DOCSLIB.ORG

Supplementary Table 2: Infection-Sensitive Genes

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Supplementary Table 2: Infection-Sensitive Genes Supplementary Table 2: Upregulated with Adenoviral Infection (pages 1 - 7)- genes that were significant by ANOVA as well as significantly increased in control compared to both 'infected control' (Ad-LacZ) and 'calcineurin infected' (Ad-aCaN). Downregulated with Adenoviral Infection (pages 7 - 13) as above except for direction of change. Columns: Probe Set- Affymetrix probe set identifier for RG-U34A microarray, Symbol and Title- annotated information for above probe set (annotation downloaded June, 2004), ANOVA- p-value for 1-way Analysis of Variance, Uninfected, Ad-LacZ and Ad- aCaN- mean ± SEM expression for uninfected control, adenovirus mediated LacZ treated control, and adenovirus mediated calcineurin treated cultures respectively. Upregulated with Adenoviral Infection Probe Set Symbol Title ANOVA Uninfected Ad-LacZ Ad-aCaN Z48444cds_at Adam10 a disintegrin and metalloprotease domain 10 0.00001 837 ± 31 1107 ± 24 1028 ± 29 L26986_at Adcy8 adenylyl cyclase 8 0.00028 146 ± 12 252 ± 21 272 ± 21 U94340_at Adprt ADP-ribosyltransferase 1 0.00695 2096 ± 100 2783 ± 177 2586 ± 118 U01914_at Akap8 A kinase anchor protein 8 0.00080 993 ± 44 1194 ± 65 1316 ± 44 AB008538_at Alcam activated leukocyte cell adhesion molecule 0.01012 2775 ± 136 3580 ± 216 3429 ± 155 M34176_s_at Ap2b1 adaptor-related protein complex 2, beta 1 subunit 0.01389 2408 ± 199 2947 ± 143 3071 ± 116 D44495_s_at Apex1 apurinic/apyrimidinic endonuclease 1 0.00089 4959 ± 185 5816 ± 202 6057 ± 158 U16245_at Aqp5 aquaporin 5 0.02710 168 ± 6 214 ± 9 216 ± 17 L12383_at Arf4 ADP-ribosylation factor 4 0.00001 8634 ± 125 10596 ± 121 10465 ± 291 rc_AA944324_at Arf6 ADP-ribosylation factor 6 0.00000 3016 ± 122 4546 ± 203 4164 ± 123 U90887_at Arg2 arginase 2 0.00000 415 ± 25 891 ± 42 907 ± 34 AF017756_at Axin GSK-3beta interacting protein rAxin 0.00003 965 ± 51 1352 ± 53 1372 ± 52 M75168_at Bat1a HLA-B-associated transcript 1A 0.00331 2403 ± 131 3116 ± 82 3016 ± 157 rc_AA892014_s_at Bat1a HLA-B-associated transcript 1A 0.00000 5108 ± 198 8177 ± 483 7792 ± 149 rc_AI010293_at Bat3 HLA-B-associated transcript 3 0.00000 2198 ± 63 3271 ± 109 2981 ± 82 L26268_at Btg1 B-cell translocation gene 1 0.00059 3958 ± 229 4921 ± 121 5280 ± 224 L02315_at Cacnb4 calcium channel beta 4 subunit 0.00095 231 ± 17 310 ± 8 304 ± 14 L27487_at Calcrl calcitonin receptor-like 0.01445 147 ± 13 202 ± 18 215 ± 15 U53859_at Capns1 calpain, small subunit 1 0.02169 5700 ± 343 6902 ± 213 6675 ± 280 U77933_at Casp2 caspase 2 0.00000 1085 ± 37 1749 ± 98 1969 ± 78 U49930_g_at Casp3 caspase 3 0.00004 1276 ± 59 1589 ± 60 1730 ± 49 AF087437UTR#1_s_at Cbfb core binding factor beta 0.00002 4776 ± 306 6158 ± 235 6601 ± 97 L11007_at Cdk4 cyclin-dependent kinase 4 0.00004 4838 ± 135 6305 ± 330 6599 ± 173 X83579_at Cdk7 cyclin-dependent kinase 7 0.00015 599 ± 35 838 ± 46 903 ± 43 U11031_at Cntn3 contactin 3 0.00012 128 ± 22 230 ± 29 278 ± 9 X95466_at CPG2 CPG2 protein 0.00266 242 ± 18 381 ± 34 349 ± 20 X14788_s_at Creb1 cAMP response element binding protein 1 0.01655 514 ± 31 694 ± 44 680 ± 47 L15618_at Csnk2a1 casein kinase II, alpha 1 polypeptide 0.00156 772 ± 75 1096 ± 71 