Variant Requirements for DNA Repair Proteins in Cancer Cell Lines That Use

Variant requirements for DNA repair proteins in cancer cell lines that use

alternative lengthening of telomere mechanisms of elongation

DISSERTATION

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University

Alaina Rae Martinez

Biomedical Sciences Graduate Program

The Ohio State University

2016

Dissertation Committee:

Dr. Jeffrey D. Parvin, Advisor

Dr. Joanna Groden

Dr. Amanda E. Toland

Dr. Kay F. Huebner

Alaina Rae Martinez

2016

Abstract

The human genome relies on DNA repair proteins and the telomere to maintain genome stability. Genome instability is recognized as a hallmark of cancer, as is limitless replicative capacity. Cancer cells require telomere maintenance to enable this uncontrolled growth. Most often telomerase is activated, although a subset of human cancers depend on recombination-based mechanisms known as Alternative Lengthening of Telomeres (ALT). ALT depends invariably on recombination and its associated DNA repair proteins to extend telomeres. This study tested the hypothesis that the requirement for those requisite recombination proteins include other types of DNA repair proteins.

These functions were tested in ALT cell lines using C-circle abundance as a marker of

ALT. The requirement for homologous recombination proteins and other DNA repair proteins varied between ALT cell lines compared. Several proteins essential for homologous recombination were dispensable for C-circle production in some ALT cell lines, while proteins grouped into excision DNA repair processes were required for C- circle production. The MSH2 mismatch repair protein was required for telomere recombination by intertelomeric exchange. In sum, our study suggests that ALT proceeds by multiple mechanisms that differ between human cancer cell lines and that some of these depend on DNA repair proteins not associated with homologous recombination pathways. Further studies of all DNA repair pathways in ALT will likely lead to a better understanding of ALT mechanisms and ultimately better ALT-targeted therapeutics. ii

Dedication

To my grandparents, parents and husband who have worked hard and made sacrifices so that I could have this opportunity and to my siblings for being examples for me to follow.

iii

Acknowledgments

I would like to acknowledge my advisors Dr. Jeffrey Parvin and Dr. Joanna

Groden for their guidance and encouragement throughout graduate school. I would like to thank committee members Dr. Amanda Toland and Dr. Kay Huebner for their helpful suggestions, interest in my project and thought-provoking questions. I would like to thank the 9th floor of the BRT; they have been a very collegial and friendly group of cancer researchers. Over the years there have been many members of the Parvin and Groden labs and rotation labs that I have been lucky to have met. Many became not only friends but my “Columbus family” who supported me through the hard times. I am so grateful for those friendships and could not have made it through graduate school without them.

I would also like to thank those who have guided me to this point in my life: teachers from Lewiston-Porter; professors from The College of Wooster, who believed in my capabilities; Dr. José Lemos who provided me the same opportunities, as a lab technician, as he did his students and prepared me for grad school; to him, Dr. Jacqueline

Abranches and Dr. Jessica Kajfasz, who sparked my interest in pursuing a PhD; Lemos lab friends that lent empathetic ears and encouraged me. I thank my family and friends for support, love and belief in me. Lastly, I would like to thank my husband, Senyo. It was difficult to be away from each other for five years but he encouraged me to finish graduate school. I look forward to spending the rest of my life with him, finally!

Vita

May 2007 ...... B.A. Biochemistry & Molecular Biology, The College of Wooster

2010 to present ...... PhD Candidate, The Ohio State University

Publications

Acharya, S., Kaul, Z., Gocha, A.S., Martinez, A.R., Harris, J., Parvin, J.D., and Groden, J. (2014). Association of BLM and BRCA1 during telomere maintenance in ALT cells. PLoS One 9: 1–13. Singh, M., Martinez, A.R., Lee, B.S. (2013). HuR inhibits apoptosis by amplifying Akt signaling through a positive feedback loop. J Cell Physio 228: 182-189. Abranches, J., Miller, J.H., Martinez, A.R., Simpson-Haidaris, P.J., Burne, R.A., Lemos, J.A. (2011). The collagen-binding protein Cnm is required for Streptococcus mutans adherence to and intracellular invasion of human coronary artery endothelial cells. Infect and Immun 79: 2277-2284. Martinez, A.R., Abranches, J., Kajfasz, J.K., Lemos, J.A. (2010). Characterization of the S. sobrinus acid-stress response by interspecies microarrays and proteomics. Mol Oral Micro 25: 331-342. Kajfasz, J.K., Rivera-Ramos, I., Abranches, J., Martinez, A.R., Rosalen, P.L., Derr, A.M., Quivey R.G., Lemos, J.A. (2010). Global regulation by two Spx proteins modulate stress tolerance, survival, and virulence in S. mutans. J Bacteriol 192: 2546-2556. Abranches, J., Martinez, A.R., Kajfasz, J.K., Chávez, V., Garsin, D.A., Lemos, J.A. (2009). The molecular alarmone (p)ppGpp mediates stress responses, Vancomycin tolerance, and virulence in Enterococcus faecalis. J Bacteriol 191: 2248-2256. Kajfasz, J.K., Martinez, A.R., Rivera-Ramos, I., Abranches, J., Koo, H., Quivey, Jr., R.G., Lemos, J.A. (2009). Role of Clp proteins in the expression of virulence properties of Streptococcus mutans. J Bacteriol 191: 2060-2068.

Fields of Study

Major Field: Biomedical Sciences v

Table of Contents

Abstract ...... ii

Dedication ...... iii

Acknowledgments...... iv

Vita ...... v

Publications ...... v

List of Tables ...... ix

List of Figures ...... x

Chapter 1: Functions of DNA Repair Proteins in Alternative Lengthening of Telomere

Mechanisms ...... 1

I. Telomere maintenance ...... 2

I.1 Telomere structure and function ...... 2

I.2 Telomerase ...... 4

I.3 Alternative lengthening of telomeres ...... 4

II. DNA repair proteins in ALT ...... 9

II.1 DNA damage sensors ...... 10

II.2 Chromatin modifiers ...... 12

II.3 Double-strand break proteins ...... 13

II.4 RecQ-like helicases ...... 18

II.5 Excision repair ...... 19

Chapter 2: Thesis Rationale and Research Objectives ...... 26

Chapter 3: Differential Requirements for DNA Repair Proteins in Cell Lines Using

Alternative Lengthening of Telomere Mechanisms ...... 29

I. Introduction ...... 29

II. Materials and methods ...... 32

Cell lines ...... 32

siRNA knockdown ...... 32

Western blots ...... 33

qRT PCR assays...... 33

C-circle assays ...... 33

Telomere sister chromatid exchange assays ...... 34

Homology-directed repair assays ...... 35

III. Results ...... 37

BRCA1 depletion in five ALT cell lines decreases C-circles, a quantifiable marker of

ALT ...... 37

vii

ALT cells do not depend on all requisite homologous recombination proteins for

telomere maintenance although requirements differ between ALT-positive cell lines

...... 42

Non-homologous end joining proteins are not critical for ALT ...... 47

Nucleotide excision repair, DNA mismatch repair, and base excision repair proteins

can contribute to ALT ...... 47

MSH2 stimulates intertelomeric exchanges in U-2 OS ALT cells and MSH2 and

MPG affect homology-directed repair in HeLa cells ...... 50

IV. Discussion ...... 55

Chapter 4: Thesis Summary and Future Directions ...... 59

I. Thesis summary ...... 59

II. Future directions ...... 63

III. Significance of understanding mechanisms of ALT ...... 75

References ...... 77

viii

List of Tables

Table 1. Sequence of siRNAs and quantitative PCR primers...... 36

Table 2. Summary of data from DNA repair depletions and C-circle measurements in

ALT cells ...... 58

List of Figures

Figure 1: T-loop with shelterin complex...... 3

Figure 2: ALT cells have distinct and characteristic cytological phenotypes...... 7

Figure 3: C-circle assay (CC assay)...... 9

Figure 4: DNA damage sensing and recruitment of proteins to a double-strand break. ... 11

Figure 5: Homologous recombination DNA repair pathway...... 15

Figure 6: Non-homologous end joining DNA repair pathway...... 17

Figure 7: Nucleotide excision DNA repair pathway...... 21

Figure 8: Mismatch DNA repair pathway...... 23

Figure 9: Base excision DNA repair pathway...... 24

Figure 10: Depletion of BRCA1 reduces C-circles in five ALT cell lines but not in a telomerase-dependent cell line...... 39

Figure 11: Knockdown of BRCA1 using a second siRNA reduces C-circles in ALT cell lines and confirms previous experiments...... 41

Figure 12: Depletion of homologous recombination proteins BARD1, BRCA2, PALB2 or

WRN in ALT cells do not alter C-circle abundance...... 43

Figure 13: Depletion of RNF8 or RNF168 lowers C-circle levels in VA-13 cells and depletion of NHEJ proteins does not alter C-circle abundance in Saos-2, U-2 OS or VA-

13 cells...... 46

Figure 14: Depletion of XPA, MSH2 or MPG lowers C-circle levels in U-2 OS and VA-

13 cells...... 49

Figure 15: Depletion of MSH2, XPA or MPG lowers intertelomeric exchanges in U-2

OS cells...... 52

Figure 16: Depletion of MSH2 (MMR) or MPG (BER) proteins decrease homology- directed repair (HDR)...... 54

Figure 17: Variant requirements for DNA repair proteins in ALT...... 62

Chapter 1: Functions of DNA Repair Proteins in Alternative Lengthening of Telomere Mechanisms

Maintenance of genome integrity is a critical process in human cells as select unrepaired mutations cause genome instability which can precipitate human diseases such as premature aging, chronic pulmonary disease and cancer. Human cells are faced with the challenge of repairing tens of thousands of DNA lesions per day in order to preserve genome integrity. DNA repair relies on concerted functions from a host of proteins: DNA damage sensors, DNA damage signaling and cell cycle checkpoint proteins, mediator proteins, and nucleases, polymerases, helicases and ligases (Jackson and Bartek, 2009).

Some of these proteins function not only to protect DNA in the genome but also DNA found at the end of chromosomes that compose the telomere. The telomere is a DNA- protein structure that also functions to maintain genome integrity as it protects genomic

DNA from deterioration and prevents DNA ends from eliciting a DNA damage response.

DNA repair proteins and the telomere are linked in their ability to maintain genome integrity. In some cancer cell lines and tumor types, DNA repair proteins are required for mechanisms of Alternative Lengthening of Telomeres (ALT). Activation of this telomere lengthening maintenance mechanism(s) in cells permits uncontrolled proliferation, which is necessary for the onset of cancer.

I. Telomere maintenance

I.1 Telomere structure and function

Normal human cells have functions and structures that prevent the cell from becoming neoplastic. One key structure is the telomere, in humans, which is a noncoding stretch of DNA made up of 5′TTAGGG3′ and complementary 5′CCCTAA3′ repeats at the end of a chromosome. Telomeres can range from 10-14 kb in length in normal cells and have a 3′ G-rich over-hang of 130-210 base-pairs in length (de Lange et al., 1990;

Makarov et al., 1997). The G-rich overhang is sufficient for preventing end-to-end chromosome fusions, but if left in a linear confirmation it would be detected as a double- strand break (DSB) (Zhu et al., 2003). To prevent this, the telomere forms a “t-loop” in which the 3′ G-rich overhang invades the double strand portion of the telomere forming a

D-loop (Griffith et al., 1999). A complex of proteins that binds the telomere, called the shelterin complex, helps facilitate this t-loop and also helps “shelter” the telomere from the DNA damage response. The shelterin complex consists of telomere binding proteins, the telomere repeat binding factors 1 (TRF1) and 2 (TRF2), and the single-stranded telomere binding protein, protection of telomeres 1 (POT1). The proteins TRF1- interacting nuclear factor 2 (TIN2), tripeptidyl peptidase 1 (TPP1) and Ras-proximate protein 1 (RAP1) facilitate the telomere-binding protein interactions in the complex

(Figure 1) (de Lange, 2005). Proteins involved in DNA repair and DNA damage signaling also associate with the telomere but are unable to trigger the DNA damage response or cell cycle arrest (Matulić et al., 2007; Zhu et al., 2000).

Figure 1: T-loop with shelterin complex. Shelterin proteins facilitate looping of the telomere DNA (t-loop). DNA and proteins to the right of the // represent the telomeric region.

The telomere is essential for protecting genomic DNA from deteriorating during the life-cycle of the cell. With each cell division, the DNA replication machinery cannot fully replicate the very end of the telomere; this is known as the “end replication problem”. There is a steady loss of 50-150 base-pairs of DNA per cell division. (Makarov et al., 1997; Sfeir and de Lange, 2012). Eventually, when a cell has undergone numerous cell divisions, the telomere becomes “critically short”. Consequently, the telomere can no longer perform its function; shelterin proteins can no longer bind; senescence is induced.

If genetic or epigenetic changes occur such that cell-cycle checkpoint proteins are altered in a cell, the cell will continue to proliferate even with this extreme telomere dysfunction.

When the telomere reaches about 1.5 kilobases in length, “crisis” occurs, in which cytogenetic abnormalities or cell death ensue (Counter et al., 1992; Greenberg, 2005;

Hemann et al., 2001; Kim et al., 1994). The chromosome instability that occurs at

“crisis” triggers neoplastic transformation in surviving cells (Greenberg, 2005). This presents cells with a problem due to the need for unlimited proliferative capacity. Cancer cells bypass this problem by activating a telomere maintenance mechanism (TMM) that returns chromosome stability and allows continued proliferation.

I.2 Telomerase

Most cancer tumor types express the enzyme telomerase to allow for continued proliferation. It is composed of two subunits: the reverse transcriptase subunit of telomerase performs de novo synthesis of telomere repeats; the associated RNA molecule, TERC, acts as a template so that the reverse transcriptase can add the repeats to the end of the chromosome (Greider and Blackburn, 1985; Morin, 1989). The proliferative capacity that telomerase provides is not only important for cancer cells but also stem cells. Stem cells allow for tissue regeneration and require telomerase expression to prevent telomere shortening and therefore dysfunction, senescence and/or apoptosis (Batista, 2014). Limited telomerase activity in an adult organism cannot compensate for continued telomere shortening over a lifetime and explains the link between telomeres, telomerase and aging (Collins and Mitchell, 2002).

I.3 Alternative lengthening of telomeres

A minority of cancers use the recombination-based TMM of ALT for continual proliferation. Most of the cancer types that utilize ALT are of mesenchymal origin

4 including osteosarcomas, soft-tissue sarcomas and the adult brain cancer glioblastoma multiforme. Among the most common cancer types such as breast carcinomas, ALT rarely plays a role (Bryan et al., 1997; Ferrandon et al., 2013; Hakin-Smith et al., 2003;

Henson et al., 2005; Lafferty-Whyte et al., 2009; Subhawong et al., 2009;). Rare tumors express both telomerase and ALT in the same tumor (Gocha et al., 2013). Telomerase- positive tumors are capable of switching TMM to ALT when treated with telomerase inhibitors (Hu et al., 2012). These studies indicate that the need for ALT therapies may expand beyond that of ALT-positive tumors alone (Gocha et al., 2013; Hu et al., 2012).

One type of recombination that occurs in ALT cancer cells is homologous recombination (HR)-dependent DNA replication telomere copying (Dunham et al.,

2000). A second type of recombination occurs as post-replicative exchanges between sister chromatids. A longer telomere on a sister chromatid can exchange a portion of its sequence with a shorter telomere on a sister chromatid to yield a net gain in length on the shorter sister chromatid. Intertelomeric exchanges could also take place between nearby homologous chromosomes (Conomos et al., 2014; Londoño-Vallejo et al., 2004). A third type of recombination is termed HR-mediated t-loop junction resolution. The t-loop conformation of the telomere may allow for intratelomeric recombination and resolution of the t-loop. A circular extrachromosomal telomere repeat substrate, called a t-circle, is produced from this type of recombination and can be used for rolling circle amplification

(RCA) to rapidly add on to critically short telomeres. This may contribute to the heterogeneous lengths of telomeres in ALT cells (Cesare and Griffith, 2004; Henson et al., 2009).

ALT cancer cells have distinct phenotypes that can be exploited to study proteins that affect ALT (Figure 2). ALT cancer cells have heterogeneous telomere lengths ranging from short telomeres, 2 kb in length, to long telomeres, up to 50 kb in length

(Figure 2A). The long telomeres found in ALT cells are much longer than telomere lengths observed in telomerase-positive cells, which are approximately 10 kb in length

(Bryan et al., 1995; Park et al., 1998). Another phenotype is the presence of ALT- associated promyelocytic leukemia protein (PML) bodies (APBs), a nuclear body shown by fluorescence in situ hybridization (FISH)/immunofluorescence (IF) studies to contain telomeric DNA, shelterin proteins, DNA repair proteins and PML (Yeager et al., 1999)

(Figure 2B). An elevated number of telomere sister chromatid exchanges (T-SCEs), as compared to telomerase-positive cells and the numbers of SCEs found elsewhere in the genome, can also be observed in ALT cells (Betcher et al., 2004; Londono-Vallejo et al.,

2004) (Figure 2C). A unique assay detects T-SCEs and is termed chromosome- orientation FISH (CO-FISH) in which G- and C-strands of DNA at the telomere are uniquely labeled to detect the exchange between sister chromatids (Bailey et al., 1996;

Bailey et al., 2004; Goodwin and Meyne, 1993). ALT cells also have an abundance of linear and circular single-stranded or double-stranded extrachromosomal telomere repeat

(ECTR) DNA, (telomeric DNA that has been detached from the chromosome), as compared to telomerase-positive cells (Nabetani and Ishikawa, 2009) (Figure 2D).

Figure 2: ALT cells have distinct and characteristic cytological phenotypes. ALT cells exhibit phenotypes: A) heterogeneous lengths B) APBs C) telomere sister chromatid exchanges D) ECTR DNA which can be linear or circular with complete circles of both strands (t-circle), complete G-rich circle with C-rich primer (G-circle) and complete C-rich circle with G-rich primer (C-circle).

A particular phenotypic characteristic of ALT, the abundance of C-circles, is the most correlative phenotype of ALT to-date (Henson et al., 2009; Nabetani and Ishikawa,

2009). The C-circle has a completely closed circle made of CCCTAA repeats, with a short complementary piece of DNA, TTAGGG that can be used as a primer for RCA.

RCA of C-circles in ALT cells allows the cell to quickly add to telomere length and could explain the heterogeneous lengths observed in ALT. The abundance of C-circles can be measured by using a phi29 phage DNA polymerase to amplify these circles (by RCA) to levels detectable on a Southern blot or by PCR (Figure 3). This is called the C-circle assay (CC assay). The CC assay has a likelihood of being translated to the clinic, as C- circles can be detected in blood samples from patients with osteosarcomas (Henson et al.,

2009). The CC assay is also suitable for screening ALT inhibitors because C-circle levels are immediately responsive to changes in ALT. For example, C-circle levels will decrease within 24 hours of ALT inhibition (Henson et al., 2009).

Figure 3: C-circle assay (CC assay). The C-circle contains a full C-rich circle of telomeric DNA and a short complementary G-rich primer that templates rolling circle amplification by the phi29 phage DNA polymerase. dNTPs are added to the reaction, minus dCTP. Resulting amplified products 32 are quantified via Southern blot using a P -(CCCTAA)3 probe.

II. DNA repair proteins in ALT

In ALT cells, APB nuclear foci are likely sites of telomere replication and repair.

Bromodeoxyuridine (BrdU) incorporation has been observed in APBs; they are most prominent in cells that are in S/G2-phase of the cell cycle, the cycle in which many DNA repair proteins are most highly expressed (Grobelny et al., 2000; Wu et al., 2000).

Numerous DSB repair proteins localize to APBs and include: RAD51, RAD52, replication protein A (RPA), meiotic recombination 11 (MRE11), RAD50, Nijegen breakage syndrome 1 (NBS1), Bloom’s syndrome protein (BLM), Werner’s syndrome protein (WRN), breast cancer type 1 susceptibility protein (BRCA1), Fanconi anemia

9 group D2 protein (FANCD2) and structural maintenance of chromosomes protein 5/6

(SMC5/6) (Fan et al., 2009; Gocha et al., 2014; Lillard-Wetherell et al., 2004; Potts &

Yu, 2007; Wu et al., 2000; Wu et al., 2003; Yankiwski et al., 2000; Yeager et al., 1999;

Zhu et al., 2000). These proteins are involved in all steps of DNA repair: DNA sensing, signaling, chromatin modification/remodeling and many others.

