DOCSLIB.ORG

Molecular Profiling of Innate Immune Response Mechanisms in Ventilator-Associated 2 Pneumonia

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Molecular Profiling of Innate Immune Response Mechanisms in Ventilator-Associated 2 Pneumonia bioRxiv preprint doi: https://doi.org/10.1101/2020.01.08.899294; this version posted January 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Title: Molecular profiling of innate immune response mechanisms in ventilator-associated 2 pneumonia 3 Authors: Khyatiben V. Pathak1*, Marissa I. McGilvrey1*, Charles K. Hu3, Krystine Garcia- 4 Mansfield1, Karen Lewandoski2, Zahra Eftekhari4, Yate-Ching Yuan5, Frederic Zenhausern2,3,6, 5 Emmanuel Menashi3, Patrick Pirrotte1 6 *These authors contributed equally to this work 7 Affiliations: 8 1. Collaborative Center for Translational Mass Spectrometry, Translational Genomics Research 9 Institute, Phoenix, Arizona 85004 10 2. Translational Genomics Research Institute, Phoenix, Arizona 85004 11 3. HonorHealth Clinical Research Institute, Scottsdale, Arizona 85258 12 4. Applied AI and Data Science, City of Hope Medical Center, Duarte, California 91010 13 5. Center for Informatics, City of Hope Medical Center, Duarte, California 91010 14 6. Center for Applied NanoBioscience and Medicine, University of Arizona, Phoenix, Arizona 15 85004 16 Corresponding author: 17 Dr. Patrick Pirrotte 18 Collaborative Center for Translational Mass Spectrometry 19 Translational Genomics Research Institute 20 445 North 5th Street, Phoenix, AZ, 85004 21 Tel: 602-343-8454; 22 [[email protected]] 23 Running Title: Innate immune response in ventilator-associated pneumonia 24 Key words: ventilator-associated pneumonia; endotracheal aspirate; proteome, metabolome; 25 neutrophil degranulation 26 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.01.08.899294; this version posted January 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 27 Abbreviations: AK2: Adenylate kinase 2, BAL: Bronchoalveolar Lavage Fluid, CA1: Carbonic 28 anhydrase 1, CA2: Carbonic anhydrase 2, CRP: C-reactive protein, ECM: Extracellular Matrix, 29 ELANE: Neutrophil elastase, ETA: Endotracheal Aspirates, HAI: Hospital Acquired Infection, 30 HBB: Hemoglobin subunit beta, HBA: Hemoglobin subunit alpha, HBD: Hemoglobin subunit 31 delta, ICU: Intensive Care Unit, MMP9: Matrix metalloproteinase-9, MPO: Myeloperoxidase, 32 MRSA: Methicillin Resistant Staphylococcus aureus, MSSA: Methicillin Sensitive 33 Staphylococcus aureus, NET: Neutrophil extracellular trap, NME-1: Isoform 2 of nucleoside 34 diphosphate kinase A, PRDX1: Peroxiredoxin-1, PRDX2: Peroxiredoxin-2, PRDX6: 35 Peroxiredoxin-6, ROS: Reactive oxygen species, STOM: Erythrocyte band 7 integral membrane 36 protein, VAP: Ventilator-Associated Pneumonia 37 38 2 bioRxiv preprint doi: https://doi.org/10.1101/2020.01.08.899294; this version posted January 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 39 Abstract 40 Ventilator-associated pneumonia (VAP) is a common hospital-acquired infection, leading to high 41 morbidity and mortality. Currently, bronchoalveolar lavage (BAL) is utilized in hospitals for VAP 42 diagnosis and guiding treatment options. While BAL collection procedures are invasive, 43 alternatives such as endotracheal aspirates (ETA) may be of diagnostic value, however, their utility 44 has not been thoroughly explored. Longitudinal ETA and BAL were collected from 16 intubated 45 patients up to 15 days, of which 11 developed VAP. We conducted a comprehensive LC-MS/MS 46 based proteome and metabolome characterization of longitudinal ETA and BAL to detect host and 47 pathogen responses to VAP infection. We discovered a diverse ETA proteome of the upper airways 48 reflective of a rich and dynamic host-microbe interface. Prior to VAP diagnosis by microbial 49 cultures from BAL, patient ETA presented characteristic signatures of reactive oxygen species and 50 neutrophil degranulation, indicative of neutrophil mediated pathogen processing as a key host 51 response to the VAP infection. Along with an increase in amino acids, this is suggestive of 52 extracellular membrane degradation resulting from proteolytic activity of neutrophil proteases. 