The Mirna Revolution an Introduction to Mirna Slide Deck

Isolation Quantification Functional Studies

The miRNA Revolution

An introduction to miRNA biogenesis, function, and analysis

Subu Yerramilli, PhD Associate Director, R&D [email protected]

- 1 - Sample & Assay Technologies RNA Interference: A Natural Phenomenon Discovery Tool, Potential Therapeutic

- 2 - Sample & Assay Technologies miRNA Biogenesis Canonical Pathway

microRNA Gene DNA NUCLEUS POL II Transcribed by RNA Polymerase II as Pri-miRNA a long primary transcript (pri-miRNAs), which may contain more than one miRNA. Drosha-DGCR8 In the nucleus, Pri-miRNAs are processed Pre-miRNA CYTOPLASM to hairpin-like pre-miRNAs by RNAse III- Exportin like enzyme Drosha Exportin Pre-miRNAs are then exported to the Cytosol by Exportin 5 DICER-TRBP In the cytosol RNAse III-like Dicer, mature miRNA RISC Assembly processes these precursors to mature Ago miRNAs

RISC These miRNAs are incorporated in RISC High homology Partial homology miRNAs with imperfect base pairing to the target mRNA, lead to translational repression and/or mRNA degradation mRNA cleavage Translational Repression mRNA degradation

(1) Krol, J., et.al., (2010) Nature Rev Genetics, 11, 597; (2) Winter, J., et.al., (2009) Nature Cell Biology, 11, 228 (3) Borchert, G.M., et.al., (2006) C19MC miRNAs miR-515-1, miR- 517a, miR-517c and miR-519a-1 are expressed using Pol III

- 3 - Sample & Assay Technologies miRNAs Target Recognition

Stronger efficacy Target Site Target Weaker

. Target Prediction is based on: Seed region match Position in 3’ UTR Cross species conservation Central sequence homology Evidence from microarray data

(1) Guo, H., et.al., (2010) Nature. 466: 835-40 (2) Bartel D.P., (2009) Cell 136; 215, (3) Grimson A., et.al., (2007) Mol Cell.27: 91-105.

- 4 - Sample & Assay Technologies Mechanisms of Gene Silencing by miRNA

Ribosome drop-off Deadenylation and degradation miRNA sequestration

Translational Repression and/or P Body Sequestration Transcript Degradation

(1) Guo, H., et.al., (2010) Nature. 466: 835-40. (2) Bartel D.P., (2009) Cell 136; 215, (3) Grimson A., et.al., (2007) Mol Cell.27: 91-105.

- 5 - Sample & Assay Technologies Isolation Quantification Functional Studies

miRNA Genomics

- 6 - Sample & Assay Technologies Genomic Location of miRNAs

(a) Independent Promoter miR-1-1 miR-1-1 miR-133a-2 MyoD SRF miR-133a-2

(b) Intronic miR-208 miR-208 Exon-27 Exon-28

Exon-10 Exon-11

Intergenic miRNA genes : Intergenic Transcription Units (TU) either monocistronic with independent promoter or polycistronic with a common promoter Intronic miRNA genes : Present in the introns of protein coding or noncoding genes, can also be in clusters and transcribed by the host gene promoter.

Exonic miRNAs are far more rare and often overlap an exon and an intron of a noncoding gene Some miRNAs are transcribed from the plus strand, some from the negative strand Some are expressed in the same direction as neighboring protein-encoding genes, some are antisense to neighboring genes (1) Olena, AF., et.al., (2009) J Cell Physiol. 222: 540-45. (2) Kim, VN and Nam JW. (2006) Trends Genet. 22: 165-73.