II.1 DNA damage sensors

DNA damage sensors play a role in ALT. In ALT cells, upon inhibition of the

DNA damage signaling ataxia telangiectasia mutated (ATM) and ataxia telangiectasia and Rad3-related protein (ATR) proteins with caffeine treatment, BrdU incorporation in

APBs was inhibited. These results indicate that inhibition of ATM/ATR affects telomere synthesis in APBs (Nabetani et al., 2004). The MRE11-RAD50-NBS1 (MRN) complex

(Figure 4) is a sensor of DNA DSBs and participates in pathway choice between the two main DSB repair pathways, non-homologous end joining (NHEJ) (a more error prone pathway) or HR (conservative) (Chen et al., 2008; Lamarche et al., 2010). NBS1 of the

MRN complex is associated with APBs and locates to telomeres in both telomerase- positive and ALT cells. In ALT cells, it recruits its complex members MRE11 and

RAD50 and also the DSB repair protein BRCA1 to APBs through its BRCA1 C-terminus

(BRCT) domain, a domain common to many DNA repair proteins (Bork et al., 1997; Wu et al., 2000; Wu et al., 2003). NBS1 depletion or MRN sequestration results in the disappearance of abundant t-circle ECTR DNAs and a steep decrease of C-circles, which are another form of ECTR DNA that is C-rich. C-circles are a quantitative marker that is most tightly correlated with ALT activity (Compton et al., 2007; Henson et al., 2009).

Sequestration of the MRN complex, through overexpression of speckled 100 kDa protein

(Sp100), a component of APBs, also suppressed APB formation and led to telomere shortening as measured by telomere restriction fragment assays, and heterogeneity of telomeres decrease as measured by quantitative telomere FISH (Jiang et al., 2005). The detrimental effects of depletion/sequestration of the MRN complex on many phenotypes of ALT and other long-term depletion studies of NBS1 has indicated the MRN complex is required for ALT. However, growth studies indicate that although proliferation is slowed upon MRN sequestration, it is not eliminated, indicating other ALT inhibitors or combinatorial therapies need to be pursued (Compton et al., 2007; Jiang et al., 2005).

Figure 4: DNA damage sensing and recruitment of proteins to a double-strand break. Upon a DSB, the MRN complex senses and binds the broken DNA and recruits ATM, a serine/threonine protein kinase that begins a phosphorylation cascade to recruit other DNA repair proteins (You et al., 2005). Phosphorylation of other DNA repair proteins continued 11

Figure 4 continued like H2AX (γ-H2AX), a member of H2A histone family, by ATM results in organization of other DNA repair proteins into nuclear DNA damage foci at the damage site, where proteins can cooperatively repair the damaged DNA (Burma et al., 2001). γ-H2AX recruits, via MDC1, chromatin modifiers, RNF8 and RNF168, E3 ubiquitin ligases that mark histones with poly-ubiquitin chains near the DSB (Doil et al., 2009; Kolas et al., 2007) . These chromatin marks recruit modifying proteins such as BRCA1 and 53BP1, which help dictate choice in repair pathway (Al-Hakim et al., 2010; Escribano-Díaz et al., 2013).

II.2 Chromatin modifiers

Ubiquitination and (small ubiquitin-like modifier [SUMO]) SUMOylation are processes necessary to orchestrate DSB repair and also ALT (Harding and Greenberg,

2016; Hu et al., 2014; Hu and Parvin, 2014). The E3 ubiquitin (Ub) ligase, FANCL in the

Fanconi anemia (FA) nuclear core complex, catalyzes the transfer of an Ub to its target substrate FANCD2 to regulate its telomere localization (Fan et al., 2009). Interestingly, the protein PML, a main component of APBs, is a tripartite motif (TRIM) protein, which commonly have SUMO E3 ligase activity (Chu and Yang, 2011). It also has a really new interesting gene (RING) domain, a domain commonly found in E3 ubiquitin ligases

(Deshaies and Joazeiro, 2009). Therefore PML may act as both SUMO and Ub E3 ligases, however to date little is known about its E3 ligase activity (Huang et al., 2015).

The most profound effect of protein modifiers in ALT has been observed with studies on the SMC5/6 complex which SUMOylates multiple telomere binding proteins. RNA interference resulted in inhibition of C-circle production and APB formation and telomere shortening and senescence (Henson et al., 2009; Potts and Yu, 2007).

Altogether, ubiquitination and SUMOylation are important for localization of proteins involved in ALT.

II.3 Double-strand break proteins

BRCA1, a protein central to the HR pathway (Figure 4 and Figure 5), was initially implicated in chromosome end maintenance in telomerase-positive activated peripheral T cells from tBrca1-/-p53-/- mice. Lack of BRCA1 expression in these cells resulted in telomere dysfunction represented by increased end-to-end fusions and translocations, as well as increased telomere signal indicating uncapped telomeres

(telomeres no longer protected by shelterin), visualized with telomeric FISH staining of metaphases (McPherson et al., 2006). In ALT cells, BRCA1 colocalizes with APB components Sp100 and PML, with a greater number of colocalizations in S/G2 of the cell cycle, when ALT is likely to occur, over that of telomerase-positive cells (Wu et al.,

2003). In ALT cells, BRCA1 colocalizes with the telomere, and telomere binding protein

TRF1 as well as NBS1 and RAD50 of the MRN complex, with a greater enrichment of colocalization in S/G2 phase of the cell cycle (Acharya et al., 2014; Wu et al., 2003).

BRCA1 depletion also results in a modest decrease in T-SCEs in ALT cells (Gocha et al.,

2014).

RAD51, the recombinase that performs homology search and strand invasion in

HR (Figure 5) (McIlwraith et al., 2000) localizes with APBs and more recently been implicated in the homology search to fix damaged telomeres in ALT cells (Cho et al.,

2014; Wu et al., 2003). Depletion of RAD51 has no effect on C-circle production, which may indicate a disconnect between the role of RAD51 in recombination that occurs to

13 elongate telomeres in ALT cells versus the recombination that takes place in response to

DNA damage at the telomere (Henson et al., 2009). A knockdown of RPA, which in HR stabilizes the single-stranded DNA until RAD51 binds (Liu et al., 2010), in ALT cells resulted in an accumulation of single-stranded telomeric DNA within APBs (Grudic et al., 2007).

Breast cancer type 2 susceptibility (BRCA2) protein is also implicated in chromosome end maintenance, demonstrated by assessing telomere aberrations in

BRCA2-deficient mouse embryonic fibroblasts (MEFs). These cells displayed an increase in telomere end fusions, ends without telomere sequence (signal free ends), anaphase bridges, and telomere dysfunction-induced foci (TIFs) (foci at the end of telomeres that have associated DNA damage response factors such as p53-binding protein 1 (53BP1) or gamma-H2A histone family, member X (γ-H2AX) (Takai et al.,

2003). BRCA2 has a more direct interaction with the telomere during S-phase, as demonstrated by telomeric chromatin immunoprecipitation (ChIP), and also may affect telomere replication as BrdU incorporation into the telomere is decreased upon BRCA2 depletion (Badie et al., 2010; Min et al., 2012; Sapir et al., 2011). A transient depletion of BRCA2 decreases T-SCEs in ALT cells, as in BRCA1-depleted ALT cells, but to a greater extent; no decrease was observed in telomerase-positive cells. In primary and telomerase-positive BRCA2-deficient patient cell lines, there was an increase in T-SCEs.

Together these results suggest BRCA2 may suppress recombination in telomerase- positive/normal cells but promote recombination in ALT cells (Sapir et al., 2011).

Figure 5: Homologous recombination DNA repair pathway. HR is the most accurate form of DSB repair because it uses sequence homology to repair the DNA lesion. In HR-mediated repair, the MRN complex senses DNA damage (Uziel et al., 2003) and recruits the BRCA1-CtIP complex to assist in DSB end resection (Greenberg et al., 2006; Wu and Lee, 2006). This process is a necessary step for subsequent HR-mediated repair of DSBs as it generates a 3′ single-strand overhang which allows the single-stranded binding protein, RPA, to bind (Sugiyama et al., 1997). RPA becomes displaced by several molecules of the recombinase RAD51, held in place on the single-stranded DNA through interactions with BRCA2 BRC repeats (Davies et al., 2001; Greenberg et al., 2006). BRCA1 interacts with BRCA2 at this step through PALB2 (Sy et al., 2009; Zhang et al., 2009). continued

Figure 5 continued The RAD51 recombinase performs strand invasion of a homologous stretch of DNA, often the sister chromatid, during the S- and G2-phases of the cell cycle and serves as a template to prime DNA synthesis (Feng et al., 2013; McIlwraith et al., 2000). This process creates Holliday junction intermediates, a mobile junction that can get resolved by DNA helicases and structure-specific endonucleases (Kikuchi et al., 2013; Raynard et al., 2006). Dissolution of Holliday junctions often results in two intact chromosomes of identical sequences, ensuring fidelity during this process of repair (Pâques and Haber, 1999).

When TRF2 is inhibited, telomeres become uncapped. The DSB DNA repair protein 53BP1 that is involved in NHEJ (Figure 6), localizes to TIFs formed at the deprotected telomeres (de Lange, 2005; Takai et al., 2003). 53BP1 localizes to APBs in

ALT cells but depletion of this protein does not affect APB formation in ALT cells (Jiang et al., 2007). The NHEJ proteins KU70/80 and ligase IV (LIG4) have also been studied in the context of the telomere. There is a requirement for KU70 and LIG4 to prevent telomere fusions upon a TRF2 deletion in TRF2F/- MEFs, which also contain an allele of

TRF2 that can be deleted with Cre–recombinase. TRF2 and KU70 together suppress recombination, as depletion of both these factors increases T-SCEs, however, LIG4 had no significant effect on T-SCEs (Celli et al., 2006).

Figure 6: Non-homologous end joining DNA repair pathway. NHEJ is a DSB DNA repair mechanism that does not depend on sequence homology and therefore is an error-prone pathway. 53BP1 and RIF1 recruitment to DSBs inhibits BRCA1 and CtIP binding, therefore committing the cell to repair the break by NHEJ instead of HR. 53BP1 and RIF1 binding occurs specifically in G1-phase of the cell-cycle when NHEJ is the pathway of choice (Escribano-Díaz et al., 2013). Binding of the DSB by KU70/KU80 heterodimer also prevents the end resection process and recruits DNA- PKcs. DNA-PKcs mediates synapsis of the termini, phosphorylating other NHEJ proteins and cell cycle check-point proteins (Meek et al., 2008; Wu and Lieber 1996). Auto- phosphorylation of DNA-PKcs regulates access of downstream NHEJ proteins to termini ends, such as Artemis, which has endo and exonuclease activity that processes damaged base termini in preparation for ligation (Meek et al., 2008; Pannicke et al., 2004). The XRCC4-LIG4-XPF complex and PNK are recruited to the ends and X family polymerases λ and µ will synthesize new DNA. LIG4 seals the gap (Hefferin and Tomkinson, 2005; Meek et al., 2008).

II.4 RecQ-like helicases

WRN and BLM are RecQ-like DNA helicases that act on replication and recombination intermediates during repair (Kamath-Loeb et al., 2012; Karow et al.,

2000; Mohaghegh et al., 2001; Saintigny et al., 2002). The genome caretaker ability of

RecQ-like helicases lies with the ability of these helicases to disrupt DNA secondary structures that potentially arise during DNA replication, such as telomere G- quadraplexes. They could re-set replication forks that meet an adduct or break in template through roles in branch migration, to perhaps bypass the lesion (Larsen & Hickson, 2013;

Lönn et al., 1990; Mohaghegh et al., 2001; Parkinson et al., 2002; Sun et al., 1998; Yu et al., 2006). BLM and WRN share a similar structure; WRN is unique due to an N-terminal exonuclease domain that can function independently of the helicase domain. There is some evidence that the functions of the WRN helicase and exonuclease domains are coordinated (Kamath-Loeb et al.,1998; Opresko et al., 2001). Defects in BLM and WRN give rise to disorders with distinct characteristics, Bloom’s and Werner’s syndromes, respectively. Both syndromes predispose those affected to cancer, which indicates their importance in maintaining genome integrity (German, 1995; Moser et al., 1999).

BLM interacts with shelterin protein TRF2, as demonstrated through IF and immunoprecipitation studies in late S- and G2/M-phases of the cell cycle (Bhattacharyya et al., 2009; Bhattacharyya et al., 2010; Lillard-Wetherell et al., 2004). In ALT cells,

BLM impacts telomere length in many cell lines; however WRN has a variable impact on telomere length in ALT cell lines (Bhattacharyya et al., 2009; Gocha et al., 2014).

BRCA1 and these helicases interact in ALT cells, in the G2-phase of the cell cycle

(Acharya et al., 2014; Gocha et al., 2014). BRCA1 and WRN collaborate in cellular responses to DNA interstrand cross-links. BRCA1 also interacts with BLM in a large genome surveillance complex of DNA repair proteins that recognizes aberrant replication structures, and stimulates BLM helicase activity (Cheng et al., 2006; Wang et al., 2000).

BRCA1 stimulates BLM helicase activity using a forked telomere substrate to a greater extent in comparison to a non-telomeric forked substrate (Acharya et al., 2014).

II.5 Excision repair

Nucleotide excision repair (NER) (Figure 7), mismatch repair (MMR) (Figure 8) and base excision repair (BER) (Figure 9) pathways have been understudied in the context of the telomere compared to DSB repair. Telomeres experience DNA damage similar to the rest of the genome although, how telomeres repair this damage might be different. Telomeric DNA loops back on itself to prevent the DSB repair machinery from recognizing the ends of the telomere as a DSB, which is facilitated by shelterin proteins.

This loop configuration and many binding proteins may provide challenges for excision repair. TRF1, TRF2 and POT1 augment long-patch BER; these proteins increase flap endonuclease 1 (FEN1) endonuclease activity on flap substrates (Miller et al., 2012).

TRF2 interacts with the structure-specific endonuclease ERCC1/xeroderma pigmentosum, complementation group F protein (XPF), involved in NER. This endonuclease removes G-rich 3′-overhangs at uncapped telomeres (Zhu et al., 2003).

Excision repair has not been comprehensively studied in telomere biology and has been studied very little in the context of ALT telomeres, specifically. The ratio of telomeric DNA to shelterin proteins in ALT cells is different than ratios found in normal

19 or telomerase-positive cancer cells; there is a higher ratio of telomeric DNA to shelterin proteins (Lau et al., 2013). This leads to question of whether this ratio leads to an increase in access to DNA damaging agents. In ALT cells there is also an abundance of abnormal and variant TTAGGG repeats, compared to normal telomeres. These are dispersed throughout ALT telomeres, unlike normal cells where they are constricted to the proximal regions of normal telomeres, which could occur because of HR-mediated telomere replication. ALT telomeres often contain base substitutions and simple intra- allelic expansions and contractions, which presumably engage excision repair pathways

(Allshire et al., 1989; Conomos et al., 2012; Conomos et al., 2013).

Figure 7: Nucleotide excision DNA repair pathway. NER is responsible for removal of single-strand bulky lesions in DNA caused by UV rays, environmental mutagens and chemotherapeutic agents. There are two types of NER, TC-NER, an accelerated repair of lesions that take place in the transcribed strand of active genes and GG-NER, repair of a lesion anywhere in the genome (Schärer, 2013). TC-NER is initiated by stalled RNA polymerase at the lesion in which TC-NER specific factors are recruited, CSA, CSB and XAB2. continued

Figure 7 continued For GG-NER, the initial DNA damage recognition factor is XPC-RAD23B. RAD23B stabilizes XPC, which has an affinity for destabilized duplex DNA, but binds the non- damaged DNA strand which allows a wide variety of bulky lesions or substrates to be recognized (Bergink et al., 2012; Gunz et al., 1996; Sugasawa et al., 2001). XPC- RAD23B binds the TFIIH subunit, XPD, a 5′ to 3′ helicase that translocates along the DNA, opens it and verifies the DNA damage. The second subunit of TFIIH, XPB, is a 3′ to 5′ helicase that uses its ATPase activity to initiate the DNA melting process (Coin et al., 2007; Compe and Egly, 2012; Sugasawa et al., 2009). The interaction of XPD with the DNA allows full assembly of the NER preincision complex; XPC-RAD53B leaves and XPA comes in. XPA is a central component of NER, bringing in all other proteins needed for incision. XPA binds RPA, which binds the non-damaged strand and helps position two endonucleases, ERCC1-XPF and XPG on the damaged strand (de Laat et al., 1998; Matsuda et al., 1995). The first incision is made by ERCC1-XPF, a process that initiates DNA synthesis and the second incision, by XPG, initiates the ligation step (Fagbemi et al., 2011). The single-stranded oligo that is bound by RPA becomes unbound and gets degraded. The DNA synthesis and ligation steps are carried out by a host of DNA polymerases, δ, κ, and ε, some of which are facilitated by the sliding clamp loader PCNA, and DNA ligases I and IIIα (LIG1/3) (Lehmann, 2011; Schärer, 2013).

Figure 8: Mismatch DNA repair pathway. Mismatches in DNA from polymerase mis-incorporation errors result in non-Watson- Crick base pairs and strand misalignments, these can lead to insertion/deletion loops during DNA replication, as well as chemical and physical damage to nucleotides (Jiricny, 2013; Spies and Fishel, 2015). MMR begins with mismatch recognition by heterodimers formed by MSH2/MSH6 (MutSα) or MSH2/MSH3 (MutSβ), which recognize small (one-two nucleotides) or large (two or more) insertion/deletion loops, respectively (Acharya et al., 1996; Gupta et al., 2012; Marsischky & Kolodner, 1999). In the presence of ATP, MSHs may undergo a conformational change to form a long-lived sliding clamp, which then forms a ternary complex with the MLH1/PMS2 (MutLα) (Blackwell et al., 1998; Kadyrov et al., 2006). The processivity factor PCNA is loaded onto the DNA by RFC to form sliding clamps to help anchor polypeptides, allowing downstream processive DNA synthesis to occur. It is also required for endonuclease activation of MutLα, for cleavage of the sugar-phosphate backbone (Iyer et al., 2008; Kadyrov et al., 2006). MMR initiates excision bi-directionally at a site that is distant from the mismatch. This occurs through strand breaks introduced between the 3′-nicked strand and 150 nucleotides past the mismatch by MutLα; the leading strand does not otherwise have ample loading sites for the 5′ to 3′ nucleolytic activity of EXO1. EXO1 degrades the strand with the mismatch. RPA stabilizes the resulting single-stranded DNA until polymerase δ fills in the gap and DNA is ligated by LIG1 (Constantin et al., 2005; Jiricny, 2013). 23

Figure 9: Base excision DNA repair pathway. BER repairs small base lesions that occur from deamination, oxidation or methylation resulting from DNA decay or damage caused by environmental chemicals, radiation, or cytostatic drugs (Krokan and Bjørås, 2013; Lindahl, 1993). BER is initiated by any of eleven DNA glycosylases that recognize specific types of damaged bases, these proteins bind to the minor groove and kink DNA at the site of damage to flip the base out of the major groove, creating an abasic site. These damaged bases are carrying minor lesions that are hidden in undistorted DNA and in the presence of excess normal bases (Huffman et al., 2005; Krokan & Bjørås, 2013). For example, MPG removes bases in which methyl groups have been added at a certain position on a base, like 7-methylguanine, or 3- methyladenine. These adducts are abundant after treatment with alkylating agents, some of which are used as chemotherapy agents (Roy et al., 1996). In the next step of the BER pathway an endonuclease, APE1, creates an incision in the DNA backbone and BER can proceed in two ways: short-patch or long-patch BER. continued

Figure 9 continued Short-patch BER occurs when a single nucleotide gap is generated and DNA polymerase β fills the gap and LIG3 ligates, both with the help of XRCC1. Long-patch BER takes place when a gap of 2-10 nucleotides is generated. DNA polymerase δ/ε fills in the gap, displacing a long single strand flap that is removed by FEN1. Replication protein, PCNA, facilitates the processivity of this process; lastly ligation takes place by LIG1 to seal the DNA (Frosina et al., 1996; Pascucci et al., 1999). Choice of pathway occurs through specification of the initiating glycosylase, availability of BER factors, cell type and proliferation status of the cell (Bauer et al., 2011; Fortini et al., 1999).

Overall, the specific pathways required for ALT TMM(s) are ill-defined. Many

DNA repair proteins have been studied in the context of ALT, however, comprehensive

ALT pathways, which encompass all proteins needed to complete every step of each ALT mechanism, has yet to be identified. ALT studies have indicated that there is likely more than one ALT mechanism and that, with inactivation of certain DNA proteins, other mechanisms may be engaged (Gocha et al., 2014). It is also unclear if all ALT cancer tumor types use the same primary mechanism for telomere elongation. Additional and more comprehensive studies of DNA repair pathways in ALT cells from various tumor types could help answer these remaining questions and provide information needed for the development of ALT-positive cancer therapeutics.

Chapter 2: Thesis Rationale and Research Objectives

In normal somatic cells lacking a TMM, the end of chromosomes cannot be replicated by the non-telomeric DNA replication machinery, leading to telomere shortening, cell senescence or apoptosis. Therefore, TMM activation is essential for cancer cell proliferation and survival. Cancer cells can maintain telomere length with the enzymatic TMM, telomerase, or with a recombination-based TMM termed ALT. ALT is used by 10% of human cancers and could be an alternative TMM used by the majority of cancers that use telomerase following treatment with telomerase inhibitors. ALT mechanism(s) depend on recombination processes and proteins involved in DNA repair, replication, and recombination. Currently, full details of ALT mechanism(s) and its required proteins are unknown. Fully understanding ALT pathway(s) is paramount for cancer biologists and oncologists to develop targeted therapeutics for ALT-positive tumors.