1124 ± 50 rc_AI230260_s_at Csnk2b casein kinase II beta subunit 0.00018 5811 ± 279 8088 ± 232 7203 ± 334 U44948_at Csrp2 cysteine rich protein 2 0.00014 1332 ± 56 1703 ± 68 1785 ± 63 U17035_s_at Cxcl10 chemokine (C-X-C motif) ligand 10 0.00007 149 ± 8 722 ± 106 637 ± 72 D83948mRNA_at D83948 RNA binding motif protein 10 0.00844 1111 ± 56 1359 ± 25 1315 ± 59 AF039583_s_at Daf decay-accelarating factor 0.00021 148 ± 28 302 ± 28 347 ± 29 X62160_at Dctn1 dynactin 1 0.00504 7885 ± 432 9401 ± 282 8979 ± 130 Page 1 Supplementary Table 2: Infection-Sensitive Genes Probe Set Symbol Title ANOVA Uninfected Ad-LacZ Ad-aCaN U30186_at Ddit3 DNA-damage inducible transcript 3 0.00006 1050 ± 71 1447 ± 52 1534 ± 62 AF063447_at Ddxl nuclear RNA helicase, DECD variant of DEAD box family 0.00000 1183 ± 89 2338 ± 201 2304 ± 44 D31734_g_at Dlx5 Distal-less homeobox 0.00037 439 ± 11 600 ± 53 641 ± 17 U15138_at Dncli2 LIC-2 dynein light intermediate chain 53/55 0.00273 12227 ± 687 13992 ± 400 15038 ± 413 AB012214_s_at Dnmt1 DNA (cytosine-5-)-methyltransferase 1 0.00005 1431 ± 42 2128 ± 99 1975 ± 95 U31777_g_at Drpla dentatorubral pallidoluysian atrophy 0.00447 2057 ± 371 3297 ± 119 2890 ± 143 L05489_at Dtr diphtheria toxin receptor 0.00000 477 ± 37 717 ± 24 796 ± 22 rc_AI104012_at Dyrk1a dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A 0.00002 475 ± 31 634 ± 22 713 ± 28 Y16188_at Ecel1 endothelin converting enzyme-like 1 0.00305 311 ± 26 459 ± 32 412 ± 21 K01677_at Eif5 eukaryotic initiation factor 5 (eIF-5) 0.00433 535 ± 32 728 ± 58 725 ± 30 M19651_at Fosl1 Fos-like antigen 1 0.01169 38 ± 4 195 ± 69 236 ± 36 U09583_at Frk src related tyrosine kinase 0.00771 24 ± 4 48 ± 3 44 ± 6 rc_AA858520_g_at Fst follistatin 0.00004 190 ± 12 300 ± 10 356 ± 27 AF058791_at G10 maternal G10 transcript 0.00008 2406 ± 91 3085 ± 94 3130 ± 108 X15467cds_at Gabrb2 Gamma-aminobutyric acid receptor beta 2 0.01864 257 ± 24 375 ± 23 374 ± 35 M80367_at Gbp2 guanylate binding protein 2, interferon-inducible 0.00009 90 ± 17 463 ± 79 428 ± 42 rc_AA891829_g_at Gch GTP cyclohydrolase 1 0.00033 1185 ± 109 1714 ± 69 1572 ± 47 AF087431_g_at Gcs1 glucosidase 1 0.00060 2139 ± 112 2859 ± 152 2604 ± 53 rc_AI228247_at Gnai3 Guanine nucleotide binding, protein, alpha inhibiting polypeptide 3 0.01269 3499 ± 86 4248 ± 193 4496 ± 279 U03390_at Gnb2l1 guanine nucleotide binding protein, beta polypeptide 2-like 1 0.00065 9898 ± 620 12818 ± 198 11968 ± 401 M22400_at Gpc3 Glypican 3 0.00015 232 ± 30 427 ± 35 433 ± 26 rc_AA946251_at Gprk5 G protein-coupled receptor kinase 5 0.02059 138 ± 14 206 ± 17 222 ± 24 U29873_at Grin3a glutamate receptor, ionotropic, N-methyl-D-aspartate 3A 0.00483 250 ± 25 341 ± 17 354 ± 20 U73174_at Gsr glutathione reductase 0.00277 458 ± 30 542 ± 35 598 ± 10 X65948_at Gtf2b general transcription factor IIB 0.02847 1225 ± 78 1552 ± 41 1561 ± 114 L01267_at Gtf2f2 general transcription factor IIF, polypeptide 2 (30kD subunit) 0.00277 542 ± 34 722 ± 63 783 ± 34 rc_AA800912_g_at Gtf2ird1 general transcription factor II I repeat domain-containing 1 0.00001 1172 ± 55 1939 ± 49 1902 ± 114 rc_AI232374_at H1f0 Histone H1-0 0.00003 2087 ± 150 4076 ± 183 3447 ± 280 rc_AI232374_g_at H1f0 Histone H1-0 0.00022 1451 ± 142 3066 ± 227 2612 ± 247 rc_AA874802_s_at H1f0 Histone H1-0 0.00009 1525 ± 89 2930 ± 342 2791 ± 70 D16479_at Hadhb TP-beta 0.00010 2649 ± 161 3414 ± 120 3641 ± 119 U18650_at Hdh Huntington disease gene homolog 0.00000 350 ± 22 495 ± 10 524 ± 14 rc_AI007857_at Hgs HGF-regulated tyrosine kinase substrate 0.00226 3536 ± 152 4481 ± 147 4261 ± 177 M13170_at Hist1h1t histone 1, H1t 0.01488 85 ± 11 119 ± 9 122 ± 7 M27433_at Hist4 germinal histone H4 gene 0.00000 280 ± 16 689 ± 44 829 ± 50 rc_AA799893_g_at Hnrpa1 heterogeneous nuclear ribonucleoprotein A1 0.00000 1658 ± 117 2931 ± 79 2974 ± 122 rc_AI104524_s_at Hnrpab heterogeneous nuclear ribonucleoprotein A/B 0.00004 6878 ± 174 9540 ± 333 8546 ± 341 X16933cds_at Hnrpd RNA binding protein p45AUF1 0.00300 1704 ± 69 2220 ± 91 2115 ± 105 AB003726_at Homer1 homer, neuronal immediate early gene, 1 0.00023 1054 ± 50 1295 ± 40 1339 ± 37 AB007690_s_at Homer2 homer, neuronal immediate early gene, 2 0.02231 495 ± 43 667 ± 60 687 ± 42 L16764_s_at Hspa1a heat shock 70kD protein 1A 0.00000 2350 ± 94 3488 ± 108 3743 ± 162 Z27118cds_s_at Hspa1a heat shock 70kD protein 1A 0.00004 504 ± 50 887 ± 39 865 ± 54 Page 2 Supplementary Table 2: Infection-Sensitive Genes Probe Set Symbol Title ANOVA Uninfected Ad-LacZ Ad-aCaN rc_AA800738_at Htatip HIV-1 Tat interactive protein, 60 kD 0.00098 1298 ± 46 1591 ± 91 1670 ± 44 M21410_s_at Htr2c 5-hydroxytryptamine (serotonin) receptor 2C 0.02960 291 ± 17 350 ± 16 355 ± 17 D49395_s_at Htr3a 5-hydroxytryptamine (serotonin) receptor 3a 0.00029 262 ± 28 459 ± 31 400 ± 24 L22558_at Htr7 5-hydroxytryptamine (serotonin) receptor 7 0.00030 385 ± 36 634 ± 49 660 ± 40 rc_AA801286_at Impa1 Inositol (myo)-1(or 4)-monophosphatase 1 0.00001 4756 ± 102 5835 ± 131 5537 ± 112 U20181_at Ireb2 iron-regulatory protein 2 0.00001 1758 ± 64 2430 ± 110 2365 ± 59 rc_AA799537_at Itpr3 inositol 1, 4, 5-triphosphate receptor 3 0.02405 1403 ± 87 1693 ± 93 1713 ± 65 M59980_s_at Kcnd2 potassium voltage gated channel, Shal-related family, member 2 0.00003 528 ± 26 916 ± 65 781 ± 37 AJ003065_at Kcnj14 potassium inwardly-rectifying channel J14 0.00238 209 ± 18 344 ± 25 311 ± 25 L21711_s_at Lgals5 Lectin, galactose binding, soluble 5 (Galectin-5) 0.00005 228 ± 19 529 ± 60 541 ± 38 U72741_g_at Lgals9 Lectin, galactose binding, soluble 9 (Galectin-9) 0.00005 218 ± 36 670 ± 76 665 ± 62 U72353_at Lmnb1 lamin B1 0.00310 94 ± 6 170 ± 17 180 ± 20 rc_AA955808_at LOC171121 protein phosphatase V 0.00852 1928 ± 106 2743 ± 170 2548 ± 187 U49058_at LOC245924 CTD-binding SR-like protein rA4 0.03506 859 ± 40 1027 ± 62 1030 ± 42 U25746_at LOC245957 RNA helicase 0.00001 878 ± 39 1208 ± 64 1254 ± 30 U78090_s_at LOC245960 potassium channel regulator 1 0.00013 1162 ± 64 1870 ± 71 1657 ± 112 rc_H31907_at LOC246185 embryo-related protein 0.00011 742 ± 39 1371 ± 77 1136 ± 94 AF068268_at LOC246268 2'5' oligoadenylate synthetase-2 0.00003 5 ± 1 81 ± 13 96 ± 13 rc_H31287_g_at LOC246273 kinase 0.00000 112 ± 15 498 ± 49 536 ± 35 AB000280_at LOC246280 peptide/histidine transporter 0.01432 799 ± 31 968 ± 52 959 ± 36 AF036335_at LOC252855 NonO/p54nrb homolog 0.00259 1825 ± 130 2532 ± 150 2426 ± 112 rc_AA859305_s_at LOC286890 tropomyosin
Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
  • The Global Architecture Shaping the Heterogeneity and Tissue-Dependency of the MHC Class I Immunopeptidome Is Evolutionarily Conserved

