Isolation Quantification Functional Studies The miRNA Revolution An introduction to miRNA biogenesis, function, and analysis Subu Yerramilli, PhD Associate Director, R&D [email protected] - 1 - Sample & Assay Technologies RNA Interference: A Natural Phenomenon Discovery Tool, Potential Therapeutic - 2 - Sample & Assay Technologies miRNA Biogenesis Canonical Pathway microRNA Gene DNA NUCLEUS POL II Transcribed by RNA Polymerase II as Pri-miRNA a long primary transcript (pri-miRNAs), which may contain more than one miRNA. Drosha-DGCR8 In the nucleus, Pri-miRNAs are processed Pre-miRNA CYTOPLASM to hairpin-like pre-miRNAs by RNAse III- Exportin like enzyme Drosha Exportin Pre-miRNAs are then exported to the Cytosol by Exportin 5 DICER-TRBP In the cytosol RNAse III-like Dicer, mature miRNA processes these precursors to mature Ago RISC Assembly miRNAs RISC These miRNAs are incorporated in RISC High homology Partial homology miRNAs with imperfect base pairing to the target mRNA, lead to translational repression and/or mRNA degradation mRNA cleavage Translational Repression mRNA degradation (1) Krol, J., et.al., (2010) Nature Rev Genetics, 11, 597; (2) Winter, J., et.al., (2009) Nature Cell Biology, 11, 228 (3) Borchert, G.M., et.al., (2006) C19MC miRNAs miR-515-1, miR- 517a, miR-517c and miR-519a-1 are expressed using Pol III - 3 - Sample & Assay Technologies miRNAs Target Recognition Stronger efficacy Target Site Target Weaker . Target Prediction is based on: Seed region match Position in 3’ UTR Cross species conservation Central sequence homology Evidence from microarray data (1) Guo, H., et.al., (2010) Nature. 466: 835-40 (2) Bartel D.P., (2009) Cell 136; 215, (3) Grimson A., et.al., (2007) Mol Cell.27: 91-105. - 4 - Sample & Assay Technologies Mechanisms of Gene Silencing by miRNA Ribosome drop-off Deadenylation and degradation miRNA sequestration Translational Repression and/or P Body Sequestration Transcript Degradation (1) Guo, H., et.al., (2010) Nature. 466: 835-40. (2) Bartel D.P., (2009) Cell 136; 215, (3) Grimson A., et.al., (2007) Mol Cell.27: 91-105. - 5 - Sample & Assay Technologies Isolation Quantification Functional Studies miRNA Genomics - 6 - Sample & Assay Technologies Genomic Location of miRNAs (a) Independent Promoter miR-1-1 miR-1-1 miR-133a-2 MyoD SRF miR-133a-2 (b) Intronic miR-208 miR-208 Exon-27 Exon-28 (c) Exonic miR-198 miR-198 Exon-10 Exon-11 Intergenic miRNA genes : Intergenic Transcription Units (TU) either monocistronic with independent promoter or polycistronic with a common promoter Intronic miRNA genes : Present in the introns of protein coding or noncoding genes, can also be in clusters and transcribed by the host gene promoter. Exonic miRNAs are far more rare and often overlap an exon and an intron of a noncoding gene Some miRNAs are transcribed from the plus strand, some from the negative strand Some are expressed in the same direction as neighboring protein-encoding genes, some are antisense to neighboring genes (1) Olena, AF., et.al., (2009) J Cell Physiol. 222: 540-45. (2) Kim, VN and Nam JW. (2006) Trends Genet. 22: 165-73. - 7 - Sample & Assay Technologies Multiple Loci Can Generate the Same Mature miRNA But are under different regulatory control Stem Loop CHR Overlapping transcripts CHR: Coordinates (GRCh37) 1302-1 12 intergenic 12: 113132839-113132981 [-] 1302-3 2 intergenic 2: 114340536-114340673 [-] 1302-7 8 intergenic 8: 142867603-142867674 [-] 1302-10 15 intergenic 15: 102500662-102500799 [-] 1302-11 19 intergenic 19: 71973-72110 [+] 1302-2 1 intronic Non protein coding 1: 30366-30503 [+] sense 1302-4 2 intronic Non protein coding 2: 208133999-208134148 [-] 1302-9 9 Non protein coding 9: 30144-30281 [+]; Sense 1302-5 20 intronic Protein coding/FAM65C; intron 4 20: 49231173-49231322 [-]; Sense 1302-6 7 intronic Protein coding/HDAC9; intron 1 7: 18166843-18166932 [-] ; Antisense 1302-8 9 intronic Protein coding/ch9orf174 9: 100125836-100125963 [-]; Antisense Mature-miR-1302: UUGGGACAUACUUAUGCUAAA www.mirbase.org - 8 - Sample & Assay Technologies A SNP in a miRNA can Change Regulatory Repertoire A SNP in a Target 3’ UTR can Create or Destroy a Binding Site (A) SNP in miRNA seed Ago2 Ago2 ORF III III III IIIIII AAA III III III IIIIII Different range of target genes Ago2 Ago2 ORF IIIIII III I I IIII III III III II IIII AAA SNP (B) SNP in mRNA regulatory region SNP ORF X AAA miRNA target site created miRNA target site destroyed Decrease in mRNA translation Increase in mRNA translation Ago2 III III III IIIIII Ago2 ORF ORF III III III IIIIIIX AAA X AAA (1) Ryan, BM., et.al., (2010) Nat Rev cancer, 10: 389-402 (2) Brest, P., et.al., (2011) Nat Genet. Jan 30. - 9 - Sample & Assay Technologies Epigenetics and miRNA Generation of miRNA Diversity by Processing and Editing .......UAGCUUAUCAGACUGAUGUUGAC.....................301661 ..................... 