Previous studies have demonstrated that ALT cells likely rely on recombination to elongate telomeres as a DNA tag inserted into a single telomere can be copied to other telomere ends (Dunham et al., 2000). Currently, it is unknown how HR in global genome

DSB repair differs from the recombination processes that occur at ALT telomeres. The overall goal of this work was to determine which HR proteins are involved in ALT and whether proteins in other DNA repair processes are also required. Our previous work

26 determined that the RecQ-like DNA helicase BLM, that functions in early and late stages of HR, is required for ALT (Bhattacharyya et al., 2009; Gocha et al., 2014). BLM localizes to APBs, sites of DNA incorporation, and interacts with telomere-binding proteins in ALT cells during late S- and G2/M-phases of the cell cycle when ALT is likely to occur ( Acharya et al., 2014; Lillard-Wetherell et al., 2004). A second RecQ-like helicase, WRN, has a role in ALT and interacts with a third protein, BRCA1, also critical for HR (Gocha et al., 2014). BRCA1 interacts with BLM and WRN in ALT cells and stimulates the in vitro helicase activities of BLM on telomere substrates. Our work also demonstrated that BRCA1 and BLM both interact with RAD50, in the MRN complex

(Acharya et al., 2014). MRN is required for ALT and participates in end resection processing of HR substrates (Lamarche et al., 2010). MRN, BRCA1 and BLM are important for the early HR step of end resection, a critical step in committing the cell to repair of a DSB via HR rather than NHEJ (Chen et al., 2008; Larsen & Hickson, 2013). It seems that these proteins likely play important roles in ALT, as they do in HR.

HR in global genome repair, and thus most likely in ALT, requires homology search and invasion of template DNA. RAD51 initiates movement of a damaged telomere to another chromosome for templated repair in ALT cells, although depleting RAD51 has no effect on an ALT-specific characteristic known as a C-circle (Cho et al., 2014; Henson et al., 2009). Therefore, to test the hypothesis that requisite proteins of HR would be required for ALT, we tested other proteins that facilitate strand invasion using the ALT specific CC assay. Using siRNAs, we individually depleted BRCA1 associated RING domain 1 protein (BARD1), BRCA2, partner and localizer of BRCA2 protein (PALB2)

27 and BRCA1, which binds these three proteins at the invasion step of HR. To determine whether depletion affected ALT, we measured the abundance of C-circles, circular and mostly single-stranded C-rich ECTR DNAs, using the CC assay that amplifies C-circles to a detectable level by Southern blot. We tested other non-HR DSB proteins, including

53BP1 and LIG4 that function in NHEJ, a HR-opposing DSB pathway of DNA repair, and ring finger protein 8 (RNF8) and ring finger protein 168 (RNF168) that function in protein recruitment preceding HR and NHEJ. Lastly, we tested one protein from each of three other excision-based DNA repair pathways: xeroderma pigmentosum, complementation group A (XPA), mutS homolog 2 (MSH2) and N-methylpurine DNA glycosylase (MPG), involved in NER, MMR and BER, respectively. Our experiments demonstrated that only some HR proteins have a role in ALT, that proteins in NHEJ do not affect ALT activity, and that surprisingly, proteins involved in excision-based DNA repair pathways are required for ALT.

Chapter 3: Differential Requirements for DNA Repair Proteins in Cell Lines Using Alternative Lengthening of Telomere Mechanisms

I. Introduction

Telomeres are chromatin structures at chromosome ends that are critical for maintaining genomic integrity in normal somatic cells. Telomeres consist of TTAGGG

DNA repeats and a protein complex known as shelterin, that binds telomeric DNA to prevent recognition of the ends by the DNA repair machinery. Telomeres will shorten with every DNA replication cycle until the telomere becomes “too short” and triggers cellular senescence or apoptosis. In germ cells and somatic stem cells, the enzyme telomerase lengthens telomeres to counteract the loss of DNA sequences that occurs with

DNA replication. In tumors, activation of TMMs confers immortality.

There are at least two broad categories of TMMs, one that uses the enzyme telomerase and a second category of recombination-based mechanisms known as ALT

(Dunham et al., 2000; Murnane et al., 1994). Some tumors are composed of a mixture of cells using one or the other mechanism (Gocha et al., 2013), while some mouse models of cancers suggest a fluidity, shifting between these TMMs (Chen et al., 2010; Hu et al.,

2012). Expression of telomerase is associated with de novo synthesis of telomeres and is activated in the majority of tumors. A subset of tumors maintains telomeres in the absence of telomerase and uses ALT. Cells in these tumors display distinct characteristics such as heterogeneous telomere lengths (Bryan et al., 1995), APBs (Yeager et al., 1999),

29 increased T-SCEs (Bechter et al., 2004; Londoño-Vallejo et al., 2004), and the abundance of linear and circular, single-stranded or double-stranded, ECTR DNA

(Cesare and Griffith, 2004; Ogino et al., 1998). One type of ECTR DNA, a C-circle, correlates precisely with ALT in 38 different immortalized human ALT-positive cells lines. C-circles are present when other ALT phenotypes disappear, no telomerase expression is measured and telomere length is maintained (Henson et al., 2009).

Although ALT cells have distinct phenotypes, the exact mechanisms of ALT are not fully understood. Evidence suggests that recombination is the primary method for

ALT telomere elongation (Draskovic and Londono Vallejo, 2013). A unique DNA sequence integrated into the telomeric region of a chromosome can be propagated, over time, to telomeric regions of other chromosomes which can result in an increased number of tagged telomeres per ALT cell (Dunham et al., 2000). This could occur through intertelomeric exchanges and/or when an adjacent chromosome with a longer telomere is used as a template to extend a short telomere. Circular ECTR DNAs could be used as substrates for RCA as described in yeast (Nosek et al., 2005). RCA of C-circles could enable rapid increases in telomere length and would explain the heterogeneous telomere length phenotype in ALT cells. Intratelomeric elongation could occur by copying the telomere loop, using a sister chromatid as a template or by unequal T-SCE between a short and longer sister chromatid to allow the short sister chromatid to gain telomere length (Muntoni et al., 2009).

Telomere elongation by ALT is likely facilitated by a network of DNA repair proteins. The MRN complex senses and processes DSBs to initiate repair and is required

30 for ALT (Zhong et al., 2007). Sequestration of MRN inhibits APB formation and facilitates telomere shortening (Jiang et al., 2005; Zhong et al., 2007). Other DNA repair proteins that may facilitate ALT, implicated by their presence at telomere synthesis sites in APBs include RAD51, RAD52, RPA, BRCA1, RAP1, WRN and some of the Fanconi anemia proteins (Fan et al., 2009; Gocha et al., 2014; Wu et al., 2003; Yeager et al.,

1999). Chromatin-associated proteins such as alpha thalassemia/mental retardation syndrome X-linked protein (ATRX), death domain-associated protein (DAXX) and H3.3

(Heaphy et al., 2011; Schwartzentruber et al., 2012), expression of non-coding telomeric repeats-containing RNAs (TERRA) (Arora et al., 2014), nuclear receptors (Conomos et al., 2012; Conomos et al., 2014), and proteins involved in meiotic recombination pathways are also associated with ALT (Cho et al., 2014).

Our previous studies have demonstrated that RecQ-like DNA helicase BLM is required for ALT, in addition to MRN, and that the HR protein BRCA1 associates with

BLM to promote ALT activities (Acharya et al., 2014; Bhattacharyya et al., 2009; Gocha et al., 2014; Lillard-Wetherell et al., 2004). In this study, we tested the requirement for

BRCA1 in ALT cell lines using C-circle abundance as an ALT marker (Henson et al.,

2009) and expanded the survey to include a total of thirteen DNA repair proteins. siRNA knockdowns were used to reduce protein expression in human ALT cell lines. BRCA1 knockdown reduced C-circles in five ALT cell lines, although we found that some of the other requisite HR proteins did not alter the C-circle phenotype. NER, MMR, and BER proteins were also evaluated, these excision-based DNA repair proteins were required for maintenance of high levels of C-circles in some ALT cell lines. These results expand the

31 scope of previous studies and show that ALT is not a single process and some mechanisms of ALT depend upon DNA repair proteins in excision DNA repair pathways.

II. Materials and methods

Cell lines

ALT cell lines, U-2 OS, Saos-2 and WI-38 VA-13 subline 2RA were obtained from

ATCC as well as the telomerase-positive cell line, HeLa (Manassas, VA). G-292 and

JFCF-6/T.1J/1-3C cell lines were kindly provided by Roger Reddel (Bryan et al., 1997;

Ng et al., 2009). Saos-2, U-2 OS and G-292 are ALT cell lines derived from human osteosarcomas; WI-38 VA-13/2RA is an ALT cell line derived from human lung fibroblasts; JFCF-6/T.1J/1-3C is an ALT cell line derived from jejunal fibroblasts from a cystic fibrosis patient; HeLa is a telomerase-positive cell line derived from a human cervical adenocarcinoma. All cell lines were maintained in Dulbecco’s Modified Eagles

Medium (DMEM; Thermo Fisher), with the exception of U-2 OS cells which were maintained in McCoy’s 5A Medium (Thermo Fisher), supplemented with 10% FBS

(Hyclone) and grown at 37⁰C, 5% CO2.

siRNA knockdown

The list of siRNAs and the sources of the siRNAs used in these experiments are listed in

Table 1. siRNAs were transfected into cultured cells in triplicate using Dharmafect 1 transfection reagent (GE Healthcare Dharmacon) at a final concentration of 50 nM. Cells were treated with two rounds of siRNA transfection 48 hours apart and DNA was collected for C-circle assays 72 hours following the second transfection.

Western blots

Whole cell extracts were prepared from each cell line using NP-40-containing lysis buffer

(50 mM Tris-Cl pH 8.0, 150 mM NaCl, 1% NP-40, 1 mM phenylmethylsulfonyl fluoride,

1x mammalian protease inhibitor cocktail [Sigma]). The following primary antibodies were used for western blotting: anti-BRCA1 OSU246 (specific to 400–1,100 amino acid region) (Towler et al., 2013); anti-BRCA1 (Ab-1) (Calbiochem); anti-lamin B (Santa

Cruz). Secondary antibodies used were: horseradish-peroxidase conjugated goat-anti- mouse, rabbit-anti-goat (Jackson ImmunoResearch Laboratories), goat-anti-rabbit (Cell

Signaling).

qRT PCR assays

RNA extracts were collected using Trizol reagent (Ambion) and RNA reverse transcribed using RNase OUT at 40 U (Invitrogen), Oligo dT at 0.5 ug (Invitrogen), Superscript II reverse transcriptase at 200 U (Invitrogen) per 1 ug of total RNA. cDNA (20 ng) was analyzed by quantitative PCR with primers (900 nM) in Table 1 and 1x Power Sybr

Green Master Mix (Applied Biosystems). Most primers have been used in previous publications and shown to be specific (Table 1). PCR reactions were performed on

Applied Biosystems StepOnePlus Real Time PCR machine. The quantitative ΔΔCT

Method was used to analyze data.

C-circle assays

Total DNA was extracted using the “DNeasy Blood & Tissue Kit” (Qiagen) and treated with 0.5 ug/ul Rnase (Sigma). DNAs were analyzed for C-circles as previously described

(Henson et al., 2009). Briefly, 50 ng (Saos-2, U-2 OS), 100 ng (G-292 and JFCF-

6/T.1J/1-3C), or 200 ng (WI-38 VA-13/2RA) of total DNAs were digested with HinfI and

RsaI restriction enzymes followed by ExoI/ExoV/λExo nucleases (New England Biolabs).

Half of the digested DNAs were subjected to the CC assay; C96 synthetic C-circle served as a positive control; water and lambda DNA served as the negative controls. Digested

DNA, 400 ng total DNA for input, and the C-circle amplified products were dot-blotted onto a nylon positively charged membrane (Hybond, GE Healthcare) and cross-linked

32 twice using a Strategene UV Stratalinker 2400. An end-labeled P-(CCCTAA)3 probe was hybridized to membrane in Ultrahyb-Oligo Hybridization Buffer (Ambion) rotating at 42⁰C. Membranes were washed with 2x SSC, 0.5 % SDS at 42⁰C and exposed to a phosphor screen (GE) overnight and imaged on a Typhoon FLA 7000 imager.

Telomere sister chromatid exchange assays

CO-FISH was performed as described previously to detect T-SCEs and intertelomeric exchanges with minor adaptations (Williams et al., 2011). Transfected cells were treated with 3:1 BrdU/C at 10 µM for 18 hours (MP Biomedicals) and treated with colcemid at

0.1 ug/mL for 4 hours (Roche). Cells were collected, treated with hypotonic solution (75 mM KCl) for 30 minutes at 37⁰C and fixed in 3:1 methanol: acetic acid. Metaphase spreads were prepared and stained as previously described. Slides were hybridized with a fluorescent probe, Alexa 488-labeled PNA (TTAGGG)3 at 0.05 uM (PNA Bio Inc.) in a hybridization cocktail of 70% formamide/2x SCC for 2 hours at 37⁰C in a dark, moist chamber. Slides were washed once with 1x PBS, 0.1%Tween (Sigma) for 5 minutes followed by hybridization of Cy3-labeled PNA (CCCTAA)3 probe 0.05 uM in hybridization cocktail (PNA Bio Inc.) for 3 hours. Slides were washed two times in 1x

PBS, 0.1%Tween at 55⁰C for 10 minutes, shaking and four times in 2x SSC, 0.1%Tween, shaking. Slides were then rinsed in deionized water, air-dried and mounted with

VectaShield DAPI (Vector Labs). Twenty metaphase spreads were analyzed per experiment, for a total of 60 metaphase spreads in three independent experiments, per treatment group. Samples were analyzed using a Zeiss AxioVert 200 M with an attached

AxioCam MRm camera and coded to blind the reader.

Homology-directed repair assays

Homology-directed repair (HDR) assays were performed as previously described

(Ransburgh et al., 2010). Briefly, HeLa cells with stably-integrated HDR GFP substrate

(HeLa-DR) were transfected with siRNAs on day 1 using Oligofectamine 2000 (Life

Technologies); cells were transfected on day 3 using Lipofectamine 2000 (Life

Technologies) with siRNAs and a plasmid expressing the I-SceI endonuclease to initiate a

DSB break. On day 5, flow cytometry was used to count the percent GFP-positive cells to correlate DNA repair competency.

Statistical analyses

Data were objectively compared between samples in the control group and samples in each experimental treatment group using a two-sided Welch’s t-test (unpaired and unequal variance) to determine significance (*, ** and *** represent p ≤ 0.05, p ≤ 0.01, and p ≤ 0.001, respectively).

Table 1. Sequence of siRNAs and quantitative PCR primers Quantitative PCR primers siRNA sequence or source Forward primer Reverse primer GL2: 18S rRNA F: 18s rRNA R: 5′CGUACGCGGAAUACUUCGA3′ 5′AATCAGGGTTCGATTCCGGA3′ 5′CCAAGATCCAACTACGAGCT3′ (Hu et al., 2014) (Hashimoto et al., 2004) (Hashimoto et al., 2004) BRCA1 5787: 5′GCUCCUCUCACUCUUCAGU3′ BRCA1 exon 11/12 F: BRCA1 exon 11/12 R: (Ransburgh et al., 2010) 5′AAGAGGAACGGGCTTGGAA3′ 5′CACACCCAGATGCTGCTTCA3′ BRCA1 2616: (Fustier et al., 2003) (Fustier et al., 2003) 5′GGUUUCAAAGCGCCAGUCA3′ (Sankaran et al., 2005)

BARD1: BARD1 exon 3/4 F: BARD1 exon 3/4 R: 5′AGCUGAAUAUUAUACCAGA3′ 5′CAATGAGCTGTCAGATTTGAAAG 5′CGAGGGCTAAACCACATTTTAA (Lee et al., 2015) AA3′ (Y.Q. Zhang et al., 2012) TT3′ (Y.Q. Zhang et al., 2012)

BRCA2-2: BRCA2 exon 12/13 F: BRCA2 exon 12/13 R: 5′GGAGGACUCCUUAUGUCCAAAU 5′GAAAATCAAGAAAAATCCTTAAA 5′GTAATCGGCTCTAAAGAAACAT UUA3′ (Ransburgh et al., 2010) GGCT3′ (Fustier et al., 2003) GATG3′ (Fustier et al., 2003) PALB2 169: PALB2 exon 12/13 F: PALB2 exon 12/13 R: 5′CUGAUCUUGGAUGUACAUU3′ 5′TGGGTGTGATGCTGTACTGT3′ 5′CCAGCCAGCAAATGAGAGTC3′ (self-designed) (self-designed) (self-designed) BLM: BLM F exon 3/4 F: BLM R exon 3/4 R: Silencer Pre-designed Human BLM 5′GAATGGTTAAGCAGCGATG3′ 5′TCAATACATGGAACTTTCTCAG3 siRNA (AM16704; Ambion) (De Luca et al., 2013) ′ (De Luca et al., 2013) WRN: WRN exon 34/35 F: WRN exon 34/35 R: ON-TARGETplus Human WRN siRNA- 5′GACAGCGGACTTCAACCTTC3′ 5′TTGGCAAACCACACAGGTAA3′ SMARTpool (L-010378; Dharmacon) (Yee et al., 2012) (Yee et al., 2012) RNF8: RNF8 exon 1/2 F: RNF8 exon 1/2 R: 5′GGACAAUUAUGGACAACAA3′ 5′GGTGCGAGGTGACTGTAGGAC3′ 5′GGGCAGATTTTTGATACCAGTT (Hu et al., 2014; F. Zhang et al. 2012) (Bonanno et al., 2013) G3′ (Bonanno et al., 2013) RNF168: RNF168 exon 2/3 F: RNF168 exon 2/3 R: 5′GGCGAAGAGCGAUGGAGGA3′ 5′TCAGCCAGTTCGTCTGCTCAGT3′ 5′TCTTCTTCCTCGCTGGCCCGT3′ (Galanty et al., 2009; Hu et al., 2014) (Gatti et al., 2015) (Gatti et al., 2015) 53BP1: 53BP1 exon 4/5 F: 53BP1 exon 4/5 R: 5′GAAGGACGGAGUACUAAUA3′ 5′GTCAGGTCATTGAGCAGTTACCTC 5′TCCTCCACAGCAGGAGCAG3′ (Galanty et al., 2009; Hu et al., 2014) 3′ (Bonanno et al., 2013) (Bonanno et al., 2013) LIG4: LIG4 F: LIG4 R: 5′AGGAAGUAUUCUCAGGAAUUA3′ 5′CACCTTGCGTTTTCCACGAA3′ 5′CAGATGCCTTCCCCCTAAGTTG (Galanty et al., 2009; Hu et al., 2014) (Liang et al., 2008) 3′ (Liang et al., 2008) XPA: XPA exon 4/5 F: XPA exon 4/5 R: ON-TARGETplus XPA siRNA 5′CACAATGGGGTGATATGAAACTC 5′CCTTTGCTTCTTCTAATGCTTCT SMARTpool (L-005067; Dharmacon) TACT3′ (Nymoen et al., 2015) TGACT3′ (Nymoen et al., 2015) MSH2: MSH2 exon 13/14 F: MSH2 exon 13/14 R: ON-TARGETplus Human MSH2 siRNA 5′GGACTGCATCTTAGCCCGAGTAG 5′GCCCATGCTAACCCAAATCCAT SMARTpool (L-00399; Dharmacon) G3′ (Ahmadi et al., 2015) CG3′ (Ahmadi et al., 2015) MPG: MPG exon 4/5 F: MPG exon 4/5 R: 5′AAGAAGCAGCGACCAGCUAGA3′ 5’CTTCTGCATGAACATCTCCAGC3′ 5′AGGGTGCTGCGAAGCTGACGC3′ (Ström et al., 2011) (Song et al., 2012) (Song et al., 2012)

III. Results

BRCA1 depletion in five ALT cell lines decreases C-circles, a quantifiable marker of ALT

BRCA1 functions in the HR pathway (Table 2) and localizes to telomeres in

ALT-positive cells, APBs and with proteins implicated in ALT, including NBS1, RAD50 and BLM (Acharya et al. 2014; Conomos et al., 2014; Gocha et al., 2014; Wu et al.

2003;). To determine if BRCA1 affects ALT, C-circle levels were evaluated in BRCA1- depleted ALT cells. C-circles are C-rich single-stranded circles of telomeric DNA with a

(TTAGGG)n primer and these C-circles are specific and quantifiable markers of ALT activity that can be used as a substrate for extending telomeres (Henson et al., 2009).