53 Days prior to VAP diagnosis, detection of pathogen peptides with species level specificity in ETA 54 may increase specificity over culture-based diagnosis. Our findings suggest that ETA may provide 55 early mechanistic insights into host-pathogen interactions associated with VAP infection and 56 therefore facilitate its diagnosis and treatment. 57 3 bioRxiv preprint doi: https://doi.org/10.1101/2020.01.08.899294; this version posted January 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 58 Introduction 59 Ventilator-associated pneumonia (VAP) is the second most common hospital-acquired infection 60 (HAI) in intensive care units (ICU), and is associated to 60% of all HAI-related deaths in the 61 United States (1). It occurs 48 hours after mechanical ventilation and accounts for more than 62 300,000 cases annually in the US. (1, 2). Mechanical ventilation can injure tracheal epithelia, and 63 promote environmental microbial colonization and migration from the upper to lower airways (3). 64 All ICU patients with prolonged hospitalization are at high risk of developing VAP, increasing the 65 cost of hospital stay by $40,000 to $50,000 per patient (3-5). VAP diagnosis is largely based on 66 clinical criteria such as fever, infiltrate on chest radiograph, leukocyte counts, and positive cultures 67 from bronchoalveolar lavages (BAL) (2, 6). With trauma patients, these symptoms are often non- 68 specific and lead to overestimation of true VAP episodes resulting in the prescription of inadequate 69 broad-spectrum antibiotics (6, 7). A study involving 300 U.S. hospitals showed a 52% increase in 70 antibiotic consumption rate in intensive care unit (ICU) compared to non-critical care (8). In 71 addition, VAP accounts for over half of the antibiotics used in the ICU which may lead to multi- 72 drug resistance (9). Culture-based testing can reduce antibiotic misuse, but it is time-consuming 73 and can delay diagnosis and treatment. Therefore, careful investigation of VAP pathogenesis is 74 required to better understand host response to microbial dysbiosis and provide insights into the 75 molecular mechanisms underlying the progression of infection. 76 Previous studies have proposed several candidate biomarkers (interleukin-1β, interleukin-8, 77 soluble triggering receptor expressed on myeloid cells type 1, C-reactive protein (CRP), 78 procalcitonin, and the mid-region fragment of pro-adrenomedullin) to assist VAP diagnosis in 79 serum, plasma or BAL (10-13). Of these, interleukin-1β and interleukin-8 have been successfully 80 validated in VAP diagnosis (13). Also, most of these proteins are inflammation markers and have 4 bioRxiv preprint doi: https://doi.org/10.1101/2020.01.08.899294; this version posted January 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 81 shown variable sensitivity and specificity towards VAP detection (12, 14). This raises potential 82 issues of misdiagnosis and emphasizes the need for further research on specific VAP biomarkers. 83 BAL has been a widely accepted matrix to study pulmonary infections (15, 16). Many studies have 84 demonstrated the utility of BAL for microbial culture, 16S rDNA analysis and determining host- 85 response against VAP infection (16-19). Endotracheal aspirate (ETA) is regarded as a source for 86 non-invasive respiratory sampling and recently has been recommended for semi quantitative 87 cultures in VAP diagnosis (20). However, the molecular composition of ETA has not been 88 explored as extensively as BAL to understand host responses to infection. We hypothesize that 89 reduced invasiveness involved in ETA sampling is permissive to more frequent longitudinal 90 molecular snapshots of host immune response and changes to microbial flora during early 91 infection. We anticipate that this enhanced granularity provides valuable mechanistic insights into 92 VAP pathogenesis. We used a multi-disciplinary approach integrating proteomics and quantitative 93 metabolomics on longitudinal ETA and matched BAL collected from intubated patients for this 94 study. 95 Experimental Procedures 96 Chemicals 97 Chemicals and solvents were procured from Sigma-Aldrich (St. Lois, MO) or Fisher Scientific 98 (San Jose, CA) unless otherwise stated. The chemicals used in this study were AR grade, and the 99 formic acid (FA) and solvents were LC-MS grade. 100 Specimen collections 101 Patients under mechanical ventilation at the ICU trauma center at HonorHealth Osborne Medical 102 Center, Scottsdale, AZ were enrolled for this study. A written informed consent was obtained from 5 bioRxiv preprint doi: https://doi.org/10.1101/2020.01.08.899294; this version posted January 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 103 either patient or a legal relative. The clinical protocol for sample collection was approved by the 104 hospital’s Institutional Review Board and the Western Institutional Review Board, Puyallup,
