A pan genome reverse vaccinology approach to prevent Streptococcus agalactiae

infection in farmed tilapia

Minami Kawasaki

BSc Honours

A thesis submitted for the degree of Doctor of Philosophy at

The University of Queensland in {2018}

School of Biological Sciences

1 Abstract

Streptococcus agalactiae (Group B Streptococcus; GBS) is a Gram-positive pathogenic bacterium that causes disease in a wide range of animals including fish. Outbreaks of GBS in farmed fish have substantial economic impacts on the aquaculture industry, especially in tilapia production, a staple food product in tropical and subtropical low- and middle-income countries and the second most widely farmed fish after carp. Although vaccination can effectively prevent disease caused by GBS in fish it often fails after relatively short periods of use. Capsular polysaccharide (CPS) is the major protective antigen in GBS vaccines and a critical virulence factor. There are currently ten CPS serotypes of GBS and, whilst vaccination against one serotype confers protection in fish, it is not cross-protective against other serotypes. In addition, under the strong selective pressure of vaccination-driven adaptive immunity, evolution of novel serotypes can occur. To improve the serotype cross- protective efficacy of GBS vaccines for aquaculture, I employed a pan-genome reverse vaccinology approach to design candidate serotype-independent protective vaccines based on conserved proteins in fish-pathogenic GBS serotypes. Reverse vaccinology exploits recent advances in genomics to predict antigens in the genome sequence. Reverse vaccinology combined with pan-genome can identify the antigens that are conserved across a diversity of strains of a pathogen.

To identify potential vaccine candidate antigens, a pan-genome was constructed for GBS comprising 82 genomes including representative isolates from wild marine fish and stingrays, farm and companion animals and from human clinical cases in Australia, along with isolates from farmed tilapia in Honduras and representative genomes from all current serotypes available via the NCBI Genbank database. Core genome single nucleotide polymorphism 2 (SNP) analysis indicated dissemination of the aquatic host-adapted ST-261 lineage in wild

Australian fish from an ancestral tilapia strain, which is congruent with several introductions of tilapia into northern Australia from Israel and Malaysia during the 1970s and 1980s.

Aquatic serotype Ib GBS strains have lost many virulence factors during adaptation, but six adhesins, named ST-261 adhesins, were well-conserved across the aquatic isolates and might be critical for virulence in fish and good targets for vaccine development. Three of six

ST-261 adhesins were also conserved across all strains including terrestrial isolates and were chosen as vaccine candidates. Expressions of ST-261 adhesin genes were inversely co-regulated with CPS expression dependent upon carbon source and metal ions in the medium. However, gene transcription was not reflective of surface expression as serum antibodies derived in tilapia against recombinant adhesins did not detect similar variation in the level of ST-261 adhesins in whole cell ELISA or Western blot. This may be due to post- transcriptional processing causing a disconnect between gene and protein expression.

To evaluate the efficacies of recombinant ST-261 adhesins as vaccines in tilapia, a vaccination and challenge experiment was conducted. All recombinant ST-261 adhesin vaccines resulted in strong antibody response detected by ELISA against the recombinant adhesins. However, no protection from disease was elicited by any of the recombinant vaccines in the challenge model. This may be due to antigenic masking by CPS. It may also be that adhesins are not expressed during the critical stages of proliferation in the host and are required at the mucosal surfaces during pathogen entry via the gastrointestinal tract.

Future work should elucidate the role of these ST-261 adhesins in pathogenicity in fish, including where and when they are expressed on GBS during the infection. 3 Prevention of disease in aquaculture caused by highly antigenically diverse pathogens such as GBS might be achieved through deployment of autogenous (custom-made) vaccines supported by careful surveillance to enable incorporation of variants as they arise. Use of rapid, low cost genomics as employed in this thesis will aid in accurate surveillance and inform vaccine modification as required. Genomics may also aid in defining the epidemiological unit over which an autogenous formulation might be employed, increasing the cost-effectiveness of custom-made autogenous vaccines. In the era of “one health”, with global antimicrobial use in animal production far exceeding use in human medicine, it is critical that affordable disease prevention methods are promoted in the world’s fastest growing food production sector.

4 Declaration by author

This thesis is composed of my original work, and contains no material previously published or written by another person except where due reference has been made in the text. I have clearly stated the contribution by others to jointly-authored works that I have included in my thesis.

I have clearly stated the contribution of others to my thesis as a whole, including statistical assistance, survey design, data analysis, significant technical procedures, professional editorial advice, financial support and any other original research work used or reported in my thesis. The content of my thesis is the result of work I have carried out since the commencement of my higher degree by research candidature and does not include a substantial part of work that has been submitted to qualify for the award of any other degree or diploma in any university or other tertiary institution. I have clearly stated which parts of my thesis, if any, have been submitted to qualify for another award.

I acknowledge that an electronic copy of my thesis must be lodged with the University Library and, subject to the policy and procedures of The University of Queensland, the thesis be made available for research and study in accordance with the Copyright Act 1968 unless a period of embargo has been approved by the Dean of the Graduate School.

I acknowledge that copyright of all material contained in my thesis resides with the copyright holder(s) of that material. Where appropriate I have obtained copyright permission from the copyright holder to reproduce material in this thesis and have sought permission from co- authors for any jointly authored works included in the thesis. 5 Publication included in this thesis

Chapter 2: Kawasaki. M., Delamare-Deboutteville, J., Bowater, R. O., Walker, M. J.,

Beatson, S., Zakour, N. L. B., Barnes, A. C., 2018. Microevolution of aquatic

Streptococcus agalactiae ST-261 from Australia indicates dissemination via

imported tilapia and ongoing adaptation to marine hosts or environment.

Applied and environmental microbiology, AEM. 00859-00818.

Contributor Statement of contribution

Minami Kawasaki Conceived experiments 15%

(candidate) Designed experiments 70%

Conducted the work and analysed the

data 80%

Wrote and edited paper 70%

Jerome Delamare-Deboutteville Conducted the work and analysed the

data 10%

Wrote and edited the paper 5%

Rachel Bowater Conceived experiments 5%

Mark Walker Conceived experiments 10%

Wrote and edited the paper 5%

Andrew C Barnes Conceived experiments 40%

Designed experiments 20%

Conducted the work and analysed the

data 10%

6 Wrote and edited paper 10%

Conceived experiments 20%

Nouri Ben Zakour Designed experiments 10%

Wrote and edited paper 5%

Scott Beatson Conceived experiments 10%

Wrote and edited paper 10%

7 Submitted manuscripts included in this thesis

No manuscripts submitted for publication

Other publications during candidature

Conference abstracts

Kawasaki. M., Labrie, L., Zakour, N. L. B., Delamare-Deboutteville, J., Barnes, A. C., 2017.

A conserved adhesin identified in the Streptococcus agalactiae pan-genome is a cross- protective recombinant vaccine against infection by serotype Ia and Ib in Tilapia. 4th FRDC

Australian Aquatic Animal Health & Biosecurity Scientific Conference.

Kawasaki. M., Labrie, L., Zakour, N. L. B., Delamare-Deboutteville, J., Barnes, A. C., 2017.

A conserved adhesin identified in the Streptococcus agalactiae pan-genome is a cross- protective recombinant vaccine against infection by serotype Ia and Ib in Tilapia. 18th

International Conference on Disease of Fish and Shellfish.

Contributions by others to the thesis

Andrew C Barnes (principle advisor) helped to conceive and design the project, supported analyse and interpret the data, and helped with thesis editing. Mark Walker (co-supervisor) helped to design the experiment to produce recombinant proteins which is the part of work in chapter 3. Nouri Ben Zakour helped to conceive and design the experiment which is part of chapter 2. Scott Beatson helped to conceive and design of some parts of experiments in chapter 2.

8 Statement of parts of the thesis submitted to qualify for the award of another degree

No works submitted towards another degree have been included in this thesis

Research Involving Human or Animal Subjects

AEC Approval Number: SBS/398/16

Approving committee: Animal Welfare Unit UQ Research and Innovation

Title: Effective vaccination of Tilapia (Oreochromis mossambicus) against Group B

Streptococcus

9 Acknowledgements

I particularly want to thank my main supervisor Andy Barnes who brought this exciting project to me and kept me motivated during these years of research. His encouragement and guidance have contributed to improve my scientific skills, including laboratory work, and scientific writing and especially bioinformatics skills, which are one of my the greatest achievement during this study. I would like to thank my co-supervisor Mark Walker for giving me invaluable advices in molecular biology and also allowed me to use equipment in his laboratory. Without his advices, I would not be able to proceed with the project smoothly. I would like to thank Nouri Ben Zakour who gave me critical supports on bioinformatics that have been a central component of many aspects of this project. My thanks also go to Jerome

Delamare-Deboutteville who spent enormous time on fish husbandry, establishing the aquarium systems for tilapia breeding and challenge trials. Thank you for being a mentor when I had difficult times. All his supports during those years of PhD are irreplaceable and very precious to me. A big thank to all my fellow research colleagues from the Aquatic Animal

Health Laboratory including Cecile Dang, Candice Middleton and Kelly-Anne Masterman for their friendship. My sincere gratitude goes to Emmanuelle McFarlane and Oleksandra

Silayeva for their countless supports inside and outside the lab. Finally, I would like to thank the University of Queensland for providing an international scholarship for tuition fee and living allowance that enabled me to complete this PhD.

10 Financial support

University of Queensland International Scholarship – providing tuition fee and living allowance

11 Keywords

Streptococcus agalactiae, evolution, pan-genome, reverse vaccinology, epidemiology, aquaculture, Oreochromis mossambicus, immunology, microbiology, vaccine

Australian and New Zealand Standard Research Classifications (ANZSRC)

ANZSRC code: 060503, Microbial Genetics, 60%

ANZSRC code: 070401, Aquaculture, 20%

ANZSRC code: 070404 Fish Pests and Diseases, 20%

Fields of Research (FoR) Classification

FoR code: 0604, Genetics, 40%

FoR code: 0605, Microbiology, 60%

12 Table of Contents

Abstract……………………………………………………….…………………..…………………2

Declaration by author………………………………………...……………..……………………..5

Publications included in this thesis…………….……………...………………………...... 6

Submitted manuscripts included in this thesis…………………………………………...... 8

Other publications during candidature…………………………………………...... 8

Contributions by others to the thesis………………………………...………...... 8

Statement of parts of the thesis submitted to qualify for the award of another degree……………………………………………………………………………………………….9

Research Involving Human or Animal Subjects………………………………….………...... 9

Acknowledgements……………………………………………………………………...... 10

Financial support………………………………………………………………………...... 11

Keywords…………………………………………………………………………………………..12

Australian and New Zealand Standard Research Classifications (ANZSRC)……….….....12

Fields of Research (FoR) Classification………………………………………………………..12

Table of Contents…………………………………………………………………………………13

List of Figures…………………………………………………………………………………...... 18

List of Tables………………………………………………………………………………………23

List of Abbreviations used in the thesis…………………………………………………………24

Chapter 1: General Introduction……………………………………………………………...27

1.1. Background…………………………………………….………………………….27

1.1.1 Dynamics of the rise in global aquaculture production………..……27

1.1.2. Diseases in Aquaculture……………………………..…..…...…..………..30

13 1.1.3. Control of bacterial diseases in aquaculture………………..…………..33

1.1.4. Streptococcal infections in fish………………………..……….………...... 35

1.1.4.1. Streptococus iniae…………………...…………………..………...35

1.1.4.2. Streptococcus agalactiae (Group B Streptococcus; GBS)……...37

1.1.5. Streptococcal intraspecific diversity……………………………...... 38

1.1.5.1 Serological typing…………………………………...... 38

1.1.5.2. Mutilocus sequence tying (MLST)…...…………………...... 39

1.1.6. Control of Streptococcal diseases………………..…………...... 40

1.1.7. Vaccine failures……………………...... 41

1.1.8. Commercial Streptococcal vaccines in aquaculture……..…………...... 43

1.1.9. Surface protein antigens………..……………………………...... 44

1.1.10. Reverse vaccinology………………..………………………...... 45

1.1.11. The Pan-genome concept………………….………………...... 48

1.1.12. The Pan-genome reveals niche specialization of aquatic S. agalactiae……………………….………………….…...... ……….……50

1.1.13. Importance of adhesion and adhesins as vaccine candidates…..….…52

1.2. Aims…………………………………………………....…………...…...………54

1.2.1. Aim 1: To explore the genomic diversity of S. agalactiae, particular interest in piscine strains, by using pan-genome…………..………55 1.2.2. Aim 2: Characterization of ST-261 adhesins and to determine the level of adhesins expression in different conditions………….….……….55 1.2.3. Aim 3: To investigate if the adhesins are able to elicit cross-protective- immune responses to different serotypes of isolates in fish challenge model………………………..……………..……...….…...56

14 Chapter 2: Microevolution of aquatic Streptococcus agalactiae ST-261 from Australia indicates dissemination via imported tilapia and ongoing adaptation to marine hosts or environment...... 57

Abstract……………………………………………………………………………...57

2.1. Introduction...... 58

2.2. Materials and Methods...... 62

2.2.1. Bacterial strains and culture conditions...... 62

2.2.2. DNA extraction and sequencing...... 73

2.2.3. De novo assembly and annotation...... 73

2.2.4. Molecular serotyping and multilocus sequence typing (MLST)...... 74

2.2.5. Phylogenetic analysis...... 74

2.2.6. Pan-genome analysis...... 76

2.2.7. Identification and comparison of virulence factors...... 76

2.2.8. Analysis of effects of SNPs in ST-261 clade...... 77

2.2.9. Accession numbers...... 77

2.3. Results and Discussion...... 77

2.3.1. Group B Streptococcus isolates from marine fish and rays in Queensland and tilapia in Honduras belong to differing host-adapted lineages...... 77 2.3.2. The S. agalactiae pan-genome comprises a small core of protein-coding genes and is open...... 83 2.3.3. Aquatic serotype Ib have a reduced repertoire of virulence factors...... 87

2.4. Conclusions...... 92

15 Chapter 3: Regulation and antigenicity of conserved ST-261 adhesins in Streptococcus agalactiae...... 94

Abstract……………………………………………………………….………….....94

3.1. Introduction...... 95

3.2. Materials and methods...... 98

3.2.1. Bacterial strains and routine culture...... 98

3.2.2. ST-261 adhesin structural characterisation...... 99

3.2.3. Investigation of effect of culture conditions on ST-261 adhesin and CPS gene expression by real-time qRT-PCR...... 99 3.2.4. Cloning, expression and purification of the recombinant proteins...... 102

3.2.5. Vaccines preparation and formulation...... 106

3.2.6. Experimental animal and husbandry...... 107

3.2.7. Vaccination of tilapia and serum collection...... 108

3.2.8. Detection of adhesins in whole cells under differing culture conditions by SDS-PAGE analysis and Western blotting...... 108

3.2.9. Enzyme linked immunosorbent assay (ELISA)...... 110

3.3. Results...... 110

3.3.1. Identification of ST-261 adhesins and their general domain structures...... 110 3.3.2. ST-261 adhesin and cpsE expression are affected by culture conditions...... 112 3.3.3. Serum antibody against recombinant ST-261 adhesins reacted with the vaccine antigens except for antisera against adhesin_1196……116 3.3.4. Changes in the protein profile of QMA0285 cultured in different conditions after 18 h...... 117

3.4. Discussion...... 120

16 Chapter 4: Recombinant ST-261 adhesins from Streptococcus agalactiae are not effective as an injectable vaccine against Streptococcosis in tilapia (Oreochromis mossambicus)...... 127 Abstract……………………………………………………………………………127

4.1. Introduction……………...... 128

4.2. Materials and methods...... 131

4.2.1. Ethics and biosecurity statements...... 131

4.2.2. Tilapia breeding...... 132

4.2.3. Bacterial strains and culture conditions...... 132

4.2.4. Pre-challenge...... 133

4.2.5. Vaccinations and challenge fish...... 134

4.2.6. Enzyme linked immunosorbent assay (ELISA)...... 136

4.3. Results...... 136

4.3.1. Homologous whole-cell vaccine protects against challenge, but heterologous whole-cell and recombinant adhesin vaccines are not protective...... 136 4.3.2. Homologous and cross-reactive serum antibody responses of tilapia to GBS serotype Ib and Ia………………………………………..…..138

4.4. Discussion...... 139

Chapter 5: General discussion...... 144

References...... 156

17 List of Figures

Fig. 1.1. The global production of capture fisheries and aquaculture. The figure obtained from FAO report 2018: The State of World Fisheries and Aquaculture (FAO, 2018).

Fig. 1.2. Salmonid fish production and antibiotics use in Norway from 1974 to 2009. The figure obtained from Gudding: Vaccination as a Preventive Measure (Gudding, 2014).

Fig. 1.3. A schematic workflow of the important steps of conventional and pan-genome reverse vaccinology approaches for vaccine development in this research.

Fig. 1.4. Virulence factors of S. agalactiae created by BLAST ring image generator. The innermost ring (black) indicates GC content and GC skew (purple/green). The light blue inner rings indicate virulence factors of piscine strains belonging to ST-553, ST-260 and ST-

261. The next rings with darker blue colour represent the strains ST-261 isolated from wild fish in Australia in previous study. Other rings show strains from different ST including terrestrial strains and human strains. The novel six adhesins are represented on the left side of the figure labeled as “ST-261 adhesins”. The figure obtained from Delamare-

Deboutteville: On the origin of Group B Streptococcus from disease outbreaks in wild marine fish in Australia (Delamare Deboutteville, 2014).

Figure 2.1. A) Maximum likelihood phylogeny of 82 S. agalactiae strains. The tree was inferred from alignment of 6,050 non-recombinant core genome SNPs. Branch length was adjusted for ascertainment bias using Felsenstein’s correction implemented in RAxML

(Stamatakis, 2014). Nodes are supported by 1,000 bootstrap replicates. The tree was rooted

18 using S. pyogenes M1 GAS (accession number: NC_002737.2) as an outgroup. B) Minimum spanning tree showing relationship amongst ST-261 serotype Ib GBS isolates based on a distance matrix derived from non-recombinant core-genome SNP alignment. The consensus network was computed in MST-Gold (Salipante and Hall, 2011).

Figure 2.2. The pan-genome of S. agalactiae. A) BLASTN-based sequence comparison of

82 S. agalactiae genomes against the S. agalactiae pan-genome as reference constructed with BRIG 0.95 (Alikhan et al., 2011). Rings from the innermost to the outermost show GC content and GC skew of the pan-genome reference, then sequence similarity of each of the

82 strains listed in the legend, from top to bottom rings are coloured according to origin with fish isolates belonging to serotype Ib ST-261, ST-260 and ST-552 in blue, fish strains belonging to serotype Ia in purple and terrestrial strains in red. The outermost ring (black) represents the reference pan-genome. B) Proportion of protein-coding genes in the core, soft core, shell and cloud of the pan-genome of 82 S. agalactiae isolates were determined with Roary. C) Histogram indicates the frequency of genes (protein-coding) in red and IGRs

(non-protein-coding intergenic regions) in blue-green from 82 S. agalactiae genomes analysed by Piggy (Thorpe et al., 2017).

Figure 2.3. Virulence gene presence and absence in S. agalactiae. Genes were identified from VFDB to create a S. agalactiae database for comparison of 82 strains by BLAST using

SeqFindr with default settings (95% identity cut off).

19 Figure 2.4. The capsular polysaccharide (cps) operon of the ST-261 lineage. The operon was identified in Genbank files manually and then compared by BLAST using EasyFig

(Sullivan et al., 2011).

Fig. 3.1. General domain structures of four ST-261 adhesins, three are conserved in all GBS strains (adhesin_0337, 0626 and 1196) and one is specific to serotype Ib piscine strains

(adhesin_1648). The orange box represents the signal peptide at N-terminus including

YSIRK-type and unknown signal peptide. The green box represents the binding domains, including streptococcal surface repeat (SSURE) domain, bacterial immunoglobulin-like domain 1 (Big-1). Grey boxes indicate putative domains identified with low confidence. The analysis revealed these domains most similar to Trypanosoma brucei PARP

(Trypan_PARP) and a coiled-coil region. The blue box indicates transmembrane domains with LPxTG cell-wall anchor motif.

Fig. 3.2. Growth of S. agalactiae strain QMA0285 in different culture media. Bacteria was grown in four different cultures 1/ THB (in Red), 2/ THB + 5 µM Mn(II)SO4 and 100 µM

Zn(II)SO4 (THB + Mn&Zn in Blue), 3/ TB without glucose (TB in Green) and 4/ TB + 55 mM glucose (TB + Glu in Pink).

Fig. 3.3. Relative expression of GBS QMA0285 adhesins and cpsE genes under three different culture conditions. Up- or down-regulations of genes are shown relative to expression in Todd-Hewitt broth (THB) during exponential growth. A) Expression ratio of adhesin_0337 (Log2). B) Expression ratio of adhesin_0626 (Log2). C) Expression ratio of

20 adhesin_1196 (Log2). D) Expression ratio of adhesin_1648 (Log2). E) Expression ratio of cpsE (Log2). * p < 0.05, ** p < 0.01, *** p < 0.001 (n= 9).

Fig. 3.4. Tilapia serum antibody responses to vaccine antigen measured by indirect ELISA.

The response of serum antibody against recombinant adhesin was compared with the response of serum antibody from tilapia injected with PBS. A) The responses of serum antibodies against recombinant adhesin_0337 and PBS. B) The responses of serum antibodies against recombinant adhesin_0626 and PBS. C) The responses of serum antibodies against recombinant adhesin_1196 and PBS. D) The responses of serum antibodies against mixture of the three adhesins and PBS. ** p < 0.05; *** p < 0.005 (n = 6).

Fig. 3.5. Silver stained SDS-PAGE of whole cell proteins of GBS strain QMA0285 grown under different conditions. Cells were grown in four different conditions including 1/ THB, 2/

THB + 5 µM Mn(II)SO4 and 100 µM Zn(II)SO4 (MnZn), 3/ Terrific Broth without glycerol (TB) and 4/ TB + 55 mM glucose (TB Glu). Cells were harvested at 12 h, 18 h and 24 h time points and reduced by boiling for 15 min in reducing buffer containing dithiothreitol (DTT).

Five µL of reduced samples were resolved by 12% SDS-PAGE gel and stained by Silver- stain. Predicted molecular masses of four adhesins are: 1) adhesin_0337 is 56.4 kDa, 2) adhesin_0626 is 54.4 kDa, 3) adhesin_1196 is 22.3 kDa and 4) adhesin_1648 is 43.45 kDa.

Lane M contains broad range protein marker (New England Biolabs).

Fig. 3.6. Immunoblot profiles of whole cell of GBS strain QMA0285 grown in four different culture conditions, reacted with antisera from vaccinated tilapia. Lane M is the protein marker (New England Biolabs) and label on top of each lane is showing the antiserum used 21 to incubate the membrane strips. A) THB grown QMA0285 antigens, B) THB + 5 µM

Mn(II)SO4 and 100 µM Zn(II)SO4 (MnZn) grown QMA0285 antigens, C) TB without glycerol grown QMA0285 antigen, D) TB + 55 mM glucose grown QMA0285 antigens and E) recombinant adhesin_0337 (56.4 kDa), 0626 (54.4 kDa), 1196 (22.3 kDa) and mixture of the three adhesins detected by antisera from tilapia that were used with each recombinant vaccine.

Fig. 4.1. Cumulative mortality and relative percent survival of vaccinated tilapia after the challenge with GBS serotype Ib strain QMA0285. A) Mean cumulative mortality (%) of each vaccinated tilapia group. B) Relative percent survival (RPS) was calculated for each vaccine group based on PBS negative control group. **** p < 0.0001; *** p < 0.005; ** p < 0.01; * p

< 0.05.

Fig. 4.2. Cross reactivity of serum antibodies from vaccinated fish from each treatment group against GBS whole cells by indirect ELISA. A) Serum antibody cross-reactivity against

GBS serotype Ib whole-cell coating antigen. B) Serum antibody response to GBS serotype

Ia whole-cell coating antigen. Significant difference from PBS: adjuvant negative control *** p < 0.005; ** p < 0.01; * p < 0.05, (n = 6 fish per treatment.)

22 List of Tables

Table 2.1 S. agalactiae isolates and sequences used in this study.

Table 2.2. Genome assembly statistics.

Table 2.3. Reference sequences used for molecular capsular serotyping.

Table 3.1. Oligonucleotide primers used in this study.

Table 3.2. Vaccine types and antigen concentrations.

Table 3.3. Relative expression of QMA0285 adhesins and CpsE genes under three different culture conditions. Up- or down- regulation of genes relative to the expression in bacteria cultured in Todd-Hewitt broth (THB) during exponential growth.

Table 4.1. Oligonucleotide primers used in this study.

Table 4.2. Vaccine types and antigen concentrations.

23 List of abbreviations used in this thesis

• 16S- 16S ribosomal RNA

• Big-1- Bacterial immunoglobulin-like 1 domains

• bp- Base pair

• BRIG-BLAST ring image generator

• BSA- Bovine serum albumin

• CC- Clonal complex

• cDNA- Complementary DNA

• CFU- Colony forming unit

• CPS- Capsular polysaccharides

• ELISA- Enzyme-linked immunosorbent assay

• EPS- Extracellular polysaccharide

• FAO - Food and Agriculture Organization

• FbsA- Fibrinogen-binding protein A

• FbsB- Fibrinogen-binding protein B

• FimH- Type 1 Fimbrial adhesin

• GAS- Group A Streptococcus

• GBS- Group B Streptococcus

• gDNA- Genomic DNA

• GI- Genomic island

• GTR- General time-reversible

• IGRs- Intergenic regions

• IPTG- Isopropyl β-D-1-thiogalactopyranoside

• IP- Intraperitoneal 24 • LB- Lysogeny Broth

• LPS- Lipopolysaccharide

• Mbp- Million base pair

• MenB- Group B meningococcus

• MLST- Multilocus sequence typing

• MW- Molecular weight

• NSW- New South Wales

• NT- Northern Territory

• OD- Optical density

• PARP- Procyclic acidic repetitive protein

• PBS- Phosphate buffered saline

• PCR- Polymerase chain reaction

• PhtD- Pneumococcal histidine triad protein D

• PhtE- Pneumococcal histidine triad protein E

• ORFs- Open reading frames

• PsaA- Pneumococcal surface antigen A

• PVDF- polyvinylidene difluoride

• QLD- Queensland

• qRT-PCR- quantitative reverse transcription polymerase chain reaction

• RPS- Relative percentage survival

• SA - South Australia

• SDS-PAGE- Sodium dodecyl sulfate-polyacrylamide gel electrophoresis

• SNPs- Single nucleotide polymorphisms

• SSURE- Streptococcal surface repeat domains 25 • ST- Sequence type

• TB- Terrific broth

• TBS- Tris buffered saline

• TBST- Tris buffered saline + Tween 20

• TCS- Two-component regulatory systems

• THB- Todd Hewitt broth

• USD- United States Dollar

• VFDB- Virulence factors database

26 Chapter 1: General Introduction

1.1. Background

1.1.1 Dynamics of the rise in global aquaculture production

In the last five decades, world fisheries production has been growing rapidly with the increase of food fish supply at an average rate of 3.2% per annum and fish consumption per capita has been rising almost twice as rapidly with each person consuming an average of

20.2 kg in 2015 compared to an average of 9.9 kg per capita in the 1960s (FAO, 2018). This significant growth in fisheries supply and demand is correlated with population growth, increases in average incomes and well developed distribution channels (FAO, 2018). Today, fish is considered an important source of protein and nutrients providing a range of essential amino acids, fatty acids and some micronutrient and comprising about 17% of the animal protein intake of the global population (Blanchard et al., 2017; Merino et al., 2012).

Global fish production, including fisheries and aquaculture, totalled 170.9 million tonnes in

2016 which was around 14 million tonnes higher than in 2012 (Fig. 1.1) (FAO, 2018).

According to Food and Agriculture Organization of the United Nations (FAO), the production of capture fisheries was 90.9 million tonnes while total aquaculture production was 80 million tonnes in 2016 (FAO, 2018). The contribution of farmed food fish to total fish production was

47% in 2016, and has been steadily growing (FAO, 2018). Aquaculture production in 1990 represented only 13.4% of total fisheries output and 25.7% in 2000 (FAO, 2016). Although productions from capture fisheries still slightly dominated in 2016, it has been decreasing

92.7 million tonnes to 90.9 million tonnes between 2015 and 2016 and it is estimated to be kept dropping (Diggles et al., 2011; FAO, 2018). World fish production in aquaculture has 27 been growing although average annual growth decreased to 5.8% in between 2000 to 2016, compared to 10% during 1990s (FAO, 2018). However, fish farming industries are still growing dramatically in a number of countries, especially in Africa from 2006 to 2010 (FAO,

2018). Total aquaculture production increased for 13.2% in Africa, 10.8% in North and Latin

America and 10.13% in Asia between 2012 to 2014 (FAO, 2016). Europe and Oceania regions showed slower aquaculture production growth, which increased only 2.7% in Europe and 1.7% in Oceania over the same period (FAO, 2016). In 2014, contribution of aquaculture for human consumption exceeded the capture fisheries for the first time (FAO, 2016). In fact, the production of cultured fish in Asia has been higher than capture fisheries since 2008, and the aquaculture production in Asia, including China accounted 88.91% of world total aquaculture production (FAO, 2016). China is one of the largest aquaculture producers and has shown dramatic expansion in farmed fish production, with annual growth rate 5.5% in

2000 to 2012 (Cao et al., 2015; Ponte et al., 2014). The total production in China alone reached 45.469 million tonnes in 2014 (FAO, 2016). Aquaculture is now recognised as one of the fastest developing food sectors in the world compared to other food production industries. For example, cattle production has increased by less than 1%, pig by 0.8% and even poultry production has only risen by 3% per year since 2000 (FAO, 2013; Troell et al.,

2014). The estimated global aquaculture harvests value was around USD 160.2 billion including food fish and aquatic algae in 2014 (FAO, 2016).

28

Fig. 1.1. The global production of capture fisheries and aquaculture. The figure obtained from FAO report 2018: The State of World Fisheries and Aquaculture (FAO, 2018).

The proportion of aquaculture commodity represented by finfish is dominant, comprising two-thirds (66.3%) of the total aquaculture production (66.6 million tonnes), with 38.6 million tonnes from fresh water finfish aquaculture and 5.6 million tonnes in finfish mariculture whereas farmed crustaceans reached 9.7% (6.4 million tonnes) and mollusc production accounted 22.8% (15.2 million tonnes) in 2012 (FAO, 2014). In finfish farming, carps including silver carp (Hypophthalmichthys molitrix), bighead carp (H. nobilis) and grass carp

(Ctenopharyngodon idella) are the dominant species which account for about 70% of freshwater aquaculture (FAO, 2012). Tilapias, mainly Nile tilapia (Oreochromis niloticus),

Mozambique tilapia (O. mossambicus), blue tilapia (O. aureus), hybrid tilapia (O. niloticus x

O. aureus) are the second most important freshwater fish in aquaculture globally and are grown in more than 130 countries and territories (FAO, 2014). Tilapia farming in Asia contributes to more than 70% of its total finfish production (FAO, 2012). Barramundi or Asian sea bass (Lates calcarifer) is widely distributed in the Indo Pacific areas and is farmed mainly 29 in Southeast Asia and Australia (Aji, 2012; FAO, 2012). This fish can inhabit fresh, brackish and marine warm water but they are mostly cultured in coastal regions or cage farmed in freshwater ponds (Aji, 2012; Bowyer et al., 2013). Although its production remains small, it is a commercially important species due to its high value (Aji, 2012; FAO, 2014). Marine aquaculture production, including of Atlantic salmon (Salmo salar), ocean trout and groupers is much lower than freshwater farming in terms of tonnage (FAO, 2014, 2016). However, although marine finfish production contributes only 7.2% of the total production of finfish culture, the value is higher than most cultured freshwater finfish, which accounts 16.6% of share value (FAO, 2016). Most farmed finfish such as carps and tilapias are warm-water fish (temperature above 15°C) so they are cultured in tropical regions like Asia, Africa and

Latin America, and it is in these warm-water regions where growth in production has been most rapid (Bowyer et al., 2013; FAO, 2016). The world population has been estimated to reach approximately 9.7 billion by 2050 (Blanchard et al., 2017). The global demand for fish products will increase since fish is considered as a key source of protein and essential nutrients (Klinger and Naylor, 2012; Merino et al., 2012). However, wild fish catch has been dropping and further expansion in capture fisheries will be suppressed because wild fish stocks have been declining to biologically unsustainable level (FAO, 2016; Klinger and

Naylor, 2012). Therefore, aquaculture is one of the solutions to the increase of seafood demand in the world and to combat against food issues in the future (Klinger and Naylor,

2012; Merino et al., 2012).