- 7 - Sample & Assay Technologies Multiple Loci Can Generate the Same Mature miRNA But are under different regulatory control

Stem Loop CHR Overlapping transcripts CHR: Coordinates (GRCh37) 1302-1 12 intergenic 12: 113132839-113132981 [-] 1302-3 2 intergenic 2: 114340536-114340673 [-] 1302-7 8 intergenic 8: 142867603-142867674 [-] 1302-10 15 intergenic 15: 102500662-102500799 [-] 1302-11 19 intergenic 19: 71973-72110 [+] 1302-2 1 intronic Non protein coding 1: 30366-30503 [+] sense 1302-4 2 intronic Non protein coding 2: 208133999-208134148 [-] 1302-9 9 Non protein coding 9: 30144-30281 [+]; Sense 1302-5 20 intronic Protein coding/FAM65C; intron 4 20: 49231173-49231322 [-]; Sense 1302-6 7 intronic Protein coding/HDAC9; intron 1 7: 18166843-18166932 [-] ; Antisense 1302-8 9 intronic Protein coding/ch9orf174 9: 100125836-100125963 [-]; Antisense

Mature-miR-1302: UUGGGACAUACUUAUGCUAAA

www.mirbase.org

- 8 - Sample & Assay Technologies A SNP in a miRNA can Change Regulatory Repertoire A SNP in a Target 3’ UTR can Create or Destroy a Binding Site

(A) SNP in miRNA seed Ago2 Ago2 ORF III III III IIIIII AAA III III III IIIIII Different range of target genes Ago2 Ago2 ORF IIIIII III I I IIII III III III II IIII AAA

SNP

(B) SNP in mRNA regulatory region SNP ORF X AAA

miRNA target site created miRNA target site destroyed Decrease in mRNA translation Increase in mRNA translation Ago2 III III III IIIIII Ago2 ORF ORF III III III IIIIIIX AAA X AAA

(1) Ryan, BM., et.al., (2010) Nat Rev cancer, 10: 389-402 (2) Brest, P., et.al., (2011) Nat Genet. Jan 30.

- 9 - Sample & Assay Technologies Epigenetics and miRNA Generation of miRNA Diversity by Processing and Editing

...... UAGCUUAUCAGACUGAUGUUGAC...... 301661 ...... 301661 ...... UAGCUUAUCAGACUGAUGUUGA...... 184371 ...... 184371 ...... UAGCUUAUCAGACUGAUGUUG...... 19423 ...... 19423ADAR ...... UAGCUUAUCAGACUGAUGUUGACU...... 12168 ...... 12168 AI Pri-miRNA ...... UAGCUUAUCAGACUGAUGUU...... 3204 ...... 3204 ...... AGCUUAUCAGACUGAUGUUGAC...... 1230 ...... 1230 AAAA ...... GUAGCUUAUCAGACUGAUGUUGA...... 884 ...... 884 ...... UAGCUUAUCAGACUGAUGU...... 818 ...... 818 ...... AGCUUAUCAGACUGAUGUUGACU...... 682 ...... A 682I DROSHA Processing ...... UAGCUUAUCAGACUGAUG...... 679 ...... 679 Block ...... AGCUUAUCAGACUGAUGUUGA...... 353 ...... 353 ...... GUAGCUUAUCAGACUGAUGUUGAC...... 310 ...... 310 ...... GUAGCUUAUCAGACUGAUGUUG...... 123 ...... 123 Pre-miRNA ...... UAGCUUAUCAGACUGAU...... 120 ...... 120 ...... UAGCUUAUCAGACUG...... 115 ...... 115 ...... UAGCUUAUCAGACUGA...... 94 ...... 94 ...... UAGCUUAUCAGACUGAUGUUGACUGU...... 81 ...... 81 Exportin ...... UUAUCAGACUGAUGUUGAC...... 69 ...... ADAR 69 ...... GCUUAUCAGACUGAUGUUGAC...... 68 ...... 68 ...... GCUUAUCAGACUGAUGUUGA...... 66 ...... 66 ...... GUAGCUUAUCAGACUGAUGUUGACU...... 53 ...... 53 ...... AGCUUAUCAGACUGAUGUUG...... 52 ...... 52 ...... UAUCAGACUGAUGUUGAC...... 45 ...... 45 ...... UAGCUUAUCAGACUGAUGUUGACUG...... 38 ...... 38 DICER ...... UUAUCAGACUGAUGUUGA...... 24 ...... 24 ...... UAUCAGACUGAUGUUGA...... 15 ...... A 15 I Processing ...... CAGACUGAUGUUGAC...... 13 ...... 13 ...... GUAGCUUAUCAGACUGAUGUU...... 11 ...... 11 Block ...... AUCAGACUGAUGUUGAC...... 8 ...... 8 ...... UAGCUUAUCAGACUGAUGUUGACUGUU...... 5 ...... A 5 I ...... GCUUAUCAGACUGAUGUUG...... 5 ...... 5 ...... AUCAGACUGAUGUUGA...... 5 ...... 5 Change in Deep sequencing reads reads ofsequencing hsa-miR-21 Deep ...... UCAGACUGAUGUUGAC...... 4 ...... 4 miRNA seed ...... AGCUUAUCAGACUGAUGUU...... 3 ...... 3 ...... CUUAUCAGACUGAUGUUGAC...... 3 ...... 3 ...... AGCUUAUCAGACUGAUG...... 2 ...... 2 ...... GCUUAUCAGACUGAUGUUGACU...... 2 ...... 2 ...... UUAUCAGACUGAUGUUG...... 2 ...... 2 ...... UUAUCAGACUGAUGUUGACU...... 2 ...... 2 ....GGGUAGCUUAUCAGACUGAUGUU...... 1 ...... 1 Slezak-Prochazka, I., et.al., (2010) RNA.. 16:1087-95 Kawahara, et. al (2007) Science. 315 (5815 ): 1137-40 www.mirbase.org - 10 - Sample & Assay Technologies Isolation Quantification Functional Studies

