Journal of Plant Pathology (2006), 88 (1), 121-125 Edizioni ETS Pisa, 2006 121

DISEASE NOTE DISEASE NOTE FIRST REPORT OF ALOPECURUS FIRST RECORD OF CHESTNUT ARUNDINACEUS, A. MYOSUROIDES, BLIGHT IN IRAN HORDEUM VIOLACEUM, AND PHLEUM PRATENSE AS HOSTS OF CLAVICEPS M. Niknejad Kazempour1, S.A. Khodaparast1, PURPUREA POPULATION G2 IN TURKEY M. Salehi2, B. Amanzadeh2, A. Nejat-Salary3 and B.K. Shiraz2 C. Eken1, S. Pazoutova2, A. Honzatko 2 and S. Yıldız1 1 Department of Plant Pathology, Faculty of Agricultural Sciences, University of Guilan, P.O. 1 Department of Plant Protection, Faculty of Agriculture, Box 41635, 1314 Rasht, Iran Atatürk University, 25240 Erzurum, Turkey 2 Natural Resources and Domestic Animals Research, 2 Guilan Province, Iran Institute of Microbiology CAS, Videnska 1083, 3 14220 Prague 4, Czech Republic Natural Resources and Domestic Animals Research, Alborz-Karaj, Iran Ergot (Claviceps purpurea (Fr.) Tul.) was observed on Diseased chestnut trees (Castanea sativa) were ob- Alopecurus arundinaceus Poir., Alopecurus myosuroides served in surveys conducted from 2001 to 2005 in the Huds., Hordeum violaceum Boiss. et Huet and Phleum forests of Visroud, Imamzadeh Ebrahim, Fuman, and pratense L. in Erzurum, Turkey, during late spring and Shafaroud, the main growing areas of chestnut in Iran. summer of 2002 and 2003. The early stage of ergot is rec- Affected plants had declining or dead branches and ognized by an appearance of thick conidia-laden “honey- sprouts with yellow or brown wilted leaves. Elliptical dew”, which exudes from infected florets. In the late yellowish-brown cankers with a cracked surface and stage of infection an elongated, hard, purplish-black scle- rough appearance were present on trunks and branches rotium develops. All Claviceps isolates were identified as and sometimes girdled these organs, thus inducing G2 population (also a chemorace) of C. purpurea, based dieback and, eventually, death of the plants. For isola- on randomly amplified polymorphic DNA (RAPD) pat- tion of the possible causal agent, small pieces of tissue tern, an absence of EcoRI restriction site in the 5.8S ribo- excised from cankers on branches and trunks of trees of somal DNA, longer conidia and ergocristine and ergosine different age coming from various locations were sur- content of sclerotia (Pazoutova et al., 2000). A suspension face sterilized with 5% sodium hypochlorite and thor- (2·106 conidia ml-1) was prepared with conidia harvested oughly washed with sterile distilled water, prior to plat- from ergot infected plants and sprayed the heads of at the ing on acidified potato dextrose agar. Plates were incu- time of anthesis of the H. violaceum and P. pratense bated at 27°C for 7-10 days and growing fungal colonies plants. Control plants were sprayed with sterile water. All were subcultured and observed for identification. plants were incubated in a greenhouse at 24oC. After 10 Among the fungi that were isolated, i.e. Chalaropsis sp., days, honeydew appeared only on inoculated plants. C. Colletotrichum sp., Fusarium oxysporum, and F. solani, purpurea was reisolated from inoculated plants. The the most common and consistently recovered from all pathogen has been recorded previously on Bromus sp., areas sampled was Cryphonectria parasitica. Its identifi- Secale cereale L., Secale montanum Gaus. (Baydar, 1975) cation was essentially based on morphological charac- and Elymus repens (L.) Gould (Demirci et al., 1997) in ters (Darpoux et al., 1975; Anonymous, 1982). To the Turkey. This is the first report of G2 population of C. pur- best of our knowledge, this is the first record from Iran purea on Alopecurus arundinaceus, A. myosuroides, of chestnut blight, a disorder causing serious problem Hordeum violaceum and Phleum pratense in Turkey. to the forests of the Guilan province.

