYT11 NM_152280 12.2 RPGRIP1 NM_020366 12.2 IFI27 NM_005532 12.2 TNNC2 NM_003279 12.1 FLJ25410 NM_144605 11.9 GLULD1 NM_016571 11.9 MET NM_000245 11.8 PROC NM_000312 11.7 A_24_P478940 A_24_P478940 11.3 ENST00000381781 ENST00000381781 11.2 GPR56 NM_201525 11.0 SPINT2 NM_021102 11.0 GNG11 NM_004126 11.0 PLXND1 NM_015103 11.0 BC036938 BC036938 10.9 RASD1 NM_016084 10.9 FARP1 NM_005766 10.8 P2RY6 NM_176798 10.7 LEFTY1 NM_020997 10.6 CD52 NM_001803 10.6 GDF15 NM_004864 10.5 A_24_P109661 A_24_P109661 10.4 A_23_P15226 A_23_P15226 10.4 ENST00000320378 ENST00000320378 10.3 VCX2 NM_016378 10.2 WBP5 NM_016303 10.2 KITLG NM_000899 10.1 RHBDL3 NM_138328 10.0 THC2383841 THC2383841 10.0 Supplementary Table 3. Genes up-regulated by DAC in RPMI8226. Gene Name Systematic Name DAC GPR30 NM_001505 217.7 FMR1NB NM_152578 191.1 DAZL NM_001351 187.0 DDX43 NM_018665 185.0 BC036938 BC036938 121.7 GSTP1 NM_000852 110.9 CST6 NM_001323 89.8 THC2376729 THC2376729 77.7 VCX3A NM_016379 76.9 VCX NM_013452 72.5 VCX2 NM_016378 72.4 THC2407823 THC2407823 67.8 SYCP3 NM_153694 64.5 NEFH NM_021076 62.6 PAGE2 NM_207339 61.7 VASN NM_138440 58.8 CXCL9 NM_002416 57.5 TNFRSF4 NM_003327 57.0 PRAME NM_206956 55.4 PDIA2 NM_006849 54.0 CKM NM_001824 51.4 PAGE5 NM_130467 49.2 DAZ2 NM_001005785 45.5 A_24_P7750 A_24_P7750 44.5 XIST NR_001564 41.3 UCHL1 NM_004181 39.3 BM668321 BM668321 38.2 ENST00000370363 ENST00000370363 38.2 CNDP1 NM_032649 37.6 ECAT8 AK023134 37.2 LEFTY1 NM_020997 36.9 ENST00000311695 ENST00000311695 36.6 MXRA8 NM_032348 35.6 TAS1R1 NM_138697 34.6 RTP3 NM_031440 34.5 BEX1 NM_018476 33.2 CARD9 NM_052813 32.0 KRT19 NM_002276 31.8 LGALS2 NM_006498 31.7 IL18 NM_001562 31.6 FES NM_002005 30.7 RAB7B NM_177403 30.2 CD52 NM_001803 29.9 CPLX3 NM_001030005 29.6 AIF1 NM_004847 28.7 P2RY5 NM_005767 27.8 A_23_P15226 A_23_P15226 27.6 VCY NM_004679 27.6 SECTM1 NM_003004 27.2 ART3 NM_001179 27.0 FAM26A NM_182494 26.9 CDH1 NM_004360 26.3 THC2304038 THC2304038 25.1 LAG3 NM_002286 24.8 CYB5R2 NM_016229 24.3 COX7A1 NM_001864 24.2 CNN3 NM_001839 24.2 GPR68 NM_003485 23.9 VCX2 NM_016378 23.0 THC2437822 THC2437822 22.4 THC2333719 THC2333719 22.2 LY6K NM_017527 22.1 C8G NM_000606 21.9 LOC643431 XM_928128 21.0 DMRTB1 NM_033067 20.8 A_32_P112546 A_32_P112546 20.7 CGREF1 NM_006569
Load more

Recommended publications
  • Merlin Is a Potent Inhibitor of Glioma Growth
    Research Article Merlin Is a Potent Inhibitor of Glioma Growth Ying-Ka Ingar Lau,1 Lucas B. Murray,1 Sean S. Houshmandi,2 Yin Xu,1 David H. Gutmann,2 and Qin Yu1 1Department of Oncological Sciences, Mount Sinai School of Medicine, New York, New York and 2Department of Neurology, Washington University School of Medicine, St. Louis, Missouri Abstract The NF2 gene shares sequence similarity with the members of Neurofibromatosis 2 (NF2) is an inherited cancer syndrome in Band 4.1 superfamily (4, 5). In particular, the NF2 protein, merlin (or schwannomin), most closely resembles proteins of the ezrin- which affected individuals develop nervous system tumors, including schwannomas, meningiomas, and ependymomas. radixin-moesin (ERM) subfamily. Similar to the ERM proteins, The NF2 protein merlin (or schwannomin) is a member of the merlin serves as a linker between transmembrane proteins and the Band 4.1superfamily of proteins, which serve as linkers actin cytoskeleton and regulates cytoskeleton remodeling and cell between transmembrane proteins and the actin cytoskeleton. motility (6–8). Unlike ERM proteins, merlin functions as a negative In addition to mutational inactivation of the NF2 gene in NF2- growth regulator or tumor suppressor. In this regard, mutational associated tumors, mutations and loss of merlin expression inactivation of the NF2 gene is sufficient to result in the have also been reported in other types of cancers. In the development of NF2-associated nervous system tumors. Moreover, present study, we show that merlin expression is dramatically NF2 mutations have also been reported in other tumor types, reduced in human malignant gliomas and that reexpression of including melanoma and mesothelioma (9), suggesting that merlin plays an important role, not only in NF2-associated tumors but also functional merlin dramatically inhibits both subcutaneous and intracranial growth of human glioma cells in mice.
