DOCSLIB.ORG

The Crystal Structure of the C45S Mutant of Annelid Arenicola Marina

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Crystal Structure of the C45S Mutant of Annelid Arenicola Marina JOBNAME: PROSCI 17#4 2008 PAGE: 1 OUTPUT: Wednesday March 5 15:35:56 2008 csh/PROSCI/152302/ps0733993 The crystal structure of the C45S mutant of annelid Arenicola marina peroxiredoxin 6 supports its assignment to the mechanistically typical 2-Cys subfamily without any formation of toroid-shaped decamers AUDE SMEETS,1 ELE´ ONORE LOUMAYE,2 ANDRE´ CLIPPE,2 JEAN-FRANCxOIS REES,2 2 1 BERNARD KNOOPS, AND JEAN-PAUL DECLERCQ 1Unit of Structural Chemistry (CSTR), Universite´ catholique de Louvain, B-1348 Louvain-la-Neuve, Belgium 2Laboratory of Cell Biology, Institut des Sciences de la Vie, Universite´ catholique de Louvain, B-1348 Louvain-la-Neuve, Belgium (RECEIVED December 10, 2007; FINAL REVISION January 24, 2008; ACCEPTED January 28, 2008) Abstract The peroxiredoxins (PRDXs) define a superfamily of thiol-dependent peroxidases able to reduce hydrogen peroxide, alkyl hydroperoxides, and peroxynitrite. Besides their cytoprotective antioxidant function, PRDXs have been implicated in redox signaling and chaperone activity, the latter depending on the formation of decameric high-molecular-weight structures. PRDXs have been mechanistically divided into three major subfamilies, namely typical 2-Cys, atypical 2-Cys, and 1-Cys PRDXs, based on the number and position of cysteines involved in the catalysis. We report the structure of the C45S mutant of annelid worm Arenicola marina PRDX6 in three different crystal forms determined at 1.6, 2.0, and 2.4 A˚ resolution. Although A. marina PRDX6 was cloned during the search of annelid homo- logs of mammalian 1-Cys PRDX6s, the crystal structures support its assignment to the mechanistically typical 2-Cys PRDX subfamily. The protein is composed of two distinct domains: a C-terminal domain and an N-terminal domain exhibiting a thioredoxin fold. The subunits are associated in dimers com- patible with the formation of intersubunit disulfide bonds between the peroxidatic and the resolving cysteine residues in the wild-type enzyme. The packing of two crystal forms is very similar, with pairs of dimers associated as tetramers. The toroid-shaped decamers formed by dimer association and observed in most typical 2-Cys PRDXs is not present. Thus, A. marina PRDX6 presents structural features of typical 2-Cys PRDXs without any formation of toroid-shaped decamers, suggesting that it should function more like a cytoprotective antioxidant enzyme or a modulator of peroxide-dependent cell signaling rather than a molecular chaperone. Keywords: peroxiredoxin; crystal structure; Arenicola marina; toroid-shaped decamer; thioredoxin fold Reprint requests to: Jean-Paul Declercq, Unit of Structural Chem- Besides classical cellular antioxidant enzymes involved istry (CSTR), Universite´ catholique de Louvain, 1 place Louis Pasteur, in the reduction of hydrogen peroxide and alkyl hydro- B-1348 Louvain-la-Neuve, Belgium; e-mail: [email protected]; peroxides in animal cells, such as glutathione peroxidases fax: 32-10-472707. Article and publication are at http://www.proteinscience.org/cgi/ (GPXs) and catalase (CAT), peroxiredoxins (PRDXs) doi/10.1110/ps.073399308. have emerged more recently as a major superfamily of 700 Protein Science (2008), 17:700–710. Published by Cold Spring Harbor Laboratory Press. Copyright Ó 2008 The Protein Society ps0733993 Smeets et al. ARTICLE RA JOBNAME: PROSCI 17#4 2008 PAGE: 2 OUTPUT: Wednesday March 5 15:35:59 2008 csh/PROSCI/152302/ps0733993 Crystal structure of A. marina peroxiredoxin 6 evolutionarily conserved peroxidases (Hofmann et al. typical 2-Cys subfamily without any formation of toroid- 2002; Wood et al. 2002; Rhee et al. 2005a). shaped decamers. A similar situation was already ob- PRDXs are selenium- and heme-free peroxidases that served for the archaeal PRDX from Aeropyrum pernix depend on cysteines for their catalytic activity (for K1, but with the formation of toroid-shaped decamers review,seeWoodetal.2003).Mechanistically,PRDXs (Mizohata et al. 2005). have been classified into