Baydar S., 1975. Researches of the Ascomycetes from Plants Darpoux H., Ride M., Bondoux, P., 1975. Apparition de foy- Around the Provinces of Erzurum, Erzincan and Gümü- ers d’Endothia parasitica sur châtaigniers en France. s¸hane. Atatürk University publication No. 411. Comptes Rendus de l’Académie d’Agriculture de France 43: Demirci E., Zengin H., Eken C., Tamer A.Ü., 1998. Parasitic 670-674. fungi determined on the weeds in Erzurum province. In: Anonymous, 1982. Data sheets on quarantine organisms No. Nemli Y., Demirkan H. (eds.). Proceedings of 2nd Turkish 69, Endothia parasitica. Bulletin OEPP/EPPO Bulletin 12: 1. Congress of Herbology, I˙zmir 1997, 55-62. Pazoutova S., Olsovska J., Linka M., Kolinska R., Flieger M., 2000. Chemoraces and habitat specialization of Claviceps purpurea populations. Applied and Environmental Micro- biology 66: 5419-5425.

Corresponding author: C. Eken Corresponding author: M. Niknejad Kazempour Fax: +90.442.2311469 Fax: +98.131.6690281 E-mail: [email protected] E-mail: [email protected]

Received 1 September 2005 Received 6 September 2005 Accepted 20 September 2005 Accepted 26 october 2005 122 Journal of Plant Pathology (2006), 88 (1), 121-125

DISEASE NOTE DISEASE NOTE DECLINE OF PINE TREES DETECTION AND OCCURRENCE IN THE IRANIAN PROVINCE OF APPLE MOSAIC VIRUS OF GHAZVIN IN HAZELNUT IN SOUTH-EAST POLAND

M. Niknejad Kazempour1, B. Yahaghi2 T. Koby∏ko and B. Nowak and T. Rostamie Shahraji2 Department of Botany, Agricultural University of Kraków, 1 Department of Plant Pathology, Faculty of Agricultural 29 Listopada 54, 31-425 Kraków, Poland Sciences, University of Guilan, P.O. Box 41635, 1314 Rasht, Iran 2 Department of Forestry, Faculty of Natural Resources, University of Guilan, P.O. Box 41635, 1314 Rasht, Iran

In spring of 2002 and 2004, during surveys of pine Infection of hazelnut with Apple mosaic virus (Ap- trees (Pinus sp.) in different area of the Iranian province MV) in south-east Poland was investigated in the years of Ghazvin symptoms of more or less extensive decline 1999-2004 in trees of Corylus avellana L., Corylus maxi- (withering and desiccation of twigs) and root rot were ma Mill., Corylus americana Walt., and Corylus colurna observed in trees of different age. The disease pro- L. that were cultivated in plantations, varietal collec- gressed gradually and often resulted in the death of af- tions, cottage gardens, allotments, urban greenery, or fected trees. For isolation of the possible causal agent, originated from natural habitats. All together 682 small pieces of tissue excised from root, twigs needles plants, representing 56 cultivars and undetermined and trunks were surface sterilized with 5% sodium plant material from non-professional plantations or growing wild, were tested by ELISA (Clark and Adams, hypochlorite and thoroughly washed with sterile dis- 1977) using a commecial kit (Loewe Biochemica, Sauer- tilled water prior to plating in acidified potato dextrose lach, Germany). ApMV was detected only in C. agar and corn meal agar. Plates were incubated at room avellana, in particular in all tested trees of cvs Negret, temperature for 5-7 days and growing fungal colonies and Gustav Zellernuss, and in a single tree of a clone of were subcultured for purification and identification. an undetermined cultivar from Italy labelled 104E. All Most of the colonies belonged to a fungus which, based plant accessions were of foreign origin. Symptoms of on morphological characters, was identified as Fusarium virus infection were detected only in affected trees in oxysporum (Mohali, 1996; Dick and Dobbie, 2002). For spring 2004, a year characterized by moderate tempera- pathogenicity tests, an inoculum consisting of cultures tures in May. Symptoms were yellow to bright yellow of this fungus grown on sterilized barley grains was mottling, ring spots, line and oak-leaf patterns. In added to individual pots where 4- to 6-month-old pine spring, symptoms were evident and more or less dif- seedlings were planted in a commercial soil mix. Inocu- fused, but with time and raise in the temperature they lated and non-inoculated control seedlings were main- became partly masked. During a second survey at the tained at 25-28°C with saturated relative humidity for end of June 2004, it was observed that symptoms had 48 h. After 4 weeks, inoculated seedlings showed symp- disappeared from a previously symptomatic tree, where- toms (root rot and wilting) resembling those seen in na- as in other trees symptoms had become more conspicu- ture. The same fungus used for inoculum was re-isolat- ous. This seems to be the first substantiated record of the occurrence of ApMV in hazelnut in Poland. ed from rotten root segments but not from the roots of control seedlings that remained viable. This is the first report of the presence of F. oxysporum in pine trees in the Ghazvin province of Iran.