1.1.2. Diseases in Aquaculture

In addition to the benefits of employment, poverty alleviation, food security and improved nutrition, particularly in developing regions, rapid growth in global aquaculture has also 30 increased problems including environmental impacts, land use conflicts and increased incidences of fish diseases (Pretto-Giordano et al., 2010; Troell et al., 2014). Disease has been an important constraint on the development of the aquaculture (Bostock et al., 2010;

Defoirdt et al., 2011). The emergence and development of disease is strongly associated with the interactions between infectious agents, host animals and environment (Toranzo et al., 2005). In the aquaculture environment, animals are routinely maintained at high densities of monospecies populations with low oxygen levels and often poor water quality

(Murray and Peeler, 2005). High stock densities lead to rapid transmission of infectious agents among animals and stressors including low dissolved oxygen and low water quality increase hosts’ susceptibility to disease (Defoirdt et al., 2011). Transfer of live fish for commercial operational reasons can result in the introduction of pathogens into new systems, and has resulted in transboundary distribution of diseases between countries

(Hedrick, 1996). Whilst quite strict biosecurity legislation applies in some countries, the difficulties associated with detection of subclinical infections and limitations in detecting live agents in frozen products can results in accidental import and introduction of new pathogens into naïve wild stock (Murray and Peeler, 2005). For example, frozen pilchards imported into

Australia from South America as tuna feed are the most likely explanation of a widespread mass mortality of wild native pilchards due to pilchard herpesvirus in the early 2000s

(Gaughan, 2001). Diseases in fish farming have significant impacts on aquaculture economics (Lafferty et al., 2015). There are two ways that diseases in farming can have economic impacts, one is the mortality and lower growth rate which reduce biological productivity and lead to reduction of harvest (Lafferty et al., 2015). The other way is that diseases lower the quality of fish causing decrease in market value (Defoirdt et al., 2011;

Lafferty et al., 2015). For example in China, diseases caused by Gram-negative bacteria 31 including Aeromonas spp., Yersinia spp. and Vibrio spp., affected freshwater carp farming and led to substantial economic losses estimated at more than 120 million USD annually

(Qi, 2002). The global losses due to disease outbreaks have been estimated as several billion USD every year (Defoirdt et al., 2011; Lafferty et al., 2015). The infectious agents causing disease in fish include bacteria (34%) viruses (25%), protists (19%) and metazoans

(18%) although bacterial infections are the most dominant cause of serious disease in aquaculture (Lafferty et al., 2015). Whilst many species of bacteria have been documented as causative agents in fish mortalities worldwide, many of these are opportunists and can be eliminated through improved husbandry. However there are a relatively small number of primary fish pathogens that are responsible for the most serious economic losses in global aquaculture (Lafferty et al., 2015; Toranzo et al., 2005).

Streptococcus is an emerging pathogen in wild and cultured fish and becoming major problem in global aquaculture (Toranzo et al., 2005; Verner-Jeffreys et al., 2017; Yanong and Francis-Floyd, 2010). These Gram-positive cocci lead to streptococcosis and are known to affect a broad range of hosts including human, terrestrial animal and aquatic animal worldwide (Evans et al., 2002; Toranzo et al., 2005). Streptococcal infection in fish was first reported in Japan in 1958 that affected commercial rainbow trout (Hoshina et al., 1958).

After this, large numbers of economically and environmentally important fish species have been found to be susceptible to Streptococcus (Li et al., 2016; Verner-Jeffreys et al., 2017;

Yanong and Francis-Floyd, 2010). Clinical signs of streptococcal infection vary depending on the fish species and the type of hosts (Agnew and Barnes, 2007; Woo and Gregory,

2014). Generally, the infected fish showed lethargic and erratic swimming resulting from meningoencephalitis (Yanong and Francis-Floyd, 2010). Other common symptoms of 32 streptococcal infection include exophthalmia and hyphema, petechia, oedema in the peritoneal cavity and intestine, pale liver and a darkly coloured spleen (Eldar et al., 1995a).

There are several species that cause streptococcosis in a diverse array of warm and temperate marine and freshwater fish (Toranzo et al., 2005). Streptococcosis is descriptive of the disease rather than the genus causing the disease, thus, ‘streptocococcosis’ is caused by S. agalactiae, S. iniae, S. parauberis and Lactococcus garvieae in warm water (Toranzo et al., 2005; Vendrell et al., 2006; Woo and Gregory, 2014). In cooler temperate water, L. piscium and Vagococcus salmoninarum are causative agents of streptococcosis (Ghittino et al., 2003). The infectious agents of streptococcosis in warm water are potentially zoonotic agents and can induce disease in humans (Toranzo et al., 2005). Streptococcus agalactiae and S. iniae are two major pathogens affecting freshwater, brackish and marine cultures in warm water and lead to high mortality and consequently economic losses (Li et al., 2016;

Rodkhum et al., 2011). For example, the global economic impact of disease outbreaks caused by S. agalactiae and S. iniae to the aquaculture industry has been estimated to be more than 250 million USD annually (Amal and Zamri-Saad, 2011).

1.1.3. Control of bacterial diseases in aquaculture

The interaction between pathogen, host and environment are important factors in development of disease (Toranzo et al., 2005). In the aquatic environment, especially farming systems, bacteria can reach high densities and the host animals would be more likely to be in contact with pathogens (Defoirdt et al., 2011; Verschuere et al., 2000).

However, in the aquaculture environment, total eradication of pathogen from the system is almost impossible (Millard et al., 2012). Therefore, controlling pathogens is critical for developing aquaculture. 33 Antibiotics have been used in aquaculture to control and kill pathogenic bacteria (Defoirdt et al., 2011). In the farming environment, fish are exposed to stress and this decreases the effectiveness of their immune system (Naylor and Burke, 2005). As a consequence, fish cannot avoid bacterial colonization and infection so use of antibiotics to control disease became common (Cabello, 2006; Naylor and Burke, 2005). However, frequent use of antibiotics increases selective pressure in a bacterial population that can lead to increase of antibiotics resistance (Cabello, 2006). Indeed, detected levels of residual antibiotics and resistant bacteria have been elevated in the area around farming sites (Kümmerer, 2009).

In addition, horizontal gene transfer of resistance genes occurs between the tolerant bacteria and other potentially more serious pathogens (Barlow, 2009). This could negatively affect human health if human pathogens acquire the resistance determinants (Cabello et al.,

2013; Diana et al., 2013). Furthermore, in some cases, antibiotics are not effective to treat bacterial infection in fish and antibiotics use has been substantially reduced (Defoirdt et al.,

2011; Verschuere et al., 2000). The decrease of antibiotics use is not only because of its ineffectiveness but also routine has been developed to protect fish against bacterial pathogens (Håstein et al., 2005; Press and Lillehaug, 1995). In Norway, antibiotics were major treatment for diseases caused by bacterial pathogens in salmonids industries in the

1980s (Midtlyng et al., 2011).

However, since the introduction of functional vaccines, despite use of antibiotics reduced, the production of Norwegian salmonids cultures reached more than double in last 10 years

(Fig. 1.2) (Gudding, 2014; Håstein et al., 2005; Midtlyng et al., 2011). As a vertebrates, fish possess an adaptive immune system (Press and Lillehaug, 1995). When vaccine (antigenic substance) is injected in fish, this stimulates the hosts immune system to develop adaptive 34 immunity (Gudding and Van Muiswinkel, 2013; Press and Lillehaug, 1995). Today, vaccination is the most important and widely used way to prevent and control bacterial Disease prevention as basis for sustainable aquaculture 145 diseases in cultured fish in developed nations (Gudding, 2014; Håstein et al., 2005).

However, some bacterial pathogens are particularly hard to control through vaccination.

FIGURE 2 Use of antibiotics and production of salmonid fish in Norway from 1974 to 2009

60 Use of antibiotics in fish 1 200 Fish production

50 1 000

40 800

30 600

20 400 Tonnes of salmonids (in thousand)

No. kgs of antibiotics (in thousand) 10 200

0 0 74 79 84 89 94 99 04 09

Fig. 1.2. Salmonid fish production and antibiotics use in Norway from 1974 to 2009. The figure obtained fromHowever, Gudding: Vaccinationthere are still as challenges,a Preventive especiallyMeasure (Gudding, related to2014) the. relatively small production of cod and other marine fish. In 2009, the amount of antibiotics used was similar for the production of salmonids and marine fish, whereas the production volume of the marine species was less than 2 percent of that for salmonids. The use of antibiotics in the farming 1.1.4.of cod Streptococcal is a consequence infections of the in fact fish that some bacterial diseases affecting this species are difficult to prevent. Francisella is an intracellular bacterium, and it is well known that 1.1.4.1.prevention Streptococcus of diseases iniae owing to such intracellular micro-organisms using inactivated vaccines is difficult. In other countries, the use of live attenuated vaccines seems to be Satr solutioneptococcus leading iniae to was the first successful isolated prevention from a skin of lesion intracellular of diseased micro-organisms Amazon freshwater based on vaccines (Shoemaker et al., 2009). In Canada, a DNA vaccine against infectious dolphinhaematopoietic (Inia geoffrensis necrosis) wasin 1972 licensed, although a few yearsit was ago potentially (Salonius isolated et al., 2007). from rainbowIn Norway, trout the possible risks associated with DNA vaccines have limited the use of such vaccines in earlier in Japan in 1958 (Hoshina et al., 1958), though not identified until later (Pier and aquaculture. However, this issue is now under reconsideration. Vaccination is the most important preventive measure in order to maintain Madin, 1976). In 1979, large-scale streptococcal infections were observed in farmed sustainability in salmonid fish farming. However, there is still a great need for research freshwaterin this area fish,in order tilapia, to userainbow the potential trout, and of the ayu immune (Plecoglossus system altivelisof fish in) leading a beneficial to serious way. Here the governmental and private sector have35 to work together. Among the many areas for cooperation are the development of vaccines against intracellular micro-organisms, oral vaccines, live vaccines, adjuvants and improved vaccines based on molecular biology.

CONCLUSIONS The conclusion based on 30 to 40 years’ experience with intensive salmonid fish farming in Norway is that sustainability should be the basis for developing a successful aquaculture industry. The Norwegian experience is that disease prevention is fundamental for sustainability. Legislation is the cornerstone in disease prevention, while vaccination is the single most important preventive measure. Finally, the authorities and the industry must be well organized and have the right competence on all levels. economic losses in Japan (Kitao et al., 1981). The pathogen was later identified as S. iniae

(Nakatsugawa, 1983; Stoffregen et al., 1996). Today, S. iniae infections in fish have been reported in multiple countries, including US (North America), Japan, China, Thailand,

Vietnam, Malaysia, Indonesia, Singapore (Asia), Bahrain and Israel (Middle East), south- east Caribbean basin (Central America), Brazil (South America) and Australia (Oceania)

(Bromage et al., 1999; Colorn et al., 2002; Ferguson et al., 2000; Figueiredo et al., 2012;

Kitao et al., 1981; Mmanda et al., 2014; Nakatsugawa, 1983; Nawawi et al., 2009; Perera et al., 1994; Suanyuk et al., 2010; Yuasa et al., 1999). Streptococcus iniae has a wide host range, which comprises freshwater, estuary and marine, cultured and wild fish such as tilapia, hybrid tilapia, hybrid striped bass, channel catfish, ayu, rainbow trout, barramundi, red drum (Sciiaenops ocellatus), European sea bass (Dicentrarchus labrax), striped piggy

(Pomadasys stridens), lizardfish (Synodus variegatus), snapper (Ocyurus chrysurus), Grey mullet (Mugus cephalus), parrot fish (Sparisoma aurofrenatum), silver bream

(Acanthopagrus australis) and Japanese flounder (Paralichthys olivaces) (Bromage et al.,

1999; Colorn et al., 2002; Ferguson et al., 2000; Kitao et al., 1981; Nakatsugawa, 1983;

Perera et al., 1994; Shoemaker et al., 2001). In Australia, outbreaks of S. iniae caused mortality of 35% in barramundi every winter and early spring that result huge losses in barramundi industries (Creeper and Buller, 2006; Nawawi et al., 2008). In addition, S. iniae has been isolated from terrestrial animals including flying fox (Puteropus alecto) and causes occasional human infections following handling of infected fish (Agnew and Barnes, 2007;

Facklam et al., 2005).

36 1.1.4.2. Streptococcus agalactiae (Group B Streptococcus; GBS)

Streptococcus agalactiae is the sole member of the Lancefield group B Streptococcus (GBS)

(Evans et al., 2002; Lancefield, 1933). Group B Streptococcus has been isolated from terrestrial animals including humans, cattle, camels, dogs, cats and frogs and from aquatic animals such as fish, seals and dolphins indicating that GBS has broad range of hosts

(Delannoy et al., 2013; Elliott et al., 1990; Evans et al., 2002). Group B Streptococcus is an important pathogens in humans: although commensal in the urogenital tracts of high proportion of the human population, GBS is the most frequent cause of meningitis and septicaemia in newborns, and is therefore of substantial concern in pregnant women

(Dangor et al., 2014; Edwards and Gonik, 2013). Streptococcus agalactiae in fish was first reported in freshwater fish, golden shiners (Notemigonus crysoleucas) in the US in 1966

(Robinson and Meyer, 1966). Robinson and Meyer (1966) isolated GBS from diseased fish’s kidney (Robinson and Meyer, 1966). They demonstrated transmission of disease between diseased and healthy fish in the aquarium causing death within four to five days of infection

(Robinson and Meyer, 1966). Since the first report, GBS infection in fish has been documented in a number of countries in tropical or temperate regions, specifically the US

(North America), Japan, China, Thailand, Malaysia, Indonesia (Asia), Israel and Kuwait

(Middle East), Honduras (Central America), Colombia and Brazil (South America) and

Australia (Oceania) (Abuseliana et al., 2010; Baya et al., 1990; Bowater et al., 2012; Eldar et al., 1995b; Evans et al., 2008; Evans et al., 2002; Geng et al., 2012; Kayansamruaj et al.,

2014; Lusiastuti et al., 2014; Najiah et al., 2012; Salvador et al., 2005). A variety of commercial and wild fish have been killed by S. agalactiae, including tilapia species, catfish species, silver pomfret (Pampus argentes), mullet (Liza klunzingeri), yellowtail and sea bream (Amal and Zamri-Saad, 2011; Elliott et al., 1990; Evans et al., 2002; Geng et al., 37 2012). Recently, the first report of natural outbreak of GBS was documented in wild giant

Queensland groupers (Epinephelus lanceolatus), diamond-scale mullet (L. vaigensis), javelin grunter (Pomadasys kaakan), giant sea catfish (Arius thalassinus) and stingray species comprising estuary ray (Dasyatis fluviorum), mangrove whipray (Himantura granulate) and eastern shovelnose ray (Aptychotrema rostrata) in northern Queensland in

Australia (Bowater et al., 2018; Bowater et al., 2012; Delamare-Deboutteville et al., 2015).

The outbreaks of disease caused by S. agalactiae lead to substantial losses in aquaculture, with particular impact on tilapia farms (Evans et al., 2004). Both pathogens have caused massive disease outbreaks and led to huge economical impacts on global aquaculture every year. This research will focus on S. agalactiae, major pathogens in warm water fish.

1.1.5. Streptococcal intraspecific diversity

1.1.5.1 Serological typing

Traditionally, intraspecific classification of streptococci have been distinguished by serological classification of antigens on the surface and hemolytic activity of bacterium

(Lancefield, 1933). Streptococcus agalactiae is Lancefield group B, however, S. iniae does not fall into any Lancefield group (Agnew and Barnes, 2007; Evans et al., 2002). The typing methods have improved with advancing technology and serotyping based on the capsular polysaccharides (CPS) has been widely used to discriminate Streptococcus isolates of the same species (Amundson et al., 2005; Kong et al., 2002). Molecular serotyping has been developed that is based on CPS synthesis (cps) gene clusters (Kong et al., 2002). Currently,

S. agalactiae can be divided into 10 different CPS serotypes, Ia, Ib and II to IX (Kong et al.,

2002; Slotved et al., 2007). The most infectious GBS in fish are identified as serotype Ia and

Ib (Delannoy et al., 2013; Evans et al., 2008). There are few strains which are belonging to 38 serotype III-4 isolated from tilapia in Thailand, Vietnam, China and Brazil (Chideroli et al.,

2017; Delannoy et al., 2013; Kayansamruaj et al., 2014; Li et al., 2013).

1.1.5.2. Mutilocus sequence tying (MLST)

Multilocus sequence typing (MLST) is an unambiguous sequence based typing which involves sequencing about 450 to 500 bp of seven housekeeping genes and which investigates composition of allele numbers, allelic profile, to determine the sequence type

(ST) (Jones et al., 2003; Sabat et al., 2013). This method is particularly useful for global epidemical research (Sabat et al., 2013). The majority of S. agalactiae strains isolated from fish have been typed as ST-260 and ST-261 (Delannoy et al., 2013; Lusiastuti et al., 2014;

Rosinski-Chupin et al., 2013). Streptococcus agalactiae ST-260 is recognized as part of clonal complex (CC) 552, comprising of non-hemolytic S. agalactiae strains (Delannoy et al., 2013). These ST-260 strains originate from Honduras, Colombia, Costa Rica and Brazil, affecting tilapia and hybrid Amazon catfish (Pseudoplatystoma fasciatum x Leiarius marmoratus), and from US infecting hybrid striped bass (Delannoy et al., 2013; Godoy et al., 2013b; Rosinski-Chupin et al., 2013). Sequence type 261 strains are a widely distributed found in Australia, Belgium, Indonesia, Israel and US affecting wild fish, tilapia and trout

(Delannoy et al., 2013; Lusiastuti et al., 2014; Rosinski-Chupin et al., 2013). Sequence type

7 has been isolated in Thailand, Kuwait and China, causing disease in tilapia and mullet

(Delannoy et al., 2013; Evans et al., 2008; Ye et al., 2011). Sequence type 7 is recognized as human pathogen that causes invasive disease in newborn and adults (Jones et al., 2003).

Human sewage is considered as source of ST-7 outbreaks in fish (Delannoy et al., 2013).

Other STs have been identified among GBS fish strains including ST-103, 257, 552 and 553 in Brazil, ST-258 in Israel, ST-259 in Honduras, ST-283 and 500 in Thailand and ST-491 in 39 Vietnam (Evans et al., 2008; Godoy et al., 2013b; Rosinski-Chupin et al., 2013). Sequence type 257, 552, 553 and 259 fall into CC-552 and ST-258 has weak connection to CC-552

(Rosinski-Chupin et al., 2013). Sequence type 261 does not belong to CC-552, but it is closely related to this CC (Godoy et al., 2013b).

1.1.6. Control of Streptococcal diseases

Due to the zoonotic potential of S. agalactiae, controlling infection of S. agalactiae is important for both aquaculture development and food safety (Ghittino et al., 2003). There are several measures to control streptococcal disease in aquaculture including antibiotic use and mass vaccination (Shoemaker et al., 2001). Evans et al. (2002) demonstrated that S. agalactiae strains isolated from seabream and mullet in Kuwait were sensitive to oxytetracycline, ampicillin, ciprofloxacin, amoxicillin/clavulanic acid, chloramphenicol, rifampin and sulphamethoxazole (Evans et al., 2002). Streptococcus agalactiae causing mass mortality of tilapia in Malaysia are also sensitive to amoxicillin, ampicillin and erythromycin (Abuseliana et al., 2010). Although, antibiotics kill pathogens, some of them will still remain and the residual antibiotics in the system increase selective pressure that would cause antibiotics resistance in bacteria (Cabello, 2006). Streptococcus agalactiae recently, isolated from tilapia in Malaysia indicated low level of resistance to amoxicillin/clavulanic acid and ampicillin (Aisyhah et al., 2015). However, antibiotics resistance represents a substantial global problem and could be transferred to ecosystems around the farm and spread amongst the bacteria so strict regulation of antibiotics and monitoring are required (Aisyhah et al., 2015). Several vaccines against streptococcal infection have been developed to protect fish (Evans et al., 2004). Eldar et al. (1995b) reported that vaccinations with whole-cell and protein extract from S. difficile, later 40 reclassified as S. agalactiae, elicited high protection to hybrid tilapia against challenge with

S. agalactiae (Eldar et al., 1995b; Kawamura et al., 2005). Whole-cell vaccination gave cross-protection against challenge with a heterologous strains of the same species (Eldar et al., 1995b). Under field raceway condition, vaccination provided protection to farmed fish with 4.5% mortality after four month of vaccination (Eldar et al., 1997). Evans et al. (2004) showed the protection to tilapia of 30g injected formalin-killed S. agalactiae resulted 80% of survival. These vaccines have been widely used in fish farms in US (Iregui et al., 2014).

1.1.7. Vaccine failures

The success of vaccination against streptococcal diseases in fish has not reflected the success seen against other bacterial infections due to re-emergence of new serotypes

(Bachrach et al., 2001). In 1997, outbreaks of disease caused by a new serotype (“serotype

II”) of S. iniae were recorded in rainbow trout in Israel after the vaccination (Bachrach et al.,

2001). In response to the reoccurrence of disease outbreaks, a new vaccine was developed containing the serotype II strain (Eyngor et al., 2008). However, vaccination against serotype

I and II S. iniae led to re-emergence of disease caused by a further novel strain in 2005

(Eyngor et al., 2008). The new strain differed from vaccine strains (serotype I and II) in the capacity to produce larger amount of extracellular polysaccharide (EPS) than vaccine strains (Eyngor et al., 2008). Eyngor et al. (2008) suggested that EPS is not only the major virulence factors but also it is a major antigenic factor since fish vaccinated with EPS alone provided protection (72%) against challenge with new strain (Eyngor et al., 2008).

Emergence of new strains after vaccinations were also reported from barramundi farms in

Northern Territory (NT), New South Wales (NSW) and South Australia (SA) in Australia

(Millard et al., 2012). An autogenous vaccine, which is a vaccine prepared from a strain 41 isolated from the farm directly and only can be used in the same farm, was used to protect barramundi against S. iniae in the farms in NT, NSW and SA. In each case, reinfection of vaccinated stock occurred and was correlated with variations in at least one of five of the 20 cps genes in capsular operon (Millard et al., 2012). This corroborated previous studies in other streptococcal species that selective pressure induced by vaccination leads to the emergence of novel strains which can escape from vaccine-induced adaptive immunity in these farmed fish (Bachrach et al., 2001; Eyngor et al., 2008). These vaccine failures were due to variability of the antigens that are targeted by the adaptive immune system during fish vaccination (Millard et al., 2012).

Fundamental factors for long-term and cross-protective vaccine are the nature of the antigens recognised by specific immune response. Therefore, antigens that are highly conserved among strains should be ideal vaccine candidates (Millard et al., 2012; Pizza et al., 2000). Most streptococci are surrounded by thick wall of polysaccharides (CPS), which is one of the major virulence factors and is the dominant antigen targeted by the immune system (Lowe et al., 2007). However, due to its antigenicity and immunogenicity, CPS is highly polymorphic under immune selective pressure (Barnes et al., 2003; Lowe et al.,

2007). Antibodies raised against vaccine strains did not cross-react with emergent strains suggesting that changes in cps genotype correlated with vaccine failure are related to antigenic differences amongst streptococcal bacteria (Millard et al., 2012). The variability of

CPS makes development of vaccines which are able to provide protection against a wide range of strains particularly challenging (Lachenauer et al., 1999). For example, S. agalactiae can be divided into 10 different CPS serotypes, Ia, Ib and II to IX and each type is antigenetically different (Johri et al., 2006; Slotved et al., 2007). Conjugate vaccines that 42 have been made from purified the CPS type, which induce protective antibodies against homologous types of US prevalent strains, are not able to provide the protection against heterologous strains found in Japan (Johri et al., 2006; Lachenauer et al., 1999; Lindahl et al., 2005).

1.1.8. Commercial Streptococcal vaccines in aquaculture

Currently, commercial vaccines against streptococcal infection are available, AQUAVAC®

Strep Sa (Merck Animal Health Inc.) against S. agalactia (Locke et al., 2010; Pridgeon and

Klesius, 2013; Zamri-Saad et al., 2014). The vaccine, AQUAVAC® Strep Sa (Merck Animal

Health Inc.), has been developed to protect fish against S. agalactiae. It is an inactivated oil- adjuvant vaccine that can induce active immunity against S. agalactiae biotype II (serotype

Ib), can be given by injection to fish more than 15 g. This vaccine has been tested in tilapia but can be used to other fish which are susceptible to S. agalactiae biotype II (serotype Ib).

Currently, it has been approved in Brazil, Costa Rica and Indonesia for tilapia (Aftabuddin et al., 2016; Brudeseth et al., 2013). Although a number of commercial vaccines against S. agalactiae, however it is not available in all countries including Australia where only autogenous vaccines can be used to control streptococcal disease (Brudeseth et al., 2013;

Millard et al., 2012). Moreover, it is killed bacterin, thus reliant on CPS antigens and are therefore serotype specific and subject to potential future serotype switching and consequent vaccine escape. Consequently, there is a need to identify more highly conserved critical surface or secreted protein antigens that can be targeted to give cross protection amongst serotypes.

43 1.1.9. Surface protein antigens

Streptococcal antigenic diversity is not a problem that is unique to development of fish vaccines; vaccines against group A and group B Streptococcus and S. pneumoniae in humans require coverage for multiple serotypes (Johri et al., 2006; Sharma et al., 2012;

Talukdar et al., 2014). As a result, many different surface or secreted protein antigens have been explored to develop long-term and cross-reactive vaccines as an alternative to CPS

(Aviles et al., 2013; Brodeur et al., 2000; Cheng et al., 2010; Johri et al., 2006). For instance, conserved anchorless surface proteins of S. pyogenes (group A Streptococcus; GAS) arginine deiminase and trigger factor have been found to elicit protection in mice against challenges with multiple serotypes of GAS (Henningham et al., 2012; Henningham et al.,

2013). In addition, Sip, surface protein of S. agalactiae, has been recognised as immunogenic protein which evokes efficient protection in CD-1 mice challenge model against six S. agalactiae strains of different capsular serotypes (Brodeur et al., 2000). For fish vaccines, Sip11, a putative iron-binding exported protein identified from S. iniae SF1, has been showed to elicit protection (69.7%) in Japanese flounder against S. inae SF1 strain

(Cheng et al., 2010). Although cross-reactivity of Sip11 against heterologous strains has to be tested, Sip11 has been considered as a vaccine candidate against S. iniae in aquaculture

(Cheng et al., 2010). In contrast, highly antigenic proteins are not always protective. M-like protein, SiMA, which is a surface expressed protein and contributes to bacteria adherence and macrophage resistance (Aviles et al., 2013). SiMA genes, simA, are highly conserved among different strains of S. iniae, considered that SiMA has a potential target for cross- protective vaccine (Aviles et al., 2013; Locke et al., 2008). However, although SiMA induced specific antibodies, the recombinant SiMA vaccine did not elicit protective immunity to barramundi against challenge with S. iniae (Aviles et al., 2013), although, the antibodies 44 raised against SiMA cross reacted in enzyme-linked immunosorbent assay (ELISA) with the heterologous challenge strain which has different capsular serotype but homologous simA sequence (Aviles et al., 2013). A similar result was observed when membrane protein, fibrinogen-binding protein (FbsA), was tested as a subunit vaccine against S. agalactiae in tilapia (Yi et al., 2014): Two protein antigens, FbsA and glycolytic enzyme α-enolase identified from S. agalactiae isolated from tilapia, were effective immunogens (Yi et al., 2014).

However, although recombinant FbsA-specific antibody titer was significantly higher than that of recombinant α-enolase, recombinant FbsA provide lower protection (approximately

40%) in tilapia against S. agalactiae challenge compared to recombinant α-enolase which resulted in > 60% protection (Yi et al., 2014). These results indicated that proteins, which have high antigenicity, are not always effective as protective immunogens (Yi et al., 2014).

Therefore, the antigens’ ability to induce protective immunity is critical for successful vaccine development.

1.1.10. Reverse vaccinology

Identification of antigens which are able to elicit protective immunity has predominantly relied on extensive biochemical, serological and microbiological experimentation and testing putative antigens in a piecemeal manner (Rappuoli, 2001). However, these conventional approaches require a long time and usually determine the most abundant or immunogenic antigens, therefore often fail if the major antigens are highly variable like CPS in

Streptococcus (Johri et al., 2006; Rappuoli, 2001). Also, the conventional approach often does not address the high potential intraspecific diversity amongst a pathogen species (Johri et al., 2006). In the last decade it has become possible to predict all potential vaccine candidate antigens in a species complex through rapid inexpensive whole genome 45 sequence technologies, coupled to advances in in silico analysis, and to identify the most conserved amongst them in an approach known as reverse vaccinology (Rappuoli, 2001).

Reverse vaccinology has already demonstrated potential to improve vaccine design in a much shorter period and at lower cost (Fig. 1.3) (Adu-Bobie et al., 2003; Rappuoli, 2001).

Briefly, the identification of potential vaccine candidates by reverse vaccinology starts from examining the genome sequence of the pathogens to find open reading frames (ORFs) which encode novel protein antigens (generally surface located or secreted) on the pathogens (Pizza et al., 2000). After identifying ORFs, the genes are cloned and expressed and the recombinant proteins undergo immunogenicity testing in an animal model (Fig. 1.3)

(Pizza et al., 2000; Rappuoli, 2001). Reverse vaccinology was pioneered by Rappuoli and first employed to improve vaccines against Neisseria meningitidis serogroup B, group B meningococcus (MenB) which can lead to meningitis and meningococcemia (Pizza et al.,

2000; Rappuoli, 2001). Vaccine development against MenB had been slow taking the conventional approach (Rappuoli, 2001): The capsular polysaccharide expressed on the surface of MenB was main target antigen, but it is chemically similar to human antigens, therefore, it had a potential risk of autoimmunity (Giuliani et al., 2006; Rappuoli, 2001). On the other hand, reverse vaccinology successfully identified 29 novel antigens that are capable of inducing antibodies against the pathogen (Giuliani et al., 2006). After screening, the vaccine comprising three antigens (Neisserial heparin-binding antigen, factor H-binding protein and N. meningitidis adhesin A), underwent phase I trials and has been granted a marketing authorization in 2012 as the first universal vaccine against MenB (Delany et al.,

2013; Giuliani et al., 2006). Identification of universal antigens, which can induce protective immune response against all strains of polymorphic bacteria, is difficult by conventional approaches (Rappuoli, 2001). Multigenome or pan-genome reverse vaccinology allows 46 identification of potential protein antigens that are conserved across the most virulent serotypes to enable development of vaccines against bacteria with highly variable antigens, such as Streptococcus spp. (Adu-Bobie et al., 2003; Maione et al., 2005; Rappuoli, 2001;

Seib et al., 2012). Maione et al. (2005) compared genome sequences of eight S. agalactiae strains that belong to serotype Ia, Ib, II, III and V, which are the most significant serotypes causing human disease (Maione et al., 2005). Maione et al. (2005) found 589 surface expressed proteins including 396 were in core genes and 193 were in variable genes

(Maione et al., 2005). After immunogenicity testing, they identified a combination of four proteins, including conserved Sip protein and variable surface expressed proteins across the strains which were assigned as pili. These induced 59.3% to 100% protection in mice against 12 GBS strains in challenge models (Maione et al., 2005; Seib et al., 2012).

However, although each antigen provides protection against several strains, one antigen could not elicit protection against all strains because either their antigen coding gene was not present or the antigen was difficult to access in a fraction of GBS (Maione et al., 2005).

Therefore, screening a genome from a single strain is insufficient to identify the antigen combination eliciting protection against all strains (Maione et al., 2005). Since this successful identification of universal vaccine candidates in GBS, the multigenome reverse vaccinology approach has been employed in other human pathogenic Streptococcus, such as GAS, S. pyogenes and S. pneumonia (Sharma et al., 2012; Talukdar et al., 2014).

47 Conventional vaccine Disease outbreak caused by development for Vaccinate fish aquaculture novel strains

Challenge model

Emergence of Grow & novel strains inactivate If vaccine is bacteria safe & If vaccine is protective not protective

Try different formulation

Licensing & manufacturing vaccine

Detect & isolate Available for farms pathogen

Generate pan-genome & Express Test vaccine Whole genome predict conserved predicted efficacy in sequencing antigens antigens challenge model Pan-genome reverse vaccinology

Fig. 1.3. A schematic workflow of the important steps of conventional and pan-genome reverse vaccinology approaches for vaccine development in this research.

1.1.11. The Pan-genome concept

The rapid advance and reduced cost of next generation sequencing technologies and bioinformatics have led to extensive whole-genome sequencing efforts with 1000s of draft bacterial genomes now publicly available to facilitate understanding of diversity, virulence and metabolic pathways (Muzzi et al., 2007; Seib et al., 2012). These are now being employed in vaccine research and development approaches such as reverse vaccinology

(Muzzi et al., 2007; Rappuoli, 2001; Seib et al., 2012). However, looking at the genome of a single clonal complex of a bacterial species is not enough to explore a bacterial species

48 (Medini et al., 2005). Recently, Tettelin et al. (2005) analyzed eight genome sequences of

GBS belonging to different serotype and found out that eight GBS strains contains 2713 genes, 1806 genes being shared by all strains while any number of the 907 total remaining genes are absent in some strains (Tettelin et al., 2005). The group of shared genes is called the “core genome” and they are likely to be essential for basic survival, the group of variable genes is called the “dispensable” or “accessory” genome and comprises specialisations for niche or host adaptation. Genes that are only present in one isolate are called strain-specific genes. Together, the core and accessory genomes from multiple representative strains with a bacterial species complex make up the “pan-genome” and should describe the complete gene set for a particular bacterial species (Medini et al., 2005; Muzzi et al., 2007; Tettelin et al., 2005).