three subfamilies depending on the number and the position of cysteines implicated in Results and Discussion the catalysis. All PRDXs contain a conserved peroxidatic cysteine residue in the N-terminal domain of the protein. Quality of the models During the catalytic cycle, the peroxidatic cysteine is first oxidized by peroxide or peroxynitrite to sulfenic acid. We report here the crystal structure of the C45S mutant of Then, this intermediate is transformed either by forming a Arenicola marina PRDX6 in three different crystal forms. disulfide bond with a resolving C-terminal cysteine of Thefirsttwoformsaremonoclinic with four monomers another subunit (typical 2-Cys subfamily) or the same (A–D) in the asymmetric unit, and the last one is ortho- subunit (atypical 2-Cys subfamily). In the 1-Cys sub- rhombic with eight monomers (A–H) in the asymmetric family, only an N-terminal peroxidatic cysteine is present unit. In all cases, pairs of monomers are associated to in the enzyme, and the sulfenic acid of the peroxidatic form dimers. cysteine is reduced by a heterologous thiol-containing In the monoclinic structures, the electron density is reductant such as glutathione. usually well defined along the protein chain except for Functionally, PRDXs are important cytoprotective anti- the first residue at the N-terminal part and a few residues oxidant enzymes, although their reactivity with peroxides (including the 63His tag) at the C-terminal part of the hasbeenpreviouslyquestionedcomparedwithGPXs polypeptides. The situation is similar for the first four and CAT (Hofmann et al. 2002). However, reassessments chains (A–D) of the orthorhombic structure, but in the of the kinetic values have shown that PRDXs may exhibit four remaining chains (E–H) the electron density is poorly high catalytic efficiencies compatible with their role as defined in some loop (residues 188–201), and in this region cytoprotective antioxidant enzymes (Parsonage et al. 2005; the structural model was built according to the well-defined Oguscu et al. 2007; Peskin et al. 2007; Trujillo et al. 2007). chains. The Ramachandran diagrams computed by the pro- Mammalian typical 2-Cys PRDXs have been also implicated gram Molprobity (Lovell et al. 2003) indicate that about as regulators of redox signaling due to their ability to be 98% of the residues lie in favored regions and that all of reversibly inactivated by peroxides during the catalytic them adopt an allowed conformation. process that accommodates the intracellular messenger All the monomers are very similar, as well as their function of hydrogen peroxide (Rhee et al. 2005b). Finally, association to form dimers. For this reason, one monomer more recently, bacteria, yeast, and human 2-Cys PRDXs and one dimer from the first monoclinic form were have been shown to act alternatively as peroxidases and selected for a detailed description since the resolution molecular chaperones, the functional switch necessitating of 1.6 A˚ achieved for this structure is substantially higher the formation of toroid-shaped homodecamers and high- than the two other ones (2.0 A˚ and 2.4 A˚ ). The avail- molecular-weight complexes (Jang et al. 2004; Chuang et al. ability of three different crystal structures remains impor- 2006; Lee et al. 2007). tant, however, because they will present differences in the In search of a homolog of mammalian 1-Cys PRDX6 packing of the dimers. Indeed, it has been shown that in the marine annelid Arenicola marina,wehavecloned in the case of typical 2-Cys PRDXs, the oligomerization and initiated the biochemical characterization of a PRDX of the dimers may play an important role in the redox with high sequence homology with mammalian PRDX6s mechanism and that enzyme activity could be linked to (E.Loumaye,A.Andersen,A.Clippe,H.Degand,M. the oligomeric state (Alphey et al. 2000; Schro¨der et al. Dubuisson, F. Zal, P. Morsomme, J.F. Rees, and B. 2000; Wood et al. 2002; Parsonage et al. 2005). Knoops, in prep.). Interestingly, although A. marina PRDX6 presents 63% identity and 85% similarity with Structure of the monomer human 1-Cys PRDX6, the protein possesses five cys- teines, among which two cysteines function