    [Show full text]
  • A Multistep Bioinformatic Approach Detects Putative Regulatory
    BMC Bioinformatics BioMed Central Research article Open Access A multistep bioinformatic approach detects putative regulatory elements in gene promoters Stefania Bortoluzzi1, Alessandro Coppe1, Andrea Bisognin1, Cinzia Pizzi2 and Gian Antonio Danieli*1 Address: 1Department of Biology, University of Padova – Via Bassi 58/B, 35131, Padova, Italy and 2Department of Information Engineering, University of Padova – Via Gradenigo 6/B, 35131, Padova, Italy Email: Stefania Bortoluzzi - [email protected]; Alessandro Coppe - [email protected]; Andrea Bisognin - [email protected]; Cinzia Pizzi - [email protected]; Gian Antonio Danieli* - [email protected] * Corresponding author Published: 18 May 2005 Received: 12 November 2004 Accepted: 18 May 2005 BMC Bioinformatics 2005, 6:121 doi:10.1186/1471-2105-6-121 This article is available from: http://www.biomedcentral.com/1471-2105/6/121 © 2005 Bortoluzzi et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: Searching for approximate patterns in large promoter sequences frequently produces an exceedingly high numbers of results. Our aim was to exploit biological knowledge for definition of a sheltered search space and of appropriate search parameters, in order to develop a method for identification of a tractable number of sequence motifs. Results: Novel software (COOP) was developed for extraction of sequence motifs, based on clustering of exact or approximate patterns according to the frequency of their overlapping occurrences.
    [Show full text]
  • Figure S1. HAEC ROS Production and ML090 NOX5-Inhibition
    Figure S1. HAEC ROS production and ML090 NOX5-inhibition. (a) Extracellular H2O2 production in HAEC treated with ML090 at different concentrations and 24 h after being infected with GFP and NOX5-β adenoviruses (MOI 100). **p< 0.01, and ****p< 0.0001 vs control NOX5-β-infected cells (ML090, 0 nM). Results expressed as mean ± SEM. Fold increase vs GFP-infected cells with 0 nM of ML090. n= 6. (b) NOX5-β overexpression and DHE oxidation in HAEC. Representative images from three experiments are shown. Intracellular superoxide anion production of HAEC 24 h after infection with GFP and NOX5-β adenoviruses at different MOIs treated or not with ML090 (10 nM). MOI: Multiplicity of infection. Figure S2. Ontology analysis of HAEC infected with NOX5-β. Ontology analysis shows that the response to unfolded protein is the most relevant. Figure S3. UPR mRNA expression in heart of infarcted transgenic mice. n= 12-13. Results expressed as mean ± SEM. Table S1: Altered gene expression due to NOX5-β expression at 12 h (bold, highlighted in yellow). N12hvsG12h N18hvsG18h N24hvsG24h GeneName GeneDescription TranscriptID logFC p-value logFC p-value logFC p-value family with sequence similarity NM_052966 1.45 1.20E-17 2.44 3.27E-19 2.96 6.24E-21 FAM129A 129. member A DnaJ (Hsp40) homolog. NM_001130182 2.19 9.83E-20 2.94 2.90E-19 3.01 1.68E-19 DNAJA4 subfamily A. member 4 phorbol-12-myristate-13-acetate- NM_021127 0.93 1.84E-12 2.41 1.32E-17 2.69 1.43E-18 PMAIP1 induced protein 1 E2F7 E2F transcription factor 7 NM_203394 0.71 8.35E-11 2.20 2.21E-17 2.48 1.84E-18 DnaJ (Hsp40) homolog.