Phage phi29 DNA polymerase in the CC assay amplifies the C-circles to a detectable level for quantification by Southern blot or qPCR (Henson et al., 2009; Lau et al., 2013).

An advantage of using the CC assay is that C-circle half-life is short, changes in ALT activity can be detected within 24 hours after protein depletion. Other ALT assays, such as measurement of changes in heterogeneous telomere lengths, requires numerous cell line passages; measuring changes in APBs and T-SCEs requires many steps for staining, imaging and counting cells. For these reasons, the CC assay was chosen as the screening method for the discovery of ALT effectors.

We chose to begin by re-examining the role of BRCA1 in ALT. Five ALT cell lines were used in testing BRCA1 as an ALT effector: p53-null osteosarcoma tumor cell line, Saos-2; p53-positive osteosarcoma tumor cell line, U-2 OS; SV40-transformed lung fibroblast cell line, WI-38 VA-13 subline 2RA (herein named VA-13); jejunal fibroblast cell line from a cystic fibrosis patient, JFCF-6/T.1J/1-3C (referred to as JFCF-6/1-3C); 37 mutant p53 osteosarcoma tumor cell line G-292. Successful depletion of BRCA1 protein in each ALT cell line was confirmed by comparing control siRNA-treated samples to the

BRCA1-siRNA treated samples on a western blot (Figure 10A). The CC assay was used to assess changes in C-circle levels in BRCA1-depleted compared to control-treated ALT cells. Representative CC assay dot blots (Figure 10B) show that every ALT cell line has a different C-circle amount when comparing control siRNA-treated samples from each cell line. A dot-blotted telomerase-positive HeLa sample demonstrates how telomerase- positive cell lines have low levels of C-circles, which are below the detection level by dot blots. Depletion of BRCA1 decreased C-circles in all ALT cell lines (JFCF-6/1-3C and

G-292, data not shown) but had no detectable effect on C-circles in the HeLa telomerase- positive cell line (Figure 10B).

Figure 10: Depletion of BRCA1 reduces C-circles in five ALT cell lines but not in a telomerase-dependent cell line. (A) Following two rounds of siRNA transfection targeting either the BRCA1 mRNA or luciferase (control), protein extracts were analyzed by immunoblotting with antibodies specific for BRCA1 (top) and lamin B as a loading control (bottom). continued 39

Figure 10 continued (B) Representative dot blots of CC assay products. Total DNA extracted from control siRNA or BRCA1 siRNA-treated samples from 3 ALT cell lines and 1 telomerase-positive cell line (HeLa) were subjected to restriction and exonuclease digestion and DNA (25 ng) was subjected to the CC assay and dot blotting (bottom left). Total DNA (400 ng) was blotted to demonstrate equal input for the assay (top left). Controls included in the CC assay were dot-blotted: positive control C-96 synthetic C-circle (C96) and negative controls, no DNA (dash) and lambda DNA (λDNA; bottom right). (C) Phosphorimager quantitation of C-circle abundance in 5 ALT cell lines. The results from three independent experiments are presented as a fold-change in C-circle signal relative to the signal obtained in the control. Black bars, control siRNA average; Gray bars, BRCA1 siRNA average; error bars, standard error; *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, determined by Welch’s t-test. (D) Representative C-circle dot blot after depletion of BRCA1 in VA-13 cells. Dot blot displays three independent C-circle experiments with controls which represents how each CC assay was typically performed. Total DNA is dot-blotted to show equal loading (top to bottom lanes 1, 3, 5); digested DNA represents DNA that has been digested by restriction enzymes HinfI and RsaI and exonucleases but not subjected to the CC assay (coordinates: top to bottom lanes 2, 4, 6/left to right lanes 1 and 3); CC assay products represents fully digested DNA subjected to the CC assay (coordinates: top to bottom lanes 2, 4, 6/left to right lanes 2 and 4); controls that were included for the CC assay was no DNA, lambda DNA, and a synthetic C96 C-circle (top to bottom lane 7, in order as listed, left to right).

Quantitation of C-circle levels upon BRCA1 depletion, in both osteosarcoma cell lines Saos-2 and U-2 OS, shows BRCA1 depletion reduces C-circles approximately 2- fold compared to controls and is statistically significant (p = 0.010, p = 0.041, respectively) (Figure 10C). In the ALT cell line with the lowest levels of C-circles, VA-

13 (Figure 10B), there was an approximate 50-fold reduction in C-circle abundance, which was statistically significant (p = 1.077 x 10-4) (Figure 10C and Figure 10D). A 3- fold and 1.75-fold reduction in C-circles was also observed in a fibroblast ALT cell line

JFCF-6/T.1J/1-3C and an additional osteosarcoma cell line, G-292, respectively (Figure

10C). Both of these reductions were statistically significant (p = 0.047 and p = 0.003,

40 respectively). BRCA1 depletion using a second, non-overlapping siRNA was performed in Saos-2 and VA-13 cells (Figure 11A) and yielded similar results (Figure 11B). Our results suggest that BRCA1 is required for C-circle formation in five ALT cell lines, which suggests that it may be a required protein for ALT mechanisms.

Figure 11: Knockdown of BRCA1 using a second siRNA reduces C-circles in ALT cell lines and confirms previous experiments. (A) Immunoblot following two rounds of transfections using BRCA1-specific siRNA 2616 was probed with antibodies specific to BRCA1 (top) and lamin B (as loading control, bottom). (B) Quantitation of C-circle abundance in two ALT cell lines. The results from three independent experiments are presented as C-circle signal relative to control. Black bars, control siRNA average; Gray bars, BRCA1 siRNA average; error bars, standard error; **p ≤ 0.01, ***p ≤ 0.001, determined by Welch’s t-test.

ALT cells do not depend on all requisite homologous recombination proteins for telomere maintenance although requirements differ between ALT-positive cell lines

HR proteins required for ALT may differ from HR protein requirements. We continued with the CC assay to test whether other requisite HR proteins, BARD1,

BRCA2 and PALB2 may have a role in ALT. Depletions were performed in three ALT cell lines by siRNA-mediated targeting. In Saos-2 cells, siRNAs for all three targets reduced mRNA expression 3.5-fold or more (p < 0.05) (Figure 12A). Surprisingly,

BARD1 depletion, a protein that heterodimerizes with BRCA1 (Table 2) (Wu et al.,

1996), does not significantly affect C-circle levels in Saos-2 cells (p = 0.069) (Figure

12B). BRCA1 and BRCA2 interact via the protein PALB2 in order to recruit the recombinase RAD51 to facilitate recombination in HR (Sy, et al., 2009; Zhang et al.,

2009). BRCA2 reduction in Saos-2 did not decrease C-circles significantly (p = 0.081), however, depletion of PALB2 in Saos-2 cells resulted in a significant, 2-fold reduction of

C-circles (p = 0.001) (Figure 12B). Together, these results indicate that in the Saos-2 osteosarcoma cell line select HR proteins affect ALT activity. HR proteins BRCA1 and

PALB2 significantly affect C-circles in Saos-2 cells, while other HR proteins, such as

BARD1 and BRCA2, have little effect.

Figure 12: Depletion of homologous recombination proteins BARD1, BRCA2, PALB2 or WRN in ALT cells do not alter C-circle abundance. Following two rounds of siRNA transfection, cells were collected and analyzed for effectiveness of siRNA targeting by measuring mRNA abundance. continued 43

Figure 12 continued (A) (C) (E) Changes in mRNA expression of targeted genes were determined by quantitative PCR (qPCR) shown as the average relative to the control ± standard error of the mean (SEM) from three or more independent experiments. All knockdowns significantly reduce expression (p < 0.05) as compared to control, determined by Welch’s t-test. (B) (D) (F) Quantitation of C-circle levels after knockdown of HR gene products. The averages from three independent experiments are presented normalized to the signal obtained by the control. Gray bars, averages of three or more experiments for each single HR product knockdown; error bars, standard error; *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, determined by Welch’s t-test.

The siRNAs targeting the HR protein encoding mRNAs in U-2 OS and VA-13 cells were effective in significantly reducing expression levels by 2-fold or more (p <

0.05) (Figures 12C and 12E). Depletion of BARD1 or BRCA2 in U-2 OS and VA-13, like Saos-2, did not significantly affect C-circle levels (p = 0.429/p = 0.289; p = 0.280/p

= 0.610, respectively) (Figures 12D and 12F). In contrast to Saos-2 cells, depletion of

PALB2 in U-2 OS and VA-13 cells did not significantly affect C-circle levels (p = 0.712; p = 0.069, respectively) (Figures 12D and 12F) which suggests select HR proteins may be required for ALT in some but not all ALT cell lines. Collectively, these data demonstrate that some requisite HR proteins, namely BARD1 and BRCA2, are disposable for ALT activity. Taken together, the BARD1 and BRCA1 results were striking, the function of BRCA1 in ALT seems to be independent of BARD1. These two proteins are generally considered to function interdependently in HR (Chiba and Parvin,

2001; Lee et al., 2015; Li and Yu, 2013).

WRN, a RecQ-like DNA helicase similar in structure to BLM with an additional exonuclease domain and that also prevents aberrant HR (Table 2), is involved in ALT

44 processes (Chu and Hickson, 2009; Gocha et al., 2014). Reduced expression of WRN in

Saos-2, U-2 OS and VA-13 cells (Figures 12A, 12C, and 12E) was associated with an increase in C-circles in Saos-2 and U-2 OS, although this increase was not significant (p

= 0.116; p = 0.199, respectively) (Figures 12B and 12D). C-circle levels were relatively similar to control in VA-13 cells (p = 0.462) (Figure 12F). RNF8 and RNF168 are E3 ubiquitin ligases that function in a signaling cascade to recruit DNA DSB repair proteins to DNA lesions, including BRCA1 and 53BP1 (Table 2) (Doil et al., 2009; Kolas et al.,

2007; Mailand et al., 2007). RNF8 and RNF168 were targeted by siRNAs in three ALT cell lines (Saos-2, U-2 OS and VA-13). A 3.7-fold or greater decrease in mRNA expression of RNF8 and RNF168 was achieved in Saos-2, U-2 OS and VA-13 cells (p <

0.05) (Figures 13A, 13C, and 13E). The CC assay revealed that depletion of RNF8 or

RNF168 had no impact on the levels of C-circles in the osteosarcoma ALT cell lines tested, Saos-2 and U-2 OS (p = 0.381/p = 0.447; p = 0.250/p = 0.276, respectively)

(Figures 13B and 13D). Strikingly, however, in VA-13 cells the depletion of the RNF8 decreased C-circle levels significantly by 6-fold and the depletion of RNF168 decreased

C-circle levels significantly by 3-fold (p = 1.049 x 10-3; p = 0.015, respectively) (Figure

13F). These results indicate that the ubiquitin ligases RNF8 and RNF168 may function in

ALT in some ALT cell types.

Figure 13: Depletion of RNF8 or RNF168 lowers C-circle levels in VA-13 cells and depletion of NHEJ proteins does not alter C-circle abundance in Saos-2, U-2 OS or VA-13 cells. Depletions and analyses were done as in Figure 12. (A) (C) (E) The change in mRNA expression of ubiquitin ligase and NHEJ products were analyzed by qPCR; averages in mRNA expression relative to the control ± standard error of the mean from three or more independent experiments. All knockdowns were significant (p < 0.05) compared to control, determined by Welch’s t-test. continued 46

Figure 13 continued (B) (D) (F) Quantitation of C-circle levels after knockdown of ubiquitin ligase and NHEJ products. Results from three independent experiments are presented normalized to the signal obtained in the control transfection. Gray bars, averages of three or more experiments for each single ubiquitin ligase and NHEJ product knockdown; error bars, standard error; *p ≤ 0.05, **p ≤ 0.01, determined by Welch’s t-test.

Non-homologous end joining proteins are not critical for ALT

HR and NHEJ are two pathways by which a DSB can be repaired. To test whether

NHEJ contributes to ALT, two NHEJ proteins were each knocked down in three ALT cell lines (Saos-2, U-2 OS and VA-13) and C-circles were evaluated. The mRNA expression levels of 53BP1, a key regulator in NHEJ that has crosstalk with BRCA1, and

LIG4, the DNA ligase needed for one of the final steps of NHEJ repair (Table 2)

(Baumann and West, 1998; Bunting et al., 2010), were also significantly knocked down in these three ALT cell lines, as detected by qPCR (p < 0.05) (Figures 13A, 13C, and

13E). The CC assay indicated that depletion of 53BP1 or LIG4 had no significant effect on the levels of C-circles in Saos-2, U-2 OS and VA-13 cell lines tested (p = 0.519/p =

0.741; p = 0.438/p = 0.660; p = 0.084/p = 0.051, respectively) (Figures 13B, 13D, and

13F), suggesting that NHEJ proteins have a minimal role in ALT, if at all.

Nucleotide excision repair, DNA mismatch repair, and base excision repair proteins can contribute to ALT

Depletion of proteins in excision DNA repair pathways, defined as repair pathways that remove and replace damaged/mismatched DNA using the preserved complementary strand as a template, were also evaluated for functions in ALT. siRNA

47 transfection targeted three proteins activated at early steps in three different pathways:

XPA in NER, MSH2 in MMR and DNA glycosylase MPG in BER. For NER, XPA organizes the assembly of an NER complex at the incision site in both transcription- coupled (TC)-NER and global genome (GG)-NER (Table 2) (Schärer, 2013). For MMR,

MSH2 forms a complex with either mutS homolog 6 (MSH6) or mutS homolog 3

(MSH3) to scan DNA for a base mismatch or long insertions/deletions, respectively

(Acharya et al. 1996). For BER, MPG cleaves N-glycosidic bonds to allow damaged bases to flip out and create an apyrimidinic/apurinic site (Roy et al., 1996). All three siRNAs significantly reduced mRNA expression levels by 2-fold or more in Saos-2 cells

(p < 0.05) (Figure 14A). Targeting XPA or MPG in Saos-2 cells had little effect on C- circle levels, as C-circle abundance was similar to that of the control cells (p = 0.821; p =

0.429, respectively) (Figure 14B). Targeting MSH2 significantly decreased C-circles

2.5-fold in Saos-2 cells (p = 0.023).

Figure 14: Depletion of XPA, MSH2 or MPG lowers C-circle levels in U-2 OS and VA-13 cells. Depletions and analyses were done as in Figure 12. (A) (C) (E) The change in mRNA expression of XPA (NER), MSH2 (MMR) or MPG (BER) gene products were determined by qPCR from three or more independent experiments. All knockdowns were significant (p < 0.05) compared to control, determined by Welch’s t-test. continued

Figure 14 continued (B) (D) (F) Quantitation of C-circle levels after knockdown of XPA (NER), MSH2 (MMR), and MPG (BER) gene products. Results from three independent experiments are presented relative to the signal obtained by the control. Gray bars, averages of three or more experiments for each single XPA, MSH2 and MPG product knockdown; error bars, standard error; *p-value ≤ 0.05, **p ≤ 0.01, ***p-value ≤ 0.001, determined by Welch’s t-test.

In U-2 OS and VA-13 ALT cell lines, depletion of each of these proteins had different effects than in Saos-2 cells. XPA, MSH2 and MPG mRNA expression levels were significantly reduced by 5.5-fold or more upon treatment with siRNAs (p < 0.05)

(Figures 14C and 14E). Depletion of XPA, MSH2 or MPG significantly reduced the abundance of C-circles in U-2 OS and VA-13 cell lines (p = 0.031/p = 0.036/p = 0.012; p

= 0.003/p = 0.001/p = 0.003, respectively) (Figures 14D and 14F). This result suggests that multiple DNA repair pathways are involved in ALT: HR, NER, MMR and BER.

Also surprising was that the NER protein XPA and the BER protein MPG was important for maximal ALT activity in U-2 OS and VA-13 cells but was not critical in the Saos-2

ALT cell line. These results suggest that there are multiple ALT mechanisms, which use unique sets of proteins, and that each ALT cell line may use a different mechanism.

MSH2 stimulates intertelomeric exchanges in U-2 OS ALT cells and MSH2 and MPG affect homology-directed repair in HeLa cells

Next we asked whether recombination substrates, other than C-circles, may be affected by depletion of excision-based DNA repair proteins. An mRNA depletion of

XPA, MSH2 or MPG was performed in U-2 OS ALT cells (Figure 15A) and then these cells were analyzed using CO-FISH. Changes in T-SCEs involving two sister chromatids

50 and intertelomeric exchanges involving one sister chromatid, can be visualized with this technique (Figure 15B) (Conomos et al., 2014). We counted 60 metaphases and found that depletion of MSH2 resulted in a 6% reduction in the average percent of intertelomeric exchanges per metaphase (p = 0.020) (Figures 15B-15D) and a trend of decreased average percent T-SCEs per metaphase compared to control (Figures 15B-15C and 15E). Depletion of the NER protein XPA or the BER protein MPG did not significantly alter average intertelomeric exchanges or T-SCEs per metaphase compared to control (Figures 15D and 15E), similar to the observations by Hagelstrom et al. following XPF reduction (2010). MSH2 was the only protein among those tested to stimulate two recombination events expected to occur in ALT, intertelomeric exchanges and recombination with C-rich ECTR circular DNA (C-circles).

Figure 15: Depletion of MSH2, XPA or MPG lowers intertelomeric exchanges in U-2 OS cells. Cells were transfected with two rounds of the appropriate siRNAs, as was done in Figure 12; slides were coded to “blind” measurements. continued 52

Figure 15 continued (A) Quantitation by qPCR of targeted mRNAs in each transfection. All knockdowns were significant (p < 0.05) compared to control, determined by Welch’s t-test. (B) Representative images of an intertelomeric exchange (one yellow signal) and T-SCE event (two yellow signals). (C) Representative metaphase spreads of control and MSH2; arrows indicate intertelomeric exchanges, arrow heads indicate T-SCEs. (D) Quantitation of intertelomeric exchanges in U-2 OS cells, displayed as a density plot with each circle representing a metaphase, is plotted along the y-axis to indicate the % average intertelomeric exchanges within that cell. A total of 60 metaphase spreads were counted for each treatment group, 20 metaphases were counted per each independent experiment in which 3 independent experiments were performed. The red bar indicates where the mean falls among the 60 metaphases counted for each treatment group; p-values determined by Welch’s t-test. (E) Quantitation of T-SCEs in U-2 OS cells displayed as a density plot, with each circle representing a metaphase, is plotted along the y-axis to indicate the % average T-SCEs within that cell. A total of 60 metaphase spreads were counted for each treatment group, 20 metaphases were counted per each independent experiment in which 3 independent experiments were performed. The red bar indicates where the mean falls among the 60 metaphases counted for each treatment group; p- values determined by Welch’s t-test.

To test the roles of XPA, MSH2, and MPG in HDR siRNA-mediated depletions

(Figure 16A) were carried out in a HeLa-derived cell line, called HeLa-DR, which contains an genome-integrated recombination substrate (GFP) that allows HDR to be measured (Ransburgh et al., 2010). Depletion of the positive control, BRCA1, resulted in a 15-fold decrease in HDR compared to control (p = 1.471 x 10-4) (Figure 16B).

Depletion of XPA had little effect on HDR compared to control (p = 0.511). MSH2 or

MPG depletion generated 2-fold and 3-fold decreases in HDR, respectively, compared to controls (p = 1.405 x 10-3; p = 0.008, respectively) (Figure 16B). These effects on HDR were surprising given MSH2 and MPG classification as MMR and BER proteins, respectively.

Figure 16: Depletion of MSH2 (MMR) or MPG (BER) proteins decrease homology- directed repair (HDR). HeLa-DR cells (Ransburgh et al., 2010) were transfected with the appropriate siRNA for luciferase (control), BRCA1, XPA, MSH2 or MPG. (A) Quantitation by qPCR of targeted mRNAs in each transfection. All knockdowns were significant (p < 0.05) compared to control, determined by Welch’s t-test. (B) Measurement of GFP-positive cells determined by flow-cytometry and normalized relative to the control transfected cells. Gray bars represent the average HDR in the indicated experimental group relative to control, from three independent experiments, with the exception of BLM and WRN data obtained from two independent experiments, provided by Tapahsama. Banerjee; error bars, standard error; **p ≤ 0.01, ***p ≤ 0.001, determined by Welch’s t-test.

IV. Discussion

ALT relies upon HR and DNA repair proteins to maintain telomere length

(Bhattacharyya et al., 2009; Dunham et al., 2000; Lillard-Wetherell et al., 2004; Muntoni and Reddel, 2005; Murnane et al., 1994; Stavropoulos et al., 2002; Wu et al., 2003). In this study, we asked whether this process depends upon both requisite HR proteins and non-HR DNA repair proteins. CC assays measured C-circles, as responsive and specific markers of ALT activity (Henson et al., 2009). Our results demonstrated that: 1) many requisite HR proteins were not required for ALT; 2) MMR protein MSH2 contributes to two possible recombination events that could occur in ALT, recombination with C-circles and intertelomeric exchanges; 3) DNA repair proteins that function in NER, MMR or

BER are required to promote C-circles in some cell lines; 4) ALT cell lines differ in their requirement for specific DNA repair proteins in ALT processes.