as peroxi- In the first monoclinic crystal form, the average RMS de- datic and resolving cysteines of typical 2-Cys PRDXs viation between the Ca atoms of the four chains is 0.184 (E.Loumaye,A.Andersen,A.Clippe,H.Degand,M. A˚ , and chain B can be considered as the ‘‘central subunit’’ Dubuisson, F. Zal, P. Morsomme, J.F. Rees, and B. with an average RMS deviation of 0.165 A˚ between this Knoops, in prep.). The crystal structures of the C45S chain and the three other ones. Figure 1 shows the fold mutant of annelid worm Arenicola marina PRDX6 pre- of this monomer and a topological diagram. The structure sented here support its assignment to the mechanistically is composed of two domains. The N-terminal domain 1 www.proteinscience.org 701 JOBNAME: PROSCI 17#4 2008 PAGE: 3 OUTPUT: Wednesday March 5 15:36:00 2008 csh/PROSCI/152302/ps0733993 Smeets et al. b-sheet (b10, b11, b13, b12) and one a-helix (a6) located between strands b11 and b12. There are only a very few intrasubunit contacts between the two domains. They involve residues located in helix a5indomain1and in the loop between b10 and b11 in domain 2. Hydrogen bonds are formed between Ser162 Og andThr173Og1 and between Arg158 Nh1 and the carbonyl oxygen of Trp177. A. marina PRDX6 presents 63% identity with human PRDX6 (hORF6), whose crystal structure has been deter- mined and corresponds to PDB code 1prx (Choi et al. 1998). The folds of these two monomers of PRDX6 are very similar: 195 residues can be aligned with an RMS deviation of 0.97 A˚ between the Ca atoms. Large differ- ences occur mainly in domain 1, in two regions that do not belong to the thioredoxin fold: the loop between a3 and b5, and the short two-stranded b-sheet (b6, b7), which is a unique feature of A.
Load more

Recommended publications
  • UC San Diego Electronic Theses and Dissertations
    UC San Diego UC San Diego Electronic Theses and Dissertations Title Vanadium-dependent bromoperoxidase in a marine Synechococcus / Permalink https://escholarship.org/uc/item/34x4t8rp Author Johnson, Todd Laurel Publication Date 2013 Peer reviewed|Thesis/dissertation eScholarship.org Powered by the California Digital Library University of California UNIVERSITY OF CALIFORNIA, SAN DIEGO Vanadium-dependent bromoperoxidase in a marine Synechococcus A dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy in Marine Biology by Todd L. Johnson Committee in charge: Brian Palenik, Chair Bianca Brahamsha, Co-Chair Lihini Aluwihare James Golden Jens Mühle Bradley Moore 2013 Copyright Todd L. Johnson, 2013 All rights reserved. The dissertation of Todd L. Johnson is approved, and it is acceptable in quality and form for publication on microfilm and electronically: ________________________________________________________ ________________________________________________________ ________________________________________________________ ________________________________________________________ ________________________________________________________ Co-Chair ________________________________________________________ Chair University of California, San Diego 2013 iii DEDICATION To Janet, Tim, and Andrew Johnson, for unconditional love and support. iv TABLE OF CONTENTS Signature Page……………………………………………………………………………iii Dedication ………………………………………………………………………………..iv Table of Contents………………………………………………………………………….v List
    [Show full text]
  • Oxidative Stress Modulates the Expression Pattern of Peroxiredoxin-6 in Peripheral Blood Mononuclear Cells of Asthmatic Patients and Bronchial Epithelial Cells
    Allergy Asthma Immunol Res. 2020 May;12(3):523-536 https://doi.org/10.4168/aair.2020.12.3.523 pISSN 2092-7355·eISSN 2092-7363 Original Article Oxidative Stress Modulates the Expression Pattern of Peroxiredoxin-6 in Peripheral Blood Mononuclear Cells of Asthmatic Patients and Bronchial Epithelial Cells Hyun Jae Shim ,1 So-Young Park ,2 Hyouk-Soo Kwon ,1 Woo-Jung Song ,1 Tae-Bum Kim ,1 Keun-Ai Moon ,1 Jun-Pyo Choi ,1 Sin-Jeong Kim ,1 You Sook Cho 1* 1Division of Allergy and Clinical Immunology, Department of Internal Medicine, Asan Medical Center, University of Ulsan College of Medicine, Seoul, Korea 2Division of Pulmonary, Allergy and Critical Care