Dick M.A., Dobbie K., 2002. Species of Fusarium on Pinus in Clark M.F., Adams, A.N, 1977. Characteristics of the mi- New Zealand. New Zealand Plant Protection 55: 58-62. croplate method of enzyme-linked immunosorbent assay Mohali S.R., 1996. First Fusarium oxysporum and Fusarium for the detection of plant viruses. Journal of General Virol- solani associated with root diseases of Caribbean pine in ogy 34: 475-483. Venezuela. Plant Disease 80: 959.

Corresponding author: M. Niknejad Kazempour Corresponding author: B. Nowak Fax: +98.131.6690281 Fax: +48.12.6625266. E-mail: [email protected] E-mail: [email protected]

Received 6 September 2005 Received 26 October 2005 Accepted 26 October 2005 Accepted 13 December 2005 Journal of Plant Pathology (2006), 88 (1), 121-125 123

DISEASE NOTE DISEASE NOTE ERYSIPHE CRUCIFERARUM ON ALYSSUM FIRST RECORD OF GRAPEVINE VEIN DESERTORUM VAR. DESERTORUM NECROSIS IN SYRIA AND ALYSSUM HIRSUTUM IN TURKEY T. Mslmanieh1, M. Digiaro1, T. Elbeaino1 and G.P. Martelli2 A. Karakaya 1 Istituto Agronomico Mediterraneo, Via Ceglie 9, 70010, Department of Plant Protection, Faculty of Agriculture, Valenzano (BA), Italy 2 Ankara University, 06110 Dy´skapy´ Ankara, Turkey Dipartimento di Protezione delle Piante e Microbiologia Applicata, Università degli Studi and Istituto di Virologia Vegetale del CNR, Sezione di Bari, Via G.C. Amendola 165/A, 70126 Bari, Italy

In 2005, powdery mildew symptoms were observed Vein necrosis (VN) is a virus-like disease of grapevine first on Alyssum desertorum var. desertorum and Alyssum hir- described from France (Legin and Vuittenez, 1973), whose sutum plants growing at the Haymana Research Farm of putative agent was recently suggested to be Grapevine ru- Ankara University. The causal agent of this disease has pestris stem-pitting associated virus (GRSPaV = Rupestris been identified as Erysiphe cruciferarum Opiz ex Junell stem pitting-associated virus) (Bouyahia et al., 2005). In the (Braun, 1995). The collections concerned are character- course of a survey of virus diseases of grapevine in Syria, 135 ized by the following microscopic features: mycelium on samples representative of different European grape varieties leaves, pods and stems, cylindric-doliiform conidia and American rootstocks grown in the country were analysed by RT-PCR for the presence of GRSPaV, using the virus-spe- formed singly, 31 × 15 µm, length/width ratio generally cific primers Pr48d: AGCTGGGATTATAAGGGAGGT larger than 2, cleistothecia gregarious to scattered, 108 and Pr49d: CCAGCCGTTCCACCACTAAT (A. Rowhani, µm, cells ca. 15 µm diam., appendages mycelioid, ca. 6 personal communication). GRSPaV was detected in 102 sam- µm wide, generally longer than cleistothecium, asci nu- ples. Buds from 18 GRSPaV PCR-negative and 35 GRSPaV merous, shortly stalked, 58 × 34 µm, 2-8 spored, as- PCR-positive vines were then grafted onto 110R indicators. cospores ellipsoid-ovoid, 23 × 15 µm. Erysiphe crucifer- Typical VN symptoms were induced by 28 of the 35 arum on Alyssum desertorum has been reported from GRSPaV-positive accessions, but by none of the 18 GRSPaV- Romania and the same fungus has been reported from negative sources, thus supporting the reported association Romania and former Soviet Union on Alyssum hirsutum between GRSPaV and VN. A second round of RT-PCR us- (Braun, 1995). This is the first report of Erysiphe cru- ing extracts from the seven graft-inoculated 110R indicators ciferarum on Alyssum desertorum var. desertorum and that had not shown VN reactions, revealed the presence of Alyssum hirsutum from Turkey. GRSPaV in three of them. The absence VN symptoms in these GRSPaV-positive indicators may be attributed to the existence of virus strains that infect 110R latently (Bouyahia et al., 2006). However, whether the apparent absence of GRSPaV in the remaining four indicators is due to false posi- tive PCR reactions in the first round of tests, or to a failure to transmit virus by grafting, remains to be ascertained. To our knowledge, this represents the first record of VN and GRSPaV from Syria. Braun U., 1995. The powdery mildews (Erysiphales) of Eu- Bouyahia H., Boscia D., Savino V., La Notte P., Pirolo C., rope. G. Fischer Verlag, Jena, New York, USA. Castellano M.A., Minafra A., Martelli G.P., 2005. Gra- pevine rupestris stem pitting-associated virus is linked with grapevine vein necrosis. Vitis 44: 133-137. Bouyahia H., Materazzi A., Triolo E., 2006. Study of the rela- tionship between GRSPaV molecular variants and vein necrosis. Extended Abstracts 15th Meeting of ICVG, Stellen- bosch 2006 (in press). Legin R., Vuittenez A., 1973. Comparaison des symptoms et transmission par greffage d’une mosaïque nervaire de Vitis vinifera, de la marbrure de V. rupestris et d’une affection nécrotique de l’hybride Rup-Berl 110 R. Rivista di Patolo- gia Vegetale 9: 57-63.