    The Global Architecture Shaping the Heterogeneity and Tissue-Dependency of the MHC Class I Immunopeptidome Is Evolutionarily Conserved

    bioRxiv preprint doi: https://doi.org/10.1101/2020.09.28.317750; this version posted September 29, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The Global Architecture Shaping the Heterogeneity and Tissue-Dependency of the MHC Class I Immunopeptidome is Evolutionarily Conserved Authors Peter Kubiniok†1, Ana Marcu†2,3, Leon Bichmann†2,4, Leon Kuchenbecker4, Heiko Schuster1,5, David Hamelin1, Jérome Despault1, Kevin Kovalchik1, Laura Wessling1, Oliver Kohlbacher4,7,8,9,10 Stefan Stevanovic2,3,6, Hans-Georg Rammensee2,3,6, Marian C. Neidert11, Isabelle Sirois1, Etienne Caron1,12* Affiliations *Corresponding and Leading author: Etienne Caron ([email protected]) †Equal contribution to this work 1CHU Sainte-Justine Research Center, Montreal, QC H3T 1C5, Canada 2Department of Immunology, Interfaculty Institute for Cell Biology, University of Tübingen, Tübingen, Baden-Württemberg, 72076, Germany. 3Cluster of Excellence iFIT (EXC 2180) "Image-Guided and Functionally Instructed Tumor Therapies", University of Tübingen, Tübingen, Baden-Württemberg, 72076, Germany. 4Applied Bioinformatics, Dept. of Computer Science, University of Tübingen, Tübingen, Baden- Württemberg, 72074, Germany. 5Immatics Biotechnologies GmbH, Tübingen, 72076, Baden-Württemberg, Germany. 6DKFZ Partner Site Tübingen, German Cancer Consortium (DKTK), Tübingen, Baden- Württemberg, 72076, Germany. 7Institute for Bioinformatics and Medical Informatics,
  • From Inverse Agonism to 'Paradoxical Pharmacology' Richard A

    From Inverse Agonism to 'Paradoxical Pharmacology' Richard A

    International Congress Series 1249 (2003) 27-37 From inverse agonism to 'Paradoxical Pharmacology' Richard A. Bond*, Kenda L.J. Evans, Zsirzsanna Callaerts-Vegh Department of Pharmacological and Pharmaceutical Sciences, University of Houston, 521 Science and Research Bldg 2, 4800 Caltioun, Houston, TX 77204-5037, USA Received 16 April 2003; accepted 16 April 2003 Abstract The constitutive or spontaneous activity of G protein-coupled receptors (GPCRs) and compounds acting as inverse agonists is a recent but well-established phenomenon. Dozens of receptor subtypes for numerous neurotransmitters and hormones have been shown to posses this property. However, do to the apparently low percentage of receptors in the spontaneously active state, the physiologic relevance of these findings remains questionable. The possibility that the reciprocal nature of the effects of agonists and inverse agonists may extend to cellular signaling is discussed, and that this may account for the beneficial effects of certain p-adrenoceptor inverse agonists in the treatment of heart failure. © 2003 Elsevier Science B.V. All rights reserved. Keywords. Inverse agonism; GPCR; Paradoxical pharmacology 1. Brief history of inverse agonism at G protein-coupled receptors For approximately three-quarters of a century, ligands that interacted with G protein- coupled receptors (GPCRs) were classified either as agonists or antagonists. Receptors were thought to exist in a single quiescent state that could only induce cellular signaling upon agonist binding to the receptor to produce an activated state of the receptor. In this model, antagonists had no cellular signaling ability on their own, but did bind to the receptor and prevented agonists from being able to bind and activate the receptor.
  • Supplemental Table 1 Enriched Genes in Cortical Astrocytes from Aged