301661 .......UAGCUUAUCAGACUGAUGUUGA......................184371 ..................... 184371 .......UAGCUUAUCAGACUGAUGUUG.......................19423 ..................... ADAR19423 .......UAGCUUAUCAGACUGAUGUUGACU....................12168 ..................... 12168 AI Pri-miRNA .......UAGCUUAUCAGACUGAUGUU........................3204 ..................... 3204 ........AGCUUAUCAGACUGAUGUUGAC.....................1230 ..................... 1230 AAAA ......GUAGCUUAUCAGACUGAUGUUGA......................884 ..................... 884 .......UAGCUUAUCAGACUGAUGU.........................818 ..................... 818 ........AGCUUAUCAGACUGAUGUUGACU....................682 .....................A I682 DROSHA Processing .......UAGCUUAUCAGACUGAUG..........................679 ..................... 679 Block ........AGCUUAUCAGACUGAUGUUGA......................353 ..................... 353 ......GUAGCUUAUCAGACUGAUGUUGAC.....................310 ..................... 310 ......GUAGCUUAUCAGACUGAUGUUG.......................123 ..................... 123 Pre-miRNA .......UAGCUUAUCAGACUGAU...........................120 ..................... 120 .......UAGCUUAUCAGACUG.............................115 ..................... 115 .......UAGCUUAUCAGACUGA............................94 ..................... 94 .......UAGCUUAUCAGACUGAUGUUGACUGU..................81 ..................... 81 Exportin ...........UUAUCAGACUGAUGUUGAC.....................69 .....................ADAR 69 .........GCUUAUCAGACUGAUGUUGAC.....................68 ..................... 68 .........GCUUAUCAGACUGAUGUUGA......................66 ..................... 66 ......GUAGCUUAUCAGACUGAUGUUGACU....................53 ..................... 53 ........AGCUUAUCAGACUGAUGUUG.......................52 ..................... 52 ............UAUCAGACUGAUGUUGAC.....................45 ..................... 45 .......UAGCUUAUCAGACUGAUGUUGACUG...................38 ..................... 38 DICER ...........UUAUCAGACUGAUGUUGA......................24 ..................... 24 ............UAUCAGACUGAUGUUGA......................15 .....................A I15 Processing ...............CAGACUGAUGUUGAC.....................13 ..................... 13 ......GUAGCUUAUCAGACUGAUGUU........................11 ..................... 11 Block .............AUCAGACUGAUGUUGAC.....................8 ..................... 8 .......UAGCUUAUCAGACUGAUGUUGACUGUU.................5 .....................A I5 .........GCUUAUCAGACUGAUGUUG.......................5 ..................... 5 .............AUCAGACUGAUGUUGA......................5 ..................... 5 Change in Deep sequencing reads reads of sequencing hsa-miR-21 Deep ..............UCAGACUGAUGUUGAC.....................4 ..................... 4 miRNA seed ........AGCUUAUCAGACUGAUGUU........................3 ..................... 3 ..........CUUAUCAGACUGAUGUUGAC.....................3 ..................... 3 ........AGCUUAUCAGACUGAUG..........................2 ..................... 2 .........GCUUAUCAGACUGAUGUUGACU....................2 ..................... 2 ...........UUAUCAGACUGAUGUUG.......................2 ..................... 2 ...........UUAUCAGACUGAUGUUGACU....................2 ..................... 2 ....GGGUAGCUUAUCAGACUGAUGUU........................1 ..................... 1 Slezak-Prochazka, I., et.al., (2010) RNA.. 16:1087-95 Kawahara, et. al (2007) Science. 315 (5815 ): 1137-40 www.mirbase.org - 10 - Sample & Assay Technologies Isolation Quantification Functional Studies miRNA in Disease - 11 - Sample & Assay Technologies Potential for Disruption of miRNA in Disease microRNA Gene Genomic Instability Altered Transcription Pri-miRNA AAAA Gene Amplification Methylation Translocation Histone Modification Drosha-DGCR8 Deletion Transcription Factor Pre-miRNA DROSHA Insertional Mutagenesis Processing Exportin miRNA Biogenesis Loss of Dicer miRNA Binding Site in target Processing DICER-TRBP SNP or Mutation mature miRNA Ago Alternative Splicing Separation of 3’-UTR by miRNP Chromosomal Translocation Target Transcript Croce CM., (2009) Nat Rev Genet. 10: 704-714. - 12 - Sample & Assay Technologies Unique miRNA Signatures are found in Human Cancer miRNAs located in genomic regions amplified in cancers (e.g. miR-12-92 cluster) can function as oncogenes, whereas miRNAs located in portions of chromosomes deleted in cancers (e.g. miR-15a-miR-16-1 cluster) can function as tumor suppressors. Abnormal expression of miRNAs has been found in both solid and hematopoietic tumors. miRNA expression fingerprints correlate with clinical and biological characteristics of tumors , including tissue type, differentiation, aggression and response to therapy. The race is on to find good