Corresponding author: A. Karakaya Corresponding author: M. Digiaro Fax: +90.312.3187029 Fax: +39.080.4606275 E-mail: [email protected] E-mail: [email protected] Received 8 November 2005 Received 22 November 2005 Accepted 24 November 2005 Accepted 15 November 2005 124 Journal of Plant Pathology (2006), 88 (1), 121-125

DISEASE NOTE DISEASE NOTE FIRST RECORD OF GRAPEVINE VEIN FIRST RECORD OF DOWNY MILDEW MOSAIC DISEASE IN SYRIA CAUSED BY PERONOSPORA SP. ON BASIL IN MALTA T. Mslmanieh1, M. Digiaro1, T. Elbeaino1 and G.P. Martelli2 A. Porta-Puglia and D. Mifsud

1 Istituto Agronomico Mediterraneo, Via Ceglie 9, 70010, Ministry for Rural Affairs and the Environment, Valenzano (BA), Italy Department of Plant Health, Agricultural Research 2 Dipartimento di Protezione delle Piante e Microbiologia & Development Centre, Gh-ammieri, Applicata, Università degli Studi and Istituto di Virologia Marsa CMR 01, Malta Vegetale del CNR, sezione di Bari, Via Amendola 165/A, 70126 Bari, Italy During a survey of virus diseases in the main grapevine- Downy mildew was observed in Malta on sweet basil growing areas of Syria, strong chlorotic vein feathering (Ocymum basilicum L.) in three locations (Mtarfa and and vein banding were observed in leaves of grapevines of Z˙ abbar, September 2005; Mellieh- a, November 2005). cv Corna Alegra in a collection plot in the southern district Leaves of infected plants showed chlorotic patches start- of Dara’a. No virus was recovered from symptomatic ing from the central veins and a grey mildew developed plants by mechanical transmissions to a range of herba- on the lower leaf surface. The pathogen morphology was ceous species in the families Chenopodiaceae, Cucur- in agreement with the description given by Garibaldi et bitaceae, Amaranthaceae, and Solanaceae. Likewise, no al. (2005) for sporangiophores (conidiophores) and spo- positive reaction was obtained in ELISA with antisera to rangia (conidia) of Peronospora sp. Conidia were able to Grapevine fanleaf virus (GFLV), Arabis mosaic virus (Ar- germinate directly on water agar in darkness. Fifty MV), Grapevine fleck virus (GFkV), Grapevine leafroll as- seedlings of basil (from local farm-produced seeds, at the stage of 8-10 true leaves) and 6 ten-month-old sage sociated virus 1 (GLRaV-1), Grapevine leafroll associated plants (Salvia officinalis L., from cuttings having 1-3 virus 2 (GLRaV-2) and Grapevine leafroll associated virus 3 branches with 60-100 leaves per plant) were artificially (GLRaV-3), Grapevine virus A (GVA), and Grapevine inoculated by spraying their leaves with a water suspen- virus B (GVB), or RT-PCR using degenerate primers for sion of conidia (5·104 ml-1). An equal number of plants, the detection of nepoviruses (Digiaro et al., 2006). By con- sprayed with water, were used as controls. The plants trast, Vitis riparia and Kober 5BB, two of a standard series were grown in pots (diam. 12 cm, filled with a mixture of of green