Load more

Recommended publications
  • Identifying and Mapping Cell-Type-Specific Chromatin PNAS PLUS Programming of Gene Expression
    Identifying and mapping cell-type-specific chromatin PNAS PLUS programming of gene expression Troels T. Marstranda and John D. Storeya,b,1 aLewis-Sigler Institute for Integrative Genomics, and bDepartment of Molecular Biology, Princeton University, Princeton, NJ 08544 Edited by Wing Hung Wong, Stanford University, Stanford, CA, and approved January 2, 2014 (received for review July 2, 2013) A problem of substantial interest is to systematically map variation Relating DHS to gene-expression levels across multiple cell in chromatin structure to gene-expression regulation across con- types is challenging because the DHS represents a continuous ditions, environments, or differentiated cell types. We developed variable along the genome not bound to any specific region, and and applied a quantitative framework for determining the exis- the relationship between DHS and gene expression is largely tence, strength, and type of relationship between high-resolution uncharacterized. To exploit variation across cell types and test chromatin structure in terms of DNaseI hypersensitivity and genome- for cell-type-specific relationships between DHS and gene expres- wide gene-expression levels in 20 diverse human cell types. We sion, the measurement units must be placed on a common scale, show that ∼25% of genes show cell-type-specific expression ex- the continuous DHS measure associated to each gene in a well- plained by alterations in chromatin structure. We find that distal defined manner, and all measurements considered simultaneously. regions of chromatin structure (e.g., ±200 kb) capture more genes Moreover, the chromatin and gene-expression relationship may with this relationship than local regions (e.g., ±2.5 kb), yet the local only manifest in a single cell type, making standard measures of regions show a more pronounced effect.
    [Show full text]
  • Oxidative Stress Modulates the Expression Pattern of Peroxiredoxin-6 in Peripheral Blood Mononuclear Cells of Asthmatic Patients and Bronchial Epithelial Cells
    Allergy Asthma Immunol Res. 2020 May;12(3):523-536 https://doi.org/10.4168/aair.2020.12.3.523 pISSN 2092-7355·eISSN 2092-7363 Original Article Oxidative Stress Modulates the Expression Pattern of Peroxiredoxin-6 in Peripheral Blood Mononuclear Cells of Asthmatic Patients and Bronchial Epithelial Cells Hyun Jae Shim ,1 So-Young Park ,2 Hyouk-Soo Kwon ,1 Woo-Jung Song ,1 Tae-Bum Kim ,1 Keun-Ai Moon ,1 Jun-Pyo Choi ,1 Sin-Jeong Kim ,1 You Sook Cho 1* 1Division of Allergy and Clinical Immunology, Department of Internal Medicine, Asan Medical Center, University of Ulsan College of Medicine, Seoul, Korea 2Division of Pulmonary, Allergy and Critical Care Medicine, Department of Internal Medicine, Konkuk University Medical Center, Seoul, Korea Received: Jul 8, 2019 ABSTRACT Revised: Nov 29, 2019 Accepted: Dec 23, 2019 Purpose: Reduction-oxidation reaction homeostasis is vital for regulating inflammatory Correspondence to conditions and its dysregulation may affect the pathogenesis of chronic airway inflammatory You Sook Cho, MD, PhD diseases such as asthma. Peroxiredoxin-6, an important intracellular anti-oxidant molecule, Division of Allergy and Clinical Immunology, Department of Internal Medicine, Asan is reported to be highly expressed in the airways and lungs. The aim of this study was to Medical Center, University of Ulsan College of analyze the expression pattern of peroxiredoxin-6 in the peripheral blood mononuclear cells Medicine, 88 Olympic-ro 43-gil, Songpa-gu, (PBMCs) of asthmatic patients and in bronchial epithelial cells (BECs). Seoul 05505, Korea. Methods: The expression levels and modifications of peroxiredoxin-6 were evaluated in Tel: +82-2-3010-3285 PBMCs from 22 asthmatic patients.