Medicine, Department of Internal Medicine, Konkuk University Medical Center, Seoul, Korea Received: Jul 8, 2019 ABSTRACT Revised: Nov 29, 2019 Accepted: Dec 23, 2019 Purpose: Reduction-oxidation reaction homeostasis is vital for regulating inflammatory Correspondence to conditions and its dysregulation may affect the pathogenesis of chronic airway inflammatory You Sook Cho, MD, PhD diseases such as asthma. Peroxiredoxin-6, an important intracellular anti-oxidant molecule, Division of Allergy and Clinical Immunology, Department of Internal Medicine, Asan is reported to be highly expressed in the airways and lungs. The aim of this study was to Medical Center, University of Ulsan College of analyze the expression pattern of peroxiredoxin-6 in the peripheral blood mononuclear cells Medicine, 88 Olympic-ro 43-gil, Songpa-gu, (PBMCs) of asthmatic patients and in bronchial epithelial cells (BECs). Seoul 05505, Korea. Methods: The expression levels and modifications of peroxiredoxin-6 were evaluated in Tel: +82-2-3010-3285 PBMCs from 22 asthmatic patients.
    [Show full text]
  • SUPPLEMENTARY DATA Supplementary Figure 1. The
    SUPPLEMENTARY DATA Supplementary Figure 1. The results of Sirt1 activation in primary cultured TG cells using adenoviral system. GFP expression served as the control (n = 4 per group). Supplementary Figure 2. Two different Sirt1 activators, SRT1720 (0.5 µM or 1 µM ) and RSV (1µM or 10µM), induced the upregulation of Sirt1 in the primary cultured TG cells (n = 4 per group). ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary Table 1. Primers used in qPCR Gene Name Primer Sequences Product Size (bp) Sirt1 F: tgccatcatgaagccagaga 241 (NM_001159589) R: aacatcgcagtctccaagga NOX4 F: tgtgcctttattgtgcggag 172 (NM_001285833.1) R: gctgatacactggggcaatg Supplementary Table 2. Antibodies used in Western blot or Immunofluorescence Antibody Company Cat. No Isotype Dilution Sirt1 Santa Cruz * sc-15404 Rabbit IgG 1/200 NF200 Sigma** N5389 Mouse IgG 1/500 Tubulin R&D# MAB1195 Mouse IgG 1/500 NOX4 Abcam† Ab133303 Rabbit IgG 1/500 NOX2 Abcam Ab129068 Rabbit IgG 1/500 phospho-AKT CST‡ #4060 Rabbit IgG 1/500 EGFR CST #4267 Rabbit IgG 1/500 Ki67 Santa Cruz sc-7846 Goat IgG 1/500 * Santa Cruz Biotechnology, Santa Cruz, CA, USA ** Sigma aldrich, Shanghai, China # R&D Systems Inc, Minneapolis, MN, USA † Abcam, Inc., Cambridge, MA, USA ‡ Cell Signaling Technology, Inc., Danvers, MA, USA ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary
    [Show full text]
  • Role of Peroxiredoxin 6 in Human Melanoma
    Role of Peroxiredoxin 6 in human melanoma Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Bayerischen Julius-Maximilians-Universität Würzburg vorgelegt von Alexandra Schmitt aus Würzburg Würzburg 2015 Eingereicht am:__________________________ Mitglieder der Promotionskommission: Vorsitzender:____________________________ Gutachter:______________________________ Gutachter:______________________________ Tag des Promotionskolloquiums:___________________ Doktorurkunde ausgehändigt am:___________________ Eidesstattliche Erklärung Gemäß §4, Abs. 3, Ziff. 3, 5 und 8 der Promotionsordnung der Fakultät für Biologie der Bayerischen Julius-Maximilians-Universität Würzburg Hiermit erkläre ich ehrenwörtlich, dass ich die vorliegende Dissertation selbständig angefertigt und keine anderen als die angegebenen Quellen und Hilfsmittel verwendet habe. Ich erkläre weiterhin, dass die vorliegende Dissertation weder in gleicher, noch in ähnlicher Form bereits in einem anderen Prüfungsverfahren vorgelegen hat. Weiterhin erkläre ich, dass ich außer den mit dem Zulassungsantrag urkundlich vorgelegten Graden keine weiteren akademischen Grade erworben oder zu erwerben versucht habe. Würzburg, Januar 2015 ______________________________________ Alexandra Schmitt Table of contents 1. Abstract ................................................................................................................. 1 2. Zusammenfassung ............................................................................................... 3 3. Introduction ..........................................................................................................