Whilst a bacterial species should be fully described by applying the pan-genome (Tettelin et al., 2005), according to Tettelin et al. (2005), the pan-genome of GBS will increase by an average of 33 new genes each time new genome sequences are introduced, therefore, the

GBS pan-genome is still an “open” pan-genome (Tettelin et al., 2005). This “open” pan- genome mode was consistent when whole-genome sequences of five S. pyogenes were analyzed which resulted in the addition of about 27 new genes to the pan-genome every time the genome of a new strain was sequenced (Tettelin et al., 2005). In contrast, when the complete genomes of eight strains of Bacillus anthracis were analyzed, the number of novel genes added to the pan-genome decreased to zero after the fourth strain, so the species is considered to have a “closed” pan-genome (Muzzi et al., 2007; Tettelin et al.,

2005). It has been suggested that bacterial species which have an open pan-genome can colonise variable environments and have several mechanisms to exchange genetic material 49 like transformation (obtained genes from environment), transduction (virus delivers DNA) and conjugation exchange of DNA between bacteria (Medini et al., 2005). On the other hand, bacteria that live in limited niches and have poor capacity to acquire additional genetic material have a closed pan-genome (Medini et al., 2005; Tettelin et al., 2005). Therefore, although only four whole-genome sequences are enough to explore B. anthracis, larger numbers of complete genome sequences are required to fully describe GBS by pan-genome

(Medini et al., 2005; Muzzi et al., 2007; Tettelin et al., 2005).

1.1.12. The Pan-genome reveals niche specialisation of aquatic S. agalactiae

Our previous work on classification of S. agalactiae by MLST revealed that all Australian S. agalactiae piscine strains belong to ST-261, which is consistent with previous studies on aquatic GBS (Delannoy et al., 2013). In addition, we have sequenced the whole-genomes from 23 S. agalactiae including 16 marine and seven terrestrial strains and compared with

18 other assembled genomes involving human, bovine, camel and frog against virulence factors of S. agalactiae (Delamare Deboutteville, 2014). The results indicated that there has been substantial virulence factors reduction among ST-261 isolates from Australian fish

(Fig. 1.4) (Delamare Deboutteville, 2014). Some inactivated genes encode for the proteins which contribute to bacterial adherence to host cells, one of the key steps in streptococcal pathogenesis (Delamare Deboutteville, 2014). For example, some components of pilus

(Pilus 1 and 2), FbsA and B and laminin binding protein are not present in ST-261 strains in

Australia (Fig. 1.4) (Delamare Deboutteville, 2014). On the other hand, six proteins which are specific to ST-261 were identified and may contribute to cell adhesion (Delamare

Deboutteville, 2014). These include two serine-rich proteins anchored to the surface by

LPXTG C-terminal motif, a membrane protein in the amidase family, a bacterial membrane 50 protein belonging to BibA family and two putative proteins with LPXTG motif (Delamare

Deboutteville, 2014). Therefore, it has been hypothesised that these six proteins are

important in pathogenesis of S. agalactiae in fish. These proteins will therefore be key initial

targets in my current research.

Fig. 1.4. Virulence factors of S. agalactiae created by BLAST ring image generator. The innermost ring (black) indicates GC content and GC skew (purple/green). The light blue inner rings indicate virulence factors of piscine strains belonging to ST-553, ST-260 and ST-261. The next rings with darker blue

colour represent the strains ST-261 isolated from wild fish in Australia in previous study. Other rings show strains from different ST including terrestrial strains and human strains. The novel six adhesins are represented on the left side of the figure labeled as “ST-261 adhesins”. The figure obtained from

Figure 3. BRIG output image of Streptococcus agalactiae51 virulence factors. Figure 3 shows a comparison of the total virulence factors of 47 GBS isolates (the full list of the isolates is described in Appendix 2). The innermost rings show GC content (black) and GC skew (purple/green). The remaining rings show BLAST comparisons of the virulence factors of 47 GBS isolates, with the first seven innermost light blue rings showing piscine isolates from previous studies (ST-553, ST-260, ST-261), the next 16 dark blue rings between the two red circles are the piscine isolates from this study (ST-261), and the following 24 rings include terrestrial strains from this study and representative strains of the different sequence- types retrieved from the database. Labels around the outside of the circular image correspond to the GBS virulence factors summarized by their functions with the name of the genes. Gaps within each concentric ring indicate that part or the entire gene is absent for this particular strain. The image is scaled to the nucleotide length of the genes. Long tick marks on the inner circumference of the ring indicate increments of 10 kilobase-pairs (kbp) and short tick marks indicate 2 kbp. Figure produced using BLAST Ring Image Generator (BRIG) (Alikhan et al., 2011).

94 93 Delamare Deboutteville: On the origin of Group B Streptococcus from disease outbreaks in wild marine fish in Australia (Delamare Deboutteville, 2014).

1.1.13. Importance of adhesion and adhesins as vaccine candidates

Bacterial adherence to the host cell surface is the primary and most fundamental step in bacterial infection (Wizemann et al., 1999). Adhesins are proteins mediating bacterial attachment to the host (Wizemann et al., 1999). The interactions between adhesins and host surface receptors are specific and usually involve protein-carbohydrate lectin-like reactions, but sometimes involve protein-protein or carbohydrate-carbohydrate reactions

(Nobbs et al., 2009). Attachment to specific surface receptors on the host cell prevents pathogens from being cleared by mucociliary defense mechanisms and determines bacterial tissue tropism (Wizemann et al., 1999). Without this step, the pathogen cannot colonise the tissue of the host so the infection would not progress, thus the pathogens cannot cause disease (Wizemann et al., 1999). Understanding adhesin interaction with the host is significant to understanding the pathogenesis of the bacteria since adhesins are contributing the adhesion, the first step of bacterial infection. Due to their ability to recognise invariant receptor on the host cell, they are highly conserved among all the pathogenic strains

(Wizemann et al., 1999). Because of this unavoidable structural homology, adhesin have been targeted for vaccine development (Langermann et al., 1997; Wizemann et al., 1999).

For example, antibodies against a Type 1 Fimbrial (FimH) adhesin, which is produced by most Escherichia coli and mediates binding to mannose-oligosaccharides, cross react with more than 90% of E. coli strains and prevent adhesion to bladder cells in vitro (Langermann et al., 1997).

52 Adhesins are key virulence factors in Streptococcus (Nobbs et al., 2009). The antigens I/II family of S. mutans were some of the earliest antigens determined to be adhesins in streptococci (Nobbs et al., 2009; Wizemann et al., 1999). These adhesins bind to glycoproteins in saliva and mediate the attachment to the surface of tooth (Wizemann et al.,

1999). Streptococci are capable of expression of multiple adhesins which allow them to adhere to and colonise different tissues (Nobbs et al., 2009).

Although proteins which contribute to bacterial adherence such as M-like protein SiMA and

FbsA failed to elicit protective immunity in fish, adhesin-based vaccines have continued to be developed against Streptococcus and have provided protection in other cases (Aviles et al., 2013; Khan and Pichichero, 2012; Margarit et al., 2009; Nobbs et al., 2009; Yi et al.,

2014). Pili are known to mediate attachment to the host cell in both Gram-positive and Gram- negative pathogens and components of pili can elicit immune response (Margarit et al.,

2009).

Streptococcus agalactiae human isolates from the US and Italy have conserved at least one of the three pilus islands and the combination of pilus components from those three islands elicited protection against more than 90% of GBS strains in the US and Italy (Margarit et al.,

2009). Margarit et al. (2009) demonstrated that a vaccine prepared from combination of recombinant pilus components is can elicit broad protection in mice against challenge with multiple S. agalactiae isolates (Margarit et al., 2009). Moreover, two proteins, which are components of the universal vaccine against S. agalactiae, showed pilus-like structures

(Lauer et al., 2005; Maione et al., 2005). Other adhesins have also been shown to induce broad protection in mice. These include the Pneumococcal histidine triad protein D (PhtD) 53 and E (PhtE) surface proteins of S. pneumoniae (Khan and Pichichero, 2012), that are, characterized by a histidine triad motif, and belong to the highly conserved Pht protein family in pneumococci (Khan and Pichichero, 2012; Melin et al., 2010). Khan and Pichichero (2012) demonstrated that both PhtD and PhtE play important roles in mediating bacterial attachment to the human nasopharyngeal and lung epithelial cells and could elicit functional antibodies (Khan and Pichichero, 2012).

Recently, a number of putative proteins, which were predicted to be adhesins, have been identified from complete genome sequence of S. iniae isolated from Japanese flounder

(Zhang et al., 2014). Putative proteins such as fibrinogen-binding-like protein, serine-rich protein, alkaline amylopullulanase, agglutinin receptor, collagen-binding protein and laminin-binding protein have been predicted as adhesin in the isolate (Zhang et al., 2014).

However, although these putative adhesins have been predicted to be antigenic, their abilities to induce protective immunity have yet to be tested (Zhang et al., 2014). Moreover, their universal conservation across the S. iniae pan-genome has not been determined.

1.2. Aims

This study will employ will generate a pan-genome to investigate into the genomic diversity of S. agalactiae and employ the pan-genome and reverse vaccinology approach to explore the protein antigens expressed on the surface of fish pathogenic GBS. Six adhesins, which have been identified in S. agalactiae piscine strain serotype Ib and ST-261 ND2-22

(FO393392), were also found from Australian piscine strains. Therefore, it has been hypothesised that these six adhesins play important roles in pathogenesis of S. agalactiae

54 in fish. The goal of this research is to determine if these adhesins can be potential candidates for a universal vaccine against disease caused by S. agalactiae in fish.

1.2.1. Aim 1: To explore the genomic diversity of S. agalactiae, particular interest in piscine strains, by using a pan-genome

The pan-genome of S. agalactiae is well advanced, but it still lacks geographic coverage, from Latin America, Asia and Africa regions. We sequenced more genomes of S. agalactiae isolated from tilapia in Honduras and wild fish in Queensland. In addition to the new sequences, draft genome of piscine and terrestrial strains from Queensland from previous work (Delamare Deboutteville, 2014), Ghanaian piscine strains from public database

(Verner-Jeffreys et al., 2017) and complete genomes available on NCBI database were used to generate the pan-genome. These sequences were also used to investigate the phylogenetic relationship. The resulting pan-genome was analysed and major virulence factors of S. agalactiae identified.

1.2.2. Aim 2: Characterization of ST-261 adhesins and to determine the level of adhesins expression in different conditions

The six proteins identified in ST-261 strains were predicted as adhesins in previous studies

(Delamare Deboutteville, 2014; Rosinski-Chupin et al., 2013). Their domain structures were analysed by in silico to examine their possible roles in fish pathogenesis. Two types of vaccines, whole-cell and recombinant vaccines were prepared to investigate if these adhesins can induce antibodies production in tilapia, O. mossambicus, to obtain antibodies.

To prepare the whole-cell vaccine that express high level of adhesins and low level of CPS, bacteria were grown in different conditions and real-time quantitative reverse transcription 55 polymerase chain reaction (qRT-PCR) was employed to determine such condition. The antibodies obtained will be used to confirm the expression of adhesins in the determined condition.

1.2.3. Aim 3: To investigate if the adhesins are able to elicit a cross-protective immune responses against different S. agalactiae serotypes by experimental infection in tilapia

Adhesins have been shown to be highly antigenic as potential vaccine candidates that can elicit protection to the host against pathogens (Maione et al., 2005; Margarit et al., 2009;

Wizemann et al., 1999). However, although the adhesins successfully induce specific antibodies, the antibodies might not elicit protection against bacteria (Aviles et al., 2013; Yi et al., 2014). Both M-like protein SiMA and FbsA have been demonstrated to evoke antibody responses but did not confer protective immunity to fish against challenges (Aviles et al.,

2013; Yi et al., 2014). Therefore, an animal challenge model is required to confirm if the adhesin-based vaccines against S. agalactiae are effective to confer broad protection to fish against multiple strains of S. agalactiae.

56 Chapter 2: Microevolution of aquatic Streptococcus agalactiae ST-261 from Australia indicates dissemination via imported tilapia and ongoing adaptation to marine hosts or environment

Abstract

Streptococcus agalactiae (group B Streptococcus; GBS) causes disease in a wide range of animals. The serotype Ib lineage is highly adapted to aquatic hosts, exhibiting substantial genome reduction compared with terrestrial conspecifics. Here, we sequence genomes from

40 GBS isolates, including 25 isolates from wild fish and captive stingrays in Australia, six local veterinary or human clinical isolates, and nine isolates from farmed tilapia in Honduras, and compared them with 42 genomes from public databases. Phylogenetic analysis based on non-recombinant core genome single nucleotide polymorphisms (SNPs) indicated that aquatic serotype Ib isolates from Queensland were distantly related to local veterinary and human clinical isolates. In contrast, Australian aquatic isolates are most closely related to a tilapia isolate from Israel, differing by only 63 core-genome SNPs. A consensus minimum spanning tree based on core-genome SNPs indicates the dissemination of sequence type

261 (ST-261) from an ancestral tilapia strain, which is congruent with several introductions of tilapia into Australia from Israel during the 1970s and 1980s. Pan-genome analysis identified 1,440 genes as core, with the majority being dispensable or strain specific, with non-protein-coding intergenic regions (IGRs) divided among core and strain-specific genes.

Aquatic serotype Ib strains have lost many virulence factors during adaptation, but six adhesins were well conserved across the aquatic isolates and might be critical for virulence in fish and for targets in vaccine development. The close relationship among recent ST-261 isolates from Ghana, the United States, and China with the Israeli tilapia isolate from 1988 57 implicates the global trade in tilapia seed for aquaculture in the widespread dissemination of serotype Ib fish-adapted GBS.

2.1. Introduction

Streptococcus agalactiae, or Lancefield group B Streptococcus (GBS), is a commensal and occasionally pathogenic bacterium with a very diverse host range. A common commensal in the urogenital tracts of humans, GBS is also a leading cause of morbidity in newborns causing meningitis, septicemia, and pneumonia (Brochet et al., 2006; Doumith et al., 2017;

Edwards and Gonik, 2013; Six et al., 2015). Streptococcus agalactiae can cause septicemic infections in cattle, domestic dogs and cats, camels, reptiles, and amphibians (Bowater et al., 2012; Delamare-Deboutteville et al., 2015; Elliott et al., 1990; Evans et al., 2002). In fish, disease outbreaks caused by S. agalactiae have substantial impact on the aquaculture industry, particularly on the production of warm freshwater species, such as tilapia

(Oreochromis spp.) (Chen et al., 2012; Li et al., 2016; Verner-Jeffreys et al., 2017; Zhang et al., 2013). Most outbreaks to date in freshwater farmed fish have resulted from infection by highly adapted strains of GBS with genomes that are 10 to 15% smaller than their terrestrial conspecifics (Rosinski-Chupin et al., 2013). Unusually, S. agalactiae also causes significant mortality in wild aquatic animals, including grouper, stingrays, and mullet (Delamare-

Deboutteville et al., 2015), suggesting further adaptation to marine and freshwater aquatic hosts.

Microevolution within a bacterial species can be driven by host or environmental adaptation

(Brynildsrud et al., 2014; Rosinski-Chupin et al., 2013), permitting an inference of the epidemiology of disease outbreaks and how pathogens may have transferred within and 58 between geographic regions (Barnes et al., 2016; Brynildsrud et al., 2014; Sabat et al., 2013).

This requires an analysis of factors that evolve at a sufficiently rapid pace to be informative over relatively short timespans. In GBS, capsular serotyping either with antibodies or by molecular serotyping (i.e., sequencing of the capsular operon) has become a widely used method of typing for population studies (Carvalho-Castro et al., 2017; Jones et al., 2003;

Kapatai et al., 2017; Kong et al., 2002), and currently, S. agalactiae can be divided into 10 capsular serotypes (Ia, Ib, and II to IX) (Carvalho-Castro et al., 2017; Sheppard et al., 2016).

Determining capsular serotypes is also critical for vaccine formulation, since capsular polysaccharide (CPS) is highly immunogenic, and antibodies against CPS can confer excellent protection against infections by the homologous CPS serotype (Eldar et al., 1995a;

Evans et al., 2004; Kapatai et al., 2017). Further typing resolution is provided by multilocus sequence typing (MLST), a method that has been employed to great effect to conduct global population studies of isolates based on genetic variations among relatively slowly evolving housekeeping genes (Jones et al., 2003). Combining molecular serotyping and MLST in the analysis of S. agalactiae revealed that the majority of isolates associated with aquatic environments and hosts fall within serotypes Ia and Ib, in which Ia isolates belong to sequence type 7 (ST-7) in clonal complex 7 (CC-7) and ST-103 in CC-103 (Carvalho-Castro et al., 2017; Chong et al., 2017; Evans et al., 2008; Godoy et al., 2013a; Kannika et al.,

2017; Sun et al., 2016; Zhang et al., 2013). Serotype Ib strains isolated in Central and South

America are ST-260 and ST-552 in CC-552 (Delannoy et al., 2013; Godoy et al., 2013a), and strains isolated in Australia, Israel, Belgium, China, Ghana, the United States, and

Southeast Asia belong to ST-261 (Bowater et al., 2012; Delamare-Deboutteville et al., 2015;

Delannoy et al., 2013; Lusiastuti et al., 2014; Pridgeon and Zhang, 2014; Rosinski-Chupin et al., 2013; Verner-Jeffreys et al., 2017). Serotype III is commonly causative of disease in 59 humans but has also been isolated from fish in Thailand, China, and recently, Brazil

(Chideroli et al., 2017; Kannika et al., 2017; Li et al., 2013; Suanyuk et al., 2008).

While capsular serotyping and MLST have been useful in inferring the origins and dispersal of GBS subtypes, they do not display sufficient resolution to explore the spread and evolution within individual sequence types, nor can they reflect the complete genetic diversity of S. agalactiae (Tettelin et al., 2005). The rapid fall in the cost of whole genome sequencing coupled with multiplexing and rapid development of open-source bioinformatics tools has permitted a much deeper analysis of evolution, host adaptation, and epidemiological modeling within a single bacterial species (Francis and Tanaka, 2012), including those from aquatic hosts (Barnes et al., 2016; Brynildsrud et al., 2014). Bacteria, such as S. agalactiae, that can colonize multiple host species often have greater genomic intraspecies diversity (Puymège et al., 2015). In GBS, two major evolutionary trends have been implicated in rapid adaptation to new hosts, namely, the acquisition of new genes by lateral gene transfer and genome reduction via gene loss integral to host specialization

(Richards et al., 2014; Rosinski-Chupin et al., 2013). For example, S. agalactiae Ia strains

GD201008-001 and ZQ0910, isolated from tilapia in China, carry a 10-kb genomic island

(GI) which is absent from their closely related human isolate A909. Moreover, this 10-kb GI bears many similarities with the Streptococcus anginosus SK52/DSM 20563 genome sequence, suggesting possible transfer from S. anginosus to GBS, with implications for virulence in tilapia (Liu et al., 2013; Rosinski-Chupin et al., 2013). During fish host adaptation, serotype Ib strains have undergone reductive evolution, resulting in 10 to 25% of their genomes being lost compared to terrestrial S. agalactiae isolates and serotype Ia piscine strain (Rosinski-Chupin et al., 2013). The evolution of S. agalactiae by genome reduction is 60 an ongoing process, with a high number of pseudogenes present in GBS genomes from aquatic sources (Rosinski-Chupin et al., 2013).

The evolution of S. agalactiae and adaptation to aquatic hosts is an incomplete and ongoing process; consequently, sequencing the genomes from a few isolates is insufficient to understand the full potential genetic diversity of S. agalactiae as a species (Tettelin et al.,

2005). The pan-genome or supragenome of a bacterial species defines the full complement of genes, or the union of all the gene sets, within the species (Tettelin et al., 2005). This pan-genome is subdivided into its core genome, which includes all the genes that are present in all the strains of the same bacterial species and must therefore be responsible for essential biological functions to allow the species to survive, and the accessory genome, containing species-specific genes that are unique to single strains or constrained to a cohort of strains within the species; these genes contribute to the diversity makeup of the species.

The pan genome of a species resolves the true genomic diversity of that species and permits the identification of gene cohorts that are essential to the species as a whole, along with gene complements in the accessory genome that permit host or habitat specialization

(Tettelin et al., 2005). Moreover, by identifying potential antigens within the pan-genome that are conserved across all strains that infect a particular host type, vaccine targets can be specified that are likely to cross-protect (He et al., 2017; Tettelin et al., 2005). Indeed, the first multicomponent protein-containing universal vaccine against human S. agalactiae was developed using a pan-genome reverse-vaccinology approach by analysing eight human isolates to predict putative antigens that were conserved among those strains (Maione et al.,

2005). Some antigens in this vaccine are in the accessory genome; consequently it is

61 important to analyze the dispensable genome as far as possible for vaccine development

(Maione et al., 2005; Tettelin et al., 2005).

The S. agalactiae pan-genome is now well advanced but still “open” (i.e., new genes continue to be added with more sequenced genomes) and geographically constrained (He et al., 2017; Tettelin et al., 2005). In the present study, we sequenced the genomes of new aquatic S. agalactiae strains isolated from tilapia in Honduras and from wild and captive marine fish in Australia. We infer the potential epidemiological distribution of ST-261 in aquatic hosts in Australia and show continuing adaptation to saltwater fish. Moreover, we identify conserved surface proteins across ST-260 and ST-261 that may have potential for incorporation into vaccines for aquaculture of important food fish species, such as tilapia and grouper.

2.2. Materials and Methods

2.2.1. Bacterial strains and culture conditions

Forty S. agalactiae isolates comprising strains collected from fish in Honduras and Australia, along with reptiles, humans, and other terrestrial mammals from Australia, were chosen for sequencing (Table 2.1). Of these 40 isolates, 25 strains were collected from several species of fish in Queensland, Australia, two human clinical strains were from Queensland, Australia, one strain was isolated from saltwater crocodile (Crocodylus porosus) in the Northern

Territory, Australia, and three isolates were collected from domestic animals, including cats, dogs, and cattle in Australia. Additionally, nine isolates originating from disease in farmed tilapia in Honduras were sequenced during this study. All isolates were maintained at -80°C in Todd-Hewitt broth (THB) (Oxoid) containing 25% glycerol as frozen stock. The isolates 62 were recovered from stock on Columbia agar containing 5% sheep blood (Oxoid) for 24 h at 28°C. For liquid culture, the isolates were grown in THB or 18 h with low agitation at 28°C.

63 Table 2.1. S. agalactiae isolates and sequences used in this study.

Isolate Origin Year Host Serotype ST Size Accession Assembly

(Mbp) number levels

QMA0264 QLD, AU 2008 Epinephelus lanceolatus Ib 261 1.8 SAMN07998566 Contig

QMA0266 QLD, AU 2008 Epinephelus lanceolatus Ib 261 1.8 SAMN07998567 Contig

QMA0267 QLD, AU 2008 Epinephelus lanceolatus Ib 261 1.8 SAMN07998568 Contig

QMA0268 QLD, AU 2009 Pomadasys kaaken Ib 261 1.8 SAMN07998569 Contig

QMA0271 QLD, AU 2009 Arius thalassinus Ib 261 1.8 SAMN07998570 Complete

QMA0273 QLD, AU 2009 Arius thalassinus Ib 261 1.8 SAMN07998571 Contig

QMA0274 QLD, AU 2009 Liza vaigensis Ib 261 1.8 SAMN07998572 Contig

QMA0275 QLD, AU 2009 Aptychotrema rostrata Ib 261 1.8 SAMN07998573 Contig

QMA0276 QLD, AU 2009 Himantura granulata Ib 261 1.8 SAMN07998574 Contig

QMA0277 QLD, AU 2009 Dasyatis fluviorum Ib 261 1.8 SAMN07998575 Contig

QMA0280 QLD, AU 2010 Epinephelus lanceolatus Ib 261 1.8 SAMN07998576 Contig

QMA0281 QLD, AU 2010 Epinephelus lanceolatus Ib 261 1.8 SAMN07998577 Contig

64 QMA0284 QLD, AU 2010 Epinephelus lanceolatus Ib 261 1.8 SAMN07998578 Contig

QMA0285 QLD, AU 2010 Epinephelus lanceolatus Ib 261 1.8 SAMN07998579 Contig

QMA0287 QLD, AU 2010 Pomadasys kaaken Ib 261 1.8 SAMN07998580 Contig

QMA0290 QLD, AU 2010 Arius thalassinus Ib 261 1.8 SAMN07998581 Contig

QMA0292 QLD, AU 2010 Aptychotrema rostrata Ib 261 1.8 SAMN07998582 Contig

QMA0294 QLD, AU 2010 Epinephelus lanceolatus Ib 261 1.8 SAMN07998583 Contig

QMA0320 QLD, AU 2010 Dasyatis fluviorum Ib 261 1.8 SAMN07998584 Contig

QMA0321 QLD, AU 2010 Dasyatis fluviorum Ib 261 1.8 SAMN07998585 Contig

QMA0323 QLD, AU 2010 Dasyatis fluviorum Ib 261 1.8 SAMN07998586 Contig

QMA0326 QLD, AU 2010 Dasyatis fluviorum Ib 261 1.8 SAMN07998587 Contig

QMA0347 QLD, AU 2010 Dasyatis fluviorum Ib 261 1.8 SAMN07998588 Contig

QMA0368 QLD, AU 2010 Epinephelus lanceolatus Ib 261 1.8 SAMN07998589 Contig

QMA0369 QLD, AU 2011 Epinephelus lanceolatus Ib 261 1.8 SAMN07998590 Contig

QMA0485 Honduras 2014 Oreochromis niloticus Ib 260 1.8 SAMN07998597 Contig

QMA0487 Honduras 2014 Oreochromis niloticus Ib 260 1.8 SAMN07998598 Contig

65 QMA0488 Honduras 2014 Oreochromis niloticus Ib 260 1.8 SAMN07998599 Contig

QMA0489 Honduras 2014 Oreochromis niloticus Ib 260 1.8 SAMN07998600 Contig

QMA0494 Honduras 2014 Oreochromis niloticus Ib 260 1.8 SAMN07998601 Contig

QMA0495 Honduras 2014 Oreochromis niloticus Ib 260 1.8 SAMN07998602 Contig

QMA0496 Honduras 2014 Oreochromis niloticus Ib 260 1.8 SAMN07998603 Contig

QMA0497 Honduras 2014 Oreochromis niloticus Ib 260 1.8 SAMN07998604 Contig

QMA0499 Honduras 2014 Oreochromis niloticus Ib 260 1.8 SAMN07998605 Contig

QMA0355 QLD, AU 2011 Homo sapiens Ia 23 2.0 SAMN07998591 Contig

QMA0357 QLD, AU 2011 Homo sapiens Ia 23 2.0 SAMN07998592 Contig

QMA0336 NT, AU 2005 Crocodylus porosus Ia 23 2.0 SAMN07998593 Contig

QMA0300 QLD, AU 2008 Canis lapis familiaris V 1 2.1 SAMN07998594 Contig

QMA0303 QLD, AU 2009 Felis catus V 1 2.1 SAMN07998595 Contig

QMA0306 QLD, AU 2005 Bos taurus V 1 2.2 SAMN07998596 Contig

GS16-0008 Ghana 2016 Oreochromis niloticus Ib 261 1.8 SRX2698682 Contig

GS16-0031 Ghana 2016 Oreochromis niloticus Ib 261 1.8 SRX2698681 Contig

66 GS16-0035 Ghana 2016 Oreochromis niloticus Ib 261 1.8 SRX2698680 Contig

GS16-0046 Ghana 2016 Oreochromis niloticus Ib 261 1.8 SRX2698679 Contig

ND2-22 Israel 1988 Oreochromis niloticus Ib 261 1.8 FO393392 Complete

138P USA 2007 Oreochromis niloticus Ib 261 1.8 CP007482 Complete

138spar USA 2011 Oreochromis niloticus Ib 261 1.8 CP007565.1 Complete

GX026 China 2011 Oreochromis niloticus Ib 261 1.8 CP011328.1 Complete

S13 Brazil 2015 Oreochromis niloticus Ib 552 1.8 CP018623.1 Complete

S25 Brazil 2015 Oreochromis niloticus Ib 552 1.8 CP015976.1 Complete

SA20 Brazil Oreochromis niloticus Ib 552*** 1.8 CP003919.2 Complete

GD201008-001 China 2010 Oreochromis niloticus Ia 7 2.1 NC_018646.1 Complete

HN016 China 2011 Oreochromis niloticus Ia 7 2.1 NZ_CP011325.1 Complete

WC1535 China 2015 Oreochromis niloticus Ia 7 2.2 NZ_CP016501.1 Complete

A909 USA Homo sapiens Ia 7 2.1 NC_007432.1 Complete

GBS85147 Brazil Homo sapiens Ia 103 2.0 NZ_CP010319.1 Complete

Sag37 China 2014 Homo sapiens Ib* 12 2.2 NZ_CP019978.1 Complete

67 GBS1-NY USA 2012 Homo sapiens II 22 2.2 NZ_CP007570.1 Complete

GBS2_NM USA 2012 Homo sapiens II 22 2.2 NZ_CP007571.1 Complete

GBS6 USA 2009 Homo sapiens II 22 2.2 NZ_CP007572.1 Complete

FDAARGOS_254 USA 2014 Homo sapiens II* 22 2.2 CP020449.1 Complete

COH1 USA Homo sapiens III 17 2.1 NZ_HG939456.1 Complete

NEM316 France Homo sapiens III 23 2.2 NC_004368.1 Complete

CU_GBS_08 Hong Kong 2008 Homo sapiens III 283 2.1 NZ_CP010874.1 Complete

CU_GBS_98 Hong Kong 1998 Homo sapiens III 283 2.0 NZ_CP010875.1 Complete

NGBS128 Canada 2010 Homo sapiens III 17 2.1 NZ_CP012480.1 Complete

SG-M1 Singapore 2015 Homo sapiens III 283 2.1 NZ_CP012419.2 Complete

H002 China 2011 Homo sapiens III 736 2.1 NZ_CP011329.1 Complete

Sag158 China 2014 Homo sapiens III* 19 2.1 NZ_CP019979.1 Complete

NGBS061 Canada 2010 Homo sapiens IV 459 2.2 NZ_CP007631.1 Complete

NGBS572 Canada 2012 Homo sapiens IV 452 2.1 NZ_CP007632.1 Complete

2603V/R USA Homo sapiens V 110 2.2 NC_004116.1 Complete

68 CNCTC10/84 USA Homo sapiens V 26 2.0 NZ_CP006910.1 Complete

NGBS357 Canada 2011 Homo sapiens V 1 2.2 NZ_CP012503.1 Complete

SS1 USA 1992 Homo sapiens V 1 2.1 NZ_CP010867.1 Complete

GBS-M002 China 2014 Homo sapiens VI* 1 2.1 NZ_CP013908.1 Complete

SA111 Portugal 2013 Homo sapiens II* 61** 2.3 NZ_LT545678.1 Complete

Hoplobatrachus FWL1402 China 2014 III* 739** 2.1 NZ_CP016391.1 Complete chinensis

09mas018883 Sweden Bos taurus V* 1 2.1 NC_021485.1 Complete

GBS ST-1 USA 2015 Canis lupus familiaris V 1 2.2 NZ_CP013202.1 Complete

ILRI005 Kenya Camelus dromedarius V* 609 2.1 NC_021486.1 Complete

ILRI112 Kenya Camelus dromedarius VI* 617 2.0 HF952106.1 Complete

AU, Australia; QLD, Queensland; NT, Northern Territory; ST, Sequence Type. *Serotype was detected with Kaptive. ** ST was determined via Center for Genomic Epidemiology. *** Gap in glcK.