    [Show full text]
  • Adult, Embryonic and Fetal Hemoglobin Are Expressed in Human Glioblastoma Cells
    514 INTERNATIONAL JOURNAL OF ONCOLOGY 44: 514-520, 2014 Adult, embryonic and fetal hemoglobin are expressed in human glioblastoma cells MARWAN EMARA1,2, A. ROBERT TURNER1 and JOAN ALLALUNIS-TURNER1 1Department of Oncology, University of Alberta and Alberta Health Services, Cross Cancer Institute, Edmonton, AB T6G 1Z2, Canada; 2Center for Aging and Associated Diseases, Zewail City of Science and Technology, Cairo, Egypt Received September 7, 2013; Accepted October 7, 2013 DOI: 10.3892/ijo.2013.2186 Abstract. Hemoglobin is a hemoprotein, produced mainly in Introduction erythrocytes circulating in the blood. However, non-erythroid hemoglobins have been previously reported in other cell Globins are hemo-containing proteins, have the ability to types including human and rodent neurons of embryonic bind gaseous ligands [oxygen (O2), nitric oxide (NO) and and adult brain, but not astrocytes and oligodendrocytes. carbon monoxide (CO)] reversibly. They have been described Human glioblastoma multiforme (GBM) is the most aggres- in prokaryotes, fungi, plants and animals with an enormous sive tumor among gliomas. However, despite extensive basic diversity of structure and function (1). To date, hemoglobin, and clinical research studies on GBM cells, little is known myoglobin, neuroglobin (Ngb) and cytoglobin (Cygb) repre- about glial defence mechanisms that allow these cells to sent the vertebrate globin family with distinct function and survive and resist various types of treatment. We have tissue distributions (2). During ontogeny, developing erythro- shown previously that the newest members of vertebrate blasts sequentially express embryonic {[Gower 1 (ζ2ε2), globin family, neuroglobin (Ngb) and cytoglobin (Cygb), are Gower 2 (α2ε2), and Portland 1 (ζ2γ2)] to fetal [Hb F(α2γ2)] expressed in human GBM cells.
    [Show full text]
  • SUPPLEMENTARY DATA Supplementary Figure 1. The
    SUPPLEMENTARY DATA Supplementary Figure 1. The results of Sirt1 activation in primary cultured TG cells using adenoviral system. GFP expression served as the control (n = 4 per group). Supplementary Figure 2. Two different Sirt1 activators, SRT1720 (0.5 µM or 1 µM ) and RSV (1µM or 10µM), induced the upregulation of Sirt1 in the primary cultured TG cells (n = 4 per group). ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary Table 1. Primers used in qPCR Gene Name Primer Sequences Product Size (bp) Sirt1 F: tgccatcatgaagccagaga 241 (NM_001159589) R: aacatcgcagtctccaagga NOX4 F: tgtgcctttattgtgcggag 172 (NM_001285833.1) R: gctgatacactggggcaatg Supplementary Table 2. Antibodies used in Western blot or Immunofluorescence Antibody Company Cat. No Isotype Dilution Sirt1 Santa Cruz * sc-15404 Rabbit IgG 1/200 NF200 Sigma** N5389 Mouse IgG 1/500 Tubulin R&D# MAB1195 Mouse IgG 1/500 NOX4 Abcam† Ab133303 Rabbit IgG 1/500 NOX2 Abcam Ab129068 Rabbit IgG 1/500 phospho-AKT CST‡ #4060 Rabbit IgG 1/500 EGFR CST #4267 Rabbit IgG 1/500 Ki67 Santa Cruz sc-7846 Goat IgG 1/500 * Santa Cruz Biotechnology, Santa Cruz, CA, USA ** Sigma aldrich, Shanghai, China # R&D Systems Inc, Minneapolis, MN, USA † Abcam, Inc., Cambridge, MA, USA ‡ Cell Signaling Technology, Inc., Danvers, MA, USA ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary
    [Show full text]
  • Role of Peroxiredoxin 6 in Human Melanoma