miRNA in Disease

- 11 - Sample & Assay Technologies Potential for Disruption of miRNA in Disease

microRNA Gene Genomic Instability Altered Transcription Pri-miRNA AAAA Gene Amplification Methylation Translocation Histone Modification Drosha-DGCR8 Deletion Transcription Factor Pre-miRNA DROSHA Insertional Mutagenesis Processing Exportin miRNA Biogenesis Loss of Dicer miRNA Binding Site in target Processing DICER-TRBP SNP or Mutation mature miRNA Ago Alternative Splicing Separation of 3’-UTR by miRNP Chromosomal Translocation

Target Transcript Croce CM., (2009) Nat Rev Genet. 10: 704-714.

- 12 - Sample & Assay Technologies Unique miRNA Signatures are found in Human Cancer

miRNAs located in genomic regions amplified in cancers (e.g. miR-12-92 cluster) can function as oncogenes, whereas miRNAs located in portions of chromosomes deleted in cancers (e.g. miR-15a-miR-16-1 cluster) can function as tumor suppressors.

Abnormal expression of miRNAs has been found in both solid and hematopoietic tumors.

miRNA expression fingerprints correlate with clinical and biological characteristics of tumors , including tissue type, differentiation, aggression and response to therapy.

The race is on to find good miRNA markers and therapeutics!

- 13 - Sample & Assay Technologies miRNAs Might be Ideal Biomarkers for Disease

Small and stable

Limited number (~ 1048 human miRNA in miRBase 16.0)

Tissue & disease-specific expression

Tissues constantly release miRNAs into circulation (necrotic/apoptotic cells, exosomes)

Detectable in tissue, blood (plasma/serum), oral mucosa, salvia, urine

Sensitive and easy detection by qRT-PCR

www.mir2disease.org - 14 - Sample & Assay Technologies Isolation Quantification Functional Studies

miRNA Isolation Technologies

- 15 - Sample & Assay Technologies miRNeasy kit: Cells and Tissues Flexible Protocol for Co-purification or Enrichment of miRNA

Options: Copurification of miRNA & total RNA - or - miRNA enriched fraction and total RNA > 200 nt