    [Show full text]
  • Supplementary Table 8. Cpcp PPI Network Details for Significantly Changed Proteins, As Identified in 3.2, Underlying Each of the Five Functional Domains
    Supplementary Table 8. cPCP PPI network details for significantly changed proteins, as identified in 3.2, underlying each of the five functional domains. The network nodes represent each significant protein, followed by the list of interactors. Note that identifiers were converted to gene names to facilitate PPI database queries. Functional Domain Node Interactors Development and Park7 Rack1 differentiation Kcnma1 Atp6v1a Ywhae Ywhaz Pgls Hsd3b7 Development and Prdx6 Ncoa3 differentiation Pla2g4a Sufu Ncf2 Gstp1 Grin2b Ywhae Pgls Hsd3b7 Development and Atp1a2 Kcnma1 differentiation Vamp2 Development and Cntn1 Prnp differentiation Ywhaz Clstn1 Dlg4 App Ywhae Ywhab Development and Rac1 Pak1 differentiation Cdc42 Rhoa Dlg4 Ctnnb1 Mapk9 Mapk8 Pik3cb Sod1 Rrad Epb41l2 Nono Ltbp1 Evi5 Rbm39 Aplp2 Smurf2 Grin1 Grin2b Xiap Chn2 Cav1 Cybb Pgls Ywhae Development and Hbb-b1 Atp5b differentiation Hba Kcnma1 Got1 Aldoa Ywhaz Pgls Hsd3b4 Hsd3b7 Ywhae Development and Myh6 Mybpc3 differentiation Prkce Ywhae Development and Amph Capn2 differentiation Ap2a2 Dnm1 Dnm3 Dnm2 Atp6v1a Ywhab Development and Dnm3 Bin1 differentiation Amph Pacsin1 Grb2 Ywhae Bsn Development and Eef2 Ywhaz differentiation Rpgrip1l Atp6v1a Nphp1 Iqcb1 Ezh2 Ywhae Ywhab Pgls Hsd3b7 Hsd3b4 Development and Gnai1 Dlg4 differentiation Development and Gnao1 Dlg4 differentiation Vamp2 App Ywhae Ywhab Development and Psmd3 Rpgrip1l differentiation Psmd4 Hmga2 Development and Thy1 Syp differentiation Atp6v1a App Ywhae Ywhaz Ywhab Hsd3b7 Hsd3b4 Development and Tubb2a Ywhaz differentiation Nphp4
    [Show full text]
  • Supplementary Table 2
    Supplementary Table 2. Differentially Expressed Genes following Sham treatment relative to Untreated Controls Fold Change Accession Name Symbol 3 h 12 h NM_013121 CD28 antigen Cd28 12.82 BG665360 FMS-like tyrosine kinase 1 Flt1 9.63 NM_012701 Adrenergic receptor, beta 1 Adrb1 8.24 0.46 U20796 Nuclear receptor subfamily 1, group D, member 2 Nr1d2 7.22 NM_017116 Calpain 2 Capn2 6.41 BE097282 Guanine nucleotide binding protein, alpha 12 Gna12 6.21 NM_053328 Basic helix-loop-helix domain containing, class B2 Bhlhb2 5.79 NM_053831 Guanylate cyclase 2f Gucy2f 5.71 AW251703 Tumor necrosis factor receptor superfamily, member 12a Tnfrsf12a 5.57 NM_021691 Twist homolog 2 (Drosophila) Twist2 5.42 NM_133550 Fc receptor, IgE, low affinity II, alpha polypeptide Fcer2a 4.93 NM_031120 Signal sequence receptor, gamma Ssr3 4.84 NM_053544 Secreted frizzled-related protein 4 Sfrp4 4.73 NM_053910 Pleckstrin homology, Sec7 and coiled/coil domains 1 Pscd1 4.69 BE113233 Suppressor of cytokine signaling 2 Socs2 4.68 NM_053949 Potassium voltage-gated channel, subfamily H (eag- Kcnh2 4.60 related), member 2 NM_017305 Glutamate cysteine ligase, modifier subunit Gclm 4.59 NM_017309 Protein phospatase 3, regulatory subunit B, alpha Ppp3r1 4.54 isoform,type 1 NM_012765 5-hydroxytryptamine (serotonin) receptor 2C Htr2c 4.46 NM_017218 V-erb-b2 erythroblastic leukemia viral oncogene homolog Erbb3 4.42 3 (avian) AW918369 Zinc finger protein 191 Zfp191 4.38 NM_031034 Guanine nucleotide binding protein, alpha 12 Gna12 4.38 NM_017020 Interleukin 6 receptor Il6r 4.37 AJ002942
    [Show full text]
  • Genomic and Transcriptome Analysis Revealing an Oncogenic Functional Module in Meningiomas