    Role of Peroxiredoxin 6 in human melanoma Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Bayerischen Julius-Maximilians-Universität Würzburg vorgelegt von Alexandra Schmitt aus Würzburg Würzburg 2015 Eingereicht am:__________________________ Mitglieder der Promotionskommission: Vorsitzender:____________________________ Gutachter:______________________________ Gutachter:______________________________ Tag des Promotionskolloquiums:___________________ Doktorurkunde ausgehändigt am:___________________ Eidesstattliche Erklärung Gemäß §4, Abs. 3, Ziff. 3, 5 und 8 der Promotionsordnung der Fakultät für Biologie der Bayerischen Julius-Maximilians-Universität Würzburg Hiermit erkläre ich ehrenwörtlich, dass ich die vorliegende Dissertation selbständig angefertigt und keine anderen als die angegebenen Quellen und Hilfsmittel verwendet habe. Ich erkläre weiterhin, dass die vorliegende Dissertation weder in gleicher, noch in ähnlicher Form bereits in einem anderen Prüfungsverfahren vorgelegen hat. Weiterhin erkläre ich, dass ich außer den mit dem Zulassungsantrag urkundlich vorgelegten Graden keine weiteren akademischen Grade erworben oder zu erwerben versucht habe. Würzburg, Januar 2015 ______________________________________ Alexandra Schmitt Table of contents 1. Abstract ................................................................................................................. 1 2. Zusammenfassung ............................................................................................... 3 3. Introduction ..........................................................................................................
    [Show full text]
  • Molecular Epidemiology and Hematologic Characterization of Δβ
    Jiang et al. BMC Medical Genetics (2020) 21:43 https://doi.org/10.1186/s12881-020-0981-x RESEARCH ARTICLE Open Access Molecular epidemiology and hematologic characterization of δβ-thalassemia and hereditary persistence of fetal hemoglobin in 125,661 families of greater Guangzhou area, the metropolis of southern China Fan Jiang1,2, Liandong Zuo2, Dongzhi Li2, Jian Li2, Xuewei Tang2, Guilan Chen2, Jianying Zhou2, Hang Lu2 and Can Liao1,2* Abstract Background: Individuals with δβ-thalassemia/HPFH and β-thalassemia usually present with intermedia or thalassemia major. No large-scale survey on HPFH/δβ-thalassemia in southern China has been reported to date. The purpose of this study was to examine the molecular epidemiology and hematologic characteristics of these disorders in Guangzhou, the largest city in Southern China, to offer advice for thalassemia screening programs and genetic counseling. Methods: A total of 125,661 couples participated in pregestational thalassemia screening. 654 subjects with fetal hemoglobin (HbF) level ≥ 5% were selected for further investigation. Gap-PCR combined with Multiplex ligation dependent probe amplification (MLPA) was used to screen for β-globin gene cluster deletions. Gene sequencing for the promoter region of HBG1 /HBG2 gene was performed for all those subjects. Results: A total of 654 individuals had hemoglobin (HbF) levels≥5, and 0.12% of the couples were found to be heterozygous for HPFH/δβ-thalassemia, including Chinese Gγ (Aγδβ)0-thal, Southeast Asia HPFH (SEA-HPFH), Taiwanese deletion and Hb Lepore–Boston–Washington. The highest prevalence was observed in the Huadu district and the lowest in the Nansha district. Three cases were identified as carrying β-globin gene cluster deletions, which had not been previously reported.