    Supplemental Table 1 Enriched Genes in Cortical Astrocytes from Aged

    Supplemental Table 1 Enriched genes in cortical astrocytes from aged and young-adult mice * Genes were present in the astrocyte module from the WGCNA analysis, and contains astrocyte enriched genes compared to microglia and oligodendrocytes # = Fold change of aged astrocyte expression over the average expression of all analyzed samples (microglia, astrocytes: young, old, with and without myelin contamination) $ ; aged = genes only present in the aged astrocyte top 1000 list (used to compare with lists from Cahoy, Lovatt, Doyle; see Fig. 4B), all = genes present in all astrocyte top 1000 lists Gene Symbol* Aged astr. (log2) Young astr.(log2) FC (aged/ aver.)# Location Ptprz1 15.37 15.02 18.76 Plasma Membrane Slc7a10 14.49 14.44 18.28 Plasma Membrane Gjb6 15.13 14.42 18.18 Plasma Membrane Dclk1 14.63 14.28 17.18 unknown Hes5 15.69 15.55 16.94 Nucleus Fgfr3 15.27 14.46 16.54 Plasma Membrane Entpd2 13.85 13.56 15.92 Cytoplasm Grin2c 14.93 14.87 15.75 Plasma Membrane Slc1a2 15.51 15.39 15.58 Plasma Membrane Fjx1 14.36 13.98 14.52 Extracellular Space Slc6a1 14.20 14.16 14.47 Plasma Membrane Kcnk1 12.93 13.49 14.43 Plasma Membrane Ppap2b 16.16 16.10 14.37 Plasma Membrane Fam20a 14.48 14.72 14.00 Extracellular Space Dbx2 13.68 13.32 13.99 Nucleus Itih3 13.93 13.93 13.94 Extracellular Space Htra1 17.12 16.91 13.92 Extracellular Space Atp1a2 14.59 14.48 13.73 Plasma Membrane Scg3 15.71 15.72 13.68 Extracellular Space F3 15.59 15.08 13.51 Plasma Membrane Mmd2 14.22 14.60 13.50 unknown Nrcam 13.73 13.88 13.47 Plasma Membrane Cldn10a 13.37 13.57 13.46
  • Silencing of Phosphoinositide-Specific

    Silencing of Phosphoinositide-Specific

    ANTICANCER RESEARCH 34: 4069-4076 (2014) Silencing of Phosphoinositide-specific Phospholipase C ε Remodulates the Expression of the Phosphoinositide Signal Transduction Pathway in Human Osteosarcoma Cell Lines VINCENZA RITA LO VASCO1, MARTINA LEOPIZZI2, DANIELA STOPPOLONI3 and CARLO DELLA ROCCA2 Departments of 1Sense Organs , 2Medicine and Surgery Sciences and Biotechnologies and 3Biochemistry Sciences “A. Rossi Fanelli”, Sapienza University, Rome, Italy Abstract. Background: Ezrin, a member of the signal transduction pathway (5). The reduction of PIP2 ezrin–radixin–moesin family, is involved in the metastatic induces ezrin dissociation from the plasma membrane (6). spread of osteosarcoma. Ezrin binds phosphatydil inositol-4,5- The levels of PIP2 are regulated by the PI-specific bisphosphate (PIP2), a crucial molecule of the phospholipase C (PI-PLC) family (7), constituting thirteen phosphoinositide signal transduction pathway. PIP2 levels are enzymes divided into six sub-families on the basis of amino regulated by phosphoinositide-specific phospholipase C (PI- acid sequence, domain structure, mechanism of recruitment PLC) enzymes. PI-PLCε isoform, a well-characterized direct and tissue distribution (7-15). PI-PLCε, a direct effector of effector of rat sarcoma (RAS), is at a unique convergence RAS (14-15), might be the point of convergence for the point for the broad range of signaling pathways that promote broad range of signalling pathways that promote the RAS GTPase-mediated signalling. Materials and Methods. By RASGTPase-mediated signalling (16). using molecular biology methods and microscopic analyses, In previous studies, we suggested a relationship between we analyzed the expression of ezrin and PLC genes after PI-PLC expression and ezrin (17-18).
  • Enzymatic Encoding Methods for Efficient Synthesis Of