    Neurosurg Focus 35 (6):E3, 2013 ©AANS, 2013 Genomic and transcriptome analysis revealing an oncogenic functional module in meningiomas XIAO CHANG, PH.D.,1 LINGLING SHI, PH.D.,2 FAN GAO, PH.D.,1 JONATHAN RUssIN, M.D.,3 LIYUN ZENG, PH.D.,1 SHUHAN HE, B.S.,3 THOMAS C. CHEN, M.D.,3 STEVEN L. GIANNOTTA, M.D.,3 DANIEL J. WEISENBERGER, PH.D.,4 GAbrIEL ZADA, M.D.,3 KAI WANG, PH.D.,1,5,6 AND WIllIAM J. MAck, M.D.1,3 1Zilkha Neurogenetic Institute, Keck School of Medicine, University of Southern California, Los Angeles, California; 2GHM Institute of CNS Regeneration, Jinan University, Guangzhou, China; 3Department of Neurosurgery, Keck School of Medicine, University of Southern California, Los Angeles, California; 4USC Epigenome Center, Keck School of Medicine, University of Southern California, Los Angeles, California; 5Department of Psychiatry, Keck School of Medicine, University of Southern California, Los Angeles, California; and 6Division of Bioinformatics, Department of Preventive Medicine, Keck School of Medicine, University of Southern California, Los Angeles, California Object. Meningiomas are among the most common primary adult brain tumors. Although typically benign, roughly 2%–5% display malignant pathological features. The key molecular pathways involved in malignant trans- formation remain to be determined. Methods. Illumina expression microarrays were used to assess gene expression levels, and Illumina single- nucleotide polymorphism arrays were used to identify copy number variants in benign, atypical, and malignant me- ningiomas (19 tumors, including 4 malignant ones). The authors also reanalyzed 2 expression data sets generated on Affymetrix microarrays (n = 68, including 6 malignant ones; n = 56, including 3 malignant ones).
    [Show full text]
  • RRAD Expression in Gastric and Colorectal Cancer with Peritoneal
    www.nature.com/scientificreports OPEN RRAD expression in gastric and colorectal cancer with peritoneal carcinomatosis Hee Kyung Kim1,4,5, Inkyoung Lee2,5, Seung Tae Kim1, Jeeyun Lee 1, Kyoung-Mee Kim3, Joon Oh Park1 & Won Ki Kang1* The role of Ras-related associated with diabetes (RRAD) in gastric cancer (GC) or colorectal cancer (CRC) has not been investigated. We aimed to investigate the biological and clinical roles of RRAD in GC and CRC and to assess RRAD as a therapeutic target. A total of 31 cancer cell lines (17 GC cell lines, 14 CRC cell lines), 59 patient-derived cells (PDCs from 48 GC patients and 11 CRC patients), and 84 matched pairs of primary cancer tissue and non-tumor tissue were used to evaluate the role of RRAD in vitro and in vivo. RRAD expression was frequently increased in GC and CRC cell lines, and siRNA/shRNA- mediated RRAD inhibition induced signifcant decline of tumor cell proliferation both in vitro and in vivo. A synergistic efect of RRAD inhibition was generated by combined treatment with chemotherapy. Notably, RRAD expression was markedly increased in PDCs, and RRAD inhibition suppressed PDC proliferation. RRAD inhibition also resulted in reduced cell invasion, decreased expression of EMT markers, and decreased angiogenesis and levels of associated proteins including VEGF and ANGP2. Our study suggests that RRAD could be a novel therapeutic target for treatment of GC and CRC, especially in patients with peritoneal seeding. Gastric cancer (GC) and colorectal cancer (CRC) are the most common gastrointestinal malignancies world- wide1. Despite declining incidence and advances in treatment, the prognosis of metastatic GC is poor, and GC is the second leading cause of cancer mortality2,3.