    [Show full text]
  • GPX4 at the Crossroads of Lipid Homeostasis and Ferroptosis Giovanni C
    REVIEW GPX4 www.proteomics-journal.com GPX4 at the Crossroads of Lipid Homeostasis and Ferroptosis Giovanni C. Forcina and Scott J. Dixon* formation of toxic radicals (e.g., R-O•).[5] Oxygen is necessary for aerobic metabolism but can cause the harmful The eight mammalian GPX proteins fall oxidation of lipids and other macromolecules. Oxidation of cholesterol and into three clades based on amino acid phospholipids containing polyunsaturated fatty acyl chains can lead to lipid sequence similarity: GPX1 and GPX2; peroxidation, membrane damage, and cell death. Lipid hydroperoxides are key GPX3, GPX5, and GPX6; and GPX4, GPX7, and GPX8.[6] GPX1–4 and 6 (in intermediates in the process of lipid peroxidation. The lipid hydroperoxidase humans) are selenoproteins that contain glutathione peroxidase 4 (GPX4) converts lipid hydroperoxides to lipid an essential selenocysteine in the enzyme + alcohols, and this process prevents the iron (Fe2 )-dependent formation of active site, while GPX5, 6 (in mouse and toxic lipid reactive oxygen species (ROS). Inhibition of GPX4 function leads to rats), 7, and 8 use an active site cysteine lipid peroxidation and can result in the induction of ferroptosis, an instead. Unlike other family members, GPX4 (PHGPx) can act as a phospholipid iron-dependent, non-apoptotic form of cell death. This review describes the hydroperoxidase to reduce lipid perox- formation of reactive lipid species, the function of GPX4 in preventing ides to lipid alcohols.[7,8] Thus,GPX4ac- oxidative lipid damage, and the link between GPX4 dysfunction, lipid tivity is essential to maintain lipid home- oxidation, and the induction of ferroptosis. ostasis in the cell, prevent the accumula- tion of toxic lipid ROS and thereby block the onset of an oxidative, iron-dependent, non-apoptotic mode of cell death termed 1.
    [Show full text]
  • Table S1. Identified Proteins with Exclusive Expression in Cerebellum of Rats of Control, 10Mg F/L and 50Mg F/L Groups
    Table S1. Identified proteins with exclusive expression in cerebellum of rats of control, 10mg F/L and 50mg F/L groups. Accession PLGS Protein Name Group IDa Score Q3TXS7 26S proteasome non-ATPase regulatory subunit 1 435 Control Q9CQX8 28S ribosomal protein S36_ mitochondrial 197 Control P52760 2-iminobutanoate/2-iminopropanoate deaminase 315 Control Q60597 2-oxoglutarate dehydrogenase_ mitochondrial 67 Control P24815 3 beta-hydroxysteroid dehydrogenase/Delta 5-->4-isomerase type 1 84 Control Q99L13 3-hydroxyisobutyrate dehydrogenase_ mitochondrial 114 Control P61922 4-aminobutyrate aminotransferase_ mitochondrial 470 Control P10852 4F2 cell-surface antigen heavy chain 220 Control Q8K010 5-oxoprolinase 197 Control P47955 60S acidic ribosomal protein P1 190 Control P70266 6-phosphofructo-2-kinase/fructose-2_6-bisphosphatase 1 113 Control Q8QZT1 Acetyl-CoA acetyltransferase_ mitochondrial 402 Control Q9R0Y5 Adenylate kinase isoenzyme 1 623 Control Q80TS3 Adhesion G protein-coupled receptor L3 59 Control B7ZCC9 Adhesion G-protein coupled receptor G4 139 Control Q6P5E6 ADP-ribosylation factor-binding protein GGA2 45 Control E9Q394 A-kinase anchor protein 13 60 Control Q80Y20 Alkylated DNA repair protein alkB homolog 8 111 Control P07758 Alpha-1-antitrypsin 1-1 78 Control P22599 Alpha-1-antitrypsin 1-2 78 Control Q00896 Alpha-1-antitrypsin 1-3 78 Control Q00897 Alpha-1-antitrypsin 1-4 78 Control P57780 Alpha-actinin-4 58 Control Q9QYC0 Alpha-adducin 270 Control Q9DB05 Alpha-soluble NSF attachment protein 156 Control Q6PAM1 Alpha-taxilin 161