    Enzymatic Encoding Methods for Efficient Synthesis Of

    (19) TZZ__T (11) EP 1 957 644 B1 (12) EUROPEAN PATENT SPECIFICATION (45) Date of publication and mention (51) Int Cl.: of the grant of the patent: C12N 15/10 (2006.01) C12Q 1/68 (2006.01) 01.12.2010 Bulletin 2010/48 C40B 40/06 (2006.01) C40B 50/06 (2006.01) (21) Application number: 06818144.5 (86) International application number: PCT/DK2006/000685 (22) Date of filing: 01.12.2006 (87) International publication number: WO 2007/062664 (07.06.2007 Gazette 2007/23) (54) ENZYMATIC ENCODING METHODS FOR EFFICIENT SYNTHESIS OF LARGE LIBRARIES ENZYMVERMITTELNDE KODIERUNGSMETHODEN FÜR EINE EFFIZIENTE SYNTHESE VON GROSSEN BIBLIOTHEKEN PROCEDES DE CODAGE ENZYMATIQUE DESTINES A LA SYNTHESE EFFICACE DE BIBLIOTHEQUES IMPORTANTES (84) Designated Contracting States: • GOLDBECH, Anne AT BE BG CH CY CZ DE DK EE ES FI FR GB GR DK-2200 Copenhagen N (DK) HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI • DE LEON, Daen SK TR DK-2300 Copenhagen S (DK) Designated Extension States: • KALDOR, Ditte Kievsmose AL BA HR MK RS DK-2880 Bagsvaerd (DK) • SLØK, Frank Abilgaard (30) Priority: 01.12.2005 DK 200501704 DK-3450 Allerød (DK) 02.12.2005 US 741490 P • HUSEMOEN, Birgitte Nystrup DK-2500 Valby (DK) (43) Date of publication of application: • DOLBERG, Johannes 20.08.2008 Bulletin 2008/34 DK-1674 Copenhagen V (DK) • JENSEN, Kim Birkebæk (73) Proprietor: Nuevolution A/S DK-2610 Rødovre (DK) 2100 Copenhagen 0 (DK) • PETERSEN, Lene DK-2100 Copenhagen Ø (DK) (72) Inventors: • NØRREGAARD-MADSEN, Mads • FRANCH, Thomas DK-3460 Birkerød (DK) DK-3070 Snekkersten (DK) • GODSKESEN,
  • Protein Interaction Network of Alternatively Spliced Isoforms from Brain Links Genetic Risk Factors for Autism

    Protein Interaction Network of Alternatively Spliced Isoforms from Brain Links Genetic Risk Factors for Autism

    ARTICLE Received 24 Aug 2013 | Accepted 14 Mar 2014 | Published 11 Apr 2014 DOI: 10.1038/ncomms4650 OPEN Protein interaction network of alternatively spliced isoforms from brain links genetic risk factors for autism Roser Corominas1,*, Xinping Yang2,3,*, Guan Ning Lin1,*, Shuli Kang1,*, Yun Shen2,3, Lila Ghamsari2,3,w, Martin Broly2,3, Maria Rodriguez2,3, Stanley Tam2,3, Shelly A. Trigg2,3,w, Changyu Fan2,3, Song Yi2,3, Murat Tasan4, Irma Lemmens5, Xingyan Kuang6, Nan Zhao6, Dheeraj Malhotra7, Jacob J. Michaelson7,w, Vladimir Vacic8, Michael A. Calderwood2,3, Frederick P. Roth2,3,4, Jan Tavernier5, Steve Horvath9, Kourosh Salehi-Ashtiani2,3,w, Dmitry Korkin6, Jonathan Sebat7, David E. Hill2,3, Tong Hao2,3, Marc Vidal2,3 & Lilia M. Iakoucheva1 Increased risk for autism spectrum disorders (ASD) is attributed to hundreds of genetic loci. The convergence of ASD variants have been investigated using various approaches, including protein interactions extracted from the published literature. However, these datasets are frequently incomplete, carry biases and are limited to interactions of a single splicing isoform, which may not be expressed in the disease-relevant tissue. Here we introduce a new interactome mapping approach by experimentally identifying interactions between brain-expressed alternatively spliced variants of ASD risk factors. The Autism Spliceform Interaction Network reveals that almost half of the detected interactions and about 30% of the newly identified interacting partners represent contribution from splicing variants, emphasizing the importance of isoform networks. Isoform interactions greatly contribute to establishing direct physical connections between proteins from the de novo autism CNVs. Our findings demonstrate the critical role of spliceform networks for translating genetic knowledge into a better understanding of human diseases.
  • Supplemental Material