    [Show full text]
  • GPX4 at the Crossroads of Lipid Homeostasis and Ferroptosis Giovanni C
    REVIEW GPX4 www.proteomics-journal.com GPX4 at the Crossroads of Lipid Homeostasis and Ferroptosis Giovanni C. Forcina and Scott J. Dixon* formation of toxic radicals (e.g., R-O•).[5] Oxygen is necessary for aerobic metabolism but can cause the harmful The eight mammalian GPX proteins fall oxidation of lipids and other macromolecules. Oxidation of cholesterol and into three clades based on amino acid phospholipids containing polyunsaturated fatty acyl chains can lead to lipid sequence similarity: GPX1 and GPX2; peroxidation, membrane damage, and cell death. Lipid hydroperoxides are key GPX3, GPX5, and GPX6; and GPX4, GPX7, and GPX8.[6] GPX1–4 and 6 (in intermediates in the process of lipid peroxidation. The lipid hydroperoxidase humans) are selenoproteins that contain glutathione peroxidase 4 (GPX4) converts lipid hydroperoxides to lipid an essential selenocysteine in the enzyme + alcohols, and this process prevents the iron (Fe2 )-dependent formation of active site, while GPX5, 6 (in mouse and toxic lipid reactive oxygen species (ROS). Inhibition of GPX4 function leads to rats), 7, and 8 use an active site cysteine lipid peroxidation and can result in the induction of ferroptosis, an instead. Unlike other family members, GPX4 (PHGPx) can act as a phospholipid iron-dependent, non-apoptotic form of cell death. This review describes the hydroperoxidase to reduce lipid perox- formation of reactive lipid species, the function of GPX4 in preventing ides to lipid alcohols.[7,8] Thus,GPX4ac- oxidative lipid damage, and the link between GPX4 dysfunction, lipid tivity is essential to maintain lipid home- oxidation, and the induction of ferroptosis. ostasis in the cell, prevent the accumula- tion of toxic lipid ROS and thereby block the onset of an oxidative, iron-dependent, non-apoptotic mode of cell death termed 1.
    [Show full text]
  • Methods and Compositions for the Treatment of Infection and Control of Flora Using Haloperoxidase
    Europaisches Patentamt 19 European Patent Office Office europeen des brevets © Publication number : 0 500 387 A2 12 EUROPEAN PATENT APPLICATION (2j) Application number : 92301448.4 6i) int. ci.5: A61K 37/50 (22) Date of filing : 21.02.92 (30) Priority: 21.02.91 US 660994 (72) Inventor : Allen, Robert Charles 3215 Woodcrest San Antonio, Texas 78209 (US) (43) Date of publication of application 26.08.92 Bulletin 92/35 @) Representative : Sheard, Andrew Gregory et al Kilburn & Strode 30, John Street @ Designated Contracting States : London WC1N 2DD (GB) AT BE CH DE DK ES FR GB GR IT LI LU MC NL PT SE © Applicant : EXOXEMIS, INC. 18585 Sigma Road, Suite 100 San Antonio, Texas 78209 (US) (54) Methods and compositions for the treatment of infection and control of flora using haloperoxidase. (57) Haloperoxidases are used to selectively bind to and, in the presence of peroxide and halide, inhibit the growth of target microbes without eliminating desirable microbes or significantly damaging other components, such as host cells, in the environment of the target microbe. When a target microbe, e.g., a pathogenic microbe, has a binding capacity for haloperoxidase greater than that of a desired microbe, e.g., members of the normal flora, the target microbe selectively binds the haloperoxidase with little or no binding of the haloperoxidase by the desired microbe. In the presence of peroxide and halide, the target bound haloperoxidase catalyzes halide oxidation and facilitates the disproportionation of peroxide to singlet molecular oxygen at the surface of the target microbe. The lifetime of singlet molecular oxygen restricts damage to the surface resulting in selective killing of the target microbe with a minimum of collateral damage to the desired microbe or physiological medium.