graft-inoculated woody indicators (LN33, 110 peat, soil and sand) each with either 10 plants of basil or R, Kober 5BB, Vitis rupestris, V. riparia and V. vinifera cv one of sage. All plants were kept in a greenhouse (20- Cabernet franc), showed visible reactions 3-4 weeks after 24ºC) and, after inoculation, they were covered for three inoculation. Symptoms exhibited by V. riparia were the days with plastic bags, which were subsequently gradual- same as those reported in the literature for vein mosaic, a ly opened and removed after six days. Symptoms and widespread virus-like disease often latent in European signs on basil leaves developed within 5-7 days on all the grapevines (Legin and Vuittenez, 1973), whereas Kober inoculated plants. Inoculated sage and control plants of 5BB showed only a mild flecking of the leaf blades. Symp- the two species were free from symptoms at the end of toms in V. riparia strengthened with time, resulting in the observations (30 days after inoculation). The experi- rolling and deformation of the leaves, whereas those in ment was repeated twice with the same results. This is Kober 5BB became progressively milder and disappeared the first record of downy mildew caused by Peronospora within a few weeks. To our knowledge, this represents the sp. on basil in Malta. These findings confirm that this first experimental evidence of the presence of grapevine pathogen differs, at least for its pathogenic behaviour, vein mosaic in Syria. from Peronospora lamii reported by some Authors on basil (Garibaldi et al., 2004). More studies are needed, Digiaro M., Elbeaino T., 2006. Use of degenerate primers for including biomolecular investigations, to define whether the simultaneous RT-PCR detection and differentiation of the organism which attacks basil but not sage deserves a subgroups A, B and C of grapevine nepoviruses. Proceed- specific rank (A. Garibaldi, personal communication). ings of the 15th Meeting of ICVG, Stellenbosch 2006. South African Journal of Enology and Viticulture (in press). Garibaldi A., Minuto A., Gullino M.L., 2005. First report of Legin R., Vuittenez A., 1973. Comparaison des symptoms et downy mildew caused by Peronospora sp. on basil (Ocy- transmission par greffage d’une mosaïque nervaire de Vitis mum basilicum) in France. Plant Disease 89: 683. vinifera, de la marbrure de V. rupestris et d’une affection Garibaldi A., Minuto G., Bertetti D., Gullino M.L., 2004. nécrotique de l’hybride Rup-Berl 110 R. Rivista di Patolo- Seed transmission of Peronospora sp. of basil. Zeitschrift gia Vegetale 9: 57-63. für Pflanzenkrankheit und Pflanzenschutz 111: 465-469.

Corresponding author: M. Digiaro Corresponding author: A. Porta-Puglia Fax: +39.080.4606275 Fax: +356.25904.211 E-mail: [email protected] E-mail: [email protected] Received 22 November 2005 Received 24 November 2005 Accepted 15 November 2005 Accepted 9 January 2006 Journal of Plant Pathology (2006), 88 (1), 121-125 125