This study first evaluated BRCA1 in ALT. BRCA1 functions in homology- directed DSB repair (Scully et al., 1996; Towler et al., 2013). In telomerase-positive cells, BRCA1 inhibits telomerase activity in transfection studies, while its loss induces telomerase (Ballal et al., 2009; Xiong et al., 2003). In ALT cells, BRCA1 localizes to telomeres and APBs and its depletion slightly reduces T-SCEs (Acharya et al., 2014; Cho et al., 2014; Gocha et al., 2014; Wu et al., 2003). In this study, we found that BRCA1 depletion in five ALT cell lines decreases C-circle levels. Altogether, there is strong evidence to support a role for BRCA1 in ALT mechanisms.

While some requisite HR proteins such as BRCA1 and RAD51 have been evaluated in ALT, others have yet to be characterized (Cho et al., 2014; Henson et al.,

2009; Potts and Yu, 2007; Yeager et al., 1999). Our results show that depletion of

BARD1, the heterodimeric protein partner of BRCA1, has no effect on C-circles, even though BARD1 strongly impacts HDR (Laufer et al., 2007; Lee et al., 2015; Westermark et al., 2003). The HR protein BRCA2, a known binding partner of RAD51 (Liu et al.,

2010; Moynahan et al., 2001), also had no effect on C-circles. However, PALB2, a protein that bridges BRCA1 and BRCA2 (Sy et al., 2009; Zhang et al., 2009) significantly decreases C-circle levels in Saos-2 cells but not in the other cell lines tested.

These data suggest that PALB2 has an activity in ALT that is BRCA2-independent. Other requisite HR proteins evaluated here for effects on C-circles suggest that the HR pathway utilized in ALT cancer cells diverges considerably from the characteristic HR pathway.

BLM was used as a positive control as it is required for ALT (Bhattacharyya et al., 2009; Bhattacharyya et al., 2010; Mendez-Bermudez et al., 2012). BLM depletion decreases C-circles in all cell lines tested. Depleting each of two NHEJ proteins has no significant effect on C-circle abundance in all ALT cell lines tested. Previous studies showed 53BP1 is not necessary for APB formation (Jiang et al., 2007), although it localizes to TIFs in ALT cells (Cesare et al., 2009). Depletion of the E3 ubiquitin ligases,

RNF8 or RNF168, that mark the chromatin site of DNA DSBs and locate to TIFs in normal cells, did not affect C-circles in Saos-2 or U-2 OS cells but were important in

VA-13 cells (Al-Hakim et al., 2010; Jacobs, 2012). These results suggest that RNF8 and

RNF168 may have a role in some ALT mechanisms.

In all ALT cells tested here, depletion of MSH2 had an effect on ALT activity.

MMR deficiencies that increase microsatellite instability (MSI) may be incompatible

56 with ALT due to disruption of the MRN complex (Giannini et al., 2002; Muntoni and

Reddel, 2005). However, deficiencies in MMR can initiate ALT and are correlated with

ALT in some tumor types (Bechter et al., 2004; Omori et al., 2009). We were also surprised to observe an effect on ALT by depletion of the NER or BER proteins, XPA and MPG, respectively, in VA-13 and U-2 OS cells. As depletion did not alter T-SCEs or intertelomeric exchanges in the U-2 OS cell line, these proteins may facilitate the use of one substrate such as C-circles, over another, such as an adjacent chromosome, to elongate telomeres. Overall, our results suggest that proteins in DNA repair pathways, other than HR, contribute to ALT mechanisms.

Lastly, the use of more than one ALT cell line in these studies illuminates the complex requirements for DNA repair proteins in ALT. PALB2 is uniquely required for

ALT in Saos-2 cells, RNF8 and RNF168 are uniquely required for ALT in VA-13 cells, and NER and BER proteins XPA and MPG, respectively, were required for ALT in

VA13 and U-2 OS. These results are summarized in Table 2. These data highlight the complexity of ALT mechanisms and imply the flexibility with which cells can employ recombination-associated telomere elongation mechanisms. Consequently, approaching

ALT therapeutically may warrant combinatorial therapies that are mechanism-specific.

As in BRCA1-deficient breast cancers that utilize poorly-defined alternative pathways to become resistant to PARP inhibitors (Jaspers et al., 2013), ALT cancers may be able to do the same.

Table 2. Summary of data from DNA repair depletions and C-circle measurements in ALT cells p-value DNA repair C-circle fold- siRNA target Function in pathway Cell line (bold = pathway change ± SEM significant) Saos-2 1.00 N/A Control U-2 OS 1.00 (GL2) VA-13 1.00 RAD51 recruitment, DSB repair, end resection Saos-2 0.46 ± 0.08 0.0196 (Scully et al., 1997; Moynahan et al., 1999; BRCA1 U-2 OS 0.38 ± 0.11 0.0285 Schlegel et al., 2006) VA-13 0.26 ± 0.08 0.0128 Forms E3 Ub ligase with BRCA1 Saos-2 0.74 ± 0.07 0.0690 BARD1 (Wu et al., 1996; Hashizume et al., 2001; Lee et al., U-2 OS 0.91 ± 0.10 0.4288 2015) VA-13 1.65 ± 0.49 0.2796 RAD51 recruitment, DSB repair Saos-2 0.55 ± 0.14 0.0806 BRCA2 (Chen et al., 1998; Moynahan et al., 2001) U-2 OS 1.44 ± 0.31 0.2887 VA-13 0.82 ± 0.32 0.6096 HR Mediates interaction between BRCA1 and BRCA2 Saos-2 0.42 ± 0.04 0.0008 PALB2 for RAD51 recruitment U-2 OS 0.84 ± 0.38 0.7115 (Sy et al., 2009; Zhang et al., 2009) VA-13 0.31 ± 0.19 0.0691 End resection, branch migration and dissolution of Saos-2 0.29 ± 0.15 0.0399 BLM Holliday Junctions (+ control) (Chu and Hickson, 2009) U-2 OS 0.13 ± 0.03 0.0012 VA-13 0.17 ± 0.06 0.0007 Absence results in aberrant HR; promotes branch Saos-2 1.50 ± 0.19 0.1162 migration of Holliday Junctions WRN U-2 OS 2.57 ± 0.83 0.1992 (Chu and Hickson, 2009) VA-13 0.80 ± 0.24 0.4624 E3 Ub ligase, initiates signaling cascade for DSB Saos-2 1.42 ± 0.38 0.3811 proteins; recruits 53BP1 and BRCA1 RNF8 U-2 OS 2.70 ± 1.06 0.2495 (Mailand et al., 2007; Kolas et al., 2007) VA-13 0.16 ± 0.03 0.0010 HR & NHEJ E3 Ub ligase, initiates signaling cascade for DSB Saos-2 1.45 ± 0.48 0.4472 repair proteins; recruits 53BP1 RNF168 U-2 OS 2.06 ± 0.71 0.2757 (Doil et al., 2009) VA-13 0.34 ± 0.08 0.0149 Binds DSB ends and prevents extensive end Saos-2 1.69 ± 0.89 0.5193 resection 53BP1 U-2 OS 4.00 ± 3.13 0.4382 (Iwabuchi et al., 2003; Bunting et al., 2010) VA-13 1.38 ± 0.12 0.0839 NHEJ Performs final step, ligation, to repair the DSB Saos-2 1.21 ± 0.56 0.7411 (Baumann and West, 1998) LIG4 U-2 OS 0.88 ± 0.16 0.6597 VA-13 2.08 ± 0.42 0.0507 Recognizes and recruits NER proteins to damage Saos-2 0.93 ± 0.27 0.8205 site; involved in both GG & TC-NER NER XPA U-2 OS 0.44 ± 0.14 0.0314 (Schärer, 2013) VA-13 0.32 ± 0.08 0.0029 Heterodimerizes with MSH6 and MSH3, binds to Saos-2 0.38 ± 0.15 0.0234 DNA mismatch and initiates downstream MMR MMR MSH2 U-2 OS 0.36 ± 0.18 0.0359 events (Acharya et al., 1996) VA-13 0.35 ± 0.07 0.0006 Methyl purine DNA glycosylase, severs glycosidic Saos-2 1.81 ± 0.82 0.4290 bond of damaged methylated purine BER MPG U-2 OS 0.33 ± 0.12 0.0124 (Roy et al., 1996) VA-13 0.57 ± 0.07 0.0031 58

Chapter 4: Thesis Summary and Future Directions

I. Thesis summary

The human cell maintains genomic stability through many processes, such as the ability to initiate DNA repair following genotoxic stress, or through telomeric protection of chromosomal DNA. Maintaining genomic stability is key to preventing neoplastic transformation. Paradoxically, some human cancer cells exploit DNA repair processes to enable telomere lengthening and replicative immortality, a key hallmark of cancer. This mechanism is called ALT. It is understood that ALT cancer cells use DNA or RNA templates and recombination to elongate the telomere instead of telomerase. We sought to understand ALT pathways by depleting DSB proteins and evaluating ALT using the

ALT specific CC assay (Figure 17).

Our initial hypothesis was that the proteins coordinating the strand-invasion step of HR would be required for ALT. BRCA1 heterodimerizes with BARD1, while BRCA2 interacts with BRCA1 through PALB2. All four of these proteins facilitate RAD51-based strand invasion (Chen et al., 1998; Hashizume et al., 2001; Lee et al., 2015; Moynahan et al., 2001; Moynahan et al., 1999; Scully et al., 1997; Sy et al., 2009; L. C. Wu et al.,

1996; Zhang et al., 2009). BRCA1, BARD1, PALB2 or BRCA2 were depleted in ALT cells to determine their effects on ALT using the CC assay. We found that BARD1 and

BRCA2 did not affect ALT and that PALB2 did not affect ALT in the majority of ALT

59 cell lines. However, BRCA1 affected ALT in multiple cell lines. We did not test RAD51, as it had already been tested in the CC assay by Henson et al. (2009) and is not required for ALT. As BRCA1 participates in earlier steps of HR such as end resection (Feng et al.,

2013), other end resection HR proteins have been tested in ALT studies and are required for ALT, such as NBS1 and BLM (Bhattacharyya et al., 2009; Bhattacharyya et al.,

2010; Chen et al., 2008; Chu & Hickson, 2009; Gocha et al., 2013; Zhong et al., 2007).

Other proteins required for the strand invasion and DNA synthesis steps for the recombination-based mechanism of telomere elongation (ALT) have yet to be identified.

DSBs are repaired by HR or by the NHEJ pathway. We decided to test the effects of depleting proteins in NHEJ such as 53BP1 which begins the pathway and opposes key

HR proteins and LIG4, the ligating factor that is required to complete NHEJ (Baumann and West, 1998; Bunting et al., 2010). Our prediction was that these proteins would not contribute to ALT, as NHEJ primarily takes place in G1-phase of the cell cycle, whereas

ALT occurs primarily in S/G2-phase of the cell cycle. Indeed, depleting these proteins did not affect ALT in our assay. We also sought to test proteins that act upstream of both

DSB DNA repair pathways, proteins which mark chromatin by ubiquitination for recruitment of DSB repair proteins. Depletion of the ubiquitin E3 ligases, RNF8 or

RNF168, that recruit proteins from both DSB pathways requiring 53BP1 and BRCA1

(Doil et al., 2009; Hu et al., 2014; Kolas et al., 2007; Mailand et al., 2007), only affected

ALT in one ALT cell line.

In our studies, we also tested proteins involved in NER, MMR and BER using our

ALT-specific CC assay. We hypothesized that these proteins would have no effect on

ALT activity since they fix DNA breaks independently of recombination. Surprisingly, depleting XPA, which coordinates proteins for both TC-NER and GG-NER (Schärer,

2013), affected ALT activity in two out of three ALT cell lines. Depletion of the BER protein MPG, a methyl purine glycosylase (Roy et al., 1996), had similar effects. Also surprising was that MSH2, a MMR protein that repairs both single and multiple mismatches (Acharya et al., 1996; Gupta et al., 2012; Kadyrov et al., 2006) affected ALT in all three ALT cell lines tested. Depletion of MSH2 also affected intertelomeric exchanges in the one ALT cell line tested. These data suggest that these excision-based repair proteins warrant further studies in ALT cells to determine whether their functions were independently important for ALT or if entire excision-based repair pathways contribute to ALT.

Figure 17: Variant requirements for DNA repair proteins in ALT. Summary of the findings in this study. Green indicates Saos-2 cell line; pink indicates U- 2 OS cell line; orange indicates VA-13 cell line; blue indicates the protein group that each individually siRNA targeted protein that affects ALT belongs to; gray indicates proteins that affect ALT as measured by C-circle abundance. Underlined proteins are continued 62

Figure 17 continued proteins which affect ALT that were common among all ALT cell lines tested. Non- underlined proteins indicate the differences in protein requirements among cell lines. The X indicates that no proteins tested in that group affect ALT.

II. Future directions

Further studies to define a plausible role for excision-based repair pathway proteins in ALT could determine how ALT mechanism(s) work and how to trigger cancer cell apoptosis or senescence. Less is known about the role of excision-based repair proteins at the telomere and even less in ALT. The focus of ALT studies have primarily been on proteins that contribute to HR following experiments showing that a DNA tag inserted in one telomere becomes copied to other telomeres of non-homologous chromosomes in human ALT cells. This indicates that ALT is a HR-based mechanism of telomere elongation. However, our data and that of others have shown only some requisite HR proteins are implicated in ALT. Data also suggests that ALT could be an aberrant form of HR with the flexibility to employ a variety of DNA repair proteins to perform telomere elongation. NER and BER proteins contribute to the production of C- circles, a template used to elongate the telomere specifically in ALT cells. MSH2 may contribute to C-circle formation and to telomere elongation that uses another chromosome to add on telomere length.

Telomeres are made up of TTAGGG repeats that form a “t-loop”, facilitated by a protein complex called shelterin. This structure of the telomere prevents activation of the

DNA damage response. Curiously, there are many DNA repair proteins that interact with

63 shelterin at the telomere (de Lange, 2005; Matulić et al., 2007; Zhu et al., 2000). To date, little is known about how these protein-DNA complexes affect the ability of DNA repair proteins to repair lesions that occur at the telomere. Furthermore, there is evidence that shows that telomeres in ALT cells exhibit an altered state of heterochromatin, alterations in chromatin remodelers, and different telomere sequences that could affect the binding ability of shelterin proteins. Manipulation of mouse telomeric and subtelomeric heterochromatin, or loss of heterochromatin marks in mice, lead to phenotypic characteristics of ALT (Benetti et al., 2007; García-Cao et al., 2004; Gonzalo et al.,

2006). Recently, studies have found a large subset of ALT tumors with mutations in

ATRX or DAXX genes, (encoding SWI/SNF family of chromatin remodelers). Depletion of the histone chaperone ASF1 initiates ALT (Bower et al., 2012; Heaphy et al., 2011;

Lovejoy et al., 2012; O’Sullivan et al., 2014; Schwartzentruber et al., 2012) . ALT cells also have a greater range of variant telomeric sequences throughout the telomere, in comparison to telomerase-positive or normal cells. Overall these characteristics of ALT cells suggest that the ALT telomere is in a more open configuration (Conomos et al.,

2012; Lee et al., 2014).

A more open chromatin structure at the telomere in ALT cells, in comparison to normal or telomerase-positive cancer cells, could affect the susceptibility of the ALT telomere to DNA damage. It could also affect the ability of DNA repair proteins to access the ALT telomere in order to fix DNA lesions. Understanding the role of excision-based repair pathways in ALT would give a much needed and better understanding of the role of excision-based repair pathways in telomere biology in general. A better understanding

64 of how excision repair pathways work in normal cells, telomerase-positive cells, and

ALT cells might ultimately have a significant impact on understanding how these cell populations respond differently to chemotherapeutic agents that cause DNA damage.

Our results indicate excision-based repair proteins are involved in ALT processes.

Are the effects of excision repair proteins on telomere maintenance direct or indirect? Do they interact with templates of recombination, promote functions of other proteins required for TMMs, or have indirect effects through replication? Are all protein components of each excision repair pathway involved or is a specific class of proteins needed for telomere elongation in ALT? Answers could be used as a target for ALT therapeutics alone or in combination with HR-based ALT therapeutics. In order to understand the role of the excision-based proteins implicated in ALT and to understand other components of the excision repair pathways in ALT, we propose three new aims:

Aim 1. Determine XPA (NER), MSH2 (MMR) and MPG (BER) telomeric interactions in order to ascertain the telomeric substrates of these proteins in ALT cells.

Aim 2. Identify a role for XPA, MSH2 and MPG in telomeric replication in order to discover a functional role for these proteins at the telomere in ALT cells.

Aim 3. Identify the involvement of other NER, MMR and BER proteins in ALT to discern whether entire excision-based pathways of repair contribute to ALT mechanisms.

Aim 1. Determine XPA (NER), MSH2 (MMR) and MPG (BER) telomeric interactions in order to ascertain the telomeric substrates of these proteins in ALT cells.

We have observed that depletion of XPA, MSH2 and MPG proteins normally involved in the NER, MMR and BER excision repair pathways, lead to depletion of C- circles, a specific and quantifiable marker of ALT activity (Henson et al., 2009).

However, it is unclear if this effect on C-circles is a direct effect on C-circle formation.

Molecular techniques such as IF/FISH and ChIP assays will be used to determine possible telomeric substrates of XPA, MSH2 and MPG. We hypothesize that XPA, MSH2 and MPG do not bind directly to the ECTR DNA, C-circles, but interact with chromosomal telomeric DNA.

Objective 1.1 Perform on slide amplification of C-circles and concurrent immunofluorescence and fluorescence in situ hybridization to determine whether XPA, MSH2 and MPG colocalize with C-circle substrates.

Experimental approach. The first experiments in aim 1 will seek to determine whether effects of XPA, MSH2 and MPG on C-circles are through more direct interactions with these substrates. IF/FISH in combination with RCA of C-circles on metaphase spreads will be performed in order to test whether XPA, MSH2 and MPG localize to C-circles in

ALT cells. Metaphase spreads will be generated for two ALT cell lines, a fibroblast lung cell line VA-13 and an osteosarcoma p53-positive cell line, U-2 OS. A telomerase- positive cell line HeLa will be used as a negative control for C-circle amplification.

Slides will be prepared for combined IF and telomere FISH on metaphase spreads as established by Cesare et al. (Support protocol 1; Cesare et al., 2015) with the following adaptation after the ethanol dehydration step and after IF protocol is complete, on-slide

RCA will be performed as described by Li et al. (Li et al., 2005). After on-slide RCA,

FISH will be continued per Cesare et al. but without the denaturation step. IF will be performed using XPA, MSH2, and MPG antibodies, and no antibody for negative control. For RCA reaction, slides will be included in which no phi29 polymerase is added to the on-slide reaction. The FISH probe will be a Cy3-labeled (TTACCC)3 PNA probe.

MRE11 IF, combined with FISH will be used as a positive control (Cesare et al., 2009).

Expected results, interpretation, possible pitfalls. We expect that there will be little localization of XPA, MSH2 or MPG with amplified C-circles, as the effects on C-circle abundance may be through replication. We expect to see strong signals with telomeric

FISH. ECTR DNA may be able to be observed without amplification, as foci near but not on the ends of the chromosomes, although this could also be a result of non-specific binding of the FISH probe to the slide. On-slide amplification of C-circles and comparison to a slide in which no phi29 polymerase was added, will give greater confidence of a positive signal, although false-positive signals are still possible. If XPA,

MSH2 or MPG localizes with C-circles, a yellow signal will be obtained. This technique will also determine whether XPA, MSH2, and MPG are located at the telomere, an advantage over performing telomeric-FISH in interphase cells since XPA, MSH2 and

MPG have diffuse staining in the absence of DNA damage agents. Since this is a new application of two existing protocols, optimization of time of amplification and time of annealing probes will be assessed.

Objective 1.2 Determine whether XPA, MSH2 or MPG binds telomeric DNA in ALT cells by telomeric ChIP.

Experimental approach. The second experiments in aim 1 will seek to determine whether

XPA, MSH2 and MPG could bind chromosomal telomeric DNA, which may suggest a more direct role for these proteins at the telomere. Telomeric ChIP will be performed in

ALT cells in order to test this objective. ALT cells will be crosslinked and lysed; lysates will be sonicated to generate DNA fragments. XPA, MSH2 and MPG antibodies will be used for chromatin immunoprecipitation of resulting DNA fragments. TRF2 and IgG antibodies will be used for positive and negative control antibodies, respectively. DNA will be dot-blotted onto a nylon membrane; telomere and Alu repeat element DNA probes will be hybridized (Ballal et al., 2009). Further studies of excision DNA repair protein telomere binding will be conducted using ChIP-seq to determine specific sites within the telomere region in which XPA, MSH2 and MPG could bind.