69 Table 2.2. Genome assembly statistics.

Strain BioSample no. Sequence yield No. of Genome size GC content N50 (bp) Coverage (x)

(bp) contigs (bp) (%)

QMA0264 SAMN07998566 383,903,016 26 1,800,255 35.27 181,173 213

QMA0266 SAMN07998567 383,903,016 23 1,799,604 35.26 181,173 213

QMA0267 SAMN07998568 822,647,364 22 1,805,121 35.33 181,785 456

QMA0268 SAMN07998569 541,821,504 22 1,796,834 35.25 130,961 302

QMA0271 SAMN07998570 488,654,460 1 1,802,470 35.28 1,802,470 271

QMA0273 SAMN07998571 488,596,752 26 1,799,223 35.26 181,173272 272

QMA0274 SAMN07998572 666,932,868 33 1,795,949 35.23 91,064 371

QMA0275 SAMN07998573 444,271,968 28 1,798,598 35.26 129,867 247

QMA0276 SAMN07998574 595,443,828 30 1,801,706 35.28 101,410 330

QMA0277 SAMN07998575 532,021,392 30 1,794,975 35.23 125,723 296

QMA0280 SAMN07998576 507,086,244 26 1,798,991 35.26 130,981 282

QMA0281 SAMN07998577 947,517,396 28 1,795,694 35.26 130,961 528

70 QMA0284 SAMN07998578 870,597,252 27 1,804,787 35.3 129,871 482

QMA0285 SAMN07998579 946,715,952 25 1,798,637 35.26 181,149 526

QMA0287 SAMN07998580 744,380,280 27 1,799,347 35.27 130,969 414

QMA0290 SAMN07998581 1,059,786,168 24 1,804,000 35.3 181,153 587

QMA0292 SAMN07998582 383,835,312 22 1,800,208 35.26 181,172 213

QMA0294 SAMN07998583 807,742,572 24 1,800,272 35.26 181,172 449

QMA0300 SAMN07998584 703,661,784 33 2,109,161 35.25 115,466 334

QMA0303 SAMN07998585 949,167,156 42 2,123,226 35.05 94,602 447

QMA0306 SAMN07998586 745,047,660 106 2,165,975 35.52 40,135 344

QMA0320 SAMN07998587 445,338,936 30 1,804,060 35.3 181,347 247

QMA0321 SAMN07998588 406,041,552 22 1,800,073 35.26 181,173 226

QMA0323 SAMN07998589 487,351,368 22 1,800,031 35.26 181,173 271

QMA0326 SAMN07998590 847,046,508 22 1,800,125 35.26 181,173 471

QMA0336 SAMN07998591 437,035,536 37 2,022,886 35.26 87,595 216

QMA0347 SAMN07998592 942,292,680 21 1,795,434 35.23 181,173 525

71 QMA0355 SAMN07998593 903,514,248 66 1,996,200 35.31 63,524 453

QMA0357 SAMN07998594 564,675,720 35 2,004,249 35.23 92,563 282

QMA0368 SAMN07998595 506,471,448 26 1,803,560 35.3 104,282 281

QMA0369 SAMN07998596 1,056,496,560 28 1,804,404 35.3 130,985 586

QMA0485 SAMN07998597 490,192,752 28 1,803,278 35.27 109,741 272

QMA0487 SAMN07998598 467,765,088 28 1,800,682 35.25 109,741 260

QMA0488 SAMN07998599 356,791,512 29 1,800,616 35.25 109,741 198

QMA0489 SAMN07998600 432,449,472 28 1,801,015 35.25 109,741 240

QMA0494 SAMN07998601 363,434,736 37 1,792,992 35.28 71,935 203

QMA0495 SAMN07998602 412,230,672 28 1,803,007 35.27 109,741 229

QMA0496 SAMN07998603 499,707,096 29 1,801,879 35.27 109,737 277

QMA0497 SAMN07998604 364,009,464 28 1,800,976 35.25 109,741 202

QMA0499 SAMN07998605 428,636,208 28 1,799,426 35.24 109,741 238

72 2.2.2. DNA extraction and sequencing

Genomic DNA (gDNA) was extracted from 10-ml early stationary phase THB cultures with the DNeasy minikit (Qiagen), according to the manufacturer’s instructions. The quantity of extracted DNA was measured by Qubit fluorimetry (Invitrogen), and the quality was checked by agarose gel electrophoresis. To confirm the purity of the gDNA, the 16S rRNA gene was amplified by PCR using universal primers 27F and 1492R (Amann et al., 1995), and the

PCR products were sent to Australian Genome Research Facility (AGRF, Brisbane,

Australia) for Sanger sequencing. The 16S amplicon sequences were assembled in

Sequencher version 5.2.2 and analyzed by BLAST. Once identity and purity were confirmed,

Nextera XT paired-end libraries were generated using gDNA from each isolate and sequenced on the Illumina HiSeq 2000 platform system (AGRF, Melbourne, Australia).

2.2.3. De novo assembly and annotation

Illumina sequencing yielded between 5,288,952 and 12,577,340 read pairs for each strain.

Read quality control and contaminant screening were performed using FastQC (Andrews,

2010). Reads were trimmed using the clip function in Nesoni (https://github.com/Victorian-

Bioinformatics-Consortium/nesoni) and then assembled de novo with SPAdes assembler version 3.11 (Bankevich et al., 2012). Assemblies were quality checked using Quast version

4.6 (Bankevich et al., 2012). The assemblies of fish isolates in Queensland comprised about

1.8 million base pair (Mbp) of assembled sequence, while terrestrial strains comprised 2

Mbp. The assembled contigs for all Queensland strains were reordered against an internal curated reference genome from S. agalactiae strain QMA0271, using the Mauve contig ordering tool (Rissman et al., 2009). Automated annotation was performed using Prokka

1.12 (Seemann, 2014). 73 2.2.4. Molecular serotyping and multilocus sequence typing (MLST)

Reference sequences for the nine CPS serotypes Table 2.3 (Sheppard et al., 2016) were retrieved from GenBank to generate a database for prediction of capsular serotype from the draft genomes with Kaptive, using default settings (Wyres et al., 2016). To determine multilocus sequence types (MLST), all draft assemblies were analysed using the Center for

Genomic Epidemiology web-tools MLST ver. 1.8, using S. agalactiae configuration (see https://cge.cbs.dtu.dk//services/MLST/ ) (Larsen et al., 2012).

Table 2.3. Reference sequences used for molecular capsular serotyping.

Serotype Accession Size Reference

Number (bp)

Ia AB028896.2 25021 (Yamamoto et al., 1999)

Ib AB050723.1 9987 (Watanabe et al., 2002)

II EF990365.1 12864 (Martins et al., 2007)

III AF163833.1 17276 (Chaffin et al., 2000)

IV AF355776.1 17596 (Chaffin et al., 2002)

V AF349539.1 18239 (Chaffin et al., 2002)

VI AF337958.1 16448 (Chaffin et al., 2002)

VII AY376403.1 14202 (Cieslewicz et al., 2005)

VIII AY375363.1 12637 (Cieslewicz et al., 2005)

2.2.5. Phylogenetic analysis

To estimate approximate phylogenetic relationships among our strains and other isolates with whole genome sequences available in GenBank (Table 2.1), a core genome single 74 nucleotide polymorphism SNP-based phylogenetic tree was constructed. Whole genome sequences of Queensland and Honduras tilapia isolates, terrestrial isolates and the genomes obtained from GenBank were aligned with Parsnp in the Harvest Tools suite version 1.2 (Treangen et al., 2014). The genome of Streptococcus pyogenes M1 (Group A

Streptococcus; GAS) (RefDeq accession number NC_002737.2) was also included as an outgroup for tree rooting. Hypothetical recombination sites in the core genome alignment were detected and filtered out with Gubbins (Croucher et al., 2015). Maximum likelihood phylogenetic trees were inferred with RAxML version 8.2.9 (Stamatakis, 2014) based on non-recombinant core genome SNPs under general time-reversible (GTR) nucleotides substitution model, with 1000 bootstrap replicates. Ascertainment bias associated with analysis of only variable sites was accounted for using Felsenstein’s correction implemented in RAxML (Stamatakis, 2014). The resulting tree was exported and rooted, nodes with low bootstrap supported collapsed with Dendroscope, and the resulting tree/cladogram annotated with Evolview version 2 (He et al., 2016).

In order to infer possible phylogenetic relationships within the aquatic ST-261 clade of GBS, minimum spanning trees were constructed in MSTGold 2.4 (Salipante and Hall, 2011) from a distance matrix based on core genome SNPs derived by alignment of 27 ST-261 genomes in Geneious V9.1 (Biomatters Inc.). A consensus tree was constructed based on inference of 2400 trees and only those edges occurring in greater than 50% of trees were included in the consensus.

75 2.2.6. Pan-genome analysis

A reference pan-genome was built with GView server (Petkau et al., 2010) using our curated genome of Queensland ST-261 serotype Ib grouper isolate, QMA0271 as a seed and 38 complete genomes from public databases added sequentially (Table 2.1). Only complete genomes were included into the reference pan-genome to avoid incomplete genes associated with the high fragmentation of draft sequences. For visualisation, draft and complete genomes were compared with the reference pan-genome using BLAST ring image generator (BRIG) 0.95 (Alikhan et al., 2011). To investigate core and accessory protein-coding genes, sequences from all strains were analysed with Roary (Page et al.,

2015) using default settings. Since Roary only considers protein-coding sequences, we used Piggy (Thorpe et al., 2017) to identify non protein-coding intergenic regions (IGRs) in each strain, which comprise about 15% of the GBS genomes. The 1,539 strain-specific

IGR sequences identified in Piggy were then extracted from the representative merged clusters of IGR sequences and used as query sequences in a local BLASTn analysis (E value 1e_10) against all the coding sequences in the pan-genome. The output from the

BLAST search was tabulated and analyzed further in Microsoft Excel.

2.2.7. Identification and comparison of virulence factors

Virulence factor screening was performed using SeqFindr (Stanton-Cook et al., 2013) by comparing the assembled genomes of all strains in this study along with the genomes available through GenBank (Table 2.1) against a list of 51 S. agalactiae-specific virulence factors sequences collected from the Virulence Factors Database (VFDB) (Chen et al.,

2005), complemented by six additional sequences identified in the sequenced ST-261 S. agalactiae strain ND2-22 (Table 2.1). 76 2.2.8. Analysis of effects of SNPs in ST-261 clade

Putative effects of SNPs amongst and between the ST-261 clade were determined using

SNPeff version 4.3p (Cingolani et al., 2012). First, a new S. agalactiae database was constructed from the Genbank-formatted curated reference genome for QMA0271, in accordance with the manual (http://snpeff.sourceforge.net/SnpEff_manual.html#databases).

Then a VCF file, generated from curated SNPs generated by alignment of complete genomes of 27 ST-261 isolates in Geneious version 9.1, was annotated for SNP effect with

SNPeff using the database from QMA0271 as reference.

2.2.9. Accession numbers

The accession numbers for genome assemblies used in this study are presented with strain metadata in Table 2.1. The assembly statistics and BioSample numbers are in Table 2.2.

2.3. Results and Discussion

2.3.1. Group B Streptococcus isolates from marine fish and rays in Queensland and tilapia in Honduras belong to differing host-adapted lineages

The average size of draft genomes of isolates from fish and rays in Queensland was

1,801,022 bp, containing 1,881 genes on average, while the mean genome size of strains from Honduran tilapia was 1,801,133 bp with an average of 1,869 genes, consistent with the small genomes associated with the host-adapted aquatic lineage (Rosinski-Chupin et al., 2013) (Table 2.1 and 2.2). Molecular serotyping indicated that all Queensland and

Honduras aquatic strains belong to serotype Ib, but Queensland isolates belong to ST-261 while Honduras strains are ST-260. Both ST-260 and ST-261 have been identified infecting aquatic animals. Sequence type 261 isolates have been isolated from tilapia in Brazil and 77 Costa Rica occupy CC-552, along with ST-552 and ST-553 strains also isolated from tilapia in Latin America (Godoy et al., 2013a), whilst ST-261 has been isolated from tilapia in USA,

China, Ghana and Israel (Pridgeon and Zhang, 2014; Rosinski-Chupin et al., 2013; Verner-

Jeffreys et al., 2017).

The aquatic isolates analysed herein extend the known host range of GBS ST-261 to rays and marine finfish and expand the environmental distribution from freshwater to marine habitats, in addition to those previously reported (Bowater et al., 2018; Bowater et al., 2012;

Delamare-Deboutteville et al., 2015). Group B Streptococcus strains isolated from humans and terrestrial animals in Queensland and Northern Territory, Australia, were also sequenced and have larger genomes of 2,072,596 bp comprising 2,067 genes on average, suggesting that recent possible local transfer from terrestrial origin to Australian fish is highly unlikely, although probable transfer between humans and fish has been reported for ST-7

GBS elsewhere (Evans et al., 2002; Evans et al., 2009; Liu et al., 2013). Non-human mammalian strains from Australia sequenced in this study QMA0300 and QMA0303 belong to ST-1 serotype V, and QMA0306 belong to ST-67 serotype III, whereas human isolates,

QMA0355 and QMA0357, and crocodile strain QMA0336 belong to ST-23 serotype Ia.

Indeed, the high sequence identity between the human ST-23 serotype Ia isolates and those from farm-raised crocodiles supports the idea of potable human transfer to these animals, as previously implied (Bishop et al., 2007).

To identify the possible origin of the ST-261 isolates from marine fish in Australia, a phylogenetic tree was constructed by maximum likelihood from 29,689 non-recombinant core genome SNPs and short indel positions derived by alignment of whole genome 78 sequences of 25 Queensland fish isolates, 9 Honduras isolates, 6 Queensland terrestrial isolates and 42 genomes from public databases (Fig. 2.1A). Two distinct groups were resolved, the first comprising entirely of aquatic isolates (including serotype Ib isolates from

ST-552, ST-260 and ST-261), while the second major group comprised various isolates of terrestrial origin and some fish isolates from ST-7 serotype Ia that may have infected fish via transfer from terrestrial sources (Fig. 2.1A). The serotype Ib aquatic group branched into three distinct lineages based on ST (Fig. 2.1A). One lineage comprised all Honduras strains of ST-260, which were derived from a lineage comprising ST-552 isolates from Brazil (Fig.

2.1A). This is supportive of previous observations in which an extended typing system based on MLST, virulence genes and serotype indicated geographic endemism within fish isolates from differing regions of Brazil (Godoy et al., 2013a). The isolates belonging to ST-261 from

USA, Israel, Ghana, China and Queensland clustered together (Fig. 2.1A). The second major division, containing serotype Ia fish strains along with terrestrial isolates, was more complex, but isolates largely clustered in line with serotype and ST (Fig. 2.1A). The aquatic serotype Ia isolates clustered with human isolates of ST-7 (Fig. 2.1A). These fish isolates have acquired a 10kb GI, putatively from S. anginosus, in contrast to their human ST-7 serotype Ia relatives (Liu et al., 2013). Lineage 10 comprised serotype III ST-17 human isolates (Fig. 2.1A). Serotype Ia strains were divided among several additional ST groups, where three Australian serotype Ia ST-23 strains (QMA0336, QMA0355 and QMA0357) isolated from humans and a saltwater crocodile clustered together with strains of serotype

III ST-23 (NEM316) and serotype IV ST-452 (NGBS572), also of human origin (Fig. 2.1A).

This lineage appears to be derived from NEM316 which is a frequent cause of late-onset disease in human infants (Herbert et al., 2005). A further serotype Ia isolate was located in

ST-103 and clustered together with two strains of serotype V ST-609 and ST-617 isolated 79 from camels (Fig. 2.1A) (Fischer et al., 2013). Two newly sequenced Australian terrestrial strains, QMA0300 isolated from a dog and QMA0303 isolated from a cat clustered with other serotype V ST-1 strains isolated from humans, cattle and dog hosts (Fig. 2.1A). This lineage also contained NGBS061 serotype IV ST-495 and GBS-M002 serotype VI ST-1 (Fig. 2.1A).

ST-1 emerged as a significant cause of infection and disease in humans during the 1990s, but was recently inferred to have evolved from strains causing mastitis in cattle in the 1970s

(Flores et al., 2015). Moreover, QMA0306 ST-1 serotype V from cattle in Queensland was closely related to SA111 ST-61 serotype II, which represents a host-adapted lineage of S. agalactiae that is dominant in cattle in Europe (Fig. 2.1A) (Almeida et al., 2016).

Our phylogeny based on whole genome SNPs does not support recent direct transfer of

GBS from Australian human clinical or terrestrial animal sources to marine fish and stingrays, in spite of close proximity of many of the wild fish cases to human habitation (Bowater et al.,

2012). Consequently, we refined our analyses to the ST-261 aquatic host-adapted lineage to attempt to infer possible route of introduction and subsequent evolution in Australian marine fish. A consensus minimum spanning tree based on a distance matrix comprised of all core genome SNPs derived from alignment of the ST-261 serotype Ib strains revealed a likely original introduction via tilapia from Israel, with only 63 core genome SNPs separating an Australian stingray isolate from the type strain of S. difficile (re-assigned as S. agalactiae serotype Ib) (Vandamme et al., 1997), isolated from tilapia in Israel in 1988 (Fig. 2.1B) (Eldar et al., 1994). Tilapia were imported on a number of occasions during the 1970s and 1980s from Israel into North Queensland around Cairns and Townsville, and a number of strains and hybrids have since colonised rivers and creeks throughout Queensland (Mather and

Arthington, 1991). Globally, the aquatic ST-261 lineage appears to have been transferred 80 through human movements of tilapia for aquaculture and other purposes over the last several decades. The US and Chinese tilapia isolates also appear to derive from the early

ND2-22 isolate, as do recent isolates from tilapia in Ghana (Fig. 2.1B). Indeed, phylogenetic analysis by maximum likelihood of draft whole genome alignments suggest that the

Ghanaian and Chinese isolates share a recent common ancestor that is derived from ND2-

22, with only 60 SNPs separating ND2-22 and the Ghanaian strains (Verner-Jeffreys et al.,

2017). We identified only 36 core genome SNPs separating the Ghanaian isolates from

ND2-22 but this reflects the smaller core genome in our study as a result of the high number of GBS isolates analysed (40 in the present study compared with 9 in the previous study)

(Verner-Jeffreys et al., 2017).

The minimum spanning tree implicates continued adaptation of the ST-261 lineage post- introduction and suggests that grouper (marine Teleostei family) may have been infected via estuary stingrays (Dasyatidae family) (Fig. 2.1B). Stingrays are occasional prey for adult giant Queensland grouper and stingray barbs have been found in the gut of grouper post- mortem (Bowater, unpublished observation). ST-261 GBS has also caused mortality in captive stingrays in South East Queensland, translocated from Cairns in North Queensland

(Bowater et al., 2018).

81

Figure 2.1. A) Maximum likelihood phylogeny of 82 S. agalactiae strains. The tree was inferred from alignment of 6,050 non-recombinant core genome SNPs. Branch length was adjusted for ascertainment bias using Felsenstein’s correction implemented in RAxML (Stamatakis, 2014). Nodes are supported by 1,000 bootstrap replicates. The tree was rooted using S. pyogenes M1 GAS (accession number: NC_002737.2) as an outgroup. B) Minimum spanning tree showing relationship amongst ST-261 serotype Ib GBS isolates based on a distance matrix derived from non-recombinant core genome SNP alignment. The consensus network was computed in MST-Gold (Salipante and Hall, 2011). 82 2.3.2. The S. agalactiae pan-genome comprises a small core of protein-coding genes and is open

To further elucidate adaptation amongst the fish pathogenic GBS types a pan-genome was built from 39 complete genomes retrieved from GenBank and using our curated ST-261 grouper isolate QMA0271 as a high-quality reference seed genome. The resulting pan- genome was 4,074,275 bp (Fig. 2.2A). All-vs-all BLAST analysis of the genomes implemented in BRIG clearly indicated the substantial reduction in genome size among the fish pathogenic ST-261 cohort, as previously reported for a limited number of ST-261 isolates (Rosinski-Chupin et al., 2013). Here, we find that ST-260 and ST-552 fish- pathogenic sequence types within serotype Ib are similarly reduced and that conservation amongst the serotype Ib strains is high (Fig. 2.2A). In total 4,603 protein-coding genes were predicted in S. agalactiae pan-genome using Roary (Fig. 2.2B), which is consistent with previous research (Liu et al., 2013). The number of core genes was 1,440 (representing

35% of the pan-genome), while previous studies reported 1,202 to 1,267 genes in the pan- genome (He et al., 2017; Liu et al., 2013). These differences may result from the methods being used to examine the pan-genome, the difference in sequences number being used to create the pan-genome, and finally, the use of draft sequences in the analysis (Liu et al.,

2013). A majority of protein-coding genes found in the pan-genome belonged to both the dispensable and strain-specific genes. This could be a result of the inclusion of a high number of serotype Ib strain sequences, which were all significantly smaller (approx. 1.8

Mbp) than those of other isolates. Liu et al. (2013) demonstrated that removing Ib piscine isolates from their analysis resulted in an increase in the number of core genes.

83 Frequency analysis of IGRs in S. agalactiae pan-genome showed that the number of IGRs shared across all strains was smaller than core protein-coding genes, whereas strain- specific IGRs were much higher than protein-coding strain-specific genes (Fig. 2.2C).

Intergenic regions analysis with Piggy excludes IGRs that are less than 30 bp, which may result in fewer IGRs than protein-coding genes in core regions (Thorpe et al., 2017). Most

IGRs identified in the pan-genome belonged to either core genes or strain-specific genes

(Fig. 2.2C), in line with previous findings in Staphylococcus aureus ST-22 and Escherichia coli ST-131 where similar distributions of IGRs were detected (Thorpe et al., 2017). The gradients of the accumulation curves for both protein-coding genes and IGRs are still strongly positive; therefore the S. agalactiae pan-genome remains open.

To determine whether strain-specific IGR sequences may be derived from genes (or pseudogenes) that have undergone erosion, we queried the gene sequences used to construct the pangenome by BLASTn using 1,539 strain-specific representative IGR sequence clusters (output from Piggy). A total of 1,862 hits were retrieved from 683/1,539 representative IGR sequence clusters supportive of the gene origins of many IGRs.

Overrepresentation of sequences from the QMA0271 reference genome among the hits

(309/1,862 from 39 genomes employed in the pan-genome) was expected, as it was employed as the seed for the pan-genome assembly. Of the 241 unique hits among genes from QMA0271, 39 hits fell in genes that we annotated as pseudogenes. Pseudogenes are predicted to be rapidly lost from the genome, evidenced by the lack of conserved pseudogenes across multiple strains of the same species (Kuo and Ochman, 2010; Lerat and Ochman, 2005). The relatively high presence of pseudogenes or remnants thereof within the serotype Ib ST-261 QMA0271 is supportive of ongoing adaptation of this lineage 84 to the aquatic host and habitat (Rosinski-Chupin et al., 2013). As pseudogenes are often not annotated as such in database assemblies (Lerat and Ochman, 2004, 2005), further manual inspection of the 849 unique BLAST hits was performed in Excel and by reference to the pan-genome. Pseudogenes may arise through frameshift SNPs, resulting in early termination or interruption by insertion elements (Lerat and Ochman, 2004), and 239 of the

849 unique BLAST hits were identified as insertion element transposases and a further four as or phage/prophage proteins, suggesting possible gene disruptions by insertion.

Hypothetical proteins comprised 215 of the 849 unique sequences identified by BLAST of strain-specific IGR through the pan-genome, while genes annotated as transcriptional regulators comprised 48 sequences. These results lend preliminary support to the hypothesis that much of the IGR of bacteria comprises gene remnants and is worthy of in- depth exploration.

85 A

4000 kbp

500 kbp 3500 kbp S. agalactiae

Pan-genome 1000 kbp 3000 kbp 4,074,275 bp

1500 kbp 2500 kbp

2000 kbp

B C

2000 Category Gene Core genes IGRs (99%-100%) 1500

Soft core genes 1440 genes (95%-99%) 2069 genes 35% 1000

51% Count Shell genes (15%-95%)

Cloud genes 500 (0%-15%)

112 genes 442 genes 3% 0 11% 0 20 40 60 80 Isolates

86 Figure 2.2. The pan-genome of S. agalactiae. A) BLASTN-based sequence comparison of 82 S. agalactiae genomes against the S. agalactiae pan-genome as reference constructed with BRIG 0.95 (Alikhan et al., 2011). Rings from the innermost to the outermost show GC content and GC skew of the pan-genome reference, then sequence similarity of each of the 82 strains listed in the legend, from top to bottom rings are coloured according to origin with fish isolates belonging to serotype Ib ST-261, ST-260 and ST-552 in blue, fish strains belonging to serotype Ia in purple and terrestrial strains in red. The outermost ring (black) represents the reference pan-genome. B) Proportion of protein-coding genes in the core, soft core, shell and cloud of the pan-genome of 82 S. agalactiae isolates were determined with Roary. C) Histogram indicates the frequency of genes (protein-coding) in red and IGRs (non-protein-coding intergenic regions) in blue-green from 82 S. agalactiae genomes analysed by Piggy (Thorpe et al., 2017).

2.3.3. Aquatic serotype Ib have a reduced repertoire of virulence factors

Almost all genes classed as adhesins, involved in immune evasion and host invasion, and most of the toxin-related genes found in terrestrial isolates were absent from serotype Ib aquatic isolates (Fig. 2.3). Rosinski-Chupin et al. (2013) reported ~60% of the virulence genes found in human strains were present in a serotype Ib GBS strain from fish. We found that CAMP factor gene cfa/cfb was present in all strains including serotype Ib ST-260, 261 and 552 isolates, but CAMP reaction was previously reported to be negative for ST-260 and

261 strains (Evans et al., 2008; Rosinski-Chupin et al., 2013). These authors identified that

CAMP factor gene in ST-261 is disrupted while the gene in ST-260 is unaltered but the level of gene expression may be too low to detected by the test (Rosinski-Chupin et al., 2013).

Most of the genes in cyl locus have been lost from Ib piscine strains and only cylB, an ABC

ATP binding cassette transporter was present in ST-260 and 552 (Fig. 2.3). The cyl locus is responsible for hemolytic activity and production of pigment via co-transcription of cylF and cylL (Spellerberg et al., 2000). In ST-261, the cyl gene cluster is replaced by a GI resulting in loss of hemolytic activity (Rosinski-Chupin et al., 2013). Of particular relevance to virulence and antigenic diversity, transmembrane immunoglobulin A-binding C protein beta- 87 antigen cba was absent in all aquatic isolates (Fig. 2.3). This gene has been reported in type

Ib and Ia GBS previously (Nagano et al., 2002), and is implicated in virulence in neonates and is up regulated in GBS serotype Ia strain A909 in response to human serum (Nagano et al., 2002; Yang et al., 2010, 2011). In contrast, capsule-related genes were largely conserved and associated with serotype (Fig. 2.3), supporting the major role of capsule in virulence of fish pathogenic streptococci (Delannoy et al., 2016; Locke et al., 2007).

Although serotype Ib aquatic isolates have lost the majority of virulence factors found in terrestrial isolates, most contained six sequences that were identified as probable adhesins by homology (Fig. 2.3). These ST-261 adhesins (named 0337, 0626, 0856, 1185, 1196 and

1648 based on position in the annotated ST-261 genome from QMA0271) were fully conserved amongst aquatic serotype Ib ST-261 (Fig. 2.3). Moreover, ST-261 adhesin 0856 was only present in ST-261 and two serotype II isolates, GBS1-NY and SA111 strains (Fig.

2.3). ST-261 adhesins 1185 and 1648 were shown to be unique to aquatic serotype Ib isolates, being absent from Ia fish isolates and all terrestrial strains (Fig. 2.3). The analysis indicated that ST-261 adhesins 0337, 0626 and 1196 were well conserved across most of the isolates regardless of origin but 1196 was the only adhesin-like gene present in all strains analysed (Fig. 2.3). Some terrestrial strains, such as QMA0355, 0357, 0336 and NGBS572 lacked adhesin 0337 (Fig. 2.3).

88 ST-261 Adhesins Antiphagocytosis Adhesins Toxin

CNCTC1084 V 26 NGBS128 100 III 17 COH1 GD201008001 99 HN016 Ia 7 97 100 WC1535 A909 100 Sag37 Ib 12

94 CU GBS 98 FWL1402 739283 99 III 50 CU GBS 08 100 SG M1 283 2603VR V 110 100 Sag158 19 95 III H002 736 94 GBS M002 VI 1 NGBS061 IV 495 97 QMA0303 100 09mas018883 95 SS1 100 V 1 98 QMA0300 GBS ST1 NGBS357 NEM316 III 23 100 NGBS572 IV 452 97 QMA0336 89 99 QMA0357 Ia 23 70 QMA0355 SA111 II 61 100 QMA0306 V 1

99 GBS6 54 GBS2 NM 68 II 22 100 GBS1 NY FDAARGOS 254 ILRI005 V 609 0 92 GBS85147 Ia 103 74 ILRI112 V 617 S25 100 SA20 552 S13 QMA0487 QMA0489 99 QMA0485 QMA0488 66 QMA0497 260 QMA0495 100 QMA0499 QMA0496 QMA0494 138P 100 96 138spar GX026 ND2-22 GS16 0008 GS16 0035 73 Ib GS16 0031 GS16 0046 100 QMA0292 QMA0294 QMA0320 QMA0277 50 261 QMA0276 QMA0275 QMA0281 QMA0287 100 QMA0264 QMA0268 QMA0280 68 QMA0274 QMA0267 QMA0290 QMA0271 QMA0285 S.pyogenes

Figure 2.3. Virulence gene presence and absence in S. agalactiae. Genes were identified from VFDB to create a S. agalactiae database for comparison of 82 strains by BLAST using SeqFindr with default settings (95% identity cut off).

As CPS is a requirement for full virulence in several fish pathogenic streptococci (Delannoy et al., 2016; Locke et al., 2007) and the major antigen in GBS (Pasnik et al., 2005; Seib et al., 2012; Yao et al., 2013), further analysis of the serotype Ib cps operon was conducted.

Within the serotype Ib lineage, the capsular polysaccharide operon was well conserved (Fig.

2.4). However, QMA0281 from grouper had a deletion at position 341 in cpsB, encompassing cpsC, cpsD and cpsE (Fig. 2.4), resulting in a chimeric ORF. Moreover, an insertion in a TA repeat at position 557 in cpsH resulted in an early stop codon marginally reducing gene size (Fig. 2.4). QMA0368 had a TT insertion at nucleotide position 745 in

89 cpsE resulting in insertion of an early stop codon and truncation of the gene (Fig. 2.4).

Deletion of this region that includes the priming glycosyl transferase for capsular biosynthesis results in loss of capsule, attenuated virulence and modified pathology in the fish pathogen S. iniae (Millard et al., 2012). Buoyant density analysis in Percoll indicated that QMA0281 is also deficient in capsule (not shown). cps operon SNPs amongst the

Australian serotype Ib isolates were rare (Fig. 2.4). Indeed only 1 SNP neuA separated

QMA0271 from the 1988 tilapia isolate from Israel suggesting very little evolution of the cps operon since introduction of the lineage (Fig. 2.4). This may reflect a well-adapted capsule for colonization naïve hosts, as the Australian isolates were from wild fish and captive stingrays recently after capture and transport, thus placing little selective pressure for novel capsular sequence types. Immunity in fish drives evolution of novel capsular sequence types in S. iniae but these reported cases were all in high intensity aquaculture with occasional use of autogenous vaccination and opportunity for development of cps-specific immunity

(Millard et al., 2012). This may explain the relatively high number of SNPs in genes encoding sugar and sialic acid modifying enzymes amongst the isolates from tilapia farmed in

Honduras relative to the other isolates examined, as autogenous vaccination is occasionally used on farms where isolates were sourced and may apply selective pressure favoring modified CPS.

90 cpsY cpsA cpsB cpsC cpsD cpsE cpsFcpsG cpsH cpsI cpsJ cpsK cpsL neuB neuC neuD neuA QMA0271 deletion 341C 557TA insertion QMA0281 lost stop codon early stop codon

QMA0285 SNPs

A310C QMA0292

A478G QMA0294

A478G A310C QMA0321

745TT QMA0368

T765A ND2-22

T765A 138P A649G A538G G427C A901G GS16_0031 A649G A538G G427C T765A GS16_0035 A649G A538G T765A GS16_0046 C1080T G564T G578A G247A G120T 912A A537G T70C A27C C84T QMA0485 C1080T A651C G578A G909T C13T A795T T653G 912A T83C G465T T70C A56C QMA0494 A537G G120T G564T C84T

Figure 2.4. The capsular polysaccharide (CPS) operon of the ST-261 lineage. The operon was identified in Genbank files manually and then compared by BLAST using EasyFig (Sullivan et al., 2011). 91 2.4. Conclusions

The clade of aquatic S. agalactiae serotype Ib including ST-260, ST-261 and ST-552 is a highly adapted fish pathogen with a substantially reduced genome compared to all other serotypes from terrestrial mammalian, reptile and fish hosts. These variants were originally identified as S. difficile due to their impoverished growth on laboratory media and hence difficulty of isolation from diseased fish (Eldar et al., 1994). Isolates from fish that were previously identified as S. difficile were assigned to serotype Ib GBS a few years later

(Vandamme et al., 1997) but the recent discovery that serotype Ib isolates have substantially smaller genomes than those of other GBS serotypes (Rosinski-Chupin et al., 2013) explains the marked phenotypic difference that merited early phenotypic assignation of these strains to a separate species. Other serotypes have been isolated from fish, notably serotype Ia and serotype III, but these seem to arise from terrestrial transfer rather than being retained amongst the aquatic host population (Evans et al., 2008). In contrast, serotype Ib has only been isolated from fish and stingrays, appears to be well-adapted and is likely to have been transferred internationally via trade in domesticated tilapia, evidenced here by the very close relationship (only a handful of SNPs) between a strain isolated from tilapia in 1988 in Israel and those found in fish and stingrays in Australia since 2008, and in tilapia in the USA, China and Ghana. The ST-261 lineage in Australia likely arrived with several introductions of tilapia in the 1970s and 1980s. Tilapia are classed as a noxious pest in Australia and import was banned, but not before several lines became established throughout tropical and subtropical freshwater habitats in Queensland (Mather and Arthington, 1991). Although ST-261 serotype Ib GBS has not been isolated from farm fish in Queensland in spite of proximity of freshwater farms to tilapia-infested creeks, this clade of GBS is a substantial problem in farmed tilapia globally. The cohort of putative adhesins identified here to be conserved 92 through all fish pathogenic serotypes (including Ia and III in addition to Ib) may be promising candidates for cost-effective cross-serotype protective vaccines for aquaculture and are worthy of future research.