    [Show full text]
  • Hemoglobin Sickle D Punjab—A Case Report
    154 Case Report Hemoglobin sickle D Punjab—a case report M. B. Mukherjee, R. R. Surve, R. R. Gangakhedkar, D. Mohanty, R. B. Colah Institute of Immunohaematology, Parel, Mumbai, India. Case History Compound heterozygosity for βS/βD results in a severe hemolytic anemia and a clinical syndrome similar to that of sickle cell disease. Here, we report a case of HbSD Punjab disease. A 10 year old female child residing at Nagpur, A 10 year old female child from Nagpur was referred Maharashtra presented with severe hemolytic anemia, to us with severe hemolytic anemia, occasional episodes hepatosplenomegaly and occasional pains in bones and of pains (predominantly bones and abdomen) associ- abdomen. Initially, she was thought to be a case of sickle cell anemia, however, with the help of HPLC and molecu- ated with fever. She had also received three units of lar analysis it was confirmed as HbSD Punjab disease. blood. Physical examination revealed short stature Key words: HbSD Punjab, Sickle cell disease, Haplotype, (weight 12.5 kg and height 105 cm), pallor, hepatome- α-geonotype galy (2 cm) and splenomegaly (3 cm) below the right and left costal margins respectively. Cardiovascular, res- piratory and nervous systems were normal. HbD Punjab also known as HbD Los Angeles is a β- chain variant and is characterized by a Glu→Gln sub- Investigations stitution at codon 121 with a GAA→CAA change at the DNA level and the electrophotetic mobility at alkaline Her Hb was 5.9 g/dl and the reticulocyte count was pH is similar to HbS (β6, Glu→Val).[1] HbD has been 3.3%.
    [Show full text]
  • Genome Editing of HBG1/2 Promoter Leads to Robust Hbf Induction in Vivo While Editing of BCL11A Erythroid Enhancer Shows Erythroid Defect
    Genome Editing of HBG1/2 Promoter Leads to Robust HbF Induction In Vivo While Editing of BCL11A Erythroid Enhancer Shows Erythroid Defect Kai-Hsin Chang, Minerva Sanchez, Jack Heath, Edouard de Dreuzy, Scott Haskett, Abigail Vogelaar, Kiran Gogi, Jen DaSilva, Tongyao Wang, Andrew Sadowski, Gregory Gotta, Jamaica Siwak, Ramya Viswanathan, Katherine Loveluck, Hoson Chao, Eric Tillotson, Aditi Chalishazar, Abhishek Dass, Frederick Ta, Emily Brennan, Diana Tabbaa, Eugenio Marco, John Zuris, Deepak Reyon, Meltem Isik, Ari Friedland, Terence Ta, Fred Harbinski, Georgia Giannoukos, Sandra Teixeira, Christopher Wilson, Charlie Albright, Haiyan Jiang Editas Medicine, Inc., Cambridge, MA 60th Annual Meeting and Exposition of American Society of Hematology December 2, 2018, San Diego, CA © 2018 Editas Medicine Overview Etiology of Sickle Cell Disease In Vivo Study Design to Evaluate Two Approaches to Increase Fetal Hemoglobin (HbF) Expression Effect of Downregulating BCL11A Expression by Targeting its Erythroid Enhancer Editing Cis-regulatory Elements in b-Globin Locus Conclusion © 2018 Editas Medicine Etiology of Sickle Cell Disease Amino Hemoglobin Low DNA Acid Tetramer O2 a a a a b-globin GLU G A G b b b b HbA a a a a a a a a s s s VAL b b b -globin G T G bs bs bs bs bs bs HbS HbS Fiber • Sickle cell disease (SCD) is caused by a single mutation E6V of the b-globin chain, leading to polymerization of hemoglobin (Hb) and formation of sickle hemoglobin (HbS) fibers when deoxygenated. • Symptoms include anemia, acute chest syndrome, pain crises, and an array of other complications. • Patients suffer significant morbidity and early mortality.