Expected results, interpretation, possible pitfalls. It is expected that XPA, MSH2, MPG and TRF2 but not IgG will pull down telomeric DNA. Lack of detectable Alu repeat

DNA after immunoprecipitation will indicate specificity of protein binding. The telomeric DNA detected on the ChIP telomere dot blot is expected to be a majority of telomeric DNAs attached to chromosomes as ECTR DNA quantity in a cell is low in comparison, which is why they must be amplified in a CC assay. ChIP-seq experiments will determine binding sites for excision-based DNA repair proteins within telomeres.

Distinguishing between subtelomere and telomere binding might provide a greater understanding of the role of XPA, MSH2 or MPG at the telomere. If excision-based DNA repair proteins play a role in replication, they would be expected to locate to the 68 subtelomeric region as replication of the telomere begins here (Chakhparonian and

Wellinger, 2003). It is possible that these proteins are not abundant at the telomere with a low level of metabolic DNA damage, DNA damage agents may need to be added to cells before cell collection for ChIP.

Aim 2. Identify a role for XPA, MSH2 and MPG in telomeric replication in order to discover a functional role for these proteins at the telomere in ALT cells.

NER, MMR and BER are DNA repair pathways that help maintain genomic stability by fixing errors before DNA replication is complete. Telomere structure differs from the remainder of the genome, suggesting that telomeric replication is different than genomic replication. DNA replication at the telomere may be a dynamic process by which DNA unloops and shelterin proteins are removed before replication can take place. Given the repetitive nature of the telomere and the propensity of G4 quadraplexes, it is likely that telomeres experience replication stress at a higher frequency. Understanding the role of

NER, MMR and BER protein components in telomere replication would contribute to answering how replication at the telomere is different than at the rest of the genome.

Furthermore, the ALT telomere has differences in heterochromatic state, the functioning of chromatin remodelers at the telomere, and variant sequences, compared to the telomere in normal or telomerase-positive cells, which could influence DNA replication. Our hypothesis is that XPA, MSH2 and MPG will differ in their effects on telomere replication as compared to telomerase-positive cells.

Objective 2.1 Determine if XPA, MSH2, and MPG colocalizes with sites of telomere synthesis using IF and BrdU incorporation techniques.

Experimental approach. The first experiment in aim 2 will seek to determine whether

XPA, MSH2 and MPG colocalizes with sites of telomere synthesis in ALT cells, which may suggest an involvement of these proteins in telomere replication or elongation.

Experiments will test colocalization of XPA, MSH2 or MPG with BrdU in APBs using

IF and BrdU incorporation techniques. APBs are nuclear foci found in ALT cells but not in telomerase-positive or normal cells. These foci contain shelterin proteins, DNA replication and repair proteins and telomeric DNA. Most likely APBs are sites for DNA replication and repair as BrdU is incorporated into APBs in late S/G2-phase of the cell cycle (Wu et al., 2000). Colocalization studies will be performed in VA-13 and U-2 OS

ALT cells, and HeLa telomerase-positive cells. Cells will be subjected to a double thymidine block and labeled with BrdU for 30 min at 13 h post-release. Subsequently, cells will be fixed and stained for BrdU and XPA, MSH2 or MPG together with PML and

TRF1 as a marker for APBs, or telomeric DNA in general (for telomerase-positive cells).

Confocal microscopy will be used in IF studies.

Expected results, interpretation, possible pitfalls. We expect to see that XPA, MSH2 and

MPG colocalize with BrdU and PML in ALT cells more than observed with BrdU and the telomere (FISH) in telomerase-positive cells. Given that XPA, MSH2 and MPG may have diffuse staining in the absence of DNA damage, DNA damaging agents may be added to increase positive-foci in the assay. Results will determine if NER, MMR and

BER proteins are associated with telomere synthesis.

Objective 2.2 Determine whether XPA, MSH2 or MPG depletion affects telomeric replication using an immunofluorescent DNA fiber technique.

Experimental approach. The second experiment in aim 2 will aim to discover what effect depletion of XPA, MSH2, or MPG could have on telomere replication in ALT cells. An immunofluorescent DNA fiber technique will be used to visualize telomeric replication affects after protein depletion. XPA, MSH2 and MPG will be depleted singly using siRNAs in VA-13 and U-2 OS ALT cell lines, and a HeLa telomerase-positive cell line.

BLM/WRN will be depleted together as a positive control. These depleted cells will be pulse-labeled with IdU and then CldU nucleotide analogues. Cells will be resuspended in

PBS and spotted on glass slides. Lysis buffer will be added to the slides for 10 mins and slides will be tilted to stretch DNA fibers by gravitational flow. The stretched DNA will be fixed and denatured and the slides will be blocked with BSA (Jackson and Pombo,

1998; Saldivar et al., 2012). The fixed DNA will be hybridized overnight with a biotinylated subtelomeric DNA FISH probe, prepared by nick translation in the presence of biotin-16-dUTP to identify the specific telomeric/subtelomeric segments. A biotin- labeled telomeric PNA probe will be hybridized to the G-rich strand to identify the telomeric segment. After hybridization, the slides will be blocked and FISH probes will be detected by incubating with Alexa Fluor 350–conjugated avidin followed by two rounds of incubation with a biotinylated anti-avidin antibody and then again with the

Alexa Fluor 350–conjugated avidin. The two incorporated, halogenated nucleosides will be visualized by indirect immunostaining, during the second round of FISH detection, using a mouse anti-IdU monoclonal antibody and a rat anti-CldU monoclonal antibody followed by Alexa Fluor 568 anti–mouse and Alexa Fluor 488 anti–rat antibodies. After 71 immunostaining, coverslips will be mounted on slides with antifade mounting medium.

Fluorescence microscopy and a camera will be used to take pictures of fibers. The images will be analyzed using appropriate analysis software (ie. Image J) to measure length

(correlates to speed of replication) and frequency of different replication structures

(Drosopoulos et al., 2015; Nieminuszczy et al., 2016).

Expected results, interpretation, possible pitfalls. We expect to see DNA fibers in the

XPA-, MSH2- or MPG-depleted samples that are visually different from that of the siRNA-control treated samples. Immunofluorescent DNA fiber assays allows direct visualization of the progression of individual replication forks within cells at telomeres and provides quantitative information on various aspects of DNA synthesis, such as replication fork processivity (replication speed), fork stalling, origin usage and fork termination. These results are visualized as different patterns of green and red IF along the fiber; telomeric sequence will be visualized by blue IF. Drosopoulous et al. has demonstrated that BLM/WRN-deficient cells display a reduction in telomere length: more than 20 % of molecules should show no IdU labeling in the telomere indicating the

G-rich telomere strand is replicated solely by lagging strand copying (Drosopoulos et al.,

2015). Replication defects may not be observed by depletion of XPA, MSH2 or MPG alone; therefore DNA damage agents may be explored in conjunction with depletion of these factors. These results will contribute to understanding how telomere replication or telomere replication stress is handled at the telomere, and by comparison to a telomerase- positive cell line, will determine how excision DNA repair factors differ in effecting replication in ALT cells.

Aim 3. Identify the involvement of other NER, MMR and BER proteins in ALT to discern whether entire excision-based pathways of repair contribute to ALT mechanisms.

ALT cells rely on a concerted effort from a host of proteins: DNA damage sensors, DNA damage signaling and cell cycle checkpoint proteins, mediator proteins, nucleases and helicases to perform telomere lengthening. However, the list of necessary proteins to carry out ALT mechanisms is incomplete, for example the polymerases needed to perform second-strand synthesis for templated mechanisms or the human polymerase that could perform RCA have not yet been identified. Proteins needed to carry out excision- based DNA repair have been sparsely studied in the context of the telomere. In order to predict which proteins that belong to NER, MMR or BER repair pathways may be involved in ALT, a screen of the protein members of these pathway will be performed.

Objective 3. Identify other excision-based DNA repair proteins that could contribute to ALT using the C-circle assay.

Experimental approach. C-circle levels will be measured upon single depletions of excision-based repair proteins in ALT cells in order to identify the select proteins or entire excision-based pathways of repair that could contribute to ALT mechanisms. The

CC assay will be used to test the effects of depleting key NER, MMR and BER repair proteins on C-circle levels in U-2 OS and VA-13 ALT cell lines. To start exploring the

NER pathway in ALT, the proteins ERCC1/XPF will be depleted, as they remove G-rich

3′ overhangs in cells in which TRF2 has been inhibited (Zhu et al., 2003). XPC and CSB will also be depleted, as they are involved in GG-NER and TC-NER, respectively. For

MMR, proteins, MSH3 and MSH6, that independently heterodimerize with MSH2, will be tested, as they recognize large and small insertion/deletion loops, respectively. For 73

BER, Polβ, FEN1 and APE1 will be depleted as shelterin proteins stimulate the activities of these proteins in long-patch BER on telomeric substrates (Miller et al., 2012;

Muftuoglu et al., 2006). Positive-controls in our assay will be XPA, MSH2, and MPG as tested previously.

Expected results, interpretation, possible pitfalls. We expect to see that depletion of

ERCC1/XPF will have an effect in ALT cells as ALT cells may have more deprotected telomeres in which could allow ERCC1/XPF to bind its G-rich substrate better.

Determining the effects of XPC or CSB will define whether one or both NER pathways are important in ALT cells. We expect that TC-NER might play a role in ALT as there are elevated levels of long noncoding RNA telomeric repeat-containing RNAs (TERRA) in ALT cells that are capable of forming DNA-RNA hybrids which may be tied to the recombinogenic potential of ALT cells (Arora et al., 2014; Azzalin et al., 2007; Lovejoy et al., 2012). As MSH2 independently affects C-circle abundance in a few ALT cell lines, depletion of its protein partners will determine whether MSH2 works independently in

ALT cells or if results will look similar in protein partners of MSH2 indicating these proteins work together as in genomic repair. Polβ, FEN1 and APE1 BER repair proteins are predicted to affect C-circle formation in ALT cells as these proteins physically interact with shelterin proteins. Time and resources permitting, other excision-based

DNA repair proteins will be screened using the CC assay to determine if entire excision- based pathways of repair are involved in ALT.

III. Significance of understanding mechanisms of ALT

Although ALT is implicated in about 10% of cancers, it is most prevalent among cancers of mesenchymal origin such as osteosarcomas and soft-tissue sarcomas, tumor types that often afflict children and in which treatment progress has long been slow. It is also common in glioblastoma multiforme, the most common and aggressive type of brain tumor that occurs in adults (Bryan et al., 1997; Costa et al., 2006; Hakin-Smith et al.,

2003; Henson et al., 2005; Jeyapalan et al., 2008; Lafferty-Whyte et al., 2009; Villa et al., 2008). Both ALT and telomerase are TMMs that promote immortalization; current evidence suggests that specific TMM is associated with prognosis and response to treatment in select cancer types (Costa et al., 2006; Ferrandon et al., 2013; Ulaner et al.,

2004). In liposarcomas, ALT is associated with a poor clinical outcome (Costa et al.,

2006; Venturini et al., 2010). In vivo mouse studies suggest that tumors treated with telomerase inhibitors can adapt and trigger ALT activation. Some human tumors have been found to utilize both telomerase and ALT TMMs (Bryan et al., 1997; Henson and

Reddel, 2010; Hu et al., 2012; Gocha et al., 2013). Furthermore, current studies including the aforementioned, indicate ALT may encompass more than one mechanism of telomere elongation. Our previous work suggests that ALT cell lines could engage “alternative”

ALT mechanisms to compensate for loss or deficiencies in function of select DNA repair proteins (Gocha et al., 2014). This work suggests that the requirement for DNA repair proteins in ALT differ between ALT cells lines, indicating that each ALT cell line could have its own preferred primary ALT mechanism. It is unknown, though, how the primary

ALT mechanism that elongates the telomere in a particular cell line is chosen to begin

75 with and how ALT cells may chose other DNA repair proteins to compensate for loss of previously used DNA repair proteins. Therefore, it is necessary to continue to advance the efforts to understand all ALT mechanisms in order to develop ALT inhibitors that could be part of potent and durable anti-cancer approaches.

References

Acharya, S., Kaul, Z., Gocha, A.S., Martinez, A.R., Harris, J., Parvin, J.D., and Groden, J. (2014). Association of BLM and BRCA1 during telomere maintenance in ALT cells. PLoS One 9: 1–13.

Acharya, S., Wilson, T., Gradia, S., Kane, M.F., Guerrette, S., Marsischky, G.T., et al. (1996). hMSH2 forms specific mispair-binding complexes with hMSH3 and hMSH6. Proc Natl Acad Sci U S A 93: 13629–34.

Ahmadi, A., Behmanesh, M., Boroumand, M.A., and Tavallaei, M. (2015). Up-regulation of MSH2, XRCC1 and ATM genes in patients with type 2 diabetes and coronary artery disease. Diabetes Res Clin Pract 109: 500–506.

Al-Hakim, A., Escribano-Diaz, C., Landry, M.-C., O’Donnell, L., Panier, S., Szilard, R.K., and Durocher, D. (2010). The ubiquitous role of ubiquitin in the DNA damage response. DNA Repair (Amst) 9: 1229–1240.

Allshire, R.C., Dempster, M., and Hastie, N.D. (1989). Human telomeres contain at least three types of G-rich repeat distributed non-randomly. Nucleic Acids Res 17: 4611–27.

Arora, R., Lee, Y., Wischnewski, H., Brun, C.M., Schwarz, T., and Azzalin, C.M. (2014). RNaseH1 regulates TERRA-telomeric DNA hybrids and telomere maintenance in ALT tumour cells. Nat Commun 5: 1–11.

Azzalin, C.M., Reichenbach, P., Khoriauli, L., Giulotto, E., and Lingner, J. (2007). Telomeric repeat containing RNA and RNA surveillance factors at mammalian chromosome ends. Science 318: 798–801.

Badie, S., Escandell, J.M., Bouwman, P., Carlos, A.R., Thanasoula, M., Gallardo, M.M., et al. (2010). BRCA2 acts as a RAD51 loader to facilitate telomere replication and capping. Nat Struct Mol Biol 17: 1461–9.

Ballal, R.D., Saha, T., Fan, S., Haddad, B.R., and Rosen, E.M. (2009). BRCA1 localization to the telomere and its loss from the telomere in response to DNA damage. J Biol Chem 284: 36083–98.

Batista, L.F.Z. (2014). Telomere biology in stem cells and reprogramming. Prog Mol 77

Biol Transl Sci 125: 67–88.

Bauer, M., Goldstein, M., Christmann, M., Becker, H., Heylmann, D., and Kaina, B. (2011). Human monocytes are severely impaired in base and DNA double-strand break repair that renders them vulnerable to oxidative stress. Proc Natl Acad Sci U S A 108: 21105–10.

Baumann, P., and West, S.C. (1998). DNA end-joining catalyzed by human cell-free extracts. Proc Natl Acad Sci U S A 95: 14066–70.

Bechter, O.E., Zou, Y., Walker, W., Wright, W.E., and Shay, J.W. (2004). Telomeric recombination in mismatch repair deficient human colon cancer cells after telomerase inhibition. Cancer Res 64: 3444–51.

Benetti, R., Gonzalo, S., Jaco, I., Schotta, G., Klatt, P., Jenuwein, T., and Blasco, M.A. (2007). Suv4-20h deficiency results in telomere elongation and derepression of telomere recombination. J Cell Biol 178: 925–36.

Bergink, S., Toussaint, W., Luijsterburg, M.S., Dinant, C., Alekseev, S., Hoeijmakers, J.H.J., et al. (2012). Recognition of DNA damage by XPC coincides with disruption of the XPC-RAD23 complex. J Cell Biol 196: 681–8.

Bhattacharyya, S., Keirsey, J., Russell, B., Kavecansky, J., Lillard-Wetherell, K., Tahmaseb, K., et al. (2009). Telomerase-associated protein 1, HSP90, and topoisomerase IIalpha associate directly with the BLM helicase in immortalized cells using ALT and modulate its helicase activity using telomeric DNA substrates. J Biol Chem 284: 14966– 77.

Bhattacharyya, S., Sandy, A., and Groden, J. (2010). Unwinding protein complexes in ALTernative telomere maintenance. J Cell Biochem 109: 7–15.

Blackwell, L.J., Martik, D., Bjornson, K.P., Bjornson, E.S., and Modrich, P. (1998). Nucleotide-promoted release of hMutSalpha from heteroduplex DNA is consistent with an ATP-dependent translocation mechanism. J Biol Chem 273: 32055–62.

Bonanno, L., Costa, C., Majem, M., Sanchez, J.J., Gimenez-Capitan, A., Rodriguez, I., et al. (2013). The predictive value of 53BP1 and BRCA1 mRNA expression in advanced non-small-cell lung cancer patients treated with first-line platinum-based chemotherapy. Oncotarget 4: 1572–81.

Bork, P., Hofmann, K., Bucher, P., Neuwald, A.F., Altschul, S.F., and Koonin, E. V (1997). A superfamily of conserved domains in DNA damage-responsive cell cycle checkpoint proteins. FASEB J 11: 68–76.

Bower, K., Napier, C.E., Cole, S.L., Dagg, R.A., Lau, L.M.S., Duncan, E.L., et al. (2012). Loss of wild-type ATRX expression in somatic cell hybrids segregates with activation of alternative lengthening of telomeres. PLoS One 7: 1–10.

Bryan, T.M., Englezou, A., Dalla-Pozza, L., Dunham, M.A., and Reddel, R.R. (1997). Evidence for an alternative mechanism for maintaining telomere length in human tumors and tumor-derived cell lines. Nat Med 3: 1271–4.

Bryan, T.M., Englezou, A., Gupta, J., Bacchetti, S., and Reddel, R.R. (1995). Telomere elongation in immortal human cells without detectable telomerase activity. EMBO J 14: 4240–8.

Bunting, S.F., Callén, E., Wong, N., Chen, H.-T., Polato, F., Gunn, A., et al. (2010). 53BP1 inhibits homologous recombination in Brca1-deficient cells by blocking resection of DNA breaks. Cell 141: 243–54.

Burma, S., Chen, B.P., Murphy, M., Kurimasa, A., and Chen, D.J. (2001). ATM phosphorylates histone H2AX in response to DNA double-strand breaks. J Biol Chem 276: 42462–7.

Celli, G.B., Denchi, E.L., and Lange, T. de (2006). Ku70 stimulates fusion of dysfunctional telomeres yet protects chromosome ends from homologous recombination. Nat Cell Biol 8: 855–890.

Cesare, A.J., and Griffith, J.D. (2004). Telomeric DNA in ALT cells is characterized by free telomeric circles and heterogeneous t-loops. Mol Cell Biol 24: 9948–57.

Cesare, A.J., Heaphy, C.M., and O’Sullivan, R.J. (2015). Visualization of telomere integrity and function in vitro and in vivo using immunofluorescence techniques. Curr Protoc Cytom 73: 12.40.1-31.

Cesare, A.J., Kaul, Z., Cohen, S.B., Napier, C.E., Pickett, H.A., Neumann, A.A., and Reddel, R.R. (2009). Spontaneous occurrence of telomeric DNA damage response in the absence of chromosome fusions. Nat Struct Mol Biol 16: 1244–51.

Chakhparonian, M., and Wellinger, R.J. (2003). Telomere maintenance and DNA replication: How closely are these two connected? Trends Genet 19: 439–46.

Chen, J., Silver, D.P., Walpita, D., Cantor, S.B., Gazdar, A.F., Tomlinson, G., et al. (1998). Stable interaction between the products of the BRCA1 and BRCA2 tumor suppressor genes in mitotic and meiotic cells. Mol Cell 2: 317–28.

Chen, L., Nievera, C.J., Lee, A.Y.-L., and Wu, X. (2008). Cell cycle-dependent complex formation of BRCA1.CtIP.MRN is important for DNA double-strand break repair. J Biol 79

Chem 283: 7713–20.

Chen, W., Xiao, B.K., Liu, J.P., Chen, S.M., and Tao, Z.Z. (2010). Alternative lengthening of telomeres in hTERT-inhibited laryngeal cancer cells. Cancer Sci 101: 1769–1776.

Cheng, W.-H., Kusumoto, R., Opresko, P.L., Sui, X., Huang, S., Nicolette, M.L., et al. (2006). Collaboration of Werner syndrome protein and BRCA1 in cellular responses to DNA interstrand cross-links. Nucleic Acids Res 34: 2751–60.

Chiba, N., and Parvin, J.D. (2001). Redistribution of BRCA1 among four different protein complexes following replication blockage. J Biol Chem 276: 38549–54.

Cho, N.W., Dilley, R.L., Lampson, M.A., and Greenberg, R.A. (2014). Interchromosomal homology searches drive directional ALT telomere movement and synapsis. Cell 159: 108–121.

Chu, W.K., and Hickson, I.D. (2009). RecQ helicases: Multifunctional genome caretakers. Nat Rev Cancer 9: 644–54.