93 Chapter 3: Regulation and antigenicity of conserved ST-261 adhesins in

Streptococcus agalactiae

Abstract

Streptococcus agalactiae (group B Streptococcus; GBS) causes disease in warm water fish resulting in mass mortalities globally. Previously, we assembled the pan-genome of GBS and identified that three out of six adhesins found in the sequence type 261 (ST-261) clonal complex (CC) are conserved in all GBS isolates while two are only present in serotype Ib fish strains and one is specific to ST-261. We characterised three ST-261 adhesins

(adhesin_0337, 0626 and 1196) conserved in all strains and one specific to serotype Ib piscine strains (adhesin_1648) in silico. General domain analysis revealed that adhesin_0337 and 0626 have two binding domain structures in their sequences while known binding domain structures were not identified in adhesin_1196 and 1648 suggesting adheisn_0337 and 0626 might play important roles in pathogenicity in fish. The expression of genes encoding the ST-261 adhesins and CpsE (the initiating glycosyltransferase for capsular polysaccharide expression) varied inversely, dependent upon the culture condition suggesting co-regulation. Serum antibodies against adhesin_0337, 0626 and mixture of adhesin_0337, 0626 and 1196 derived from tilapia reacted to the vaccine antigens. While the level of antibody against adhesin_1196 by itself was low, the adhesin was recognised by tilapia when it was mixed with other adhesins, 0373 and 0626. Although culture conditions affect the expression of ST-261 adhesins, the level of ST-261 adhesins detected in whole cells by enzyme linked immunosorbent assay (ELISA) and Western blot did not seem to reflect gene expression. This may be due to post-transcriptional processing causing a disconnect between gene and protein expression. In conclusion, given the antigenicity of 94 adhesin_0373 and 0626 and their ubiquitous conservation amongst GBS, these ST-261 adhesins appear to be good vaccine candidates. A vaccination and challenge model trial in fish is warranted.

3.1. Introduction

Streptococcus agalactiae or group B streptococcus (GBS) is an opportunistic pathogen of humans and animals. In humans, the bacterium colonises mucosal surfaces as a commensal organism, but may cause meningitis and septicaemia in neonates (Brochet et al., 2006; Edwards and Gonik, 2013; Six et al., 2015). In warm water fish, GBS is a significant cause of disease with infections reported in a diverse range of farmed and wild fish species globally (Bowater et al., 2012; Evans et al., 2008; Jafar et al., 2008; Mian et al., 2009). The economic loss caused by GBS disease outbreaks are substantial, especially in tilapia

(Oreochromis spp.) aquaculture, resulting in estimated 40 million USD loss annually (Mian et al., 2009; Sun et al., 2016; Verner-Jeffreys et al., 2017). Hence, controlling disease is critical for the expansion of aquaculture, and vaccination of stock is the most effective way to control and prevent disease outbreaks on fish farms (Håstein et al., 2005; Lafferty et al.,

2015; Nur-Nazifah et al., 2014). However, there are at least 10 major capsular serotypes of

GBS (Paoletti and Madoff, 2002; Slotved et al., 2007; Yao et al., 2013). While vaccination against one serotype confers protection against the same serotype, the vaccine does not cross-protect against other serotypes (Bachrach et al., 2001; Paoletti and Madoff, 2002).

Consequently, serotype specificity resulting from variation in the highly immunogenic capsular polysaccharide (CPS) antigens represents a particular problem in controlling

Streptococcal infections by vaccination in both humans and animals.

95 The rapid advance of whole genome sequencing and bioinformatics have allowed relatively rapid identification of the most conserved surface and secreted proteins amongst strains of a bacterial species which can then be shortlisted as potential targets for vaccination, an approach termed reverse vaccinology (Rappuoli, 2001). This reverse vaccinology approach was first applied to develop a vaccine against Neisseria meningitidis, Group B meningococcus (MenB) (Pizza et al., 2000; Rappuoli, 2001). Subsequently, Maione et al.

(2005) developed the first universal vaccine candidate against multiple GBS serotypes in human using the reverse vaccinology based on a pan-genome derived from eight different

GBS serotypes (Maione et al., 2005; Nuccitelli et al., 2015). The concept of the pan-genome was first described by Tettelin et al. (2005) and states that the gene repertoire of a bacterial species could be fully described by their pan-genome, which consists of the core genome or genes shared among all strains within a species, and the accessory genome comprising those genes that are unique or shared between several strains only. Exploring only the core genome to find effective vaccine candidates may identify candidate antigens that are represented in all major serotypes, but presents the risk of missing some important antigens present in the accessory genome (Nuccitelli et al., 2015). The universal vaccine against human GBS contains four surface proteins, one was found in the core gnome and three proteins were identified from the accessory genome (Maione et al., 2005).

We sequenced the genomes of GBS isolates from wild and captive fish, along with collocated terrestrial farm, domestic animal and human clinical isolates in Australia and assembled a pan-genome based on these strains along with complete genome sequences of GBS available in the NCBI database (Kawasaki et al., 2018). The pan-genome analysis revealed that, although serotype Ib piscine strains have lost approximately 60% of their 96 virulence factor repertoire compared with terrestrial conspecific and serotype Ia piscine strains, a number of virulence factors including hyaluronate lyase (exoenzyme), CPS and six surface protein, which were identified as adhesins, are conserved (Kawasaki et al., 2018).

Bacterial adhesins mediate adherence to host surfaces (tissues, cells, and extracellular matrix), and may play a critical role in invasive infection (Nobbs et al., 2009). Streptococcal bacteria can express numerous adhesins that allow interaction with a diverse array of host components by binding to specific receptors on the host cell, which allow colonisation of target host tissue without being eliminated by mucocilliary defense (Henningham et al.,

2013; Nobbs et al., 2015; Nobbs et al., 2009; Raynes et al., 2018; Walker et al., 2014). Due to their role in attachment to invariant host receptors, adhesins are highly conserved and are thus excellent candidates for protective vaccines. Indeed, vaccination with specific adhesins from S. pneumoniae conferred protection in mice, and the resulting IgG reduced bacterial attachment to human epithelial cells supporting the high potential for recombinant protein vaccines based on these adhesins (Gianfaldoni et al., 2007; Khan and Pichichero,

2012). Also, a combination of three pilus components provided significant protection against

GBS clinical isolates regardless the CPS serotype (Margarit et al., 2009). Margarit et al.

(2009) found that at least one of the three pilus islands were conserved among the all clinical isolates used in their study. Previously, we have shown that all GBS sequence type (ST)

261 strains carry the six adhesins (ST-261 adhesins), but only three of them are conserved within all strains including terrestrial isolates, while one is exclusive to ST-261 and two are specific to serotype Ib piscine strains (Kawasaki et al., 2018). Therefore, in this study, we focus on four ST-261 adhesins, three which are conserved in all strains and one which is specific to serotype Ib fish strains.

97 In aquaculture, cost effectiveness is critical for vaccine development since the fish require a higher antigen dose than terrestrial animals to induce high protection, and the target species are of relatively low monetary value (Sommerset et al., 2014). In contrast to purified recombinant proteins, inactivated whole-cell vaccines are inexpensive to produce by simple fermentation (Ulmer et al., 2006). However, growth conditions are critical because major antigenic proteins may not by expressed at high levels under “normal” culture (Colquhoun et al., 2002). For instance, the bacterin against Vibrio salmonicida confers better protection in Atlantic salmon when bacteria were grown at 10˚C, rather than 22˚C (Colquhoun et al.,

2002). This is likely to be very important in whole-cell vaccines against Streptococcus where potential cross-protective protein antigens against heterologous serotypes may not be expressed at sufficiently high levels to overcome the immunodominance of the CPS (Aviles et al., 2013). Therefore, in this study, we characterised ST-261 adhesins in silico and determined culture conditions that regulate their expressions relative to capsule. Also, to examine if fish can recognise the adhesin, recombinant adhesins were produced and injected to fish to measure the antibody response in order to determine whether a vaccination and live challenge model can be justified.

3.2. Materials and methods

3.2.1. Bacterial strains and routine culture

Two serotype Ib, ST-261 strains of GBS, QMA0271, originally isolated from the heart of giant catfish (Netuma thalassina) in 2009 and QMA0285 which was isolated from the head kidney of giant Queensland grouper (Epinephelus lanceolatus) in 2008, and one serotype

Ia, QMA0357 human strain that was isolated from female genital in Townsville hospital in

2011 were used in this study. They were recovered from frozen stock (-80ºC) and grown on 98 Columbia agar containing 5% sheep blood (Oxoid) or in Todd-Hewitt broth (THB) at 28ºC unless otherwise stated. For QMA0357, the bacterial culture was incubated at 37ºC. TOP10

Escherichia coli DH5-α (Invitrogen) was used for cloning and E. coli Rosetta 2(DE3)

(Novagen) was used for recombinant protein expression. Lysogeny Broth (LB) agar or

Terrific broth (TB) supplemented with ampicillin (50 µg/mL) when selection was required were used to culture TOP10 E. coli DH5-α. To culture E. coli Rosetta 2(DE3), both ampicillin

(50 µg/mL) and chloramphenicol (34 µg/mL) were added to LB agar or TB. Both E. coli strains were grown with shaking at 200 rpm at 37ºC.

3.2.2. ST-261 adhesin structural characterisation

Analysis of general domain structures of ST-261 adhesins were performed by SMART

GENOMES (http://smart.embl-heidelberg.de/smart/set_mode.cgi?GENOMIC=1) (Letunic et al., 2015) and HMMER (http://www.ebi.ac.uk/Tools/hmmer/) (Finn et al., 2011). To identify signal peptide cleavage sites and transmembrane regions in amino acid sequence from

QMA0271, SignalP 4.1 Server (http://www.cbs.dtu.dk/services/SignalP/)(Petersen et al.,

2011) and TMHMM Server v. 2.0 (Krogh et al., 2001) were used. 3D structure models of the adhesins were created by PHYRE2

(http://www.sbg.bio.ic.ac.uk/phyre2/html/page.cgi?id=index) (Lewis et al., 2013).

3.2.3. Investigation of effect of culture conditions on ST-261 adhesin and CPS gene expression by real-time qRT-PCR

To investigate effects of culture conditions on expression of ST-261 adhesin genes, overnight starter cultures of GBS strain QMA0285 in THB and TB were standardised to

OD600 of 1.0 and used to inoculate two THB and two TB cultures (without glycerol) 99 respectively at 2% (v/v). These cultures were then grown for 12 h at 28ºC with gentle shaking.

To determine any effect of metals on ST-261 adhesins and CPS gene expression, Mn(II)SO4

(final concentration 5 µM) and Zn(II)SO4 (final concentration 100 µM) were added to one of the THB culture at 10 h 30 min post inoculation, while the other culture remained unchanged.

To investigate the effect of increase in carbohydrate availability, glucose was added to one of the TB culture to a final concentration 55 mM at 11 h 30 min post-inoculation, while the other culture remained un-changed (Di Palo et al., 2013). After 12 h total incubation, 1.5 mL culture was from each of the treatments, cells were harvested by centrifugation for 5 min at

4°C 14,103 x g, supernatants discarded and the cell pellets were snap-frozen in ethanol/dry ice slurry then stored at -80ºC for subsequent RNA extraction. All experiments were conducted with three biological replicates (ie. from three independent starter cultures per treatment). An identical experiment was conducted in parallel to determine growth curves under the treatment conditions by measurement of optical density at 595 nm every 30 min for 30 h in a BMG Fluostar optima instrument (BMG Labtech).

The relative expressions of ST-261 adhesin genes and cpsE, a gene encoding the first glycosyl transferase of the capsular polysaccharide operon of GBS under the culture conditions above were determined by real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR). Briefly, total RNA was extracted with Maxwell® RSC simplyRNA Cells Kit (Promega) following the manufacturer’s instruction. Contaminating gDNA was removed with the RNAse-Free DNAse set (Qiagen) and remaining RNA was quantified using the Qubit® Fluorometer RNA high sensitivity assay kit (Life Technologies,

Melbourne). Complementary DNA (cDNA) was synthesised from 100 ng per sample with

100 the QuantiTect® Reverse Transcription Kit (Qiagen) in accordance with the manufacture’s instruction.

Primers for real-time qRT-PCR were designed with Primer3 v. 0.4.0

(http://bioinfo.ut.ee/primer3-0.4.0/) (Koressaar and Remm, 2007; Untergasser et al., 2012) based on ST-261 adhesins and cpsE nucleotide sequences (Table 3.1). All real-time qRT-

PCR reactions were performed in 384-well plates with reagents dispensed using an epMotion 5075 Robot (Eppendorf, Hamburg). The concentration of each primer was optimised at 0.2 µM and template cDNA at 0.2 ng were added to each reaction yielding

100% efficiency. In each reaction there were 0.2 µL of forward primer, 0.2 µL of reverse primer (both from 10µM stock solutions), 5 µL of SYBRGreen Master Mix (Applied

Biosytems), 2 µL of cDNA 0.1 ng/µL, and 2.6 µL of water. Cycling parameters were: 95 °C for 10 min followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min, then a final melt curve at 95 °C for 15 s, 60 °C for 1 min and 95 °C for 15 s in a thermocycler ABI Vii7 (Thermo

Fisher Scientific). All temperature cycling was performed with acceleration at 1.6 °C /s.

Initially, five reference genes (Table 3.1) were tested for stability across all treatment conditions in a pilot study and the most stable, adhP, was chosen using the ∆Cq method for inclusion in the main experiment (De Santis et al., 2011). The ∆∆Cq method was used for normalisation of target gene transcript abundances against a reference gene according to

∆Cq ∆Cq normaliser the equation [Ratio (test/calibrator) = (E/target) / (Enormaliser) ] (De Santis et al., 2011;

Pfaffl, 2001; Pfaffl et al., 2002). The Relative Expression Software Tool (Pfaffl et al., 2002) was used to calculate the normalized relative expression quantity of each target genes for each conditions, and was based on the pair-wise fixed reallocation randomisation test

(10,000 randomisations) (Pfaffl et al., 2002). The results represent the relative up- or down- 101 regulation of each gene of interest relative to the internal control between treated and untreated samples.

3.2.4. Cloning, expression and purification of the recombinant proteins

Since three ST-261 adhesins were identified across all GBS strains (Kawasaki et al., 2018), recombinant ST-261 adhesin 0337, 0626 and 1196 were produced expressed in E. coli.

Primers were designed to amplify ST-261 adhesin sequences excluding signal peptides and transmembrane regions using Phusion® High-Fidelity DNA Polymerase (New England

BioLabs) (Table 3.1). The PCR products were cleaned or purified from 2% agarose gel, if needed, using ISOLATE II PCR and Gel Kit (Bioline) according to the manufacturer’s instructions, then directionally cloned into Champion pET101 (Invitrogen), transformed into

TOP10 E. coli DH5-α for storage, propagation and maintenance using standard procedures.

The transformants were grown on LB agar plate containing ampicillin (50 µg/mL), then colonies were analysed by PCR and plasmid constructs were confirmed by Sanger sequencing (AGRF, Brisbane). The confirmed transformed TOP10 E. coli DH5-α were archived in 20% glycerol at -80ºC. The codon usage of adhesin coding sequences were analysed with GenScript Rare Codon Analysis Tool (http://www.genscript.com/cgi- bin/tools/rare_codon_analysis) and the codon adaptation index was calculated. To overcome the codon bias, E. coli Rosetta 2(DE3) (Novagen) was chosen for recombinant protein expression. The vectors containing the cloned genes were purified from TOP10 E. coli DH5-α and then transformed into E. coli Rosetta 2(DE3) for isopropyl β-D-1- thiogalactopyranoside (IPTG)-induced expression. For expression, overnight cultures of E. coli Rosetta 2(DE3) were used to inoculate 400 mL of fresh TB (10% inoculum v/v)

102 containing chloramphenicol and ampicillin and grown until OD600 = 0.4-0.6. IPTG was added to a final concentration of 0.5 mM and incubated for 4 h at 37ºC with shaking.

The expressed recombinant protein was purified via 6x His tag at the C-terminal using Ni-

NTA affinity chromatography (Qiagen) under native conditions. Wash and eluted fractions were analysed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Western-blotting onto polyvinylidene difluoride (PVDF) membranes (Immobilon P,

Merck), the membrane was blocked with 5% skim milk in Tris buffered saline + 0.005%

Tween 20 (TBST) at 4ºC overnight and recombinant protein was detected in blots using a mouse monoclonal anti-Penta-His antibody (1:1000) supplied in the purification kit (Qiagen) with a secondary polyclonal anti-mouse IgG produced in goat conjugated to alkaline phosphatase (1:15 000) (Sigma Aldrich). Colour was developed using NBT-BCIP Liquid

Substrate System (Sigma Aldrich). Finally, the eluted recombinant protein was quantified by

PierceTM BCA Protein Assay Kit (Thermo Fisher Scientific) and stored in elution buffer at -

80ºC until use.

103 Table 3.1. Oligonucleotide primers used in this study.

Experiments Gene Primer Length (bp) Nucleotide sequence (5’ to 3’)

Adhesin SA_adhe0337F_RTPCR 20 ATGAAGCGTTTGGTGGAGAC

0337 SA_adhe0337R_RTPCR 20 AGAGCTTGCCCCTCTTTACC

Adhesin SA_adhe0626F_RTPCR 20 TGAGATGCCTAAAACTGCCC

0626 SA_adhe0626R_RTPCR 20 GGTGCTGTTGGTTTCGAAGT

Adhesin SA_adhe1196F_RTPCR 20 CATCGCAACCCTCACCTAGT

Real-time 1196 SA_adhe1196R_RTPCR 20 ATTCATCGCGATCCACTTCT

qRT-PCR Adhesin SA_adhe1648F_RTPCR 20 GTCTTCACAGCAGGAGCACA

1648 SA_adhe1648R_RTPCR 20 TAAGAGTGGACTTGCGGCTT

cpsE SA_cpsE_F1091_RTPCR 24 CAAGCATAGATGAGTTGCCTCAAT

SA_cpsE_R1208_RTPCR 21 CGTCGCTTCTGCGTTGAATT

adhP SA_adhP_F59_RTPCR 20 AACGTCTTTGAGGGTTGGTG

(reference) SA_adhP_R208_RTPCR 20 GTTTCCAAGACCACCTGCAC

Adhesin SA_adhe0271_0337F 19 CACCATGCCCCAACATAAA

104 0337 SA_adhe0271_0337R 30 ATTTTTAGATATCATAGACATTTTTT

Cloning TACC

Adhesin SA_adhe0271_0626F 23 CACCATGACACCAGTAATGGCAG

0626 SA_adhe0271_0626R 27 TTTTTTAGCTAAGGCTGTCATAGCT

TT

Adhesin SA_adhe0271_1196F 28 CACCATGACAAGTGATAAGAATAC

1196 TGAC

SA_adhe0271_1196F 22 TTCCTTTTTAGGCTTACTGTGG

105 3.2.5. Vaccines preparations and formulation

Two formalin killed bacterins, which included QMA0285 grown in THB and QMA0357 grown in TB without glycerol, and four recombinant vaccines were prepared. Briefly, overnight GBS strain QMA0285 starter cultures grown in THB (OD600 = 1) was used to inoculate (2% v/v) fresh 50 mL THB cultures in 200 mL flasks and incubated at 28ºC with gentle swirling for 16 h (early stationary phase). For QMA0357, overnight starter culture grown in THB was spun and the cells were re-suspended in fresh TB to adjust OD600 = 1. This culture was used to inoculate (2% v/v) fresh 50 mL TB cultures without glycerol in 200 mL flasks and incubated at 37ºC with gentle agitation for 8 h (early stationary phase). Bacterial cultures were spun for 15 min at 4ºC and 3220 x g and resuspended in the appropriate volume of supernatant to adjust OD600 to 1. The cultures were immediately chilled on ice and a small aliquot was taken from each culture before formalin addition to estimate a colony forming unit (CFU).

Formalin solution (from stock 37%) was added to a final concentration of 0.5% v/v equivalent to 0.2% final concentration of formalin for 4 days at 4ºC. To check for complete inactivation of vaccines, 200 µL of each culture was plated onto Columbia agar containing 5% sheep blood (Oxoid) and plates left to incubate for up to one week at 28ºC for QMA0285 and 37ºC for QMA0357. Once complete inactivation of vaccines was confirmed by culture, the suspensions were emulsified with MONTANIDE ISA766 (Seppic, France) adjuvant at the ratio of 4:6 by 25 times passage through a sterile 19G needle fitted to 3 mL Luer lock syringe.

For recombinant vaccine, the recombinant protein in elution buffer was diluted to 400 µg/mL and then was emulsified as descried above. Mixed recombinant vaccine, which is the mixture of three recombinant ST-261 adhesins, contain 133 µg/mL of each recombinant ST-

261 adhesin. As a negative control vaccine, phosphate buffered saline (PBS) was emulsified with the adjuvant at the same ratio (3:7). Prepared vaccines were transferred in opaque 106 screw capped 5 mL centrifuge tubes and stored at 4ºC. Stabilities of vaccines were checked by centrifuging subsample of each vaccine. All bacterins and recombinant vaccines used in the study are listed in (Table 3.2).

Table 3.2. Vaccine types and antigen concentrations.

Antigen Concentration Per tilapia

PBS - -

Whole-cell, Ib 4 x 108 cfu/mL 4 x 107 cfu/mL

Whole-cell, Ia 4 x 108 cfu/mL 4 x 107 cfu/mL

Recombinant protein, 0337 400 µg/mL 40 µg/mL

Recombinant protein, 0626 400 µg/mL 40 µg/mL

Recombinant protein, 1196 400 µg/mL 40 µg/mL

Recombinant protein, Mix 400 µg/mL (~ 133 µg/mL of 40 µg/mL (~13 µg/mL of

(mixture of 3 adhesins) each adhesin) each adhesin)

3.2.6. Experimental animal and husbandry

Catching, breeding, vaccination and challenge in tilapia were performed under guidance of animal welfare and ethics requirements with approval by the Animal Welfare Unit, UQ

Research and Innovation at the University of Queensland (AEC approval number:

SBS/398/16). In addition, since tilapia, Oreochromis mossambicus, is an invasive species in Australia, the permission to collect, transport, possess and breed tilapia for research was obtained from Queensland Government Department of Agriculture and Fisheries Biosecurity

(permit number: PRID000267). In this study, tilapias were obtained from a wild population in the Brisbane river catchment and treated with Vetsense Kilverm Pig and Poultry Wormer 107 (Vetsense) to remove parasites. Five tilapias were dissected for bacteriology. Then tilapias were transferred to a recirculating freshwater system consisting of eight 112 L circular food- grade plastic tanks with individual aeration. The water temperature was maintained at 28˚C.

Tilapias were fed to satiation twice a day with a commercial diet for native freshwater fish

(Ridley Aqua Feed). Water quality was maintained by mechanical and biological filtrations. The quality was monitored regularly for ammonia, nitrite, nitrate, pH and water hardness. Water exchanges were performed as required.

3.2.7. Vaccination of tilapia and serum collection

Tilapias were anaesthetised with AQUI-S® (AQUI-S New Zealand Ltd). and vaccinated by intraperitoneal (IP) injection with 100 µL vaccine per tilapia by using 1 mL syringe and 23G needle. Cohorts of nine fish were injected per vaccine and placed in one tank. Tilapias were kept in the tanks for 900 degree days (32 days at 28˚C) for immunity development. Then, tilapias were euthanized by lethal overdose of AQUI-S® (AQUI-S New Zealand Ltd). and bled from the caudal vein. Blood was stored at 4˚C overnight to clot and centrifuged at 7000 x g for

10 min to collect sera. The sera were stored at -20˚C for subsequent use.

3.2.8. Detection of adhesins in whole cells under differing culture conditions by SDS-PAGE analysis and Western blotting

Based on real-time qRT-PCR results, the conditions that induced either high or low adhesins/CPS expression were analysed by SDS-PAGE analysis. Briefly, four cultures were prepared under the conditions above (THB, TB, TB+glucose, TB+Mz&Zn) and cells were harvested from each culture after 12 h, 18 h and 24 h. The cells were pelleted by centrifugation and reduced by boiling for 15 min in reducing buffer containing dithiothreitol 108 (Bio-Rad). The reduced samples were resolved in 12% SDS-PAGE gels and stained with

PierceTM Silver Stain Kit (Thermo Fisher Scientific).

For Western blotting using antisera against the vaccines prepared above, GBS strain

QMA0285 was grown in the four different media and cells were harvested after 18 h of incubation at 28 ºC. The cells were washed thrice in chilled 10mM Tris buffered saline (TBS) and were resuspended in reducing buffer containing 2-mercaptoethanol (Sigma Aldrich).

Cells were reduced by boiling for 15 min and the samples were separated in 12% SDS-

PAGE gels. Each recombinant ST-261 adhesin and the mixture of recombinant ST-261 adhesins were also resolved by SDS-PAGE for Western blotting to determine if they were recognised by tilapia serum. The proteins were transferred to Immun-Blot ® LE PVDF membrane (Bio-Rad) and the membranes were blocked with 1% bovine serum albumin

(BSA) (Sigma Aldrich) dissolved in TBS containing 0.01% Tween 20 (TBST) (Sigma Aldrich) overnight at 4˚C. The membranes were washed thrice in TBST and cut into strips to separate each lane. Each membrane strip was placed in small zip-lock bag and proteins were detected in each blot by each anti-serum raised in tilapia (1:32 dilution in TBST). After 3 h incubation at room temperature, all membrane strips were washed three times in TBST and incubated with a secondary polyclonal anti-barramundi IgM antibody produced in sheep

(1:1500, shown to cross-react with tilapia IgM in a dot blot) for 1 h at room temperature.

Unbound antibodies were removed by washing membranes in TBST and a tertiary polyclonal anti-goat IgG (cross-reacts with sheep IgG) raised in donkey conjugated to alkaline phosphatase (1:15000) (Sigma Aldrich) was added and incubated for 1 h at room temperature. After removing unbound antibodies by washing, NBT-BCIP Liquid Substrate

System (Sigma Aldrich) was applied to develop the colour. 109 3.2.9. Enzyme linked immunosorbent assay (ELISA)

Antibody responses of tilapia to the recombinant adhesins were evaluated by indirect enzyme linked immunosorbent assay (ELISA) as described previously (Delamare-Deboutteville et al.,

2006). Briefly, four 96-well ELISA high binding plates (Greiner) were coated with each recombinant ST-261 adhesin diluted in carbonate bicarbonate buffer (1 µg/mL) overnight at

4˚C. One plate was coated with mixture of recombinant ST-261 adhesins which containing 0.33

µg/mL of each protein. Plates were washed three times in TBST and blocked with 1% BSA for

4 h at room temperature. Plates were washed again in TBST and anti-sera diluted in TBST

(1:32) were added and incubated for 3 h at room temperature. As a negative control, serum collected from tilapias which were vaccinated with PBS was added to one row of the plates. A secondary antibody, anti-barramundi IgG produced in sheep (1:2000, shown to cross-react with tilapia IgM in a dot blot) was added to wells and plates were incubated for 1 h at room temperature. Then, plates were incubated for 1 h at room temperature with tertiary anti-sheep

IgG raised in donkey conjugated with alkaline phosphatase (1:15000). Before each incubation step with antibody, plates were rinsed thrice in TBST. Finally, plates were washed in TBST five times to remove unbound antibodies and then, washed twice in TBS to remove Tween 20. The colour was developed by p-Nitrophenyl Phosphate Liquid Substrate System (Sigma Aldrich).

The plate was immediately placed in a Fluostar Optima luminometer (BMG Labtech) and the absorbance was read at 405 nm every 30 min for 3 h.

3.3. Results

3.3.1. Identification of ST-261 adhesins and their general domain structures

The conserved domain analysis of amino acid sequences of ST-261 adhesins indicated that these adhesins present typical cell-wall protein characteristics with an LPXTG anchor motif 110 at the C-terminal end (Fig. 3.1) (Novick, 2000). SignalP analysis identified signal peptide sequences at N-terminus suggesting they are exported to the surface in a sec-dependent manner (Schneewind and Missiakas, 2012). The adhesins were named adhesin_0337,

0626, 1196 and 1648 in this study based on gene number in the QMA0271 reference genome (NCBI accession number; CP029632).

Adhesin_0337 comprises 521 amino acids with predicted molecular weight (MW) of 56.4 kDa. Homologues of adhesin_0337 cell surface proteins were encoded by S. sanguinis

(WP_045773392.1), S. gordonii (WP_061586219.1) and S. oligofermentans

(WP_048764222.1) with 49%, 47% and 43% amino acid identities respectively. Analysis of general domain structure revealed that adhesin_0337 contained two streptococcal surface repeat domains (SSURE) which bind to fibronectin (Fig. 3.1) (Bumbaca et al., 2004). These domains were also identified in WP_045773392.1 in S. sanguinis and WP_048764222.1 in

S. oligofermentans. Adhesin_0626 consisted of 512 amino acids with a predicted MW of

54.4 kDa, with 46% amino acid identity with cell surface-anchored protein encoded by S. equi (WP_021321150.1), 43% with S. ictaluri (WP_008089095.1) and 43% with S. dysgalactiae (WP_022554498.1). Adhesin_0626 contained two bacterial immunoglobulin- like 1 domains (Big-1) belonging to the intimin/invasin family (Fig. 3.1). Adhesin_1196 was small, with a predicted MW of 22.3 kDa, comprising 206 amino acids with no similarity to proteins from other streptococci species. Binding domain structures were not identified in adhesin_1196, but it contains a procyclic acidic repetitive protein (PARP) like sequence (Fig.

3.1). Adhesin_1648 predicted size was 43.45 kDa and consisted of 392 amino acids.

BLASTn analysis of adhesin_1648 with other bacterial group revealed a hypothetical protein encoded by Enterococcus faecalis (WP_061100550.1) with 33% amino acid similarity. 111 However, alignment scores were low (< 65). While no binding domain could be found in

adhesin_1648 sequence, a coiled-coil structure was identified (Fig. 3.1).