    [Show full text]
  • PRDX1 and PRDX6 Are Repressed in Papillary Thyroid Carcinomas Via BRAF V600E-Dependent and -Independent Mechanisms
    548 INTERNATIONAL JOURNAL OF ONCOLOGY 44: 548-556, 2014 PRDX1 and PRDX6 are repressed in papillary thyroid carcinomas via BRAF V600E-dependent and -independent mechanisms ARIANNA NICOLUSSI1*, SONIA D'INZEO1*, GABRIELLA MINCIONE4,5, AMELIA BUFFONE2, MARIA CARMELA DI MARCANTONIO4, ROBERTO COTELLESE4, ANNADOMENICA CICHELLA4, CARLO CAPALBO2, CIRA DI GIOIA3, FRANCESCO NARDI3, GIUSEPPE GIANNINI2 and ANNA COPPA1 Departments of 1Experimental Medicine, 2Molecular Medicine, 3Radiological, Oncological and Pathological Sciences, Sapienza University of Rome, Rome; 4Department of Experimental and Clinical Sciences, 5Center of Excellence on Aging, Ce.S.I., ‘G. d'Annunzio’ University Foundation, Chieti-Pescara, Italy Received September 18, 2013; Accepted November 6, 2013 DOI: 10.3892/ijo.2013.2208 Abstract. Many clinical studies highlight the dichotomous Introduction role of PRDXs in human cancers, where they can exhibit strong tumor-suppressive or tumor-promoting functions. In recent years, several studies have linked oxidative stress Recent evidence suggests that lower expression of PRDXs (OS) to thyroid cancer (1-3). The thyroid gland itself gener- correlates with cancer progression in colorectal cancer (CRC) ates reactive radical molecules, through the process of iodine or in esophageal squamous carcinoma. In the thyroid, increased metabolism and thyroid hormone synthesis. During this process, levels of PRDX1 has been described in follicular adenomas TSH stimulates H2O2 production, which is the substrate of and carcinomas, as well as in thyroiditis, while reduced levels thyroperoxidase (TPO) on the apical membrane of the thyroid of PRDX6 has been found in follicular adenomas. We studied follicular cells (4). Therefore, thyrocytes need protective the expression of PRDX1 and PRDX6, in a series of thyroid mechanisms that limit the oxidative damage of H2O2 produc- tissue samples, covering different thyroid diseases, including tion by catalase, gluthatione peroxidases and peroxiredoxins 13 papillary thyroid carcinomas (PTCs).
    [Show full text]
  • Reactive Oxygen Species and Protein Modifications in Spermatozoa
    Biology of Reproduction, 2017, 97(4), 577–585 doi:10.1093/biolre/iox104 Review Advance Access Publication Date: 13 September 2017 Review Reactive oxygen species and protein modifications in spermatozoa† ∗ Cristian O’Flaherty1,2,3, and David Matsushita-Fournier2,3 Downloaded from https://academic.oup.com/biolreprod/article/97/4/577/4157784 by guest on 01 October 2021 1Department of Surgery (Urology Division), McGill University, Montreal,´ Quebec,´ Canada; 2Pharmacology and Therapeutics, Faculty of Medicine, McGill University, Montreal,´ Quebec,´ Canada and 3The Research Institute, McGill University Health Centre, Montreal,´ Quebec,´ Canada ∗Correspondence: The Research Insitute, McGill University Health Centre, room EM03212, 1001 Decarie Boulevard, Montreal,´ QC H4A 3J1, Canada. Fax: +514-933-4149; E-mail: cristian.ofl[email protected] †Grant support: This work was supported by a grant from the Canadian Institutes of Health Research (MOP 133661 to C.O.). CO is the recipient of the Chercher Boursier Junior 2 salary award from the Fonds de la Recherche en SanteduQu´ ebec´ (33158). Received 2 June 2017; Revised 1 August 2017; Accepted 11 September 2017 Abstract Cellular response to reactive oxygen species (ROS) includes both reversible redox signaling and irreversible nonenzymatic reactions which depend on the nature and concentration of the ROS involved. Changes in thiol/disulfide pairs affect protein conformation, enzymatic activity, ligand binding, and protein–protein interactions. During spermatogenesis and epididymal maturation, there are ROS-dependent modifications of the sperm chromatin and flagellar proteins.The sperma- tozoon is regulated by redox mechanisms to acquire fertilizing ability. For this purpose, controlled amounts of ROS are necessary to assure sperm activation (motility and capacitation).
    [Show full text]