    [Show full text]
  • PRDX1 and PRDX6 Are Repressed in Papillary Thyroid Carcinomas Via BRAF V600E-Dependent and -Independent Mechanisms
    548 INTERNATIONAL JOURNAL OF ONCOLOGY 44: 548-556, 2014 PRDX1 and PRDX6 are repressed in papillary thyroid carcinomas via BRAF V600E-dependent and -independent mechanisms ARIANNA NICOLUSSI1*, SONIA D'INZEO1*, GABRIELLA MINCIONE4,5, AMELIA BUFFONE2, MARIA CARMELA DI MARCANTONIO4, ROBERTO COTELLESE4, ANNADOMENICA CICHELLA4, CARLO CAPALBO2, CIRA DI GIOIA3, FRANCESCO NARDI3, GIUSEPPE GIANNINI2 and ANNA COPPA1 Departments of 1Experimental Medicine, 2Molecular Medicine, 3Radiological, Oncological and Pathological Sciences, Sapienza University of Rome, Rome; 4Department of Experimental and Clinical Sciences, 5Center of Excellence on Aging, Ce.S.I., ‘G. d'Annunzio’ University Foundation, Chieti-Pescara, Italy Received September 18, 2013; Accepted November 6, 2013 DOI: 10.3892/ijo.2013.2208 Abstract. Many clinical studies highlight the dichotomous Introduction role of PRDXs in human cancers, where they can exhibit strong tumor-suppressive or tumor-promoting functions. In recent years, several studies have linked oxidative stress Recent evidence suggests that lower expression of PRDXs (OS) to thyroid cancer (1-3). The thyroid gland itself gener- correlates with cancer progression in colorectal cancer (CRC) ates reactive radical molecules, through the process of iodine or in esophageal squamous carcinoma. In the thyroid, increased metabolism and thyroid hormone synthesis. During this process, levels of PRDX1 has been described in follicular adenomas TSH stimulates H2O2 production, which is the substrate of and carcinomas, as well as in thyroiditis, while reduced levels thyroperoxidase (TPO) on the apical membrane of the thyroid of PRDX6 has been found in follicular adenomas. We studied follicular cells (4). Therefore, thyrocytes need protective the expression of PRDX1 and PRDX6, in a series of thyroid mechanisms that limit the oxidative damage of H2O2 produc- tissue samples, covering different thyroid diseases, including tion by catalase, gluthatione peroxidases and peroxiredoxins 13 papillary thyroid carcinomas (PTCs).
    [Show full text]
  • Reactive Oxygen Species and Protein Modifications in Spermatozoa
    Biology of Reproduction, 2017, 97(4), 577–585 doi:10.1093/biolre/iox104 Review Advance Access Publication Date: 13 September 2017 Review Reactive oxygen species and protein modifications in spermatozoa† ∗ Cristian O’Flaherty1,2,3, and David Matsushita-Fournier2,3 Downloaded from https://academic.oup.com/biolreprod/article/97/4/577/4157784 by guest on 01 October 2021 1Department of Surgery (Urology Division), McGill University, Montreal,´ Quebec,´ Canada; 2Pharmacology and Therapeutics, Faculty of Medicine, McGill University, Montreal,´ Quebec,´ Canada and 3The Research Institute, McGill University Health Centre, Montreal,´ Quebec,´ Canada ∗Correspondence: The Research Insitute, McGill University Health Centre, room EM03212, 1001 Decarie Boulevard, Montreal,´ QC H4A 3J1, Canada. Fax: +514-933-4149; E-mail: cristian.ofl[email protected] †Grant support: This work was supported by a grant from the Canadian Institutes of Health Research (MOP 133661 to C.O.). CO is the recipient of the Chercher Boursier Junior 2 salary award from the Fonds de la Recherche en SanteduQu´ ebec´ (33158). Received 2 June 2017; Revised 1 August 2017; Accepted 11 September 2017 Abstract Cellular response to reactive oxygen species (ROS) includes both reversible redox signaling and irreversible nonenzymatic reactions which depend on the nature and concentration of the ROS involved. Changes in thiol/disulfide pairs affect protein conformation, enzymatic activity, ligand binding, and protein–protein interactions. During spermatogenesis and epididymal maturation, there are ROS-dependent modifications of the sperm chromatin and flagellar proteins.The sperma- tozoon is regulated by redox mechanisms to acquire fertilizing ability. For this purpose, controlled amounts of ROS are necessary to assure sperm activation (motility and capacitation).