Signal.PepCde Binding.DomainAdhesin_0337 Signal.PepCdeYSIRK Signal.PepCdeOther.Domain.(insignificant)Signal.PepCde SSURE Binding.Domain Binding.DomainSSURE Binding.Domain LPxRG TransmembraneOther.Domain.(insignificant) Other.Domain.(insignificant)Other.Domain.(insignificant) TransmembraneTransmembrane Transmembrane

Figure1 41 5: A general186 representation266 336 416of six adhesins484 512 domain structures and regions length. The orange Figure 5: A general representation of six Figureadhesins boxes5: AdomainFigure generalon N -5:terminal structures representation A general indicate andrepresentation ofsignalreg sixions adhesinspeptides length. of six suchdomain adhesinsThe as orangeYSIRK, structures domain KxYKxGKxW and structures regions and andlength. reg unknownions The length. orange signal The orange boxes on N-terminal indicate signal peptidesboxes suchonpeptides N boxes-asterminal . YSIRK, The on green Nindicate-terminal KxYKxGKxW boxes signal indicate show peptides the signal andregions such unknown peptides of as bi YSIRK,nding such signal domains asKxYKxGKxW YSIRK, including KxYKxGKxW and streptoc unknownoccal and surfacesignal unknown signal repeat (SSURE) domain, Invasin/Intimin cell-adhesion (Invasin/Intimin) domain, Fibrinogen peptidesSignal.PepCde. The green boxes showBinding.Domain the regionsAdhesin_0626peptides ofbindingSignal_PSignal.PepCde. Thebipeptidesn dingSignal.PepCde Other.Domain.(insignificant) proteingreen .Signal.PepCde domains The boxes (Fib_BP) Big-1 green show includingBinding.Domain domain, boxes theBinding.DomainBig-1 regions show serine streptocBinding.Domain the - ofLPxTGrich regions bioccal repeatndingTransmembraneOther.Domain.(insignificant) surface ofOther.Domain.(insignificant) adhesion domains binding Other.Domain.(insignificant) glycoprotein including domains streptoc including (Ser_adh_Ntrm) occal streptocTransmembraneTransmembrane surface andoccal Transmembrane surface repeat (SSURE) domain, Invasin/Intimin cellFibrinogen-adhesion binding (Invasin/Intimin) domain (Fib_BD). domain, The grey Fibrinogen boxes represent the domains, which have been repeat Figure (SSURE)rep 5:eat A general domain,(SSURE) representation Invasin/Intimin domain, of Invasin/Intimin six adhesins cell -adhes domain ion cell - (Invasin/Intimin) adhesstructuresion and (Invasin/Intimin) reg ions domain, length. FibrinogenThe domain, orange Fibrinogen identified1 30 but with215 low270 confiden301 ce.357 These476 domains516 include Trypansoma brucei procyclic acid Figurebinding 5: proteinA general (Fib_BP) representation domain, of serinesix adhesinsFigure-richboxes 5: repeat domain AFigure generalon adhesionN- terminalstructures 5: representation A general glycoproteinindicate and representation reg signalof ionssix peptidesadhesins (Ser_adh_Ntrm) length. of sixsuch domainThe adhesins as orange YSIRK, structures and domain KxYKxGKxW and structures regions and andlength. regunknownions The length.orange signal The orange bindingrepetitive proteinbinding protein(Fib_BP) protein (Trypan_PARP), domain, (Fib_BP) serine domain, coiled_coil-rich serine repeat and- rich adhesion C repeat-terminal glycoprotein adhesion cell-wall glycoprotein surface(Ser_adh_Ntrm) anchor (Ser_adh_Ntrm) repeat and and peptides. The green boxes show the regions of binding domains including streptococcal surface boxesFibrinogen on N- terminal binding domainindicate (Fib_BD).signal peptides Theboxes such grey (Ctrm_anchor)on Nas boxesboxes-terminal YSIRK, on represent domains.Nindicate -KxYKxGKxWterminal the signal The indicate domains blue peptides and boxessignal, which unknownsuch indicatepeptides as have YSIRK, trasignal such nsmembrane been as KxYKxGKxW YSIRK, domains. KxYKxGKxW and All unknown adhesins and signal unknown have signal Fibrinogenrepeat Fibrinogen binding (SSURE) domain binding domain, (Fib_BD). domain Invasin/Intimin (Fib_BD). The grey cell boxes The-adhes grey represention boxes (Invasin/Intimin) the represent domains the, domain, which domains have Fibrinogen, which been have been Signal.PepCdeSignal.PepCde Binding.Domain Binding.DomainOther.Domain.(insignificant)Adhesin_1196LPxTGSignal_P Signal.PepCdeTraypan_PARPcell-wall anchorOther.Domain.(insignificant) LPxTG (LPxTG) TransmembraneBinding.Domain domains. Other.Domain.(insignificant) Transmembrane Transmembrane peptidesidentified. The but greenwith boxeslow confiden show thece. regions Theseidentifiedpeptides domains ofbinding . bi The butnidentifiedpeptidesding proteinwith green include domains . low boxesThebut (Fib_BP) Trypansoma confidenwith green show including low domain, boxes ce. the confiden Theseregions show streptocbruce serine ce. domains- theirich of procyclicoccal These biregions repeatnding include surface domains adhesion of domains acid bi n Trypansoma ding include glycoprotein including domains Trypansoma bruce streptoc including (Ser_adh_Ntrm)i procyclicoccal bruce streptoc surfacei acid procyclic andoccal surface acid repeat (SSURE) domain, Invasin/Intimin cellFibrinogen Figure1-adhes27 5:29ion A bindinggeneral 109 (Invasin/Intimin) 158representation domain 190 (Fib_BD). of domain, six The adhesins grey Fibrinogen domain boxes represent structures the and domains regions, length.which The have orange been FigureFigure 5: A general5: Arepetitive representationgeneral protein representation of six (Trypan_PARP), adhesins domain of coiled_coilsix structuresrepetitiverep adhesinseat (SSURE) and proteinrepetitiverep regeat C domain- ionsterminal (Trypan_PARP),domain, (SSURE) protein length. cell Invasin/Intimin structures (Trypan_PARP), domain, The-wall orange coiled_coil surface Invasin/Intimin celland coiled_coil anchor- andadhes reg C ion- terminal cellions repeat (Invasin/Intimin)and-adhes length. C cellion-terminal- wall (Invasin/Intimin) surfaceThe cell domain,-wall orange anchor surface Fibrinogen domain, repeat anchor Fibrinogen repeat binding protein (Fib_BP) domain, serinebinding-rich identified2.2boxes repeat protein Aimbinding on adhesion 2 N : but (Fib_BP)-Toterminal proteinwith determine glycoproteinlow indicate domain, (Fib_BP) confiden if thesignal serine adhesinsce. domain, (Ser_adh_Ntrm)peptides These-rich can serine repeat domainssuch induce- richas adhesion YSIRK, include the andrepeat production glycoprotein KxYKxGKxWTrypansoma adhesion of glycoprotein specific bruce(Ser_adh_Ntrm) and i unknown antibodies procyclic (Ser_adh_Ntrm) signal acid and and and boxesboxes on N -onterminal N(Ctrm_anchor)-terminal indicate signal indicate domains. peptides Thesuchsignal blue as YSIRK, peptides boxes(Ctrm_anchor) indicateKxYKxGKxWrepetitivepeptides such(Ctrm_anchor) tra. Thedomains. proteinnsmembrane as greenand YSIRK, (Trypan_PARP), unknown The boxes domains. blue domains. show boxessignal TheKxYKxGKxW the coiled_coil regions blue All indicate boxes adhesins of and bi tra nindicatensmembraneding C - haveterminal domainsand tra nsmembrane cell unknown domains. including-wall surface streptoc All domains. adhesins signal anchoroccal All surface repeat have adhesins have peptides. TheFibrinogen green binding boxes domain show (Fib_BD). the regions TheFibrinogen grey(Ctrm_anchor)theirrep eat boxes ofrolesFibrinogen binding (SSURE) biin represent nbinding domainding domains. binding domain, host the (Fib_BD). domains The cell. domain domainsInvasin/Intimin blue The(Fib_BD). boxes, which including grey indicate cell boxes haveThe-adhes tra grey represent beenionnsmembrane streptoc boxes (Invasin/Intimin) the represent domains. domainsoccal the domain,, All which surfacedomains adhesins have Fibrinogen, which beenhave have been peptides. The greenSignal.PepCdeLPxTG boxes cell show-wall the anchor regionsBinding.Domain (LPxTG) Signal.PepCde of bin dingdomains. Adhesin_1648 domainsLPxTG Other.Domain.(insignificant) YSIRKcell includingBinding.DomainLPxTG-wallSignal.PepCde anchor cell streptoc-wall (LPxTG) Coiled_coil anchoroccal domains.Other.Domain.(insignificant) Binding.Domain (LPxTG) surfaceLPxTG domains.Transmembrane Other.Domain.(insignificant) Transmembrane Transmembrane repeat (SSURE)identified but domain, with low confidenInvasin/Intimince. Theseidentified domainsLPxTGPrevious binding cell butidentified cell protein include-with studiesadhes-wall low (Fib_BP) butanchor showedTrypansoma ion confidenwith (LPxTG) that domain,low (Invasin/Intimin)ce. the confiden domains. These bruce adhesin serine i domains-ce.rich s procyclic of These repeatS. agalactiae include domains adhesion acid domain, Trypansoma such include glycoprotein as pili Trypansoma , bruceFibrinogen can (Ser_adh_Ntrm) i lead procyclic to bruce antibody i acid and procyclic acid repeat (SSURE) domain, Invasin/Intimin cell-adhesion (Invasin/Intimin)FigureFibrinogen1 41 5: A bindinggeneral domain, representation domain246 276 Fibrinogen (Fib_BD).357 of six392 Theadhesins grey domain boxes representstructures theand domains regions ,length. which The have orange been bindingFigure protein 5:repetitive A general (Fib_BP) protein representation (Trypan_PARP),Figure domain, of 5: sixA general adhesins serine coiled_coil representation domain-rich production and structures repeatof C -six terminaland adhesins elicitand adhesion regopsonophagocytosis cell domainions-wall length. structures surface glycoprotein The to anchororange andinduce reg bacteriaions repeat length. (Ser_adh_Ntrm) elimination The orange events such as andrespiratory binding protein (Fib_BP) domain, serine-rich repeat adhesionrepetitive glycoproteinboxesidentified proteinrepetitive on N but- terminal (Trypan_PARP), (Ser_adh_Ntrm)with protein lowindicate confiden (Trypan_PARP), signal coiled_coil ce. and peptides These coiled_coil domainssuch and as C - YSIRK,terminal include and KxYKxGKxW Trypansoma C cell-terminal-wall surface cell bruce and-wall i unknown anchor procyclic surface repeatsignal acid anchor repeat Fibrinogenboxes on(Ctrm_anchor) 2.2 bindingN -Aimterminal 2: To indicate domain domains. determineboxes signal The (Fib_BD). on if peptides theN blue-terminal adhesins boxes such 2.2indicate(Ctrm_anchor) The asindicate canAim YSIRK,peptides2.2burstrepetitive inducesignal grey2 Aim:2.2 (Ctrm_anchor)andTo tra . Aim2 KxYKxGKxW Thensmembrane determinephagocytoticpeptides : domains. protein the boxesTo 2 green determine:production To (Trypan_PARP),such boxes The determineif domains. activityrepresent the as domains. if blue show and adhesins YSIRK, the of by boxesunknown adhesinsif specificThe theimmune the coiled_coil regions All KxYKxGKxW blue can theindicateadhesins cancells adhesins antibodies induce boxessignal of domains induce [ bi147and tra cann dingindicate thensmembrane , C149 have the -induceandterminal production and domains] . production In unknown, tra addition, which the nsmembrane cell including domains. production of-wall ofsignal although specific specific havesurface streptoc All domains. ofthe antibodies adhesinsantibodies specificanchoroccalantibod been All surface repeaties haveantibodies and and adhesinsdo haveand Fibrinogenidentified binding but domain with (Fib_BD). low peptides confiden The grey. The boxesce. green represent These boxesSignal.PepCde rep(Ctrm_anchor) show theeat domains the domains (SSURE)Binding.Domain regions domains. , domain,which include ofOther.Domain.(insignificant) bi n The haveding Invasin/Intimin blue domainsTrypansoma been boxes Transmembrane includingindicate cell-adhes tra ion streptocnsmembrane bruce (Invasin/Intimin)occali procyclic domains. surface domain, All adhesins acid Fibrinogen have peptidesLPxTG. The greencell-wall boxes anchor show (LPxTG) the regions domains. of LPxTG bi n dingtheirnot cell domainsinduce rolesLPxTG-wall in pathogenanchor binding cell including-wall (LPxTG) eliminationhost anchor cell. streptoc domains. (LPxTG) eventoccals , thedomains. surface specific antibody itself to the adhesins is capable to identifiedrepetitive but with proteintheir low roles confiden in (Trypan_PARP), bindingce. Theserep hosteat domainscell. (SSURE) include coiled_coil domain,Figuretheir 5: A generalTrypansoma roles bindingLPxTG Invasin/Intimin representation intheir binding cell protein and rolesof- sixwall bruce adhesins inhost (Fib_BP)anchor C cellbinding domaini -cell. procyclicterminal- adhesstructures(LPxTG) domain, host ionand reg cell. domains. acidions (Invasin/Intimin) serine length. cell -Therich orange-wall repeat adhesion surface domain, glycoprotein Fibrinogen anchor (Ser_adh_Ntrm) repeat and repeat (SSURE) domain, Invasin/Intimin cellFig. -3.1.adhes GeneralFibrinogenPreviousprevention domain (Invasin/Intimin)structures infection studies binding of four showedbecauseST - domain261 adhesins, thatthe domain, (Fib_BD). three antibody the are adhesinconserved Fibrinogenbind The sin ssall greyof GBSto S. adhesinsstrains boxes agalactiae represent and suchblock the as the domains pili bacterial, can, which lead adhesion to have antibody to been the repetitive(Ctrm_anchor) protein (Trypan_PARP), domains. coiled_coil binding The protein blue and C (Fib_BP) boxes-terminalboxes on N-terminal domain, indicate cell indicate- wall signal serine peptides surface - trarich such as nsmembrane repeatYSIRK, anchor KxYKxGKxW adhesion repeat and unknown glycoprotein domains. signal (Ser_adh_Ntrm) All adhesins and have binding Previous protein (Fib_BP) studies showed domain, that serine the- rich adhesin(adhe peptides repeatPrevioussin. _0337,s The of green identifiedproductionhost adhesion0626 S. boxes studiesand Previousand agalactiae 1196) show inhibit and thebut and glycoprotein showed regionsone with studies elicitis establishment specific of bisuch low n thatdingopsonophagocytosis to showed serotype domains confiden as the (Ser_adh_Ntrm) including piliIb adhesin of piscine that ,ce. bacterial streptoccan strains These thes occal of lead(adhesin_1648).to adhesin infection surfaceS.induce domains toand agalactiae s antibody Thebacteria of[ 147 include S.] . agalactiae such Forelimination Trypansoma example, as pili suchevents, the can bruce as pr such leadesence pilii procyclic ,as to can respiratory o antibodyf specific lead acid to antibody (Ctrm_anchor)LPxTG cell domains.-wall The anchor blue boxes (LPxTG)Fibrinogen indicate binding domains. transmembrane domain repetitive2.2 (Fib_BD). Aim domains. 2 : protein To The determine All (Trypan_PARP), grey adhesins boxes if the represent adhesins have coiled_coil can the inducedomains and C - theterminal, which production cell have-wall of been specific surface antibodies anchor repeat and Fibrinogen2.2 Aim binding 2: To domain determine (Fib_BD). if the The adhesins greyrepeat2.2 (SSURE)boxes can Aim burst induce domain, represent2: and2.2 To Invasin/Intimin Aimphagocytotic the determine production the2 : cell To-adhes domains if determineionactivity the (Invasin/Intimin) of adhesins, by which specific ifimmune domain, the canhave adhesins Fibrinogen antibodiescells induce been [147 can , the 149 and induce production]. In addition, the production of although specific the of antibodies antibod specificies antibodiesand do and LPxTG cell-wall anchorproduction (LPxTG) and domains.elicitidentified opsonophagocytosis but withorangebinding lowproduction tobox protein confidenrepresentsinduce (Ctrm_anchor)antibodiestheir (Fib_BP) production androlesthe domain,bacteriace. signal elicit to in Theseserine peptide PhtDbinding - rich domains.opsonophagocytosis andelimination at repeat and domainsN- terminus elicit host adhesionPhtE, The cell.including opsonophagocytosis glycoprotein member include events blue YSIRK (Ser_adh_Ntrm) boxes -of typeto Trypansomasuch adhesin induceand indicateunknown as and Phtbacteria respiratoryto signal familyinduce tra bruce nsmembrane elimination inibacteria S. procyclic pneumonia domains.elimination events acide, significsuch All events as adhesinsantly respiratory such reduced have as respiratory Fibrinogen bindingLPxTGnot domain induce (Fib_BD).cell - pathogenwall The greyanchor boxes elimination represent(LPxTG) the domains eventdomains., whichs, the have specific been antibody itself to the adhesins is capable to identifiedtheir but roles with in lowbinding confidenrepetitive host cell.ce. These protein domainspeptide. (Trypan_PARP),their The green rolesS.Previous include box pneumoniae inrepresentstheir binding studies coiled_coilTrypansoma roles the binding binding hostin showed domains,binding cell. and to bruceincluding that human host C - theterminal SSUREi cell. procyclic epithelial adhesin domain, cell Bigs -of cells1.- acidGreywall S. boxes by agalactiae surface blocking anchorsuch interaction as repeat pili , of can the lead PhtD to and antibody PhtE 2.2 Aimrepetitive 2:burst To protein and determine phagocytotic (Trypan_PARP),(Ctrm_anchor) ifactivity the coiled_coil by adhesins immune domains.identified burst and cells but The andwith C canprevent- [terminal low 147phagocytotic blueburst confiden induce,infection 149 boxesce.and These] cell .phagocytotic In domainsbecauseactivity-indicate wall addition, the include surface theby Trypansoma productiontra activity immuneantibodyalthoughnsmembrane anchorbruce by i cellsbind procyclic theimmune ss [ repeat 147antibod acid domains. to of ,adhesins cells149 specificies] . [In147 All doand addition, , adhesins 149block ]. antibodies In thealthough addition, havebacterial the although adhesion antibod and theiesto thedoantibod ies do Previous studies showed that the adhesinindicaterepetitives putative proteinofadhesins production domainsS. (Trypan_PARP), agalactiae identified with and coiled_coil with theirelicit low such confidence. and respective opsonophagocytosis C-terminal as The pili cell analysis - hostwall, can surfacerevealed receptors anchor lead t htoes e repeat induce domains to[150 antibody most] .bacteria S treptococci elimination carry events multiple such adhesins as respiratory on the their roles(Ctrm_anchor) in binding domains. host TheLPxTG cell. blue cell boxes-wall indicate anchor(Ctrm_anchor)Previous (LPxTG) tra domains.2.2hostnsmembrane Aim studiesand Previous The domains. blue2 inhibit: To boxes showed determine studiesindicate establishment domains. tra thatnsmembrane showed if the the All ofdomains. adhesin adhesins that bacterial adhesins All thes adhesins of can adhesininfection S. have have induce agalactiaes [of147 the S.]. production For agalactiaesuch example, as pili ofsuch , t specifiche can pr as esence lead pili antibodies , to cano f antibody specific lead and to antibody 2.2 Aim 2: To determinenot induce if the pathogen adhesins elimination can induce event thesimilars, not production the to T inducerypanosoma specificsurfaceburst not pathogenandbrucei to of antibodyinduce phagocytoticPARPadhere specific (Trypan_PARP) elimination pathogento specific itself antibodies activity and a to elimination coiledhost event the by- coilreceptors immunes and adhesinsregion., the The event specific [ bluecells147 box iss], . [indicate theDeletion capable147 antibody , specifics 149 ] of.to In itselfcertain antibodyaddition, to adhesins the although itself adhesins can to resultthe the is antibod adhesins capablein reducingies isdoto capable to LPxTG cell-walltheir anchor (LPxTG)roles domains.in binding host cell. LPxTGproduction cell-wall anchor and elicit (LPxTG) opsonophagocytosis domains. to induceantibodiespathogenesis bacteria to PhtD of elimination bacteria and PhtE, [147 memberevents]. For instance, ofsuch adhesin as deletion respiratory Pht family of fib in rinogen S. pneumonia-bindinge, signific adhesinantly FbsC reduced genes theirPrevious roles in binding studiesprevent host cell.infection showed because that the the antibody adhesintransmembrane bindproductionsss not domainsto ofadhesins induce productionand with S. LPXelicit pathogen TG agalactiae celland opsonophagocytosis- walland anchorblock eliminationelicit motif. the opsonophagocytosis bacterial such event tos, induce the asadhesion specific pilibacteria to induce , antibodyto can theelimination bacteria itself lead to eliminationevents the to adhesins such antibody events as is respiratory capable such asto respiratory preventPreviousS. infection pneumoniaeprevent studies because infection binding showed the because to antibody that human the the epithelial adhesinbind antibodyss sto of cellsadhesins bindS. by agalactiaess blockingto and adhesins block such interaction theand as pilibacterialblock , of can thethe leadadhesion PhtDbacterial to and antibody to adhesion PhtE the to the production burst and and elicit phagocytotic opsonophagocytosis2.2 activity Aim 2 :by To immune determine2.2 Aim cells 2: Toto if determinefbsCprevent [ the147induce from ifadhesins, the149infection adhesinsS.] agalactiae. bacteriaIn can can because addition, induce induce thecaused productionthe althoughelimination antibody thedecrease of specific production antibodies bindthein bacterial ssantibod and to of eventsadhesins specificadhesionies do and antibodiestosuch block fibrinogen theas bacterial and [respiratory164 ]. This adhesion section to willthe Previous studies showedhost and that inhibit the establishmentadhesins of S. of agalactiae bacterial burst infectionsuch andproductionadhesins phagocytotic asburst pili[ 147with andand, ] can. their elicitphagocytotic For activity lead respective opsonophagocytosis example, to by antibody immune activity host the receptors pr by cellsesence toimmune induce[ 147[150 o,f ] 149cells.bacteria specific Streptococci]. [In147 addition,elimination , 149 carry]. In although eventsaddition, multiple such the adhesinsalthough antibodas respiratory oniesthe the doantibod ies do their roles in bindingtheirhost roleshost in and bindingcell.determinehost inhibithost hostand cell. inhibit andif establishment the inhibit six establishment adhesins establishment of from bacterial of bacterialS. agalactiae of infection bacterial infection and [ 147 infection putative[147]. For]. For secreted[ example,147 example,]. For and t he example, tsurfacehe pr presenceesence proteins the o of pr f specific esence specificfrom S. of specific burst 2.2and Aim phagocytoticnot 2 : induceTo determine pathogen activity if elimination the adhesins by eventimmune cans , induce the specific burstsurfacecells the and production to antibody[ phagocytotic147adhere, to 149 itselfspecific of activity specific] to. host In the by receptors addition, adhesinsantibodiesimmune [cells147 is ] and . capable[ althoughDeletion147 , 149 ]toof. In certain addition, the adhesins antibod although can resulttheies antibod in doreducingies do production and elicitantibodies opsonophagocytosis to PhtD and PhtE,to induce member bacteria of3.3.2.Previous adhesinnot STelimination studies- 261 induce iniaeantibodies Adhesin showed Pht cannot pathogen that andfamily theevents elicitcpsE induce to adhesin PhtDexpression functional ins elimination ofsuch pathogen S.S.and agalactiae spneumonia arePhtE,as affectedantibodies respiratorysuch eliminationmember event as by pili culturee, s, can,in signific theof lead fisconditions adhesin h toevent specific and antibodyantly stheir , Pht the antibody reducedrolesfamily specific in in adhesion itself S. antibody pneumonia to will the itself be adhesinse ,investigated. signific to the isantly adhesins capable reduced to is capable to not inducetheir roles pathogen in binding host elimination cell.Previous studies event showedsantibodies, the thatnotpathogenesis specific induce thetoantibodies PhtD adhesin pathogen and of to bacteria sPhtE, antibodyPhtDof elimination S. member and [ agalactiae147 PhtE,]. For of event itself memberadhesin instance, ssuch, the to Phtof asspecific deletion adhesin pili thefamily, antibody can of adhesins inPht fib S. lead familyrinogen pneumonia itself to in antibody- tobinding S. is the epneumonia , capableadhesinssignific adhesin antly e is, FbsC signific capable reducedto genes antlyto reduced prevent infection because the antibody productionbindpreventss and toelicit S. infection adhesins pneumoniaeopsonophagocytosisprevent because andinfection to binding induce block bacteriathe because to antibodyelimination the human bacterial eventsthe epithelialbind suchantibody asss respiratoryadhesion to cellsadhesins bind by ssto blocking toandthe adhesins block interaction theand bacterial block of the the adhesionPhtD bacterial and to PhtEadhesion the to the burst and phagocytoticS. pneumoniae activity by immune bindingproduction cells to human [ 147and, elicit epithelial149] .opsonophagocytosis In addition, cellspreventfbsC from by infectionalthough blockingS. agalactiae to because inducethe interaction antibodcaused thebacteria antibody decreaseies of doelimination the bindin bacterialPhtDss to adhesinsevents and adhesion PhtE such and to asblock fibrinogen respiratory the bacterial [164 ]. This adhesion section to willthe preventPrevious infection studies showedbecause that the the adhesinantibodys ofStreptococcusburst S. andbind pneumoniaephagocytoticagalactiae2.adhesins agalactiass2.1 activityS. Cloningto pneumoniaestrain by withsuch binding immuneadhesins QM and their A0285cells as expression [ to147 pilirespective showed , binding149 human,]. In canand differentaddition, of epithelial to host leadadhesins although growth humanblock receptors tothe rates antibod in cellsantibody epithelial whenE.iesthe colido[ by150 grown ] blockingbacterial . in cells S treptococci by interaction blocking carryadhesion multipleinteraction of the PhtD adhesinsto of andthe the on PhtEPhtD the and PhtE host and inhibit establishment of bacterialhost infection andhostdetermine inhibit andhost [147 inhibit if and establishment ]the. For inhibitsix establishment adhesins example, establishment of from bacterial of the bacterialS. pragalactiae ofesence infection bacterial infection oandf [ 147 specific infectionputative[147]. ] For. For secreted example,[147 example,]. Forand t he t example,surfacehe pr presenceesence proteins the o o ff pr specific specificfromesence S. of specific nothost induce and pathogen inhibitadhesins elimination establishment with eventtheir sburst respective, the and specific ofphagocytotic host bacterial antibody receptorsnot induceadhesins activity pathogen itself Tosurface[ infection150 eliminationwith determine byadhesins to]. immuneto the S their eventadheretreptococci adhesinss if, thewithrespective the [ specificcellsto147 adhesins specific their antibody[ 147 is carry] . respectivehost capable itself, hostcan For149 to multiple receptors elicit thereceptors]. adhesinsIn example,to antibodies hostaddition, is capable adhesins[ [147150 receptors ]to]. .inDeletionalthough S fitreptococci tsh onhe[,150 candidate theof pr]the .certain S esence treptococciantibod carry genes adhesins multipleies will odo carry becanf expressed specific adhesinsresult multiple in reducing in on E.coli adhesins the on the productionantibodies and elicit to PhtD opsonophagocytosis and PhtE, member to induceofdifferent adhesin culturebacteriaantibodiesiniae Phtconditions can family elimination elicit(Fig. to PhtD3.2). infunctional TheS. and additionpneumonia events PhtE, antibodies of metals membersuch (manganesee, significasin of fisrespiratory adhesinh andandantly zinc) their Pht did reduced notrolesfamily in in adhesion S. pneumonia will bee ,investigated. significantly reduced prevent infection becausesurface tothe adhere antibody to specific notbind inducess hostto adhesins pathogen receptorsprevent and eliminationantibodies infection[147 blockusingpathogenesis ]because. Deletion to antibodies thethe event PhtD antibody Championbacterials ,and ofbindof the ss bacteriatocertain toPhtE, specificPhtDadhesins pET10adhesion member and[adhesinsand1471 block antibodyexpression ]PhtE,. the Forto bacterialof the canmemberadhesin instance, adhesion itselfsystem result to Pht of tothe deletion (Invitrogen) inadhesin thefamily reducing adhesins of inPht fib S.[ 131 rinogenfamily pneumonia is]. capableThe -inbinding primersS. epneumonia , tosignific adhesin will beantly e FbsCdesigned, signific reduced genes antlyto reduced antibodies to PhtD and PhtE, member ofsurface adhesinS. to pneumoniae adheresurface Pht to to specific adherefamily binding hostto to specific humaninreceptors S. host epithelialpneumonia [ 147receptors]. Deletion cells [ by147 blockinge]of., Deletion certainsignific interaction adhesins of certainantly can of adhesins the resultreduced PhtD in can reducing and result PhtE in reducing burst and phagocytotic activity by immune cellsaffecthost [and147 the inhibit growth, 149 cutfbsC establishment compared ] off.from In of signaladdition, to bacterialS. THB agalactiae culture infection sequences (Fig.although [147 caused3.2).]. For On example, and the decreasethe other the transmembram antibod pr hand,esence in the o fbacterial specific growthies do ratee adhesion regions.of toTo fibrinogen identify [164 signal]. This peptides section will and S. pneumoniae bindingprevent to human infection epithelial because cellstheadhesins antibody by blockingwith bind theirss interaction respectiveto adhesins host of and receptors the block PhtD the[150 and bacterial]. S PhtEtreptococci adhesion carry to multiple the adhesins on the hostS. and pneumoniae inhibit establishmentpathogenesis binding of of bacterial bacteria to human infection[147]. For [ epithelial147 instance,antibodies]. S. For pneumoniaeto PhtD example,2.transmembrane deletion and2.1 cellsPhtE, CloningS. member pneumoniae binding of t he of by andadhesin fib pr regions, rinogenesenceexpression Pht blocking to family binding human in protein- oS.binding fpneumonia of specific epithelialadhesins to sequencese human,interaction signific adhesin antly in cells epithelialE.reduced of coli FbsC by the blocking adhesins cells genes of by the interaction from blocking PhtD S. agalactiae interaction of and the PhtD ST PhtE of- 261 and the strain PhtEPhtD and PhtE not induce pathogen elimination events, the specificpathogenesis antibodydeterminepathogenesis of if itself bacteria the six to of adhesins[ the147 bacteria ] adhesins. For from [ instance,147 S. is] agalactiae. For capable deletion instance, andto ofputative deletion fibrinogen secreted of - fibbinding rinogenand surface adhesin-binding proteins FbsC adhesin from genes S. FbsC genes adhesins with their respectivehost and inhibit host receptors establishmentQMA0285S. pneumoniae cultured [surfaceTo binding150 determine of in] to. T human bacterialBto S treptococci without adhere epithelial if glucosethe cellsto infection adhesinsspecific by (carbohydrate blocking carry hostinteraction[can147 multiple limited) elicitreceptors]. of For the wasantibodies PhtD example, reduced adhesins [ and147 PhtE] while. inDeletion fi t thehe onsh , prcandidate the ofesence certain genes o fadhesins specific will becan expressed result in reducingin E.coli antibodiesadhesins to PhtD with fbsCand PhtE, from their memberS. agalactiae respective of adhesin caused hostPht decrease family receptors inadhesinsin bacterialS. pneumoniaQMA0271iniae with adhesinscan[ adhesion150 theirelicit wille], .significfunctional respectivewith be Sto analyzedtreptococci fibrinogen theirantly antibodies host respective by reduced SignalP receptors [164 in fis host] carry. 4.1hThis and[ 150 receptorsServer theirsection] . multiple S treptococci[roles165 [ 150]will inand ]adhesion. STMHMM treptococci carry adhesins will multiple Serverbe investigated. carry v. adhesins on multiple2.0 [ the166 on] . adhesins The the on the prevent infection because the antibody bindss adhesinstofbsC adhesins with from theirpathogenesisusing respective S. fbsC andthe agalactiae host Champion fromblock receptors of S. bacteria [the 150causedagalactiae pET10]. Sbacterialtreptococci [ 147decrease1 expression carry]caused. For multipleadhesion in instance, decrease adhesinsbacterial system onto thedeletion (Invitrogen)in theadhesion bacterial of fibto [adhesion 131rinogenfibrinogen]. The-binding to primers [fibrinogen164 adhesin] .will This be [ section164 FbsCdesigned]. This genes will to ®section will surface to adheresurface to toadhere specific to specificantibodies host host to receptorsreceptors PhtD and [PhtE,147 []adhesins 147. memberDeletion]. sequencesDeletion of of adhesin certain will Pht adhesinsbeof familyamplified certain incan byS. result pneumonia theadhesins primers in reducing e(Table, signific can 3) andantlyresult cloned reduced ininto reducingpET101/D-TOPO S. pneumoniae bindingdetermine to human if the six epithelial adhesins cells from by S. blocking agalactiae surfacesurface to adhere interactionfbsCcut to to specificand adhere offfromsurface hostputative signalreceptors S. to of agalactiaeto specific [ 147 theadhere sequencessecreted]. Deletion 112PhtD hostcausedto of certainspecific and andreceptors and adhesinsdecrease surface PhtE transmembram hostcan result [ 147 inreceptors in™ proteins bacterialreducing]. Deletion e [ 147adhesionfrom regions. of]. Deletion certainS. toTo fibrinogen adhesins identifyof certain [ can164 signal adhesins ]result. This peptides insection can reducing result will and in reducing host and inhibit establishmentS. ofpneumoniae bacterial bindinginfectiondetermine to [ 147vector, human2.2.1 ]ifdetermine .Cloning the Forthen epithelial six example,express andadhesins if expressionthe ed cells sixin the from E. byadhesins coli pr of blockingS.esence BL21adhesins agalactiae from Star ointeraction f in S. specific E.(DE3) agalactiaeand coli putative by offollowing and the secreted PhtDputative manufacture andand secreted surface PhtE protocol. and proteins surface from proteins S. from S. pathogenesispathogenesis of bacteria of bacteria [147 [147].] . ForFor instance, instance,pathogenesis of deletion determinetransmembrane bacteria [ deletion147] . For ofif instance,the fib regions,sixrinogen deletion adhesins of of fib- protein fibbindingrinogen fromrinogen-binding sequencesS. adhesin agalactiae FbsC- binding genes of FbsC and the putative adhesins genes adhesin secreted from S. and agalactiae FbsC surface proteins genesST-261 from strain S. adhesins with theiriniae respective can elicit host functional receptors antibodies [150]. S intreptococci fispathogenesish andTo their carry determinepathogenesis roles of multiple bacteria inif theadhesion adhesins of adhesins[147 bacteria]. will Forcan on elicitbe[ instance,147 theinvestigated. ]antibodies. For deletion instance, in fi ofsh , deletion fibcandidaterinogen of genes- binding fibrinogen will adhesinbe- bindingexpressed FbsC adhesin in genesE.coli FbsC genes antibodies to PhtD and PhtE,adhesins member withof adhesin theirfbsC respective iniaePht from S. family agalactiaecaniniaeQMA0271 elicit hostcausediniae canin decreasefunctionalS.elicit receptors can willpneumonia inelicitfunctional bacterialbe analyzed antibodies functional[adhesion150e antibodies,] to .signific fibrinogen Sbytreptococci inantibodiesSignalP fis[164 antlyinh]. Thisfisand 4.1 hsection reduced andtheirin carry Server willfis their hroles multipleand [roles165 intheir ] adhesion inand adhesion adhesinsroles TMHMM in will adhesionwill on be Server be theinvestigated. investigated. will v. 2.0be investigated.[ 166 ]. The fbsC from fbsCS. agalactiae from S. agalactiae caused caused decrease decrease in bacterialin bacterial using adhesionthe Champion adhesion to fibrinogenpET101 expression to [164 fibrinogen]. systemThis section (Invitrogen)28 [ 164will [131]. ]This. The primers section will be willdesigned to surface to adhere to specific host receptors [147]. Deletion offbsC certain from adhesins S.fbsC agalactiae from can S. caused resultagalactiae indecrease reducing caused in decrease bacterial inadhesion bacterial to adhesion fibrinogen to [fibrinogen164]. This [section164]. This will® section will surface to adhere todetermine specific if the adhesinssixhost adhesins receptors from sequences S. agalactiae [147 and will ]putative. Deletion be secreted amplified and of surface certain by proteins the from adhesinsprimers S. (Table can result 3) and in cloned reducing into pET101/D-TOPO determineS. pneumoniae determineif the six binding if the adhesins six to adhesins human from epithelial from S.S. agalactiae cellsagalactiae by cut blocking and off putative and signal interaction putativesecreted sequences of and the andsecreted surface PhtD transmembram andproteins and PhtEe from regions.surface S. To proteins identify signal from peptides S. and pathogenesis of bacteria2.2.1 Cloning [147]. Forand instance,expression deletion of adhesins ofiniae fib determinecaninrinogen elicit E. functional 2.vector,coli2.1 -if Cloningbindingdetermineantibodies thethen six inexpress fis and hadhesins adhesinand if expressiontheir theed roles in six infromE. FbsCadhesion adhesinscoli of S. will adhesinsBL21 genesagalactiae be investigated. from Star in ™S. E.(DE3) andagalactiae coli putative by following and secreted putative manufacture and secreted surface protocol. and proteins surface from proteins S. from S. pathogenesis of bacteria2.2.1 [ 147Cloningtransmembrane]. For and instance, expression regions, deletion of protein adhesins of sequencesfib inrinogen E. coli -ofbinding the adhesins adhesin from FbsC S. genes agalactiae ST-261 strain iniae adhesinscan elicitiniae with can functional their elicit respective functional antibodies host antibodies receptors in in fis [ 150fish and]h. SandTo theirtreptococci determine2. roles2.1their Cloning in if carry adhesionrolesthe adhesinsand multiple expressionin will canadhesion be elicit adhesins investigated. of antibodies adhesins onwill thein fiE. besh coli, candidateinvestigated. genes will be expressed in E.coli QMA0271 will be analyzed by SignalP 4.1 Server [165] and TMHMM Server v. 2.0 [166]. The fbsC from S. agalactiaeTo determine caused decrease if the adhesinsfbsC in bacterial from can S. elicit agalactiaeadhesion antibodies2.2.1 iniaeCloning causedto andfibrinogencanusing expression in elicitdecrease iniaethefi shof adhesinsfunctionalChampion, cancandidate[164 in in elicit E. bacterial] coli. This pET10antibodies functional genes section 1adhesion expression will in antibodies willfis be hto expressedand systemfibrinogen theirin fis (Invitrogen) rolesh inand [164 E.coliin their ]adhesion. This[ 131 roles ]section. The inwill adhesion primers be will investigated. willwill bebe designed investigated. to To determineTo ifdetermine the adhesins if the can adhesins elicit antibodies can elicit inantibodies fish, candidate in fish ,genes candidate will begenes expressed will be in expressed E.coli® in E.coli surface to adhere to specific host receptors [147]. Deletion adhesins of certain sequences adhesins will be can amplified result by in thereducing primers28 (Table 3) and cloned into pET101/D-TOPO determine if the sixusing adhesins the Champion from S. agalactiae determinepET101 expression andif the putative sixTo adhesins determinesystem secreted if thecut (Invitrogen)fromadhesins off and can S. elicit signal agalactiaesurface antibodies [131 sequences in proteinsfish] ,.and candidate The putative genes andprimers from will transmembram be S.expressedsecreted will in beE.coli and designed e surface regions. to proteins To identify from S. signal peptides and 2.2.1 Cloning and expression of adhesinsusing in the vector,E. Champion usingcoli then the express pET10Championed 1in expression E. pET10 coli BL211 expressionsystem Star™ (DE3)(Invitrogen) system by following (Invitrogen) [131]. manufactureThe [primers131]. Theprotocol. will primers be designed will be to designed to pathogenesis2.2.1 Cloning of bacteria and expression[147]. For of instance, adhesins using deletion in the E. Champion colitransmembrane of pET10 fib1 expressionrinogen system regions,-binding (Invitrogen) protein[131 adhesin]. The primers sequences will FbsC be designed genesof to the adhesins from S. agalactiae ST-261 strain iniaeTo can determine elicit functionalcut if off theantibodies signal adhesins in sequences fisiniaeh and cancan their elicit and elicit roles functional transmembram antibodiesin2. adhesion2.1 antibodies Cloning e will2.2.1 regions. and inin be Cloning fis expression fiinvestigated.hsh andTo, and theircandidate identifyofexpression rolesadhesins in signaladhesion ofin genes adhesinsE. coli peptides will willin be E. investigated. coli be and expressed in E.coli cut cut off signal off QMA0271 sequences signalcut and off transmembramwill sequences signalbe analyzede regions. sequences and To by identify transmembram SignalP signal and peptides4.1 transmembram Server e and regions. [165] eand To regions. TMHMM identify To Server signal identify v. peptides2.0 signal[166] . andThe peptides and fbsC fromTo determineS. agalactiae if the caused adhesins decrease can elicitin bacterial antibodies adhesion in fish to, candidate fibrinogen genes [164 will]. This be sectionexpressed will in E.coli using the Championtransmembrane pET10 regions,1 proteinexpression sequencestransmembraneTo system determine of adhesins regions, the To protein (Invitrogen)if adhesins determinesequences the sequences adhesins of the fromwillif adhesinsthe canbe adhesins S. fromamplified elicit[ 131 agalactiaeS. agalactiae antibodies can] by. STThe elicitthe-261 STprimers strain inantibodies primers-28 fi261sh , (Table candidate strain in fi3 will)sh and genes, candidate cloned be will designedinto be genes expressed pET101/D will be in- toTOPOexpressed E.coli ® in E.coli determine if the six adhesins from S. agalactiae transmembraneand putativetransmembrane secreted regions, and protein regions, surface sequences proteinproteins sequencesof from the S. adhesins of the from adhesins S. agalactiae from S. agalactiaeST-261 strain ST- 261 strain cut off signalusing the Champion sequences pET102.2.1 Cloning1 and expression and transmembram expressionQMA0271 system will vector, be(Invitrogen) analyzedof adhesins thenby SignalPe express 4.1 in[ regions. 131Server E.ed coli][165. in The] andE. TMHMMcoli primers BL21To Server v.Starwill 2.0 identify [™166 be(DE3)]. The designed by following signal to manufacture peptides protocol. and 2.2.1 Cloning and expressionQMA0271 ofwill adhesins be analyzed in E. coli by SignalPadhesins using4.1 sequences Server the will Champion beusing amplified[165 the ]by andthe pET10Champion primers TMHMM (Table1 expression 3) pET10and cloned Server into1 systemexpression pET101/D v. -TOPO 2.0(Invitrogen)® system[166]. (Invitrogen)The [131 ]. The primers[131]. The will primers be designed will be to designed to iniae cancut elicit off functional signal sequences antibodiesTo determine in and fis hif transmembram andthe adhesinstheirQMA0271 roles cane in QMA0271 willelicit regions.adhesion be antibodies analyzed will willTo be bein identifyby analyzed fiinvestigated. SignalPsh, candidate signalby 4.1 SignalP Server genes peptides 4.1 [will165 Server] be and and expressed TMHMM[165] and in ServerE.coliTMHMM v. 2.0Server [166 v.]. The2.0 [166]. The transmembrane regions, protein sequencesvector, then express ed ofin E. coli BL21 the Star ™(DE3) adhesins by following manufacture from protocol. S. agalactiae® ST-261 strain To determine if theadhesins adhesins sequences can elicit antibodieswill be amplified in fish, candidateby cutthe primers off genes signalcut (Table will off sequences be signal3 expressed) and sequences andcloned in transmembram E.coli into and pET101/D transmembrame regions.-TOPO e To regions. identify To signal identify peptides signal and peptides® and® using the Champion pET10adhesins1 expression sequencesadhesins systemwillsequences be (Invitrogen)amplified will be byamplified [the131 primers]. The by 28primersthe (Table primers will3) and (Table be cloneddesigned 3) andinto to cloned pET101/D into -pET101/DTOPO -TOPO QMA0271transmembrane will be analyzed regions, proteinby SignalP sequences ™4.1 of theServer adhesins [165 from] andS. agalactiae TMHMM ST-261 Server strain v. 2.0 [166]. The using the Championvector, pET10 then1 expression expressed system in E. coli (Invitrogen) BL21 Startransmembrane [131(DE3)]. The bytransmembrane primers following regions, will manufacture protein be regions, designed sequences protein protocol. to™ sequencesof the ™ adhesins of the from adhesins S. agalactiae from S. agalactiaeST-261 strain ST- 261 strain adhesins2.2.1 sequencesCloning and expression will becut of adhesinsamplified off signal in E. sequences colibyvector, the then andprimersvector, express transmembram thened (Tablein express28 E. colieed BL21 regions. in3 )E. Starandcoli ToBL21(DE3) cloned identify Star by following(DE3) into signal by manufacture pET101/Dfollowing peptides manufacture andprotocol. -TOPO protocol.® QMA0271 will be analyzed by SignalP 4.1 Server [165] and TMHMM Server v. 2.0 [166]. The cut off signal sequences and transmembramtransmembranee regions. regions,QMA0271 To protein™ identify QMA0271 will sequences be signalanalyzed will of be peptides theby analyzed SignalP adhesins and by4.1 fromSignalP Server S. [4.1 agalactiae165 Server] and TMHMM [165ST-]261 and strainServerTMHMM v. 2.0 Server [166 ]v.. The2.0 [166]. The vector,To then determine express if the adhesinsed in E.can colielicit antibodiesBL21 Star in fish,(DE3) candidate by genes following will be expressed manufacture in E.coli protocol.® adhesins sequences will be amplified by the primers (Table 3) and cloned into pET101/D-TOPO ® ® transmembrane regions, protein sequencesQMA0271 of the will adhesins be analyzedadhesins from by sequences S.SignalPadhesins agalactiae 4.1willsequences Serverbe STamplified- will261[165 be] strain byand amplified the TMHMM primers by the (TableServer primers 3v.) and 2.0(Table cloned[166 3]). andintoThe cloned pET101/D into- TOPOpET101/D -TOPO using the Champion pET101 expression system (Invitrogen)™ 28 [131]. The primers will be designed to vector, then expressed in E. coli BL21 Star (DE3) by following manufacture protocol.28 28 ® QMA0271 will be analyzed by SignalPadhesins 4.1 Server sequences [165] willand beTMHMM amplified Server by the v.primers 2.0 [ 166(Table]. The 3)™ and cloned™ into pET101/D-TOPO vector, thenvector, express28 thened in express E. colied BL21 in E. Star coli BL21(DE3) Star by following(DE3) by manufacture following manufacture protocol. protocol. cut off signal sequences and transmembrame regions. To identify™ signal peptides and adhesins sequences will be amplified byvector, the primers then express (Tableed in3) E.and coli cloned BL21 Starinto pET101/D(DE3) by following-TOPO® manufacture protocol. transmembrane regions, protein sequences of the adhesins from S. agalactiae ST-261 strain vector, then express ed in E. coli BL21 Star™(DE3) by following manufacture28 protocol. QMA0271 will be analyzed by SignalP 4.1 Server [165] and TMHMM Server v. 2.0 [166]28. The 28 28 adhesins sequences will be amplified by the primers (Table 3) and cloned into pET101/D-TOPO® vector, then expressed in E. coli BL2128 Star ™(DE3) by following manufacture protocol.