    Supplemental Material

    Supplemental Table B ARGs in alphabetical order Symbol Title 3 months 6 months 9 months 12 months 23 months ANOVA Direction Category 38597 septin 2 1557 ± 44 1555 ± 44 1579 ± 56 1655 ± 26 1691 ± 31 0.05219 up Intermediate 0610031j06rik kidney predominant protein NCU-G1 491 ± 6 504 ± 14 503 ± 11 527 ± 13 534 ± 12 0.04747 up Early Adult 1G5 vesicle-associated calmodulin-binding protein 662 ± 23 675 ± 17 629 ± 16 617 ± 20 583 ± 26 0.03129 down Intermediate A2m alpha-2-macroglobulin 262 ± 7 272 ± 8 244 ± 6 290 ± 7 353 ± 16 0.00000 up Midlife Aadat aminoadipate aminotransferase (synonym Kat2) 180 ± 5 201 ± 12 223 ± 7 244 ± 14 275 ± 7 0.00000 up Early Adult Abca2 ATP-binding cassette, sub-family A (ABC1), member 2 958 ± 28 1052 ± 58 1086 ± 36 1071 ± 44 1141 ± 41 0.05371 up Early Adult Abcb1a ATP-binding cassette, sub-family B (MDR/TAP), member 1A 136 ± 8 147 ± 6 147 ± 13 155 ± 9 185 ± 13 0.01272 up Midlife Acadl acetyl-Coenzyme A dehydrogenase, long-chain 423 ± 7 456 ± 11 478 ± 14 486 ± 13 512 ± 11 0.00003 up Early Adult Acadvl acyl-Coenzyme A dehydrogenase, very long chain 426 ± 14 414 ± 10 404 ± 13 411 ± 15 461 ± 10 0.01017 up Late Accn1 amiloride-sensitive cation channel 1, neuronal (degenerin) 242 ± 10 250 ± 9 237 ± 11 247 ± 14 212 ± 8 0.04972 down Late Actb actin, beta 12965 ± 310 13382 ± 170 13145 ± 273 13739 ± 303 14187 ± 269 0.01195 up Midlife Acvrinp1 activin receptor interacting protein 1 304 ± 18 285 ± 21 274 ± 13 297 ± 21 341 ± 14 0.03610 up Late Adk adenosine kinase 1828 ± 43 1920 ± 38 1922 ± 22 2048 ± 30 1949 ± 44 0.00797 up Early
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • 1 Metabolic Dysfunction Is Restricted to the Sciatic Nerve in Experimental

    1 Metabolic Dysfunction Is Restricted to the Sciatic Nerve in Experimental

    Page 1 of 255 Diabetes Metabolic dysfunction is restricted to the sciatic nerve in experimental diabetic neuropathy Oliver J. Freeman1,2, Richard D. Unwin2,3, Andrew W. Dowsey2,3, Paul Begley2,3, Sumia Ali1, Katherine A. Hollywood2,3, Nitin Rustogi2,3, Rasmus S. Petersen1, Warwick B. Dunn2,3†, Garth J.S. Cooper2,3,4,5* & Natalie J. Gardiner1* 1 Faculty of Life Sciences, University of Manchester, UK 2 Centre for Advanced Discovery and Experimental Therapeutics (CADET), Central Manchester University Hospitals NHS Foundation Trust, Manchester Academic Health Sciences Centre, Manchester, UK 3 Centre for Endocrinology and Diabetes, Institute of Human Development, Faculty of Medical and Human Sciences, University of Manchester, UK 4 School of Biological Sciences, University of Auckland, New Zealand 5 Department of Pharmacology, Medical Sciences Division, University of Oxford, UK † Present address: School of Biosciences, University of Birmingham, UK *Joint corresponding authors: Natalie J. Gardiner and Garth J.S. Cooper Email: [email protected]; [email protected] Address: University of Manchester, AV Hill Building, Oxford Road, Manchester, M13 9PT, United Kingdom Telephone: +44 161 275 5768; +44 161 701 0240 Word count: 4,490 Number of tables: 1, Number of figures: 6 Running title: Metabolic dysfunction in diabetic neuropathy 1 Diabetes Publish Ahead of Print, published online October 15, 2015 Diabetes Page 2 of 255 Abstract High glucose levels in the peripheral nervous system (PNS) have been implicated in the pathogenesis of diabetic neuropathy (DN). However our understanding of the molecular mechanisms which cause the marked distal pathology is incomplete. Here we performed a comprehensive, system-wide analysis of the PNS of a rodent model of DN.
  • Protein Identities in Evs Isolated from U87-MG GBM Cells As Determined by NG LC-MS/MS

    Protein Identities in Evs Isolated from U87-MG GBM Cells As Determined by NG LC-MS/MS