    [Show full text]
  • Egfr Activates a Taz-Driven Oncogenic Program in Glioblastoma
    EGFR ACTIVATES A TAZ-DRIVEN ONCOGENIC PROGRAM IN GLIOBLASTOMA by Minling Gao A thesis submitted to Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy Baltimore, Maryland March 2020 ©2020 Minling Gao All rights reserved Abstract Hyperactivated EGFR signaling is associated with about 45% of Glioblastoma (GBM), the most aggressive and lethal primary brain tumor in humans. However, the oncogenic transcriptional events driven by EGFR are still incompletely understood. We studied the role of the transcription factor TAZ to better understand master transcriptional regulators in mediating the EGFR signaling pathway in GBM. The transcriptional coactivator with PDZ- binding motif (TAZ) and its paralog gene, the Yes-associated protein (YAP) are two transcriptional co-activators that play important roles in multiple cancer types and are regulated in a context-dependent manner by various upstream signaling pathways, e.g. the Hippo, WNT and GPCR signaling. In GBM cells, TAZ functions as an oncogene that drives mesenchymal transition and radioresistance. This thesis intends to broaden our understanding of EGFR signaling and TAZ regulation in GBM. In patient-derived GBM cell models, EGF induced TAZ and its known gene targets through EGFR and downstream tyrosine kinases (ERK1/2 and STAT3). In GBM cells with EGFRvIII, an EGF-independent and constitutively active mutation, TAZ showed EGF- independent hyperactivation when compared to EGFRvIII-negative cells. These results revealed a novel EGFR-TAZ signaling axis in GBM cells. The second contribution of this thesis is that we performed next-generation sequencing to establish the first genome-wide map of EGF-induced TAZ target genes.
    [Show full text]
  • White-Nose Syndrome Is Associated with Increased Replication of A
    www.nature.com/scientificreports OPEN White-nose syndrome is associated with increased replication of a naturally persisting coronaviruses Received: 16 July 2018 Accepted: 9 October 2018 in bats Published: xx xx xxxx Christina M. Davy1,2, Michael E. Donaldson1, Sonu Subudhi 3, Noreen Rapin3, Lisa Warnecke4,5, James M. Turner4,6, Trent K. Bollinger7, Christopher J. Kyle8, Nicole A. S.-Y. Dorville4, Emma L. Kunkel4, Kaleigh J. O. Norquay4, Yvonne A. Dzal4, Craig K. R. Willis4 & Vikram Misra 3 Spillover of viruses from bats to other animals may be associated with increased contact between them, as well as increased shedding of viruses by bats. Here, we tested the prediction that little brown bats (Myotis lucifugus) co-infected with the M. lucifugus coronavirus (Myl-CoV) and with Pseudogymnoascus destructans (Pd), the fungus that causes bat white-nose syndrome (WNS), exhibit diferent disease severity, viral shedding and molecular responses than bats infected with only Myl-CoV or only P. destructans. We took advantage of the natural persistence of Myl-CoV in bats that were experimentally inoculated with P. destructans in a previous study. Here, we show that the intestines of virus-infected bats that were also infected with fungus contained on average 60-fold more viral RNA than bats with virus alone. Increased viral RNA in the intestines correlated with the severity of fungus-related pathology. Additionally, the intestines of bats infected with fungus exhibited diferent expression of mitogen-activated protein kinase pathway and cytokine related transcripts, irrespective of viral presence. Levels of coronavirus antibodies were also higher in fungal-infected bats.