28 addition of glucose increased the growth (Fig. 3.2). In addition, while bacteria reached stationary phase in THB, THB with metals and TB cultures after 24 h, the stationary phase for QMA0285 grown in TB with glucose was not observed after 30 h of incubation (Fig. 3.2).

The effect of changing the culture environment on expression of cpsE and ST-261 adhesin genes was investigated by real-time qRT-PCR. Carbohydrate limitation (growth in TB) increased relative expression of ST-261 adhesins whilst decreasing expression of cpsE compared to culture in THB (Fig. 3.3). The expression of adhesin_0337, 0626 and 1648 were up-regulated by 12.5 (p < 0.005), 4.8 (p < 0.05) and 9.2-fold (p < 0.05) respectively when grown in TB compared to THB (Table 3.3). Addition of glucose to TB culture increased both ST-261 adhesins and cpsE expression relative to expression in THB (Fig. 3.3).

However, only adhesin_0337 and 1648 were increased significantly, which adhesin_0337 was upregulated by 12.4-fold (p < 0.05) and adhesin _1648 were increased by 9.2-fold compared to the reference condition. Relative expression of ST-261 adhesins and cpsE was lower than in THB when metals were added to THB culture during mid exponential growth

(Fig. 3.3), with 8.4-fold (p < 0.005) decrease in expression of adhesin_0626, a 2.7-fold (p =

0.005) decrease in expression of adhesin_1196, a 5.6-fold (p < 0.005) decrease in expression of adhesin_1648 and a 13-fold (p < 0.005) decrease in cpsE expression (Table

3.3).

113 1.05 1.00 0.95 0.90 0.85 0.80 THB THB + Mn&Zn 0.75 TB 0.70 TB + Glucose 0.65 0.60 0.55 595 nm 0.50 OD 0.45 0.40 0.35 0.30 0.25 0.20 0.15 0.10 0.05 0.00 0 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 Time (Hour)

Fig. 3.2. Growth of S. agalactiae strain QMA0285 in different culture media. Bacteria was grown in four different cultures 1/ THB (in Red), 2/ THB + 5 µM Mn(II)SO4 and 100 µM Zn(II)SO4 (THB + Mn&Zn in Blue), 3/ TB without glucose (TB in Green) and 4/ TB + 55 mM glucose (TB + Glu in Pink).

114 A B C 6 6 6 5 5 5 ** * 4 4 4 Scale Scale Scale 2 2 2 3 3 * 3 2 2 2 1 1 1 0 0 0 -1 -1 -1 -2 -2 -2 ** Expression Ratio in Log Expression Ratio in Log Expression Ratio in Log -3 -3 -3 *** -4 -4 -4

THB + Metals TB + Glucose THB + Metals TB + Glucose THB + Metals TB + Glucose TB w/o Glycerol TB w/o Glycerol TB w/o Glycerol D E 6 6 5 5

4 * * 4 Scale Scale 2 2 3 3 2 2 1 1 0 0 -1 -1 -2 -2 Expression Ratio in Log Expression Ratio in Log -3 *** -3 -4 -4 ***

THB + Metals TB + Glucose THB + Metals TB + Glucose TB w/o Glycerol TB w/o Glycerol

Fig. 3.3. Relative expression of GBS QMA0285 adhesins and cpsE genes under three different culture conditions. Up- or down-regulations of genes are shown relative to expression in Todd-Hewitt broth

(THB) during exponential growth. A) Expression ratio of adhesin_0337 (Log2). B) Expression ratio of adhesin_0626 (Log2). C) Expression ratio of adhesin_1196 (Log2). D) Expression ratio of adhesin_1648

(Log2). E) Expression ratio of cpsE (Log2). * p < 0.05, ** p < 0.01, *** p < 0.001 (n = 9).

Table 3.3. Relative expression of QMA0285 adhesins and CpsE genes under three different culture conditions. Up- or down- regulation of genes relative to the expression in bacteria cultured in Todd- Hewitt broth (THB) during exponential growth.

Conditions adhesin_0337 adhesin_0626 adhesin_1196 adhesin_1648 CpsE TB w/o glycerol 12.483 4.773 3.998 8.614 -1.46 TB + glucose 12.422 5.638 5.135 9.215 1.008 THB +Mn & Zn -2.078 -8.395 -2.701 -5.580 -13.0 note 1: the values in red indicate statistically significant up-regulation of the genes. note 2: the value in blue show statistically significant down-regulation of the genes.

115 3.3.3. Serum antibody against recombinant ST-261 adhesins reacted with the vaccine antigens except for antisera against adhesin_1196

In order to determine whether tilapia responded to vaccination with recombinant ST-261 adhesins and to raise specific antibody for downstream analyses, specific antibodies in serum collected from vaccinated tilapia were quantified by indirect ELISA against recombinant ST-261 adhesins. ELISA results revealed that tilapia vaccinated with recombinant adhesin_0337 and mixture of three recombinant ST-261 adhesins had significantly higher level of specific serum antibodies compared to PBS vaccinated fish serum (p < 0.005), followed by the fish received recombinant adhesin_0626 (p < 0.01) (Fig.

3.4A-B and D). However, ELISA detected low level of serum antibody in tilapia injected recombinant adhesin_1196, with absorbance not significantly different from PBS negative control fish (p > 0.1).

116 A B 2.4 2.4 ** 2.2 2.2 2.0 2.0 1.8 1.8 1.6 1.6 1.4 1.4 ** 1.2 1.2 1.0 1.0 0.8 0.8 Absorbance (405 nm) Absorbance (405 nm) 0.6 0.6 0.4 0.4 0.2 0.2 0.0 0.0

0337 PBS 0626 PBS C D 2.4 2.4 2.2 2.2 2.0 2.0 *** 1.8 1.8 1.6 1.6 1.4 1.4 1.2 1.2 1.0 1.0 0.8 0.8 Absorbance (405 nm) Absorbance (405 nm) 0.6 0.6 0.4 0.4 0.2 0.2 0.0 0.0

PBS Mix PBS 1196 Fig. 3.4. Tilapia serum antibody responses to vaccine antigen measured by indirect ELISA. The response of serum antibody against recombinant adhesin was compared with the response of serum antibody from tilapia injected with PBS. A) The responses of serum antibodies against recombinant adhesin_0337 and PBS. B) The responses of serum antibodies against recombinant adhesin_0626 and PBS. C) The responses of serum antibodies against recombinant adhesin_1196 and PBS. D) The responses of serum antibodies against mixture of the three adhesins and PBS. ** p < 0.05; *** p < 0.005.

3.3.4. Changes in the protein profile of QMA0285 cultured in different conditions after 18 h

To determine whether changes in ST-261 adhesin gene expression correlated with changes in proteins in the culture, total proteins extracted from QMA0285 were compared between 117 different culture conditions and time points by SDS-PAGE. There were no apparent differences in the protein profiles of QMA0285 in samples taken after 12 h (Fig. 3.5).

However, after 18 h of incubation, proteins with relative mobilities of 56 kDa, 54 kDa and 43 kDa were observed in TB and TB with glucose cultures at 18 h and were also more abundant than in THB and THB with metals (Fig. 3.5). The apparent concentrations of these proteins remained high relative to other proteins in the TB and TB + glucose culture medium after 24 h (Fig. 3.5). `

Fig. 3.5. Silver stained SDS-PAGE of whole cell proteins of GBS strain QMA0285 grown under different conditions. Cells were grown in four different conditions including 1/ THB, 2/ THB + 5 µM Mn(II)SO4 and

100 µM Zn(II)SO4 (MnZn), 3/ TB without glycerol (TB) and 4/ TB + 55 mM glucose (TB Glu). Cells were harvested at 12 h, 18 h and 24 h time points and reduced by boiling for 15 min in reducing buffer containing DTT. Five µL of reduced samples were resolved by 12% SDS-PAGE gel and stained by Silver-stain. Predicted molecular masses of four adhesins are: 1) adhesin_0337 is 56.4 kDa, 2) adhesin_0626 is 54.4 kDa, 3) adhesin_1196 is 22.3 kDa and 4) adhesin_1648 is 43.45 kDa. Lane M contains broad range protein marker (New England Biolabs).

118 Sera of vaccinated tilapia were used in Western blotting to identify the antigens which were recognised in the whole protein profiles from GBS strain QMA0285 grown under the four experimental culture conditions (Fig. 3.6). Regardless of different culture conditions and antiserum, a major antigen with molecular mass of ~35 kDa was detected (Fig. 3.6A-D).

From bacteria grown in THB and THB with metals, other less immunoreactive bands (~70,

57 and 40 kDa) were identified by all antisera (Fig. 3.6A-B). However, bacteria grown in TB without glycerol and TB with glucose expressed fewer antigens that were detected by serum compared to bacteria grown in THB and THB with additional Mn and Zn (Fig. 3.6C-D). An immunoreactive band (~55 kDa) was detected on the membrane strips incubated with antiserum against recombinant adhesins_0626 when the bacteria were cultured in THB,

THB with metals and TB without glycerol, but not when bacteria were grown under high glucose condition (Fig. 3.6A-D). Although antisera against recombinant ST-261 adhesins

(adhesin_0337, 1196 and mix) detected vaccine antigen (Fig. 3.6E), the bands were not observed in the whole cell lysates by Western blot (Fig. 3.6A-D).

119 A B Ib IbIa Ia Mix M MPBSM PBSPBSIb IbIbIa Ia0337Ia 033703370626 06261196 11961196Mix MixMix 1196 11961196 M PBSMM PBSPBSIb IbIa 0337Ia 033706260337 0626 11960626 11961196Mix MixMix MixMix M PBS Ib Ia 0337 0626 1196 Mix 1196 M PBS Ib Ia 0337 0626 1196 Mix Mix

100 kDa 100 kDa 80 kDa 80 kDa 58 kDa 58 kDa

46 kDa 46 kDa

32 kDa 32 kDa

25 kDa 25 kDa 22 kDa 22 kDa

M CPBS Ib IbIa Ia0337 0626 06261196 Mix 0337 DM PBS PBSIb IbIa 0337Ia 03370626 06261196 1196Mix Mix 0626 M PBS Ib Ia 0337 0626 1196 Mix 03370337 MM PBS Ib Ia 0337 0626 1196 Mix 06260626 MPBSPBS Ib Ib Ia Ia0337 0337 0626 06261196 1196Mix Mix 0337 PBS Ib Ia 0337 0626 1196 Mix 0626 M PBS Ib Ia 0337 0626 1196 Mix 1196 M PBSM PBSIb Ib IaIa 0337 06260626 1196 1196 Mix M Mix 1196 Mix M PBS Ib Ia 0337 0626 1196 MixM M PBSMix Ib Ia 0337 0626 1196 Mix 100 kDa 100 kDa 80 kDa 80 kDa 58 kDa 58 kDa

46 kDa 46 kDa

32 kDa 32 kDa

25 kDa 25 kDa 22 kDa 22 kDa

E Ib Ia M M PBSPBS Ib Ib Ia Ia 03370337 0626 0626 1196 1196 Mix Mix 0337 1196 MM PBSMMPBS PBS PBS Ib Ib Ib IbIaIaIa 033703370337Ia 062606260337 1196 119606261196 Mix 1196MixMixM 0337PBSMix 0626 0626Ib1196 M1196 Ia MixPBSMix0337 Ib M0626 PBSIa 1196 0337 Mix 0626 11961196 Mix 0337 M 0626 0626PBS 1196Ib MixIa 0337 0626Mix 1196 Mix Mix

100 kDa 80 kDa 58 kDa

46 kDa

32 kDa

25 kDa 22 kDa

M PBS Ib Ia 0337 0626 1196 Mix 0337 M PBSM IbPBS IaIb 0337Ia 06260337 11960626 1196MixM PBSMix Ib 0337 Ia 06260337 M 0626 PBS1196 MixIb Ia0337 0337M 0626PBS 1196Ib IaMix 0337 06260626 1196 Mix 0626 Fig. 3.6. Immunoblot profiles of whole cell of GBS strain QMA0285 grown in four different culture conditions, reacted with antisera from vaccinated tilapia. Lane M is the protein marker (New England Biolabs) and label on top of each lane is showing the antiserum used to incubate the membrane strips.

A) THB grown QMA0285 antigens, B) THB + 5 µM Mn(II)SO4 and 100 µM Zn(II)SO4 (MnZn) grown QMA0285 antigens, C) TB without glycerol grown QMA0285 antigen, D) TB + 55 mM glucose grown QMA0285 antigens and E) recombinant adhesin_0337 (56.4 kDa), 0626 (54.4 kDa), 1196 (22.3 kDa) and

mixture of the three adhesins detected by antisera from tilapia that were with each recombinant vaccine.

3.4. Discussion

Reverse vaccinology using pan-genomes gives unprecedented ability to identify highly

conserved surface and secreted epitopes across very diverse lineages of pathogens in silico,

therefore, has potential to identify universal protein antigens amongst highly variable

pathogens such as GBS (Maione et al., 2005; Rappuoli, 2001). From pan-genome analysis, 120 six novel surface proteins, including three putative adhesins specific to serotype Ib piscine strains, one is specific to ST-261 isolate, and three adhesins identified in all GBS strains in the pan-genome (Kawasaki et al., 2018). Due to their critical roles in early stages of infection, adhesins are considered as good vaccine candidate antigens (Nobbs et al., 2009; Raynes et al., 2018). Therefore, in this study, we investigated four of ST-261 adhesins, one that is specific to serotype Ib piscine strains and three that are conserved among all strains, in order to assess if they would be good candidate antigens for the development of a cross- protective vaccine against multiple serotypes. All the identified ST-261 adhesins display a signal peptide sequence at the N-terminus and a LPXTG anchor motif at the C-terminal suggesting that they are cell-wall anchored proteins (Novick, 2000; Schneewind and

Missiakas, 2012; Siegel et al., 2017). Two ST-261 adhesins, adhesin_0337 and 0626, exhibit domain repeats in their amino acid sequences, characteristic of adhesins in streptococci (Nobbs et al., 2015). The two SSURE domains, which were found in adhesin_0337, are known to bind to fibronectin (Bumbaca et al., 2004) suggesting that adhesin_0337 may play a role in attachment to fish extracellular matrix proteins. Bacterial immunoglobulin-like (Ig) 1 domain identified in adhesin_0626 is also present in pathogenic

E. coli intimin and Yersinia pseudotuberculosis invasin, both belonging to a family of bacterial adhesion molecules that play an important role in pathogenicity (Hamburger et al.,

1999; Luo et al., 2000). Since no homologous sequences of adhesin_1196 were found in the database, this protein may only be present in GBS. The present study did not reveal the binding domain of adhesin_1648 but found a coiled-coil region with no known function.

In order to infect its host, bacteria must cope with the stress resulting from rapid environmental changes and host conditions, for example the availability of nutrients like 121 metal ions and carbohydrates (Claverys et al., 2000; McIver et al., 1995). The ability to adapt to these changes is critical, especially for pathogens that have a wide range of niches such as invasive Streptococci (Claverys et al., 2000; Tettelin et al., 2005). Group B Streptococcus is able to regulate the expression of multiple virulence factors during the course of infection to best fit the changing micro-environments of the host (Di Palo et al., 2013; Rajagopal,

2009). For instance, to initiate bacterial attachment during early stage of infection, streptococci decrease CPS production in order to maximize the exposure of their adhesins to host cells (Rajagopal, 2009).

In the present study, ST-261 adhesins and cpsE genes were down-regulated in QMA0285 under elevated metal ion concentrations (addition of manganese and zinc) compared with expression during exponential phase in THB. Manganese and zinc are important metal ions for bacteria as micronutrients and their availabilities fluctuate amongst host tissue micro- environments (Jacobsen et al., 2011; McDevitt et al., 2011). These metal ions have previously been associated with the regulation of Streptococcal virulence factors (Brown et al., 2016; Eijkelkamp et al., 2015; Kadioglu et al., 2008; McDevitt et al., 2011). In S. pneumoniae, the expression of pneumococcal histidine triad (Pht) proteins, which are involved in adhesion to human epithelial cells, are repressed by AdcR repressor in the presence of zinc (Kallio et al., 2014; Shafeeq et al., 2011). Zinc is also an important metal ion involved in innate immune defenses; indeed in response to bacterial infection, the host is capable of increasing the zinc concentration in its tissue (Cheryl-lynn et al., 2015). Under high zinc condition, S. pneumoniae’s manganese uptake via pneumococcal surface antigen

A (PsaA) is inhibited since zinc binds competitively to PsaA, resulting increased susceptibility to oxidative stress (McDevitt et al., 2011). Manganese is a crucial metal ion in 122 S. pneumoniae, indeed it is required in the production of capsule (CpsB) and also involved in reactive oxygen species detoxification, thus manganese limitation results in reduction of capsule and increased susceptibility to oxidative stress (Jacobsen et al., 2011; Morona et al., 2002). Zinc stress can interrupt the enzymatic activity of phosphoglucomutase, leading to the reduction of capsule biosynthesis in S. pyogenes (Cheryl-lynn et al., 2015). Although the regulatory mechanisms of ST-261 adhesin expression and those involved in CPS expression have not been investigated in the current study, down-regulations of four ST-

261 adhesins and cpsE genes from GBS strain QMA0285 may be caused by high zinc concentration affecting regulatory system.

In the host environment, the availabilities of carbon sources such as carbohydrates are highly variable (Paixão et al., 2015). Since carbohydrates are important for bacterial growth, pathogens must deal with fluctuating amounts of carbohydrates to survive in specific host niches, often by regulating protein production including adhesins and CPS (Di Palo et al.,

2013; Paixão et al., 2015). The expression of ST-261 adhesins by GBS strain QMA0285 grown in carbohydrate-limited TB culture and high glucose TB culture was equally up- regulated compared with expression when grown in THB. When free-sugar availability is low, bacteria must acquire carbon from other sources such as glycoproteins (Burnaugh et al., 2008; Shelburne et al., 2008). When S. pneumonia, is grown in media containing only human α-1 acid glycoprotein or yeast extract as a carbon source it is capable of growth, albeit reduced compared with media containing free sugars (Burnaugh et al., 2008). In our study, the growth of QMA0285 was reduced in carbohydrate limited TB culture (Fig. 3.2) but the bacteria still grew suggesting that bacteria are using yeast extract in TB culture medium as a carbon source. Therefore, although free carbohydrates were limited, the amount of 123 carbon seems to be sufficient for QMA0285 to yield similar levels of ST-261 adhesins gene expression with cells grown in high glucose TB, suggesting expression of these proteins is critical even under carbon limitation. Previous studies on GBS serotype V strain 2603V/R suggested that under high glucose conditions, genes coding for virulence factors such as adhesin BibA were down-regulated (Di Palo et al., 2013), in contrast with our findings.

Invasive streptococci may respond to environmental cues via two-component regulatory systems such as the capsule synthesis regulator CovRS; CovRS in GBS is responsible for regulating genes encoding virulence factors (Di Palo et al., 2013; Lamy et al., 2004), including BibA in GBS strain 2603V/R, and CovRS act as a repressor under high glucose condition leading to the down-regulation of the BibA gene (Di Palo et al., 2013). However, the regulatory control of CovRS is strain-specific (Lembo et al., 2010; Rajagopal, 2009), therefore, in piscine ST-261 GBS strain QMA0285, CovRS may either induce ST-261 adhesins expression in the presence of high glucose concentration or different regulatory systems not yet described in this lineage may be involved in the control of ST-261 adhesin expressions.

Enzyme Linked Immunosorbent Assay results revealed that tilapia develop a specific antibody response to recombinant adhesin_0337, 0626 and mixture of three recombinant

ST-261 adhesins but the level of antibody against recombinant adhesin_1196 was not different from negative control (Fig. 3.4C). In addition, Western blotting analysis indicated immunoreactive band of adhesin_1196 incubated with antiserum against adhesin_1196 was weaker than the band of adhesin_1196 on the membrane strip incubated with antiserum against mixture of three adhesins (Fig. 3.6E). The antigens’ immunogenicities can be varied depending on their characteristics including solubility, chemical nature and molecular size 124 (Roberts, 2012). Roberts (2012) suggested proteins with high molecular weight are more immunogenic than smaller peptides. Recombinant adhesin_1196 is smaller than other ST-

261 adhesin with molecular mass of 22.3 kDa so it may be less immunogenic. Also, rainbow trout (Oncorhynchus mykiss) elicit antibody against Flavobacterium psychrophilum proteins with molecular mass between 35 to 45 kDa and 65 to 200 kDa (LaFrentz et al., 2004).

However, other studies on this bacterium showed that an 18 kDa protein was highly immunogenic in rainbow trout (Dumetz et al., 2006; Sudheesh et al., 2007). Therefore, adhesin_1196 should be big enough to be recognised by fish. To understand lower antigenicity of this adhesin, other characteristics such as chemical natures of the adhesin need to be examined. Perhaps conjugating this adhesin with a carrier protein like keyhole limpet hemocyanin may help to elicit a T-dependent response to the adhesin in tilapia.

In the present study, we investigated the regulation of ST-261 adhesins and cpsE in response to different culture conditions to identify the best environmental condition for ST-

261 adhesins expression. However, although ST-261 adhesins and cpsE expression were suppressed under metal-supplemented culture condition and up-regulated under the high glucose, the Western-blotting analysis results did not resolve differences from control culture condition (THB). This may be due to the lack of correlation between mRNA abundances and protein concentration as post-transcriptional, translational and degradation regulation contribute to expressed protein concentration as much as transcription (Vogel and Marcotte,

2012). In our study, despite the significant change in gene regulation, the differences of ST-

261 adhesins and cps expressed on GBS might not be detectable due to the effects of post- transcriptional processes.