    Protein identities in EVs isolated from U87-MG GBM cells as determined by NG LC-MS/MS. No. Accession Description Σ Coverage Σ# Proteins Σ# Unique Peptides Σ# Peptides Σ# PSMs # AAs MW [kDa] calc. pI 1 A8MS94 Putative golgin subfamily A member 2-like protein 5 OS=Homo sapiens PE=5 SV=2 - [GG2L5_HUMAN] 100 1 1 7 88 110 12,03704523 5,681152344 2 P60660 Myosin light polypeptide 6 OS=Homo sapiens GN=MYL6 PE=1 SV=2 - [MYL6_HUMAN] 100 3 5 17 173 151 16,91913397 4,652832031 3 Q6ZYL4 General transcription factor IIH subunit 5 OS=Homo sapiens GN=GTF2H5 PE=1 SV=1 - [TF2H5_HUMAN] 98,59 1 1 4 13 71 8,048185945 4,652832031 4 P60709 Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 - [ACTB_HUMAN] 97,6 5 5 35 917 375 41,70973209 5,478027344 5 P13489 Ribonuclease inhibitor OS=Homo sapiens GN=RNH1 PE=1 SV=2 - [RINI_HUMAN] 96,75 1 12 37 173 461 49,94108966 4,817871094 6 P09382 Galectin-1 OS=Homo sapiens GN=LGALS1 PE=1 SV=2 - [LEG1_HUMAN] 96,3 1 7 14 283 135 14,70620005 5,503417969 7 P60174 Triosephosphate isomerase OS=Homo sapiens GN=TPI1 PE=1 SV=3 - [TPIS_HUMAN] 95,1 3 16 25 375 286 30,77169764 5,922363281 8 P04406 Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 - [G3P_HUMAN] 94,63 2 13 31 509 335 36,03039959 8,455566406 9 Q15185 Prostaglandin E synthase 3 OS=Homo sapiens GN=PTGES3 PE=1 SV=1 - [TEBP_HUMAN] 93,13 1 5 12 74 160 18,68541938 4,538574219 10 P09417 Dihydropteridine reductase OS=Homo sapiens GN=QDPR PE=1 SV=2 - [DHPR_HUMAN] 93,03 1 1 17 69 244 25,77302971 7,371582031 11 P01911 HLA class II histocompatibility antigen,
  • Gelişimsel Çocuk Nörolojisi 2017

    Gelişimsel Çocuk Nörolojisi 2017

    Baskı Mart, 2017 Bu yayının telif hakları Düzen Laboratuvarlar Grubu’na aittir. Bu yayının tümü ya da bir bölümü Düzen Laboratuvarlar Grubu’nun yazılı izni olmadan kopya edilemez. Bu yayın Düzen Laboratuvarlar Grubu tarafından tanıtım ve bilgilendirme amacıyla hazırlanmış olup hazırlanma ve basım esnasında metin ya da grafiklerde oluşabilecek her türlü hata ve eksikliklerden Düzen Laboratuvarlar Grubu sorumlu tutulamaz. Kaynak göstermek ve Düzen Laboratuvarlar Grubu’ndan yazılı izin almak suretiyle bu yayında alıntı yapılabilir. Düzen Laboratuvarlar Grubu Tunus Cad. No. 95 Kavaklıdere Çankaya 06680 Ankara www.duzen.com.tr VİZYONUMUZ Hasta haklarına saygılı, bilgilendirmeyi esas alan, testleri en doğru, izlenebilir ve tekrarlanabilir yöntemlerle çalışmak ve en az hatayı esas kabul edip, iç ve dış kalite kontrolleri ile bu kavramın gerçekleştiğini göstermektedir. MİSYONUMUZ Test sonuçları üzerinde laboratuvarmızın sorumluluğu, testin klinik laboratuvarcılık standartları ve iyi laboratuvar uygulamaları sınırları içinde, tüm kontoller yapılarak çalışılması ile sınırlıdır. Test sonuçları klinik bulgular ve diğer tüm yardımcı veriler dikkate alınarak değerlendirilmektedir. AKREDİTASYON Laboratuvarımız 2004 yılında Türk Akreditasyon Kurumu (TÜRKAK) tarafından TS EN IS IEC 17025 kapsamında akredite edilmiş, 2011 yılından itibaren ise ISO15189 kapsamında akreditasyona hak kazanmıştır. Hasta kayıt, numune alma, raporlama, kurumsal hizmetler ve tüm işletim sistemi akreditasyon kapsamındadır. GÜVENİRLİLİK Laboratuvarımız CLSI programlarına üyedir