Formats: Single Spin 96 - well Plate Manual Automated on QIAcube

- 16 - Sample & Assay Technologies miRNeasy FFPE kit Isolation from Archival Samples

FFPE Sample Characteristics

. Over 500 Million FFPE Tissues Archived! Tissue banks Pathology labs Biomedical research labs

. RNA quality is Heavily fragmented Variable cross-linking by formaldehyde cross-linking interferes with RT

. Low RNA yields Current procedures may not purify all usable RNA, may increases fragmentation, and are often ineffective in breaking up cross-links

- 17 - Sample & Assay Technologies miRNeasy FFPE Kit

Remove paraffin Novel method prevents cross-linked RNA and dry blocking downstream applications

Optimized lysis buffer with Prot. K

Prot. K Unique gDNA Eliminator columns Heat Treatment

RNeasy MinElute for small elution volume

Remove gDNA With gDNA Eliminator column

Bind RNA to RNeasy MinElute column

. Recovery of miRNA equal or better than TrizolQIAzol

- 18 - Sample & Assay Technologies Detection of Circulating miRNA

Blood collection & plasma/serum isolation

miRNeasy RNA Prep Serum & Plasma Protocol + Cel-miRNAs QIAzol Bind Wash Elute

miScript RT AAAAAAA AAAAAAA RT 2-miRNA RT TTT cDNA synthesis TTT

miScript (single miRNA Assays) RT 2 miRNA PCR Arrays Real-time PCR

Data analysis & Data analysis tools – FREE! normalization

- 19 - Sample & Assay Technologies miRNeasy Purification of Circulating miRNA from Plasma or Serum

~ 0.5 µl serum per assay Spike in normalizer

30 RT 2 Circulating miRNA in Disease Array

0 a b 1 a g a 2 a a 2 a a 2 3 2 -16 -21 -93 6 6 R -92 -19 R R -19 -27 t-7 t-7 ir-24 14 -15 -18 -29 -22 -14 -145 U i iR iR ir-223 i let-7b i iR iR le le m iR let-7d R iR iR -193a iR iR m m m m miR-126 m miR-15b m m m miR-26b miR-425 miR-19 iR-148a iR-125b iR- m miR-29c miR-30e mir-30a miR-197 mi m iR-125 m miR-99a miR-152 R miR-10b iR-196a miR-18 iR-17-3p m m RNU1A m m m m mi m m

- 20 - Sample & Assay Technologies Isolation Quantification Functional Studies

Quantification and Profiling

- 21 - Sample & Assay Technologies miScript PCR System Universal Detection

ncRNA Assays

Other small RNAs

miScript mRNAs PCR miRNAs System Quantitect assays miScript Assays

Pre-miRNAs

Pre-miRNA Assays

- 22 - Sample & Assay Technologies miScript PCR System Reverse Transcription - Principle

- 23 - Sample & Assay Technologies miScript PCR System Real-Time PCR Detection

mRNA miRNA, other small RNAs

- 24 - Sample & Assay Technologies miScript PCR System Linear cDNA synthesis from 10 pg – 1µg RNA, Detection to <20 copies

2x10 5 cells

2 cells

10 pg to 1 ug of input miRNeasy RNA from HeLa S3 cells in miScript RT reaction

- 25 - Sample & Assay Technologies miScript PCR System Pre-miRNA Detection

ncRNA Assays Other small RNAs

miScript mRNAs PCR miRNAs Quantitect assays System miScript Assays

Pre-miRNAs

Pre-miRNA Assays

- 26 - Sample & Assay Technologies Why Quantify Pre-miRNA Stem Loops?