    [Show full text]
  • Peroxiredoxins: Guardians Against Oxidative Stress and Modulators of Peroxide Signaling
    Peroxiredoxins: Guardians Against Oxidative Stress and Modulators of Peroxide Signaling Perkins, A., Nelson, K. J., Parsonage, D., Poole, L. B., & Karplus, P. A. (2015). Peroxiredoxins: guardians against oxidative stress and modulators of peroxide signaling. Trends in Biochemical Sciences, 40(8), 435-445. doi:10.1016/j.tibs.2015.05.001 10.1016/j.tibs.2015.05.001 Elsevier Accepted Manuscript http://cdss.library.oregonstate.edu/sa-termsofuse Revised Manuscript clean Click here to download Manuscript: Peroxiredoxin-TiBS-revised-4-25-15-clean.docx 1 2 3 4 5 6 7 8 9 Peroxiredoxins: Guardians Against Oxidative Stress and Modulators of 10 11 12 Peroxide Signaling 13 14 15 16 17 18 19 1 2 2 2 20 Arden Perkins, Kimberly J. Nelson, Derek Parsonage, Leslie B. Poole * 21 22 23 and P. Andrew Karplus1* 24 25 26 27 28 29 30 31 1 Department of Biochemistry and Biophysics, Oregon State University, Corvallis, Oregon 97333 32 33 34 2 Department of Biochemistry, Wake Forest School of Medicine, Winston-Salem, North Carolina 27157 35 36 37 38 39 40 41 *To whom correspondence should be addressed: 42 43 44 L.B. Poole, ph: 336-716-6711, fax: 336-713-1283, email: [email protected] 45 46 47 P.A. Karplus, ph: 541-737-3200, fax: 541- 737-0481, email: [email protected] 48 49 50 51 52 53 54 55 Keywords: antioxidant enzyme, peroxidase, redox signaling, antioxidant defense 56 57 58 59 60 61 62 63 64 65 1 2 3 4 5 6 7 8 9 Abstract 10 11 12 13 Peroxiredoxins (Prxs) are a ubiquitous family of cysteine-dependent peroxidase enzymes that play dominant 14 15 16 roles in regulating peroxide levels within cells.
    [Show full text]
  • Molecular Profiling of Innate Immune Response Mechanisms in Ventilator-Associated 2 Pneumonia
    bioRxiv preprint doi: https://doi.org/10.1101/2020.01.08.899294; this version posted January 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Title: Molecular profiling of innate immune response mechanisms in ventilator-associated 2 pneumonia 3 Authors: Khyatiben V. Pathak1*, Marissa I. McGilvrey1*, Charles K. Hu3, Krystine Garcia- 4 Mansfield1, Karen Lewandoski2, Zahra Eftekhari4, Yate-Ching Yuan5, Frederic Zenhausern2,3,6, 5 Emmanuel Menashi3, Patrick Pirrotte1 6 *These authors contributed equally to this work 7 Affiliations: 8 1. Collaborative Center for Translational Mass Spectrometry, Translational Genomics Research 9 Institute, Phoenix, Arizona 85004 10 2. Translational Genomics Research Institute, Phoenix, Arizona 85004 11 3. HonorHealth Clinical Research Institute, Scottsdale, Arizona 85258 12 4. Applied AI and Data Science, City of Hope Medical Center, Duarte, California 91010 13 5. Center for Informatics, City of Hope Medical Center, Duarte, California 91010 14 6. Center for Applied NanoBioscience and Medicine, University of Arizona, Phoenix, Arizona 15 85004 16 Corresponding author: 17 Dr. Patrick Pirrotte 18 Collaborative Center for Translational Mass Spectrometry 19 Translational Genomics Research Institute 20 445 North 5th Street, Phoenix, AZ, 85004 21 Tel: 602-343-8454; 22 [[email protected]] 23 Running Title: Innate immune response in ventilator-associated pneumonia 24 Key words: ventilator-associated pneumonia; endotracheal aspirate; proteome, metabolome; 25 neutrophil degranulation 26 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.01.08.899294; this version posted January 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder.