Chu, Y., and Yang, X. (2011). SUMO E3 ligase activity of TRIM proteins. Oncogene 30: 1108–16.

Coin, F., Oksenych, V., Egly, J.-M., Bootsma, D., Hoeijmakers, J.H.J., Carreau, M., et al. (2007). Distinct roles for the XPB/p52 and XPD/p44 subcomplexes of TFIIH in damaged DNA opening during nucleotide excision repair. Mol Cell 26: 245–56.

Collins, K., and Mitchell, J.R. (2002). Telomerase in the human organism. Oncogene 21: 564–79.

Compe, E., and Egly, J.-M. (2012). TFIIH: when transcription met DNA repair. Nat Rev Mol Cell Biol 13: 343–54.

Compton, S.A., Choi, J.-H., Cesare, A.J., Ozgür, S., and Griffith, J.D. (2007). Xrcc3 and Nbs1 are required for the production of extrachromosomal telomeric circles in human alternative lengthening of telomere cells. Cancer Res 67: 1513–9.

Conomos, D., Pickett, H.A., and Reddel, R.R. (2013). Alternative lengthening of telomeres: Remodeling the telomere architecture. Front Oncol 3: 27.

Conomos, D., Reddel, R.R., and Pickett, H.A. (2014). NuRD-ZNF827 recruitment to telomeres creates a molecular scaffold for homologous recombination. Nat Struct Mol Biol 21: 760–70.

Conomos, D., Stutz, M.D., Hills, M., Neumann, A.A., Bryan, T.M., Reddel, R.R., and Pickett, H.A. (2012). Variant repeats are interspersed throughout the telomeres and recruit nuclear receptors in ALT cells. J Cell Biol 199: 893–906.

Constantin, N., Dzantiev, L., Kadyrov, F.A., and Modrich, P. (2005). Human mismatch repair: reconstitution of a nick-directed bidirectional reaction. J Biol Chem 280: 39752– 61.

Costa, A., Daidone, M.G., Daprai, L., Villa, R., Cantù, S., Pilotti, S., et al. (2006). Telomere maintenance mechanisms in liposarcomas: Association with histologic subtypes and disease progression. Cancer Res 66: 8918–24.

Counter, C.M., Avilion, A.A., Lefeuvrel, C.E., Stewart, N.G., Greider, C.W., Harley, C.B., and Bacchettil, S. (1992). Telomere shortening associated with chromosome instability is arrested in immortal cells which express telomerase activity. EMBO J 1: 921–1929.

Davies, A.A., Masson, J.Y., McIlwraith, M.J., Stasiak, A.Z., Stasiak, A., Venkitaraman, A.R., and West, S.C. (2001). Role of BRCA2 in control of the RAD51 recombination and DNA repair protein. Mol Cell 7: 273–82.

Deshaies, R.J., and Joazeiro, C.A.P. (2009). RING domain E3 ubiquitin ligases. Annu Rev Biochem 78: 399–434.

Doil, C., Mailand, N., Bekker-Jensen, S., Menard, P., Larsen, D.H., Pepperkok, R., et al. (2009). RNF168 binds and amplifies ubiquitin conjugates on damaged chromosomes to allow accumulation of repair proteins. Cell 136: 435–46.

Draskovic, I., and Londono Vallejo, A. (2013). Telomere recombination and alternative telomere lengthening mechanisms. Front Biosci 18: 1–20.

Drosopoulos, W.C., Kosiyatrakul, S.T., and Schildkraut, C.L. (2015). BLM helicase facilitates telomere replication during leading strand synthesis of telomeres. J Cell Biol 210: 191–208.

Dunham, M.A., Neumann, A.A., Fasching, C.L., and Reddel, R.R. (2000). Telomere maintenance by recombination in human cells. Nat Genet 26: 447–50.

Escribano-Díaz, C., Orthwein, A., Fradet-Turcotte, A., Xing, M., Young, J.T.F., Tkáč, J., et al. (2013). A cell cycle-dependent regulatory circuit composed of 53BP1-RIF1 and BRCA1-CtIP controls DNA repair pathway choice. Mol Cell 49: 872–83.

Fagbemi, A.F., Orelli, B., and Schärer, O.D. (2011). Regulation of endonuclease activity in human nucleotide excision repair. DNA Repair (Amst) 10: 722–729. 81

Fan, Q., Zhang, F., Barrett, B., Ren, K., and Andreassen, P.R. (2009). A role for monoubiquitinated FANCD2 at telomeres in ALT cells. Nucleic Acids Res 37: 1740–54.

Feng, L., Fong, K.-W., Wang, J., Wang, W., and Chen, J. (2013). RIF1 counteracts BRCA1-mediated end resection during DNA repair. J Biol Chem 288: 11135–43.

Ferrandon, S., Saultier, P., Carras, J., Battiston-Montagne, P., Alphonse, G., Beuve, M., et al. (2013). Telomere profiling: Toward glioblastoma personalized medicine. Mol Neurobiol 47: 64–76.

Fortini, P., Parlanti, E., Sidorkina, O.M., Laval, J., and Dogliotti, E. (1999). The type of DNA glycosylase determines the base excision repair pathway in mammalian cells. J Biol Chem 274: 15230–6.

Frosina, G., Fortini, P., Rossi, O., Carrozzino, F., Raspaglio, G., Cox, L.S., et al. (1996). Two pathways for base excision repair in mammalian cells. J Biol Chem 271: 9573–8.

Fustier, P., Corre, L. Le, Chalabi, N., Vissac-Sabatier, C., Communal, Y., Bignon, Y.-J., and Bernard-Gallon, D.J. (2003). Resveratrol increases BRCA1 and BRCA2 mRNA expression in breast tumour cell lines. Br J Cancer 89: 168–72.

Galanty, Y., Belotserkovskaya, R., Coates, J., Polo, S., Miller, K.M., and Jackson, S.P. (2009). Mammalian SUMO E3-ligases PIAS1 and PIAS4 promote responses to DNA double-strand breaks. Nature 462: 935–9.

García-Cao, M., O’Sullivan, R., Peters, A.H.F.M., Jenuwein, T., and Blasco, M.A. (2004). Epigenetic regulation of telomere length in mammalian cells by the Suv39h1 and Suv39h2 histone methyltransferases. Nat Genet 36: 94–9.

Gatti, M., Pinato, S., Maiolica, A., Rocchio, F., Prato, M.G., Aebersold, R., and Penengo, L. (2015). RNF168 promotes noncanonical K27 Ubiquitination to signal DNA damage. Cell Rep 10: 226–238.

German, J. (1995). Bloom’s syndrome. Dermatol Clin 13: 7–18.

Giannini, G., Ristori, E., Cerignoli, F., Rinaldi, C., Zani, M., Viel, A., et al. (2002). Human MRE11 is inactivated in mismatch repair-deficient cancers. EMBO Rep 3: 248– 54.

Gocha, A.R.S., Acharya, S., and Groden, J. (2014). WRN loss induces switching of telomerase-independent mechanisms of telomere elongation. PLoS One 9: 1–16.

Gocha, A.R.S., Harris, J., and Groden, J. (2013). Alternative mechanisms of telomere 82 lengthening: Permissive mutations, DNA repair proteins and tumorigenic progression. Mutat Res 743–744: 142–50.

Gocha, A.R.S., Nuovo, G., Iwenofu, O.H., and Groden, J. (2013). Human sarcomas are mosaic for telomerase-dependent and telomerase-independent telomere maintenance mechanisms: Implications for telomere-based therapies. Am J Pathol 182: 41–8.

Gonzalo, S., Jaco, I., Fraga, M.F., Chen, T., Li, E., Esteller, M., and Blasco, M.A. (2006). DNA methyltransferases control telomere length and telomere recombination in mammalian cells. Nat Cell Biol 8: 416–24.

Greenberg, R.A. (2005). Telomeres, crisis and cancer. Curr Mol Med 5: 213–8.

Greenberg, R.A., Sobhian, B., Pathania, S., Cantor, S.B., Nakatani, Y., and Livingston, D.M. (2006). Multifactorial contributions to an acute DNA damage response by BRCA1/BARD1-containing complexes. Genes Dev 20: 34–46.

Greider, C.W., and Blackburn, E.H. (1985). Identification of a specific telomere terminal transferase activity in tetrahymena extracts. Cell 43: 405–413.

Griffith, J.D., Comeau, L., Rosenfield, S., Stansel, R.M., Bianchi, A., Moss, H., et al. (1999). Mammalian telomeres end in a large duplex loop. Cell 97: 503–514.

Grobelny, J. V, Godwin, A.K., and Broccoli, D. (2000). ALT-associated PML bodies are present in viable cells and are enriched in cells in the G(2)/M phase of the cell cycle. J Cell Sci 113: 4577–85.

Grudic, A., Jul-Larsen, A., Haring, S.J., Wold, M.S., Lønning, P.E., Bjerkvig, R., and Bøe, S.O. (2007). Replication protein A prevents accumulation of single-stranded telomeric DNA in cells that use alternative lengthening of telomeres. Nucleic Acids Res 35: 7267–78.

Gunz, D., Hess, M.T., and Naegeli, H. (1996). Recognition of DNA adducts by human nucleotide excision repair. Evidence for a thermodynamic probing mechanism. J Biol Chem 271: 25089–98.

Gupta, S., Gellert, M., and Yang, W. (2012). Mechanism of mismatch recognition revealed by human MutSβ bound to unpaired DNA loops. Nat Struct Mol Biol 19: 72–8.

Hagelstrom, R.T., Blagoev, K.B., Niedernhofer, L.J., Goodwin, E.H., and Bailey, S.M. (2010). Hyper-telomere recombination accelerates replicative senescence and may promote premature aging. Proc Natl Acad Sci U S A 107: 15768–73.

Hakin-Smith, V., Jellinek, D.A., Levy, D., Carroll, T., Teo, M., Timperley, W.R., et al. 83

(2003). Alternative lengthening of telomeres and survival in patients with glioblastoma multiforme. Lancet 361: 836–8. Harding, S.M., and Greenberg, R.A. (2016). Choreographing the double strand break response: Ubiquitin and SUMO control of nuclear architecture. Front Genet 7: 103.

Hashimoto, M., Ichihara, M., Watanabe, T., Kawai, K., Koshikawa, K., Yuasa, N., et al. (2004). Expression of CD109 in human cancer. Oncogene 23: 3716–20.

Hashizume, R., Fukuda, M., Maeda, I., Nishikawa, H., Oyake, D., Yabuki, Y., et al. (2001). The RING heterodimer BRCA1-BARD1 is a ubiquitin ligase inactivated by a breast cancer-derived mutation. J Biol Chem 276: 14537–40.

Heaphy, C.M., Wilde, R.F. de, Jiao, Y., Klein, A.P., Edil, B.H., Shi, C., et al. (2011). Altered telomeres in tumors with ATRX and DAXX mutations. Science 333: 425.

Hefferin, M.L., and Tomkinson, A.E. (2005). Mechanism of DNA double-strand break repair by non-homologous end joining. DNA Repair (Amst) 4: 639–648.

Hemann, M.T., Strong, M.A., Hao, L.Y., and Greider, C.W. (2001). The shortest telomere, not average telomere length, is critical for cell viability and chromosome stability. Cell 107: 67–77.

Henson, J.D., Cao, Y., Huschtscha, L.I., Chang, A.C., Au, A.Y.M., Pickett, H.A., and Reddel, R.R. (2009). DNA C-circles are specific and quantifiable markers of alternative- lengthening-of-telomeres activity. Nat Biotechnol 27: 1181–5.

Henson, J.D., Hannay, J.A., McCarthy, S.W., Royds, J.A., Yeager, T.R., Robinson, R.A., et al. (2005). A robust assay for alternative lengthening of telomeres in tumors shows the significance of alternative lengthening of telomeres in sarcomas and astrocytomas. Clin Cancer Res 11: 217–25.

Hu, J., Hwang, S.S., Liesa, M., Gan, B., Sahin, E., Jaskelioff, M., et al. (2012). Antitelomerase therapy provokes ALT and mitochondrial adaptive mechanisms in cancer. Cell 148: 651–63.

Hu, Y., and Parvin, J.D. (2014). Small ubiquitin-like modifier (SUMO) isoforms and conjugation-independent function in DNA double-strand break repair pathways. J Biol Chem 289: 21289–95.

Hu, Y., Wang, C., Huang, K., Xia, F., Parvin, J.D., and Mondal, N. (2014). Regulation of 53BP1 protein stability by RNF8 and RNF168 is important for efficient DNA double- strand break repair. PLoS One 9: 1–13.

Huang, S.-Y., Chang, C.-F., Fang, P.-J., Naik, M.T., Güntert, P., Shih, H.-M., and Huang, 84

T.-H. (2015). The RING domain of human promyelocytic leukemia protein (PML). J Biomol NMR 61: 173–80. Huffman, J.L., Sundheim, O., and Tainer, J.A. (2005). DNA base damage recognition and removal: New twists and grooves. Mutat Res Mol Mech Mutagen 577: 55–76.

Iwabuchi, K., Basu, B.P., Kysela, B., Kurihara, T., Shibata, M., Guan, D., et al. (2003). Potential role for 53BP1 in DNA end-joining repair through direct interaction with DNA. J Biol Chem 278: 36487–95.

Iyer, R.R., Pohlhaus, T.J., Chen, S., Hura, G.L., Dzantiev, L., Beese, L.S., and Modrich, P. (2008). The MutSalpha-proliferating cell nuclear antigen interaction in human DNA mismatch repair. J Biol Chem 283: 13310–9.

Jackson, D.A., and Pombo, A. (1998). Replicon clusters are stable units of chromosome structure: Evidence that nuclear organization contributes to the efficient activation and propagation of S phase in human cells. J Cell Biol 140: 1285–95.

Jackson, S.P., and Bartek, J. (2009). The DNA-damage response in human biology and disease. Nature 461: 1071–1078.

Jacobs, J.J.L. (2012). Fusing telomeres with RNF8. Nucleus 3: 143–9.

Jaspers, J.E., Kersbergen, A., Boon, U., Sol, W., Deemter, L. van, Zander, S.A., et al. (2013). Loss of 53BP1 causes PARP inhibitor resistance in Brca1-mutated mouse mammary tumors. Cancer Discov 3: 68–81.

Jeyapalan, J.N., Mendez-Bermudez, A., Zaffaroni, N., Dubrova, Y.E., and Royle, N.J. (2008). Evidence for alternative lengthening of telomeres in liposarcomas in the absence of ALT-associated PML bodies. Int J cancer 122: 2414–21.

Jiang, W.-Q., Zhong, Z.-H., Henson, J.D., Neumann, A.A., Chang, A.C.-M., and Reddel, R.R. (2005). Suppression of alternative lengthening of telomeres by Sp100-mediated sequestration of the MRE11/RAD50/NBS1 complex. Mol Cell Biol 25: 2708–21.

Jiang, W.-Q., Zhong, Z.-H., Henson, J.D., and Reddel, R.R. (2007). Identification of candidate alternative lengthening of telomeres genes by methionine restriction and RNA interference. Oncogene 26: 4635–47.

Jiricny, J. (2013). Postreplicative mismatch repair. Cold Spring Harb Perspect Biol 5: 1- 23.

Kadyrov, F.A., Dzantiev, L., Constantin, N., and Modrich, P. (2006). Endonucleolytic Function of MutLα in Human Mismatch Repair. Cell 126: 297–308.

Kamath-Loeb, A., Loeb, L.A., and Fry, M. (2012). The Werner syndrome protein is distinguished from the Bloom syndrome protein by its capacity to tightly bind diverse DNA structures. PLoS One 7: 1–9.

Kamath-Loeb, A.S., Shen, J.C., Loeb, L.A., and Fry, M. (1998). Werner syndrome protein. II. Characterization of the integral 3’ ---> 5’ DNA exonuclease. J Biol Chem 273: 34145–50.

Karow, J.K., Constantinou, A., Li, J.L., West, S.C., and Hickson, I.D. (2000). The Bloom’s syndrome gene product promotes branch migration of Holliday junctions. Proc Natl Acad Sci U S A 97: 6504–8.

Kikuchi, K., Narita, T., Pham, V.T., Iijima, J., Hirota, K., Keka, I.S., et al. (2013). Structure-specific endonucleases xpf and mus81 play overlapping but essential roles in DNA repair by homologous recombination. Cancer Res 73: 4362–71.

Kim, N.W., Piatyszek, M.A., Prowse, K.R., Harley, C.B., West, M.D., Ho, P.L., et al. (1994). Specific association of human telomerase activity with immortal cells and cancer. Science 266: 2011–5.

Kolas, N.K., Chapman, J.R., Nakada, S., Ylanko, J., Chahwan, R., Sweeney, F.D., et al. (2007). Orchestration of the DNA-damage response by the RNF8 ubiquitin ligase. Science 318: 1637–40.

Krokan, H.E., and Bjørås, M. (2013). Base excision repair. Cold Spring Harb Perspect Biol 5: 1-22.

Laat, W.L. de, Appeldoorn, E., Sugasawa, K., Weterings, E., Jaspers, N.G., and Hoeijmakers, J.H. (1998). DNA-binding polarity of human replication protein A positions nucleases in nucleotide excision repair. Genes Dev 12: 2598–609.

Lafferty-Whyte, K., Cairney, C.J., Will, M.B., Serakinci, N., Daidone, M.-G., Zaffaroni, N., et al. (2009). A gene expression signature classifying telomerase and ALT immortalization reveals an hTERT regulatory network and suggests a mesenchymal stem cell origin for ALT. Oncogene 28: 3765–74.

Lamarche, B.J., Orazio, N.I., and Weitzman, M.D. (2010). The MRN complex in double- strand break repair and telomere maintenance. FEBS Lett 584: 3682–95.

Lange, T. de (2005). Shelterin: The protein complex that shapes and safeguards human telomeres. Genes Dev 19: 2100–2110.

Lange, T. de, Shiue, L., Myers, R.M., Cox, D.R., Naylor, S.L., Killery, A.M., and Varmus, H.E. (1990). Structure and variability of human chromosome ends. Mol Cell 86

Biol 10: 518–27.

Larsen, N.B., and Hickson, I.D. (2013). RecQ Helicases: Conserved guardians of genomic integrity. Adv Exp Med Biol 767: 161–84.

Lau, L.M.S., Dagg, R.A., Henson, J.D., Au, A.Y.M., Royds, J.A., and Reddel, R.R. (2013). Detection of alternative lengthening of telomeres by telomere quantitative PCR. Nucleic Acids Res 41: 1–9.

Laufer, M., Nandula, S. V, Modi, A.P., Wang, S., Jasin, M., Murty, V.V.V.S., et al. (2007). Structural requirements for the BARD1 tumor suppressor in chromosomal stability and homology-directed DNA repair. J Biol Chem 282: 34325–33.

Lee, C., Banerjee, T., Gillespie, J., Ceravolo, A., Parvinsmith, M.R., Starita, L.M., et al. (2015). Functional analysis of BARD1 missense variants in homology-directed repair of DNA double strand breaks. Hum Mutat 36: 1205–14.

Lee, M., Hills, M., Conomos, D., Stutz, M.D., Dagg, R.A., Lau, L.M.S., et al. (2014). Telomere extension by telomerase and ALT generates variant repeats by mechanistically distinct processes. Nucleic Acids Res 42: 1733–46.

Lehmann, A.R. (2011). DNA polymerases and repair synthesis in NER in human cells. DNA Repair (Amst) 10: 730–733.

Li, J., Young, C.S.H., Lizardi, P.M., and Stern, D.F. (2005). In situ detection of specific DNA double strand breaks using rolling circle amplification. Cell Cycle 4: 1767–73. Li, M., and Yu, X. (2013). Function of BRCA1 in the DNA damage response is mediated by ADP-ribosylation. Cancer Cell 23: 693–704.

Liang, L., Deng, L., Nguyen, S.C., Zhao, X., Maulion, C.D., Shao, C., and Tischfield, J.A. (2008). Human DNA ligases I and III, but not ligase IV, are required for microhomology-mediated end joining of DNA double-strand breaks. Nucleic Acids Res 36: 3297–310.

Lillard-Wetherell, K., Machwe, A., Langland, G.T., Combs, K.A., Behbehani, G.K., Schonberg, S.A., et al. (2004). Association and regulation of the BLM helicase by the telomere proteins TRF1 and TRF2. Hum Mol Genet 13: 1919–32.

Lindahl, T. (1993). Instability and decay of the primary structure of DNA. Nature 362: 709–15.

Liu, J., Doty, T., Gibson, B., and Heyer, W.-D. (2010). Human BRCA2 protein promotes RAD51 filament formation on RPA-covered single-stranded DNA. Nat Struct Mol Biol 17: 1260–2. 87

Londoño-Vallejo, J.A., Der-Sarkissian, H., Cazes, L., Bacchetti, S., and Reddel, R.R. (2004). Alternative lengthening of telomeres is characterized by high rates of telomeric exchange. Cancer Res 64: 2324–7.