DISEASE NOTE DISEASE NOTE FIRST REPORT OF APPLE FIRST REPORT OF SIDA YELLOW MOSAIC PROLIFERATION AND PEAR DECLINE CHINA VIRUS ASSOCIATED PHYTOPLASMAS IN KOSOVO WITH YELLOW VEIN DISEASE OF AGERATUM CONYZOIDES A. Myrta1, M. Martini2, L. Susuri3, H.Sh. Susuri4 IN CHINA and L. Carraro2 Q. Xiong and X.P. Zhou 1 Istituto Agronomico Mediterraneo,Via Ceglie 9, 70010 Valenzano (BA), Italy 2 Institute of Biotechnology, Zhejiang University, DiPi, Università diUdine,Via delle Scienze 208, Hangzhou 310029, People’s Republic of China 33100 Udine, Italy 3 Kosovo Academy of Sciences and Arts, Rr. Emin Duraku, Nr. 1, Prishtina, Kosovo 4 Ministry of Agriculture, Food and Rural Development, Mother Teresa str. 35, Prishtina, Kosovo Sida yellow mosaic China virus (SiYMCNV) is a dis- During autumn 2005, orchards were surveyed in four tinct begomovirus found in Sida acuta in the Hainan locations of south-western and southern Kosovo for the province of China (Xiong et al., 2005). To identify alterna- presence of possible phytoplasma diseases in fruit trees. tive hosts for this virus, samples were collected in Hainan Symptoms resembling those of apple proliferation (AP), from weeds showing leaf curling, vein thickening, and yel- pear decline (PD), and European stone fruit yellows low vein symptoms. A virus isolate denoted Hn7 was ob- (ESFY) were observed in all the orchards visited. Sam- tained from an Ageratum conyzoides plant showing yellow ples were collected for laboratory assays from eight vein, sampled in Danzhou (Hainan) in October 2003. symptomatic apple trees, eight pear trees and three apri- PCR of total DNA extracts from the Hn7-infected plant cot trees. After nucleic acid extraction, nested PCR was using the degenerate primer pair PA and PB, which were done using the phytoplasma universal primers P1/P7 designed to amplify part of the intergenic region and the followed by R16F2n/R2. The R16F2n/R2 amplicons, AV2 gene of DNA-A of SiYMCNV (Xiong et al., 2005), when digested with MseI, showed a restriction profile yielded a 500 bp DNA fragment. When this PCR product characteristic of the 16SrX phytoplasma group. The was cloned and sequenced it was found to have 99.1% se- identity of the detected agents was confirmed by a sec- quence identity at the nucleotide level with the compara- ond nested PCR using the 16SrX phytoplasma group- ble sequence of SiYMCNV (AJ810096). The whole DNA- specific primer pair f01/r01 (Lorenz et al., 1995), fol- A molecule of Hn7, amplified using primers SidaR and lowed by RFLP with SspI and BsaAI. The results SidaF (Xiong et al., 2005), was 2751 bp in size showed the presence of phytoplasmas belonging to the (AM048837). A comparison with DNAs of other bego- 16SrX group, subgroup A (Candidatus Phytoplasma moviruses, showed that Hn7 DNA-A had 99% sequence mali) in six apple trees and to the 16SrX group, sub- identity with DNA-A of SiYMCNV isolate Hn8 at the nu- group C (Candidatus Phytoplasma pyri) in three pear cleotide level (Xiong et al., 2005). PCR to ascertain if a pu- trees. None of the three apricot trees was found to be tative DNAβ satellite molecule was associated with isolate infected by phytoplasmas of the 16SrX group, subgroup Hn7, using the universal primer pair β01/β02 (Li et al., B (Candidatus Phytoplasma prunorum) (Anonymous, 2004), yielded an amplicon ca. 1.4 kb in size. Sequence 2004), as had been expected on the basis of symptoma- analysis showed that DNAβ of isolate Hn7 was 1,355 nt in tology. Additional investigations of the apricot disease size (AM048833) and that it had 83.7% and 87% nu- are needed because the number of trees analyzed was cleotide sequence identities with DNAβ molecules associ- limited and the samples were collected relatively late in ated with two different SiYMCNV isolates (AJ810093/95). the season. This report is the first record of AP and PD It was concluded that the virus recovered from A. cony- in Kosovo. The presence of these epidemic diseases rep- zoides is an isolate of SiYMCNV. To our knowledge this is resents a serious threat for the local fruit tree industry. the first report of SiYMCNV infecting A. conyzoides. Anonymous, 2004. ‘Candidatus Phytoplasma’, a taxon for the Xiong Q., Guo X.J., Che H.Y., Zhou X.P., 2005. Molecular wall-less, non-helical prokaryotes that colonize plant characterization of a distinct Begomovirus species and its phloem and insects. International Journal of Systematic and associated satellite DNA molecule infecting Sida acuta in Evolutionary Microbiology 54: 1243-1255. China. Journal of Phytopathology 153: 264-268. Lorenz K.H., Schneider B., Ahrens U., Seemüller E., 1995. Li Z.H., Zhou X.P., Zhang X., Xie Y., 2004. Molecular char- Detection of apple proliferation and pear decline phyto- acterization of tomato-infecting begomoviruses in Yunnan, plasmas by PCR amplification of ribosomal and nonriboso- China. Archives of Virology 149: 1721-1732. mal DNA. Phytopathology 85: 771-776.

Corresponding author: A. Myrta Corresponding author: X.P. Zhou Fax: +39.080.4606275 Fax: +86.571.86971498 E-mail: [email protected] E-mail: [email protected] Received 15 December 2005 Received 17 December 2005 Accepted 30 January 2006 Accepted 9 January 2006