    [Show full text]
  • Systematic Elucidation of Neuron-Astrocyte Interaction in Models of Amyotrophic Lateral Sclerosis Using Multi-Modal Integrated Bioinformatics Workflow
    ARTICLE https://doi.org/10.1038/s41467-020-19177-y OPEN Systematic elucidation of neuron-astrocyte interaction in models of amyotrophic lateral sclerosis using multi-modal integrated bioinformatics workflow Vartika Mishra et al.# 1234567890():,; Cell-to-cell communications are critical determinants of pathophysiological phenotypes, but methodologies for their systematic elucidation are lacking. Herein, we propose an approach for the Systematic Elucidation and Assessment of Regulatory Cell-to-cell Interaction Net- works (SEARCHIN) to identify ligand-mediated interactions between distinct cellular com- partments. To test this approach, we selected a model of amyotrophic lateral sclerosis (ALS), in which astrocytes expressing mutant superoxide dismutase-1 (mutSOD1) kill wild-type motor neurons (MNs) by an unknown mechanism. Our integrative analysis that combines proteomics and regulatory network analysis infers the interaction between astrocyte-released amyloid precursor protein (APP) and death receptor-6 (DR6) on MNs as the top predicted ligand-receptor pair. The inferred deleterious role of APP and DR6 is confirmed in vitro in models of ALS. Moreover, the DR6 knockdown in MNs of transgenic mutSOD1 mice attenuates the ALS-like phenotype. Our results support the usefulness of integrative, systems biology approach to gain insights into complex neurobiological disease processes as in ALS and posit that the proposed methodology is not restricted to this biological context and could be used in a variety of other non-cell-autonomous communication
    [Show full text]
  • Supplementary Table 2: Infection-Sensitive Genes
    Supplementary Table 2: Infection-Sensitive Genes Supplementary Table 2: Upregulated with Adenoviral Infection (pages 1 - 7)- genes that were significant by ANOVA as well as significantly increased in control compared to both 'infected control' (Ad-LacZ) and 'calcineurin infected' (Ad-aCaN). Downregulated with Adenoviral Infection (pages 7 - 13) as above except for direction of change. Columns: Probe Set- Affymetrix probe set identifier for RG-U34A microarray, Symbol and Title- annotated information for above probe set (annotation downloaded June, 2004), ANOVA- p-value for 1-way Analysis of Variance, Uninfected, Ad-LacZ and Ad- aCaN- mean ± SEM expression for uninfected control, adenovirus mediated LacZ treated control, and adenovirus mediated calcineurin treated cultures respectively. Upregulated with Adenoviral Infection Probe Set Symbol Title ANOVA Uninfected Ad-LacZ Ad-aCaN Z48444cds_at Adam10 a disintegrin and metalloprotease domain 10 0.00001 837 ± 31 1107 ± 24 1028 ± 29 L26986_at Adcy8 adenylyl cyclase 8 0.00028 146 ± 12 252 ± 21 272 ± 21 U94340_at Adprt ADP-ribosyltransferase 1 0.00695 2096 ± 100 2783 ± 177 2586 ± 118 U01914_at Akap8 A kinase anchor protein 8 0.00080 993 ± 44 1194 ± 65 1316 ± 44 AB008538_at Alcam activated leukocyte cell adhesion molecule 0.01012 2775 ± 136 3580 ± 216 3429 ± 155 M34176_s_at Ap2b1 adaptor-related protein complex 2, beta 1 subunit 0.01389 2408 ± 199 2947 ± 143 3071 ± 116 D44495_s_at Apex1 apurinic/apyrimidinic endonuclease 1 0.00089 4959 ± 185 5816 ± 202 6057 ± 158 U16245_at Aqp5 aquaporin 5 0.02710
    [Show full text]
  • Translational Profiling Reveals the Transcriptome of Leptin Receptor Neurons and Its Regulation by Leptin
    TRANSLATIONAL PROFILING REVEALS THE TRANSCRIPTOME OF LEPTIN RECEPTOR NEURONS AND ITS REGULATION BY LEPTIN by Margaret B. Allison A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Molecular and Integrative Physiology) In the University of Michigan 2015 Doctoral Committee: Professor Martin G. Myers Jr., Chair Associate Professor Carol F. Elias Professor Malcolm J. Low Professor Suzanne Moenter Professor Audrey Seasholtz Before you leave these portals To meet less fortunate mortals There's just one final message I would give to you: You all have learned reliance On the sacred teachings of science So I hope, through life, you never will decline In spite of philistine defiance To do what all good scientists do: Experiment! -- Cole Porter There is no cure for curiosity. -- unknown © Margaret Brewster Allison 2015 ACKNOWLEDGEMENTS If it takes a village to raise a child, it takes a research university to raise a graduate student. There are many people who have supported me over the past six years at Michigan, and it is hard to imagine pursuing my PhD without them. First and foremost among all the people I need to thank is my mentor, Martin. Nothing I might say here would ever suffice to cover the depth and breadth of my gratitude to him. Without his patience, his insight, and his at times insufferably positive outlook, I don’t know where I would be today. Martin supported my intellectual curiosity, honed my scientific inquiry, and allowed me to do some really fun research in his lab. It was a privilege and a pleasure to work for him and with him.
    [Show full text]