Study transcriptional and/or post-transcriptional regulation in miRNA biogenesis, and downstream implications

Definitively identify which closely related genomic loci are expressed.

miScript miRNA assays detect mature miRNAs only Mature specific Fwd & Universal Rev primer Should not co-amplify Pre-miRNA

miScript Pre-miRNA assays amplify precursors only pre-miR specific Fwd & Rev Primers Should not co-amplify mature miRNA

.Pre-miRNA assays amplify all RNA species that conta in the stem loop

Pre-miRNAs Pri-miRNAs

- 27 - Sample & Assay Technologies miScript miRNA and pre-miRNA Assays Loci-Specific Expression Analysis

40 HeLa S3 NIH3T3 L1

25 Ct value Ct

xxx xxx xxx 15

1 2 3 1 2 3 1 -2 1 -2 3 ature ature 19b let-7a-let-7a-let-7a- m m - 7 mature 7 mature 7a mature miR-19b-miR 92a pre-miR-7-pre-miR-7pre-miR-7- let- miR- pre_miR-7-pre_miR-7-pre_miR-7- miR- miR- pre_miR-92a-1pre_miR-92a-2miR-19b

- 28 - Sample & Assay Technologies RT 2miRNA PCR Arrays Genome-Wide, Disease, & Pathway-Focused Analysis

miRNA-Ome Arrays (Human, Mouse & Rat) miFinder Arrays (Human & Mouse) 88 abundantly expressed & well-characterized miRNAs

.Cancer associate miRNA panel (Human, Mouse & Rat) 88 Cancer-associated miRNAs

.Cell Development & Differentiation (Human, Mouse & Rat) 88 Development-associated miRNA

Human Disease Circulating in Serum miRNA Array miRNAs at elevated levels in serum in human disease

Human, Mouse & Rat -Immunopathology -Inflammation -Custom miRNA Arrays available

Sample & Assay Technologies Isolation Quantification Functional Studies

miRNA Functional Studies

- 30 - Sample & Assay Technologies Manipulating miRNA Function In Vivo

- 31 - Sample & Assay Technologies Effects of miScript miRNA Mimic on Endogenous Target Inhibition of HDAC4 with miR-1 Mimic

. Features of miScript miRNA mimics: DS RNA oligonucleotide Functional sequence is the same as the natural mature miRNA Transfection results in inhibition comparable to the endogenous miRNA Stable in culture for up to 72 hours

24h 48h 72h 96h Mock Pos Neg Pos Neg Pos Neg Pos Neg

250 HDAC 4

130

Tubulin

PDCD 4 55

Tubulin 55

- 32 - Sample & Assay Technologies miScript miRNA Inhibitors Effective After 96 Hours

. HeLa S3 cells transfected with miScript miRNA inhibitors or a negative control inhibitor

. After the time points indicated, appropriate Luciferase reporters were transfected

. Twenty-four hours later, Luciferase activity was measured.

- 33 - Sample & Assay Technologies miScript miRNA Mimic & Inhibitor Controls

Mimic AllStars Negative Control siRNA negative control No homology to any mammalian gene. Verified for non-effects in microarray and phenotype assays. Verified for RISC entry

Mimic Syn-hsa-miR-1 mimic positive control Not expressed under most cell culture conditions, only expressed in muscle cells To check for optimal conditions by using miScript PCR miR-1

Inhibitor miScript Inhibitor Negative Control negative control Target the sequence of miScript mimic negative control Inhibitor Anti-hsa-miR-1 inhibitor positive control To check for optimal conditions in combination with Syn-hsa-miR-1 mimic Transfection AllStars Hs Cell Death Control siRNA control Cell death = successful transfection To run in every experiment

- 34 - Sample & Assay Technologies www.qiagen.com/GeneGlobe

- 35 - Sample & Assay Technologies A Complete Solution for miRNA Research

miRNeasy Protect Animal Blood Kit PAXgene Tissue miRNA Kit miScript PCR Controls PAXgene Blood miRNA Kit miScript Pre-miRNA Assays

QIAamp Circulating Nucleic Acid Kit miScript Target Protectors

RT 2 miRNA PCR Arrays QIAcube RT 2 SYBR Green Mastermixes

Rotor-Gene Q QIAgility

AA completecomplete offeringoffering forfor miRNAmiRNA research!research!

- 36 - Sample & Assay Technologies Thank you!

- 37 - Sample & Assay Technologies