    [Show full text]
  • Oxidative Stress in Thyroid Carcinomas: Biological and Clinical Significance
    26 3 Endocrine-Related R Ameziane El Hassani et al. Oxidative stress in thyroid 26:3 R131–R143 Cancer carcinomas REVIEW Oxidative stress in thyroid carcinomas: biological and clinical significance Rabii Ameziane El Hassani1, Camille Buffet2, Sophie Leboulleux3 and Corinne Dupuy2 1Laboratory of Biology of Human Pathologies ‘BioPatH’, Faculty of Sciences, Mohammed V University of Rabat, Rabat, Morocco 2UMR 8200 CNRS, Gustave Roussy and Paris Sud University, Villejuif, France 3Department of Nuclear Medicine and Endocrine Oncology, Gustave Roussy and Paris Sud University, Villejuif, France Correspondence should be addressed to C Dupuy: [email protected] Abstract At physiological concentrations, reactive oxygen species (ROS), including superoxide Key Words anions and H2O2, are considered as second messengers that play key roles in cellular f thyroid functions, such as proliferation, gene expression, host defence and hormone synthesis. f oxidative stress However, when they are at supraphysiological levels, ROS are considered potent DNA- f genetic instability damaging agents. Their increase induces oxidative stress, which can initiate and maintain f NADPH oxidase genomic instability. The thyroid gland represents a good model for studying the impact f dedifferentiation of oxidative stress on genomic instability. Indeed, one particularity of this organ is that follicular thyroid cells synthesise thyroid hormones through a complex mechanism that requires H2O2. Because of their detection in thyroid adenomas and in early cell transformation, both oxidative stress and DNA damage are believed to be neoplasia- preceding events in thyroid cells. Oxidative DNA damage is, in addition, detected in the advanced stages of thyroid cancer, suggesting that oxidative lesions of DNA also contribute to the maintenance of genomic instability during the subsequent phases of tumourigenesis.
    [Show full text]
  • The Role of Peroxiredoxin 6 in Cell Signaling
    antioxidants Review The Role of Peroxiredoxin 6 in Cell Signaling José A. Arevalo and José Pablo Vázquez-Medina * Department of Integrative Biology, University of California, Berkeley, CA, 94705, USA; [email protected] * Correspondence: [email protected]; Tel.: +1-510-664-5063 Received: 7 November 2018; Accepted: 20 November 2018; Published: 24 November 2018 Abstract: Peroxiredoxin 6 (Prdx6, 1-cys peroxiredoxin) is a unique member of the peroxiredoxin family that, in contrast to other mammalian peroxiredoxins, lacks a resolving cysteine and uses glutathione and π glutathione S-transferase to complete its catalytic cycle. Prdx6 is also the only peroxiredoxin capable of reducing phospholipid hydroperoxides through its glutathione peroxidase (Gpx) activity. In addition to its peroxidase activity, Prdx6 expresses acidic calcium-independent phospholipase A2 (aiPLA2) and lysophosphatidylcholine acyl transferase (LPCAT) activities in separate catalytic sites. Prdx6 plays crucial roles in lung phospholipid metabolism, lipid peroxidation repair, and inflammatory signaling. Here, we review how the distinct activities of Prdx6 are regulated during physiological and pathological conditions, in addition to the role of Prdx6 in cellular signaling and disease. Keywords: glutathione peroxidase; phospholipase A2; inflammation; lipid peroxidation; NADPH (nicotinamide adenine dinucleotide phosphate) oxidase; phospholipid hydroperoxide 1. Introduction Peroxiredoxins are a ubiquitous family of highly conserved enzymes that share a catalytic mechanism in which a redox-active (peroxidatic) cysteine residue in the active site is oxidized by a peroxide [1]. In peroxiredoxins 1–5 (2-cys peroxiredoxins), the resulting sulfenic acid then reacts with another (resolving) cysteine residue, forming a disulfide that is subsequently reduced by an appropriate electron donor to complete a catalytic cycle [2,3].
    [Show full text]