Lönn, U., Lönn, S., Nylen, U., Winblad, G., and German, J. (1990). An abnormal profile of DNA replication intermediates in Bloom’s syndrome. Cancer Res 50: 3141–5.

Lovejoy, C.A., Li, W., Reisenweber, S., Thongthip, S., Bruno, J., Lange, T. de, et al. (2012). Loss of ATRX, genome instability, and an altered DNA damage response are hallmarks of the alternative lengthening of telomeres pathway. PLoS Genet 8: 1–16.

Luca, P. De, Moiola, C.P., Zalazar, F., Gardner, K., Vazquez, E.S., and Siervi, A. De (2013). BRCA1 and p53 regulate critical prostate cancer pathways. Prostate Cancer Prostatic Dis 16: 233–8.

Mailand, N., Bekker-Jensen, S., Faustrup, H., Melander, F., Bartek, J., Lukas, C., and Lukas, J. (2007). RNF8 ubiquitylates histones at DNA double-strand breaks and promotes assembly of repair proteins. Cell 131: 887–900.

Makarov, V.L., Hirose, Y., Langmore, J.P., Allshire, R.., Dempster, M., Hastie, N.., et al. (1997). Long G tails at both ends of human chromosomes suggest a C strand degradation mechanism for telomere shortening. Cell 88: 657–666.

Marsischky, G.T., and Kolodner, R.D. (1999). Biochemical characterization of the interaction between the Saccharomyces cerevisiae MSH2-MSH6 complex and mispaired bases in DNA. J Biol Chem 274: 26668–26682.

Matsuda, T., Saijo, M., Kuraoka, I., Kobayashi, T., Nakatsu, Y., Nagai, A., et al. (1995). DNA repair protein XPA binds replication protein A (RPA). J Biol Chem 270: 4152–7. Matulić, M., Sopta, M., and Rubelj, I. (2007). Telomere dynamics: The means to an end. Cell Prolif 40: 462–74.

McIlwraith, M.J., Dyck, E. Van, Masson, J.-Y., Stasiak, A.Z., Stasiak, A., and West, S.C. (2000). Reconstitution of the strand invasion step of double-strand break repair using human Rad51 Rad52 and RPA proteins. J Mol Biol 304: 151–164.

McPherson, J.P., Hande, M.P., Poonepalli, A., Lemmers, B., Zablocki, E., Migon, E., et al. (2006). A role for Brca1 in chromosome end maintenance. Hum Mol Genet 15: 831– 8.

Meek, K., Dang, V., and Lees-Miller, S.P. (2008). Chapter 2 DNA-PK: The Means to Justify the Ends? Adv Immunol 99: 33–58.

Mendez-Bermudez, A., Hidalgo-Bravo, A., Cotton, V.E., Gravani, A., Jeyapalan, J.N., and Royle, N.J. (2012). The roles of WRN and BLM RecQ helicases in the alternative lengthening of telomeres. Nucleic Acids Res 40: 10809–20.

Miller, A.S., Balakrishnan, L., Buncher, N.A., Opresko, P.L., and Bambara, R.A. (2012). Telomere proteins POT1, TRF1 and TRF2 augment long-patch base excision repair in vitro. Cell Cycle 11: 998–1007.

Min, J., Choi, E.S., Hwang, K., Kim, J., Sampath, S., Venkitaraman, A.R., and Lee, H. (2012). The breast cancer susceptibility gene BRCA2 is required for the maintenance of telomere homeostasis. J Biol Chem 287: 5091–101.

Mohaghegh, P., Karow, J.K., Brosh, R.M., Bohr, V.A., and Hickson, I.D. (2001). The Bloom’s and Werner’s syndrome proteins are DNA structure-specific helicases. Nucleic Acids Res 29: 2843–9.

Morin, G.B. (1989). The human telomere terminal transferase enzyme is a ribonucleoprotein that synthesizes TTAGGG repeats. Cell 59: 521–529.

Moser, M.J., Oshima, J., and Monnat, R.J. (1999). WRN mutations in Werner syndrome. Hum Mutat 13: 271–9.

Moynahan, M.E., Chiu, J.W., Koller, B.H., and Jasin, M. (1999). Brca1 controls homology-directed DNA repair. Mol Cell 4: 511–8.

Moynahan, M.E., Pierce, A.J., and Jasin, M. (2001). BRCA2 Is required for homology- directed repair of chromosomal breaks. Mol Cell 7: 263–272.

Muftuoglu, M., Wong, H.K., Imam, S.Z., Wilson, D.M., Bohr, V.A., and Opresko, P.L. (2006). Telomere repeat binding factor 2 interacts with base excision repair proteins and stimulates DNA synthesis by DNA polymerase beta. Cancer Res 66: 113–24.

Muntoni, A., Neumann, A.A., Hills, M., and Reddel, R.R. (2009). Telomere elongation involves intra-molecular DNA replication in cells utilizing alternative lengthening of telomeres. Hum Mol Genet 18: 1017–27.

Muntoni, A., and Reddel, R.R. (2005). The first molecular details of ALT in human tumor cells. Hum Mol Genet 14: 191–196.

Murnane, J.P., Sabatier, L., Marder, B.A., and Morgan, W.F. (1994). Telomere dynamics in an immortal human cell line. EMBO J 13: 4953–62.

Nabetani, A., and Ishikawa, F. (2009). Unusual telomeric DNAs in human telomerase- negative immortalized cells. Mol Cell Biol 29: 703–13. 89

Nabetani, A., Yokoyama, O., and Ishikawa, F. (2004). Localization of hRad9, hHus1, hRad1, and hRad17 and caffeine-sensitive DNA replication at the alternative lengthening of telomeres-associated promyelocytic leukemia body. J Biol Chem 279: 25849–57.

Ng, L.J., Cropley, J.E., Pickett, H.A., Reddel, R.R., and Suter, C.M. (2009). Telomerase activity is associated with an increase in DNA methylation at the proximal subtelomere and a reduction in telomeric transcription. Nucleic Acids Res 37: 1152–9.

Nieminuszczy, J., Schwab, R.A., and Niedzwiedz, W. (2016). The DNA fibre technique - tracking helicases at work. Methods: 1–7. doi: 10.1016/j.ymeth.2016.04.019. [Epub ahead of print].

Nosek, J., Rycovska, A., Makhov, A.M., Griffith, J.D., and Tomaska, L. (2005). Amplification of telomeric arrays via rolling-circle mechanism. J Biol Chem 280: 10840– 5.

Nymoen, D.A., Holth, A., Hetland Falkenthal, T.E., Tropé, C.G., and Davidson, B. (2015). CIAPIN1 and ABCA13 are markers of poor survival in metastatic ovarian serous carcinoma. Mol Cancer 14: 1–9.

O’Sullivan, R.J., Arnoult, N., Lackner, D.H., Oganesian, L., Haggblom, C., Corpet, A., et al. (2014). Rapid induction of alternative lengthening of telomeres by depletion of the histone chaperone ASF1. Nat Struct Mol Biol 21: 167–74.

Ogino, H., Nakabayashi, K., Suzuki, M., Takahashi, E., Fujii, M., Suzuki, T., and Ayusawa, D. (1998). Release of telomeric DNA from chromosomes in immortal human cells lacking telomerase activity. Biochem Biophys Res Commun 248: 223–227.

Omori, Y., Nakayama, F., Li, D., Kanemitsu, K., Semba, S., Ito, A., and Yokozaki, H. (2009). Alternative lengthening of telomeres frequently occurs in mismatch repair system-deficient gastric carcinoma. Cancer Sci 100: 413–8.

Opresko, P.L., Laine, J.P., Brosh, R.M., Seidman, M.M., and Bohr, V.A. (2001). Coordinate action of the helicase and 3’ to 5’ exonuclease of Werner syndrome protein. J Biol Chem 276: 44677–87.

Pannicke, U., Ma, Y., Hopfner, K.-P., Niewolik, D., Lieber, M.R., and Schwarz, K. (2004). Functional and biochemical dissection of the structure-specific nuclease ARTEMIS. EMBO J 23: 1987–97.

Pâques, F., and Haber, J.E. (1999). Multiple pathways of recombination induced by double-strand breaks in Saccharomyces cerevisiae. Microbiol Mol Biol Rev 63: 349–404. Park, K.H., Rha, S.Y., Kim, C.H., Kim, T.S., Yoo, N.C., Kim, J.H., et al. (1998). 90

Telomerase activity and telomere lengths in various cell lines: Changes of telomerase activity can be another method for chemosensitivity evaluation. Int J Oncol 13: 489–95. Parkinson, G.N., Lee, M.P.H., and Neidle, S. (2002). Crystal structure of parallel quadruplexes from human telomeric DNA. Nature 417: 876–80.

Pascucci, B., Stucki, M., Jónsson, Z.O., Dogliotti, E., and Hübscher, U. (1999). Long patch base excision repair with purified human proteins. DNA ligase I as patch size mediator for DNA polymerases delta and epsilon. J Biol Chem 274: 33696–702.

Potts, P.R., and Yu, H. (2007). The SMC5/6 complex maintains telomere length in ALT cancer cells through SUMOylation of telomere-binding proteins. Nat Struct Mol Biol 14: 581–90.

Ransburgh, D.J.R., Chiba, N., Ishioka, C., Toland, A.E., and Parvin, J.D. (2010). Identification of breast tumor mutations in BRCA1 that abolish its function in homologous DNA recombination. Cancer Res 70: 988–95.

Raynard, S., Bussen, W., and Sung, P. (2006). A double Holliday junction dissolvasome comprising BLM, topoisomerase IIIalpha, and BLAP75. J Biol Chem 281: 13861–4.

Roy, R., Kumar, A., Lee, J.C., and Mitra, S. (1996). The domains of mammalian base excision repair enzyme N-methylpurine-DNA glycosylase. Interaction, conformational change, and role in DNA binding and damage recognition. J Biol Chem 271: 23690–7.

Saintigny, Y., Makienko, K., Swanson, C., Emond, M.J., and Monnat, R.J. (2002). Homologous recombination resolution defect in Werner syndrome. Mol Cell Biol 22: 6971–8.

Saldivar, J.C., Miuma, S., Bene, J., Hosseini, S.A., Shibata, H., Sun, J., et al. (2012). Initiation of genome instability and preneoplastic processes through loss of Fhit expression. PLoS Genet 8: 1–16.

Sankaran, S., Starita, L.M., Groen, A.C., Ko, M.J., and Parvin, J.D. (2005). Centrosomal microtubule nucleation activity is inhibited by BRCA1-dependent ubiquitination. Mol Cell Biol 25: 8656–68.

Sapir, E., Gozaly-Chianea, Y., Al-Wahiby, S., Ravindran, S., Yasaei, H., and Slijepcevic, P. (2011). Effects of BRCA2 deficiency on telomere recombination in non-ALT and ALT cells. Genome Integr 2: 1–7.

Schärer, O.D. (2013). Nucleotide excision repair in eukaryotes. Cold Spring Harb Perspect Biol 5: 1–19.

Schlegel, B.P., Jodelka, F.M., and Nunez, R. (2006). BRCA1 promotes induction of ssDNA by ionizing radiation. Cancer Res 66: 5181–9. Schwartzentruber, J., Korshunov, A., Liu, X.-Y., Jones, D.T.W., Pfaff, E., Jacob, K., et al. (2012). Driver mutations in histone H3.3 and chromatin remodelling genes in paediatric glioblastoma. Nature 482: 226–31.

Scully, R., Chen, J., Plug, A., Xiao, Y., Weaver, D., Feunteun, J., et al. (1997). Association of BRCA1 with Rad51 in mitotic and meiotic cells. Cell 88: 265–75.

Scully, R., Ganesan, S., Brown, M., Caprio, J.A. De, Cannistra, S.A., Feunteun, J., et al. (1996). Location of BRCA1 in human breast and ovarian cancer cells. Science 272: 123– 6.

Sfeir, A., and Lange, T. de (2012). Removal of shelterin reveals the telomere end- protection problem. Science 336: 593–7.

Song, S., Xing, G., Yuan, L., Wang, J., Wang, S., Yin, Y., et al. (2012). N-methylpurine DNA glycosylase inhibits p53-mediated cell cycle arrest and coordinates with p53 to determine sensitivity to alkylating agents. Cell Res 22: 1285–303.

Spies, M., and Fishel, R. (2015). Mismatch repair during homologous and homeologous recombination. Cold Spring Harb Perspect Biol 7: 1-21.

Stavropoulos, D.J., Bradshaw, P.S., Li, X., Pasic, I., Truong, K., Ikura, M., et al. (2002). The Bloom syndrome helicase BLM interacts with TRF2 in ALT cells and promotes telomeric DNA synthesis. Hum Mol Genet 11: 3135–44.

Ström, C.E., Johansson, F., Uhlén, M., Szigyarto, C.A.-K., Erixon, K., and Helleday, T. (2011). Poly (ADP-ribose) polymerase (PARP) is not involved in base excision repair but PARP inhibition traps a single-strand intermediate. Nucleic Acids Res 39: 3166–75.

Subhawong, A.P., Heaphy, C.M., Argani, P., Konishi, Y., Kouprina, N., Nassar, H., et al. (2009). The alternative lengthening of telomeres phenotype in breast carcinoma is associated with HER-2 overexpression. Mod Pathol 22: 1423–31.

Sugasawa, K., Akagi, J., Nishi, R., Iwai, S., Hanaoka, F., Araki, M., et al. (2009). Two- step recognition of DNA damage for mammalian nucleotide excision repair: Directional binding of the XPC complex and DNA strand scanning. Mol Cell 36: 642–53.

Sugasawa, K., Okamoto, T., Shimizu, Y., Masutani, C., Iwai, S., and Hanaoka, F. (2001). A multistep damage recognition mechanism for global genomic nucleotide excision repair. Genes Dev 15: 507–21.

Sugiyama, T., Zaitseva, E.M., and Kowalczykowski, S.C. (1997). A single-stranded 92

DNA-binding protein is needed for efficient presynaptic complex formation by the Saccharomyces cerevisiae Rad51 protein. J Biol Chem 272: 7940–5. Sun, H., Karow, J.K., Hickson, I.D., and Maizels, N. (1998). The Bloom’s syndrome helicase unwinds G4 DNA. J Biol Chem 273: 27587–92.

Sy, S.M.H., Huen, M.S.Y., and Chen, J. (2009). PALB2 is an integral component of the BRCA complex required for homologous recombination repair. Proc Natl Acad Sci 106: 7155–7160.

Takai, H., Smogorzewska, A., Lange, T. de, Marciniak, R.A., Johnson, F.B., Guarente, L., et al. (2003). DNA damage foci at dysfunctional telomeres. Curr Biol 13: 1549–56.

Towler, W.I., Zhang, J., Ransburgh, D.J.R., Toland, A.E., Ishioka, C., Chiba, N., and Parvin, J.D. (2013). Analysis of BRCA1 variants in double-strand break repair by homologous recombination and single-strand annealing. Hum Mutat 34: 439–45.

Ulaner, G.A., Hoffman, A.R., Otero, J., Huang, H.-Y., Zhao, Z., Mazumdar, M., et al. (2004). Divergent patterns of telomere maintenance mechanisms among human sarcomas: Sharply contrasting prevalence of the alternative lengthening of telomeres mechanism in Ewing’s sarcomas and osteosarcomas. Genes Chromosomes Cancer 41: 155–62.

Uziel, T., Lerenthal, Y., Moyal, L., Andegeko, Y., Mittelman, L., and Shiloh, Y. (2003). Requirement of the MRN complex for ATM activation by DNA damage. EMBO J 22: 5612–21.

Venturini, L., Motta, R., Gronchi, A., Daidone, M., and Zaffaroni, N. (2010). Prognostic relevance of ALT-associated markers in liposarcoma: A comparative analysis. BMC Cancer 10: 254.

Villa, R., Daidone, M.G., Motta, R., Venturini, L., Marco, C. De, Vannelli, A., et al. (2008). Multiple mechanisms of telomere maintenance exist and differentially affect clinical outcome in diffuse malignant peritoneal mesothelioma. Clin Cancer Res 14: 4134–40.

Wang, Y., Cortez, D., Yazdi, P., Neff, N., Elledge, S.J., and Qin, J. (2000). BASC, a super complex of BRCA1-associated proteins involved in the recognition and repair of aberrant DNA structures. Genes Dev 14: 927–39.

Westermark, U.K., Reyngold, M., Olshen, A.B., Baer, R., Jasin, M., and Moynahan, M.E. (2003). BARD1 participates with BRCA1 in homology-directed repair of chromosome breaks. Mol Cell Biol 23: 7926–36.

Williams, E.S., Cornforth, M.N., Goodwin, E.H., and Bailey, S.M. (2011). CO-FISH, 93

COD-FISH, ReD-FISH, SKY-FISH. Methods Mol Biol 735: 113–24.

Wu, G., Jiang, X., Lee, W.-H., and Chen, P.-L. (2003). Assembly of functional ALT- associated promyelocytic leukemia bodies requires Nijmegen breakage syndrome 1. Cancer Res 63: 2589–95.

Wu, G., and Lee, W.-H. (2006). CtIP, a multivalent adaptor connecting transcriptional regulation, checkpoint control and tumor suppression. Cell Cycle 5: 1592–6.

Wu, G., Lee, W.H., and Chen, P.L. (2000). NBS1 and TRF1 colocalize at promyelocytic leukemia bodies during late S/G2 phases in immortalized telomerase-negative cells. Implication of NBS1 in alternative lengthening of telomeres. J Biol Chem 275: 30618– 22.

Wu, L.C., Wang, Z.W., Tsan, J.T., Spillman, M.A., Phung, A., Xu, X.L., et al. (1996). Identification of a RING protein that can interact in vivo with the BRCA1 gene product. Nat Genet 14: 430–40.

Wu, X., and Lieber, M.R. (1996). Protein-protein and protein-DNA interaction regions within the DNA end-binding protein Ku70-Ku86. Mol Cell Biol 16: 5186–5193.

Xiong, J., Fan, S., Meng, Q., Schramm, L., Wang, C., Bouzahza, B., et al. (2003). BRCA1 inhibition of telomerase activity in cultured cells. Mol Cell Biol 23: 8668–90.

Yankiwski, V., Marciniak, R.A., Guarente, L., and Neff, N.F. (2000). Nuclear structure in normal and Bloom syndrome cells. Proc Natl Acad Sci U S A 97: 5214–9.

Yeager, T.R., Neumann, A.A., Englezou, A., Huschtscha, L.I., Noble, J.R., and Reddel, R.R. (1999). Telomerase-negative immortalized human cells contain a novel type of promyelocytic leukemia (PML) body. Cancer Res 59: 4175–9.

Yee, N.S., Zhou, W., Lee, M., and Yee, R.K. (2012). Targeted silencing of TRPM7 ion channel induces replicative senescence and produces enhanced cytotoxicity with gemcitabine in pancreatic adenocarcinoma. Cancer Lett 318: 99–105.

You, Z., Chahwan, C., Bailis, J., Hunter, T., and Russell, P. (2005). ATM activation and its recruitment to damaged DNA require binding to the C terminus of Nbs1. Mol Cell Biol 25: 5363–79.

Yu, H.-Q., Miyoshi, D., and Sugimoto, N. (2006). Characterization of structure and stability of long telomeric DNA G-quadruplexes. J Am Chem Soc 128: 15461–8.

Zhang, F., Bick, G., Park, J.-Y., and Andreassen, P.R. (2012). MDC1 and RNF8 function in a pathway that directs BRCA1-dependent localization of PALB2 required for 94 homologous recombination. J Cell Sci 125: 6049–57.

Zhang, F., Ma, J., Wu, J., Ye, L., Cai, H., Xia, B., and Yu, X. (2009). PALB2 links BRCA1 and BRCA2 in the DNA-damage response. Curr Biol 19: 524–9.

Zhang, Y.-Q., Bianco, A., Malkinson, A.M., Leoni, V.P., Frau, G., Rosa, N. De, et al. (2012). BARD1: An independent predictor of survival in non-small cell lung cancer. Int J cancer 131: 83–94.

Zhong, Z.-H., Jiang, W.-Q., Cesare, A.J., Neumann, A.A., Wadhwa, R., and Reddel, R.R. (2007). Disruption of telomere maintenance by depletion of the MRE11/RAD50/NBS1 complex in cells that use alternative lengthening of telomeres. J Biol Chem 282: 29314– 22.

Zhu, X.D., Küster, B., Mann, M., Petrini, J.H., and Lange, T. de (2000). Cell-cycle- regulated association of RAD50/MRE11/NBS1 with TRF2 and human telomeres. Nat Genet 25: 347–52.

Zhu, X.-D., Niedernhofer, L., Kuster, B., Mann, M., Hoeijmakers, J.H.., and Lange, T. de (2003). ERCC1/XPF removes the 3′ overhang from uncapped telomeres and represses formation of telomeric DNA-containing double minute chromosomes. Mol Cell 12: 1489–1498.