125 In conclusion, given the antigenicity of adhesin_0373 and 0626, these ST-261 adhesins would be good vaccine candidate. In addition, although the level of specific antibody response to adhesin_1196 was low, the adhesin was recognised by tilapia when it was mixed with other adhesins, 0373 and 0626. A vaccination and challenge model trial in fish is warranted. In this study, we only investigated the characteristics of ST-261 adhesins by analysing general domain structures. However, the roles of these ST-261 adhesisns in relation to pathogenicity in fish are unknown. Therefore, further work might focus on roles of

ST-261 adhesins using knockout mutants to investigate pathogenicity in an in vivo fish model. Moreover, capability of adhesin-specific antibodies to block binding to host tissue and subsequent infection might be investigated in primary fish cell cultures and passive immunisation studies respectively (Khan and Pichichero, 2012; Raynes et al., 2018;

Wizemann et al., 1999).

126 Chapter 4: Recombinant ST-261 adhesins from Streptococcus agalactiae are not effective as an injectable vaccine against Streptococcosis in tilapia (Oreochromis mossambicus)

Abstract

Effective vaccinations have underpinned disease control in the aquaculture industry for more than a decade. However, despite the successes, some bacterial fish pathogens are hard to control by vaccination due to high strain diversity. Streptococcus agalactiae (Group

B Streptococcus; GBS) expresses a polysaccharide capsule which is the major protective antigen in vaccines, but there are multiple serotypes that infect fish. Using a pan-genome reverse vaccinology approach, ST-261 adhesins were identified as conserved, surface located potential vaccine candidates that are immunogenic in tilapia. Here, we evaluated the efficacies of recombinant ST-261 adhesins as injectable vaccines in tilapia, Oreochromis mossambicus, in a challenge experiment. Tilapia were vaccinated intraperitoneally (IP) with whole-cell vaccines prepared from GBS serotype Ib strain (QMA0285) or Ia strain

(QMA0357), recombinant ST-261 adhesins (0337, 0626 and 1196), and a mixture of the recombinant proteins. After 900 degree days following immunisation, fish were challenged by IP injection with GBS serotype Ib isolate (QMA0285) and mortalities were monitored. The challenge resulted in relative percentage of survival (RPS) of 81.6% in fish vaccinated with serotype Ib whole-cell vaccine followed by RPS of 24.92% in tilapia injected with serotype

Ia whole-cell vaccine. All recombinant ST-261 adhesin vaccines (0337, 0626, 1196 and mix) resulted in RPS of less than 15%. This lack of protection by recombinant vaccines may be due to capsular polysaccharide (CPS), which is the dominant antigen, masking other antigens including the adhesins. It may also be that adhesins are not expressed during the 127 critical stages of proliferation in the host. Future work should elucidate the role of these ST-

261 adhesins in pathogenicity in fish, including and where and when they are expressed on

GBS during the infection.

4.1. Introduction

Aquaculture is the fastest-growing primary production sector in the world (Defoirdt et al.,

2011; FAO, 2016). Production has been increasing dramatically in the last five decades and, in 2014, aquaculture production for human consumption overtook the wild catch fisheries for the first time (FAO, 2016). Contribution of aquaculture to sustainable food security is significant but it also plays important roles in development of economic, social and environmental sectors (Assefa and Abunna, 2018; FAO, 2016). Expansion of the aquaculture industry is essential to accommodate the increased demand for seafood, however, there are also constraints for the industry, especially disease (Assefa and Abunna,

2018; Bondad-Reantaso et al., 2005; Defoirdt et al., 2011; Stentiford et al., 2017). The global losses caused by disease are estimated at six billion US dollars every year and the impacts of disease are more remarkable in developing countries (Assefa and Abunna, 2018). Under farm conditions, disease-causing agents, such as bacteria, can reach higher densities than in the wild and hosts are more likely to be exposed to pathogens (Defoirdt et al., 2011).

Since total eradication of pathogen from the farming system is not feasible, other means of control are important to further expansion of the aquaculture industry (Assefa and Abunna,

2018; Defoirdt et al., 2011; Millard et al., 2012). Control with antibiotics facilitates acquisition of antibiotic resistance by pathogens (Assefa and Abunna, 2018; Defoirdt et al., 2011), which can be dispersed in the environment around farming sites and increase the risk of horizontal resistance gene transfer to other serious pathogens (Barlow, 2009; Cabello et al., 2013; 128 Kümmerer, 2009) with consequent risk to human health (Cabello et al., 2013). Therefore, the use of antibiotics is under strict regulation in aquaculture and has been reduced substantially (Assefa and Abunna, 2018). Vaccines have played an important role in the reduction of antibiotic use for disease control and prevention in the aquaculture industry

(Håstein et al., 2005; Sommerset et al., 2014). In Norway, since the introduction of functional vaccines against bacterial pathogens during the early 1990s, the production of salmonids has increased more than tenfold while the use of antibiotics has been almost eliminated

(Gudding, 2014; Håstein et al., 2005). Currently a number of vaccines have been developed against bacterial pathogens, such as Aeromonas salmonicida, various Vibrio spp.,

Francisella spp., Yersinia spp. and Streptococcus spp. (Barnes et al., 2016; Håstein et al.,

2005; Munang’andu, 2018). However, some bacterial fish pathogens are still hard to control by vaccination.

Streptococcus agalactiae or Group B Streptococcus (GBS) is an important pathogen not only in human and domestic animals but also in farmed and wild fish in warm-water regions throughout the world (Delamare-Deboutteville et al., 2015; Evans et al., 2002). The impact caused by GBS outbreaks is significant, especially in tilapia (Oreochromis spp.) production

(Li et al., 2016). Whole-cell vaccines against GBS that provide excellent protection in tilapia species have been produced (Eldar et al., 1995b; Evans et al., 2004). For example, a commercial vaccine against S. agalactiae biotype II (serotype Ib), AQUAVAC® Strep Sa, has been developed by Merck Animal Health Inc., and is available in a number of countries where it has approval for use. However, GBS whole-cell vaccines are only efficient against the homologous serotype and do not give protection against different serotypes (Bachrach et al., 2001; Paoletti and Madoff, 2002). Group B Streptococcus serotypes are determined 129 by capsular polysaccharide (CPS), which is present in most encapsulated Gram-positive bacteria, and is the major antigen recognized during antibody-mediated adaptive immunity

(Paoletti and Madoff, 2002). To date, there are 10 different GBS serotypes and each serotype elicits only type-specific antibody production (Maione et al., 2005; Paoletti and

Madoff, 2002; Slotved et al., 2007; Yao et al., 2013). Moreover, CPS is highly polymorphic and, under the strong selective pressure of vaccination and fish immunity, re-emergence of novel serotypes can occur (Bachrach et al., 2001; Millard et al., 2012). Currently, three different serotypes including Ia, Ib and III are known to cause disease in wild and farmed fish (Kawasaki et al., 2018). Therefore, in order to develop more cost-effective cross- protective vaccines, identification of highly conserved surface protein antigens across different CPS serotypes is critical (Baiano and Barnes, 2009; Maione et al., 2005).

Conventional approaches to vaccine development tend to focus on the dominant antigens so they are not effective if the pathogen’s major antigens are highly variable, such as CPS in Streptococcus (Johri et al., 2006; Rappuoli, 2001). In the era of next-generation sequencing, prediction of all potential vaccine candidate antigens in a bacterial species and identifying the most conserved antigens among all strains are possible (Rappuoli, 2001).

This approach is called reverse vaccinology (Rappuoli, 2001). Reverse vaccinology identifies potential antigens by examining the pan-genome of the pathogen to determine all open reading frame (ORFs) encoding proteins (Johri et al., 2006). The identified ORFs are analysed in silico to identify surface-located and secreted proteins; protein antigens most likely to be accessible to the host immune system. Finally, the antigens are tested and their efficacies determined in vaccine trials in animal model (Johri et al., 2006). The first universal vaccine against GBS human isolates, which confers protection against serotypes Ia, Ib, II, 130 III, V and VIII, was developed by applying the reverse vaccinology approach based on a

GBS pan-genome including eight genome sequences of GBS strains (Maione et al., 2005).

In the present study, we have employed a reverse vaccinology approach based on a pan- genome from 82 GBS isolates (Kawasaki et al., 2018). Several identified surface proteins were characterised as adhesins, and three of them were conserved in most of the strains including terrestrial isolates (Kawasaki et al., 2018). Recombinant adhesins, alone and as mixtures, were found stimulate antibody production in tilapia by enzyme linked immunosorbent assay (ELISA) and Western blot (Chapter 3). To determine if these adhesins confer protection against GBS, recombinant vaccines were tested in a tilapia challenge model. We also identified the optimal culture conditions for adhesins expression (Chapter

3). To determine if these adhesins can confer protection against GBS, their efficacies were examined by a tilapia challenge model. In the previous chapter, we identified the optimal condition for adhesins expressions (Chapter 3). Therefore, a whole-cell vaccine was produced from GBS serotype Ia grown under these optimum conditions to evaluate cross- protection against challenge with the heterologous serotype Ib.

4.2. Materials and methods

4.2.1. Ethics and biosecurity statements

Catching, breeding, vaccination and challenge in tilapia were performed under guidance of animal welfare and ethics requirements with approval by the Animal Welfare Unit UQ

Research and Innovation in the University of Queensland (AEC approval number:

SBS/398/16). In addition, since tilapia, Oreochromis mossambicus, is an invasive pest species in Australia, permission to collect, transport, possess and breed tilapia for research 131 purposes was obtained from Queensland Government Department of Agriculture and

Fisheries Biosecurity Act 2014 (permit number: PRID000267).

4.2.2. Tilapia breeding

The sex of wild tilapia was determined by observing genital papilla and the animals were placed into a recirculating fresh water system consisting of two glass aquaria. Two male and six female fish were placed into each glass tank and fed twice a day with a commercial diet for native freshwater fish (Ridley Aqua Feed). Water temperature was maintained at 28˚C and quality was monitored regularly for ammonia, nitrite, nitrate, pH and water hardness.

Water exchanges were performed as required. Tilapia reproductive and breeding behaviors were monitored and the eggs were collected from their mouth and transferred to a ZET-55 Fish

Egg Incubator (Ziss Tumbler). Fish larvae were grown for two weeks in the incubator and transferred to separate floating cages to protect them from adult fish. When the fish larvae reached approximately 2 to 3 cm, they were transferred to 112 L food-grade plastic tanks with canister filter (Eheim) and grown for three months for the challenge experiment.

4.2.3. Bacterial strains and culture conditions

For the challenge experiment, GBS serotype Ib ST-261 strain QMA0285, isolated from giant

Queensland grouper, Epinephelus lanceolatus, in 2010 was used (Delamare-Deboutteville et al., 2015). For cross-serotype ELISA, GBS serotype Ia, strain QMA357 isolated from female genital in Townsville hospital in 2011 was used. The isolates were maintained as frozen stock in Todd-Hewitt broth (THB) containing 20% glycerol at -80˚C and recovered from the stock on Columbia sheep blood agar (5%) (Oxoid) at 28˚C. One colony was picked up and used to inoculate fresh THB and incubated at 28 ˚C with gentle agitation overnight 132 for bacterial suspension. For the strain QMA0357, the plate and THB culture were incubated at 37˚C.

4.2.4. Pre-challenge

A pre-challenged with GBS to evaluate the virulence of the challenging strain and to determine the concentration of inoculum for challenge experiment was performed. Briefly,

GBS strain QMA0285 was grown in THB overnight and the bacterial suspension was spun at 3220 x g to remove culture media. The pellet was resuspended in phosphate buffered saline (PBS) to OD600 = 1, then serially diluted tenfold and plated onto agar plate THB +

1.5% bacterial culture agar to estimate colony-forming units (CFU) post-hoc. The bacterial suspension was diluted 10-fold, 100-fold, 1000-fold and 104-fold in PBS as inoculums.

Sixteen tilapias were tagged individually by PIT tag (BTS-ID, Sweden) and were injected intraperitoneally with 100 µL of each inoculum, four fish per dose. Challenged fish were placed in a tank at 28°C and monitored continuously. Fish showing signs of infection were humanely killed according to a score sheet and counted as mortality. Fish were aseptically dissected (eye, kidney and brain) for bacteriology. The identity of isolated bacteria was confirmed by polymerase chain reaction (PCR) using the 16S primers (Table 4.1) (Amann et al., 1995).

Table 4.1. Oligonucleotide primers used in this study.

Gene Primer Length (bp) Nucleotide sequence (5’ to 3’)

29F 20 AGAGTTTGATCCTGGCTCAG 16S rRNA 1492R 18 GGTTACCTTGTTACGACT

133 GBS AgaF 31 AACAGCCTCGTATTTAAAATGATAGATTAAC

23S rRNA AdyR 23 TCCTACCATGACACTAATGTGTC

4.2.5. Vaccinations and challenge fish

Six vaccines were tested in this trial (Table 4.2). Preparation of whole cell and recombinant vaccines are described in Chapter 3. In total, 525 tilapias (O. mossambicus) of approximately 15 ± 5 g were starved for 12 h to reduce the risk of damaging gut by intraperitoneal (IP) injection. Fish were divided into seven groups of 75, anaesthetised with

AQUI-S® (AQUI-S New Zealand Ltd.) and injected intraperitoneally with 100 µL of vaccine.

One group was injected with 100 µL of PBS mixed with adjuvant as a negative control vaccine.

Immediately after vaccination, each group of tilapias was placed into recirculating fresh water and left to recover from injection.

Table 4.2. Vaccine types and antigen concentrations.

Antigen Concentration Per tilapia

PBS - -

Whole-cell, Ib 4 x 108 cfu/mL 4 x 107 cfu/mL

Whole-cell, Ia 4 x 108 cfu/mL 4 x 107 cfu/mL

Recombinant protein, 0337 400 µg/mL 40 µg/mL

Recombinant protein, 0626 400 µg/mL 40 µg/mL

Recombinant protein, 1196 400 µg/mL 40 µg/mL

Recombinant protein, Mix 400 µg/mL (~ 133 µg/mL of 40 µg/mL (~13 µg/mL of

(mixture of 3 adhesins) each adhesin) each adhesin)

134 Nine hundred degree days (32 days at 28˚C) post-vaccination, tilapia were anaesthetised with

AQUI-S® and identified individually using PIT tags. Tagged fish were challenged by IP injection with 100 µL of inoculum under anaesthesia with triplicate cohorts of 25 fish per treatment. Each group of 25 challenged tilapias was placed into one of three replicates 800 L tanks with individual FX4 High Performance Canister Filter (Fluval®) such that each complete experiment comprising all treatment and control groups was contained within each of three replicate trial tanks. The challenge inoculum was prepared from overnight culture of QMA0285 serotype Ib in THB culture. Cells were harvested at 3220 x g for 20 min at 4˚C and resuspended in PBS to adjust to an OD600 of 1. The pre-challenge result (data not shown) indicated that tilapia challenged with 1.01 x 106 CFU/mL (1.0 x 105 cfu/fish) resulted in 100% mortality after seven days. Therefore, the bacterial suspension was diluted 100-fold, which was determined to be equivalent to 1.01 x 106 CFU/mL. A subsample of the challenge inoculum was taken to determine challenge CFU post hoc.

Challenged tilapias were continuously monitored. Moribund fish were humanely euthanised and counted as mortality in accordance with animal welfare requirement. Mortalities were recorded several times every day and four mortalities from each vaccine group from each tank were sampled aseptically from the eye, kidney and brain onto 5% sheep blood agar

(Oxoid). The fish were observed for a total of three weeks after which trials were terminated, and all survivors were euthanized. The identity of isolated bacteria was confirmed by PCR using the AgaF/AdyR primers set (Kawata et al., 2004) as previously described (Table 4.1).

The efficacy of each vaccine was determined by calculating the relative percentage survival

(RPS) for each vaccine group according to Amend (1981) using PBS: adjuvant negative control group as the reference for control mortality. 135 4.2.6. Enzyme linked immunosorbent assay (ELISA)

In order to determine the serum antibody response against GBS, collected anti-sera

(Chapter 3) were subjected to indirect enzyme linked immunosorbent assay (ELISA) as previously described (Delamare-Deboutteville et al., 2006). Cross-reactivity of anti-sera against heterologous serotype (Ia) was also tested by using serotype Ia GBS strain QMA0357 as antigen. Enzyme linked immunosorbent assay high binding 96-well plates (Microlon,

Greiner) were coated with formalin fixed GBS strain QMA0285 or QMA0357 diluted in carbonate bicarbonate buffer and incubated overnight at 4˚C, then washed with Tris buffered saline (TBS) containing 0.005% of Tween-20 (TBST) (Sigma Aldrich). The plates were blocked with 1% bovine serum albumin (Sigma Aldrich) in TBST for 3 h at room temperature and washed thrice in TBST. Anti-sera were applied at 1:32 dilution in TBST in triplicate and incubated for 3 h at room temperature, following the incubation with secondary anti- barramundi IgM produced in sheep (1:2000) (shown to cross-react with tilapia IgM in a dot blot) and tertiary anti-goat antibodies raised in donkey conjugated with alkaline phosphatase

(1:15000) for 1 h each at room temperature. The plates were washed three times with TBST between the incubations with antibodies. After the incubation with tertiary antibody, the plates were washed thrice in TBST and twice in TBS. To develop the colour, p-Nitrophenyl

Phosphate Liquid Substrate System (Sigma Aldrich) was added to the wells and the absorbance was read at 405 nm every 30 min for 3 h at room temperature by using Fluostar

Optima luminometer (BMG Labtech).

4.3. Results

4.3.1. Homologous whole-cell vaccine protects against challenge, but heterologous whole- cell and recombinant adhesin vaccines are not protective 136 Mortalities commenced after 6 h of challenge and reached 20 to 50% at 24 h post injection except for Ib vaccinated group (Fig. 4.1A). The groups that were vaccinated with PBS: adjuvant, adhesin_0337, adhesin_0626, adhesin_1196 and mixture of adhesins showed rapid rise in mortalities within 24 h of challenge and continued for 12 days (Fig. 4.1A). After

12 days, only small number of fish was observed as dead and mortality did not occur 15 days post challenge in these groups (Fig. 4.1A). Ia whole cell vaccinated tilapia group indicated slower mortality than PBS: adjuvant group. The mortality reached 20.3% at 24 h post injection and gradually increased to 59.7% at day 10 (Fig. 4.1A). Few tilapias vaccinated with Ib were found as dead for four days after challenge but mortality stopped at day 5 (Fig. 4.1A).

Mean mortalities of PBS: adjuvant group and recombinant adhesin vaccines groups were not significantly different from each other (86.7% for PBS: adjuvant group, 80% for adhesin_0337 group, 93.3% for adhesin_0626 group, 86.7% for adhesin_1196 group and

81.3% for adhesins mix group). Tilapia vaccinated with whole cell GBS had significantly lower mortality than PBS: adjuvant group with groups vaccinated with Ib whole cell

(homologous) having mean mortality 16 % (p < 0.0001, n = 3) while groups receiving Ia whole cell (heterologous) vaccine had mean mortality of 64.7% (p < 0.05, n = 3) at day 21.

Relative percentage survival was calculated for each treatment based on the mortality of

PBS: adjuvant group. The group vaccinated with Ib whole cell showed significantly higher

RPS (81.6%) (p < 0.0001) compared to other treatments while all recombinant vaccines groups represented lower than 15% RPS (Fig. 4.1B). The RPS of serotype Ia whole-cell- vaccinated tilapias (24.92%) was lower than homologous vaccine group; however, it was

137 significantly higher than the fish receiving adhesin_0626 and adhesin_1196 recombinant vaccines (p < 0.05) (Fig. 4.1B).

B A 100 *** 100 PBS 90 90 Ib 80

80 Ia 70

70 0337 60

60 0626 50 * 40 50 1196 ** 30 40 Mix 20 30 % cumulative mortality 10 20 0 Relative percentage of survival (RPS)

10 -10

0 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Mix 0337 0626 1196 Days Vaccines Ib (Homologous)Ia (Heterologous) Fig. 4.1. Cumulative mortality and relative percent survival of vaccinated tilapia after the challenge with GBS serotype Ib strain QMA0285. A) Mean cumulative mortality (%) of each vaccinated tilapia group. B) Relative percent survival (RPS) was calculated for each vaccine group based on PBS negative control group. **** p < 0.0001; *** p < 0.005; ** p < 0.01; * p < 0.05.

4.3.2. Homologous and cross-reactive serum antibody responses of tilapia to GBS serotype

Ib and Ia

Sera were collected from six fish per treatment group 900 degree days after the vaccinations and the serum antibody reactivity to GBS whole cell was determined by ELISA. Specific antibody in sera from fish vaccinated with any of the antigens was not significantly different from sera from adjuvant control fish against serotype Ib whole cell antigen in the ELISA (p

> 0.05, n = 6) (Fig. 4.2A). To identify serotype cross-reactivity, GBS serotype Ia was also used as coating antigen in the ELISA (Fig. 4.2B). Once again, specific antibody in sera collected from tilapia vaccinated with serotype Ib and Ia whole cell vaccines did not differ significantly from PBS: adjuvant negative control serum. In contrast fish vaccinated with recombinant adhesins had significantly higher specific antibody against serotype Ia whole 138 cells compared to negative control (adhesin_0626: p < 0.005, adhesin_0337, 1196 and mix: p < 0.01) (Fig. 4.2B).

A B 1.2 1.2 ** *** ** ** 1.1 1.1

1.0 1.0

0.9 0.9

0.8 0.8

0.7 0.7

0.6 0.6

0.5 0.5 Absorbance (405 nm) 0.4 Absorbance (405 nm) 0.4

0.3 0.3

0.2 0.2

0.1 0.1

0.0 0.0 Ib Ia Ib Ia Mix Mix PBS 0337 0626 1196 PBS 0337 0626 1196 Fig. 4.2. Cross reactivity of serum antibodies from vaccinated fish from each treatment group against

GBS whole cells by indirect ELISA. A) Serum antibody cross-reactivity against GBS serotype Ib whole- cell coating antigen. B) Serum antibody response to GBS serotype Ia whole-cell coating antigen. Significant difference from PBS: adjuvant negative control *** p < 0.005; ** p < 0.01; * p < 0.05, (n = 6 fish per treatment).

4.4. Discussion

Adhesins are surface proteins which mediate bacterial attachment to the host cells to initiate infection and are well conserved across species due to their central role in infection (Nobbs et al., 2009). Therefore, they are often important antigen candidates for vaccine development (Henningham et al., 2013; Khan and Pichichero, 2012; Margarit et al., 2009;

Nobbs et al., 2009). The adhesins investigated in this study were confirmed to elicit specific antibody production (Chapter 3). In spite of this, none of recombinant adhesins conferred protection against challenge in tilapia, although two adhesins (adhesin_0337 and 0626) were capable of eliciting cross-specific antibody against serotype Ia, but not Ib whole cells.

Lack of protection against infection in spite of detectable specific antibody has been reported previously in both human and fish vaccines (Aviles et al., 2013; Sandin et al., 2006). This 139 can occur if the antibody binds a non-protective epitope (Sandin et al., 2006). For example, the amino-terminal hypervariable region of S. pyogenes M5 protein is a protective epitope since antibody that bind to this region is opsonic, while the semi-variable B-repeat region and conserved C-repeat region of the M5 protein are non-protective epitopes because antibodies binding these regions are not opsonic (Sandin et al., 2006). In the M5 protein, the B-repeat binds to fibrinogen and C-repeat region binds to human serum albumin, therefore, under physiological conditions, fibrinogen and albumin bind to the regions blocking antibody binding (Sandin et al., 2006). Here, the two adhesins that elicited high specific antibody response contain a fibronectin-binding repeat, Streptococcal surface repeat domain (SSURE) (adhesin_0337) and bacterial Ig-like domain 1 (Big-1)

(adhesin_0626) (Chapter 3). It is possible therefore, that antibody binding in vivo might be blocked by binding of host proteins and this requires further investigation. Antibody binding to B-repeat region of S. pyogenes M5 protein is significantly reduced in the presence of fibrinogen at physiological concentration (Sandin et al., 2006). However, in the present study none of serum antibodies bound serotype Ib QMA0285 whole-cells even though the host proteins were almost absent.

The accessibility of antigen is important to confer protection so surface exposed proteins are ideal target for vaccine development (Grandi, 2010; Maione et al., 2005). Although antigens might be found across all strains, the accessibility of antigens to antibody may vary amongst the strains (Maione et al., 2005). For instance, the surface accessibility of Sip protein in GBS varies from isolate to isolate, depending on the presence of CPS (Maione et al., 2005). In the present study, ST-261 serotype Ib strain QMA285 was used for challenge in tilapia. Although isolates belonging to ST-261 have a substantially reduced repertoire of 140 virulence factors (Rosinski-Chupin et al., 2013), all strains have conserved most of the capsular operon (Kawasaki et al., 2018) and express CPS as determined by buoyant density assay (Delamare Deboutteville, 2014). Although not experimentally demonstrated in fish pathogenic GBS, CPS is a critical virulence factor in other fish pathogenic streptococci such as, S. iniae (Locke et al., 2007; Rosinski-Chupin et al., 2013). Consequently, CPS may completely mask adhesins during systemic infection in the blood. Moreover, gene reduction associated with adaptation of the ST-261 lineage to fish has depleted the repertoire of transcriptional regulators (serotype Ib fish strains carry eight two-component systems compared to 21 in human strains) (Rosinski-Chupin et al., 2013). This may cause deregulation of virulence gene expression (Rosinski-Chupin et al., 2013), therefore, our challenge strain QMA0285 might express large amounts of CPS during infection. In contrast, whole cell ELISA against GBS serotype Ia QMA0357 from humans detected cross-reacting antibody in serum from fish vaccinated with recombinant adhesins, which suggests this strain might express less CPS compared to QMA0285 enabling binding of antibody to exposed adhesins.

Pathogens regulate expression of surface proteins and virulence factors to adapt to changing environment in the host. Consequently, organization of surface proteins fluctuates during the course of infection (Grandi, 2010; Rajagopal, 2009). Streptococcus species, such as GBS and S. iniae are known to infect fish through a number of routes (Agnew and Barnes,

2007; Delamare-Deboutteville et al., 2015; Iregui et al., 2016). Group B Streptococcus infection of fish via injection, immersion and oral routes have been experimentally demonstrated but highest mortality is by injection challenge (Delamare-Deboutteville et al.,

2015; Iregui et al., 2016). However, Iregui et al. (2016) suggest that the gastrointestinal 141 epithelium is the most important natural route of infection and CPS was not detected when

GBS adhered to the gastrointestinal epithelium of red tilapia, Oreochromis spp. (Iregui et al.,

2016). In our study, tilapias were challenged with GBS via intraperitoneal injection, bypassing the environment where genes required for attachment may be induced. An important follow up study should determine when these adhesins are expressed in ST-261 and other fish pathogenic lineages during more natural cohabitation infections.

In the present study, only the whole-cell killed vaccine was protective, and the only against the homologous capsular serotype. In contrast, the whole-cell vaccine comprising the heterologous serotype Ia only marginally decreased mortality against Ib challenge compared to adjuvant-only controls, although the difference was statistically significant.

Serotype Ia whole-cell vaccine was grown under carbohydrate limited condition, the optimum condition for adhesin expression and suppression of CPS expression as determined by real-time qRT-PCR (Chapter 3), but the protection was still poor. This may result from immunodominance by the CPS antigen. Fish adaptive immunity and immune memory recognises and responds overwhelmingly to bacterial carbohydrate antigens with lipopolysaccharide (LPS) and CPS being the dominant protective antigens in vaccines against Yersina ruckeri LPS (Welch and LaPatra, 2016), Vibrio anguillarum LPS (Boesen et al., 1999), Lactococcus garvieae CPS (Barnes and Ellis, 2004; Barnes et al., 2002) and S. iniae (Millard et al., 2012). Even though there may be a primary response to purified recombinant adhesins or those expressed in the optimized killed Ia culture, it may be that the critical secondary response is not successfully initiated during infection as the fish response is fully consumed in dealing with the polysaccharides of the capsule.

142 Group B Streptococcus serotype Ib whole-cell vaccine provided excellent protection against homologous serotype challenge but no specific antibody was detected in serum immediately prior to challenge. This may be because the peak primary antibody response in vaccinated fish was missed and protection was derived from secondary antibody response activated on infection during challenge. However, high antibody levels were elicited by the recombinant proteins (Chapter 3), but no protection was evident. This apparent paradox might be explained by the differing nature and kinetics of the immune response of fish to particulate and soluble antigens (Dos Santos et al., 2001). Primary antibody response to soluble T- dependent DNP in sea bass is substantially higher and faster (18-24 days) than the response to particulate Photobacterium damselae or Vibrio bacterins and the response declines quickly from the peak (Dos Santos et al., 2001). In the present study the sera were collected four weeks post-immunisation, which may coincide with peak response to soluble recombinant proteins but may not be optimal for primary response against killed cells (Dos

Santos et al., 2001).

The adhesins identified in my previous research (Kawasaki et al., 2018) are conserved across almost all lineage of GBS, even against a background of substantial genetic change as lineages become host adapted (Kawasaki et al., 2018; Rosinski-Chupin et al., 2013).

This suggests they are under strong selection and essential for GBS survival. Further work is required to fully elucidate their role in infection in fish and when and where they are expressed by GBS. It may be possible to adapt antigen delivery and presentation to improve cross-protection based on a very limited repertoire of conserved surface proteins across the diversity of S. agalactiae sequence types.

143 Chapter 5: General Discussion

Emerging infectious diseases have been a significant constraint to aquaculture expansion with global economic and social impacts (Adam and Gunn, 2017; Stentiford et al., 2017).

Under the aquaculture condition, disease causing agents such as bacteria, viruses and parasites can be present at a high density and transmit among host animals rapidly since the animals are often maintained at high densities of monospecies populations (Defoirdt et al., 2011; Kennedy et al., 2016). In addition, poor environmental conditions including low oxygen level and low water qualities in aquaculture system can increase host susceptibility

(Defoirdt et al., 2011; Murray and Peeler, 2005). Moreover, increase of global seafood trading and transport can lead to disease transmission between countries resulting in introduction of new pathogens into naïve aquaculture systems and environments around farms (Dadar et al., 2017; Stentiford et al., 2017). The negative impacts of infectious disease is not only the economic losses, but also increases in antibiotics use, which raises the risk of developing antibiotic resistance with potential threats to human health if serious pathogens acquire the resulting resistance by horizontal gene transfer or simply by their presence in the environment or products in which the antibiotics were used (Barlow, 2009;

Cabello et al., 2013; Dadar et al., 2017).

Vaccination in aquaculture has successfully reduced the use of antibiotics while increasing production by protecting fish against pathogens (Gudding, 2014; Håstein et al., 2005;

Sommerset et al., 2014). Today, many commercial vaccines against bacterial pathogens are available to aquaculture producers in several countries (Barnes et al., 2016; Håstein et al., 2005; Munang’andu, 2018). However, vaccines are not a perfect solution to all bacterial

144 diseases and some bacterial pathogens, like Streptococcus, present challenges to effective long-term protective vaccines.

Outbreaks of GBS cause significant impacts, especially in tilapia (Oreochromis spp.) productions in Asia, Middle East, North America, Latin America and Africa (Brum et al.,

2017; Li et al., 2016; Liu et al., 2016; Verner-Jeffreys et al., 2017) and, although many outbreaks are caused by fish-specific clonal complexes (Kawasaki et al., 2018), there are increasing numbers of cases of human pathogenic variants isolated from diseased fish presenting a potential biosafety hazard (Liu et al., 2016). Aquaculture production of tilapia is second highest in the world after carp production and is still increasing (FAO, 2018) so mitigating disease risk is critical in tilapia farming (Liu et al., 2016). Whole-cell inactivated vaccines against GBS provide good protection for tilapia from GBS infection (Eldar et al.,

1995b; Evans et al., 2004; Liu et al., 2016). However, due to the variations of capsular polysaccharide (CPS), which is the dominant antigen of GBS, whole-cell killed vaccine usually provide effective protection only against homologous CPS serotype but are not protective for heterologous GBS infection (Liu et al., 2016; Paoletti and Madoff, 2002). In addition, CPS is highly polymorphic so strong selective pressure exerted by vaccines can cause capsular switching to facilitate GBS to escape vaccine coverage (Bellais et al., 2012).

Therefore, to overcome the serotype specificity problem, the identification of antigens that are well conserved across the different serotype strains is likely to be a good strategy for developing cost effective cross-protective vaccine (Baiano and Barnes, 2009; Maione et al.,

2005).

145 In this study, I applied pan-genome reverse vaccinology to develop a potential multi- serotype cross-protective GBS vaccine for tilapia, Oreochromis mossambicus. I generated a pan-genome for GBS from 82 genomes, including representatives from wild marine fish isolates, stingray isolates, terrestrial isolates and human isolates in Australia, farmed tilapia isolates in Honduras and genomes available NCBI database (Kawasaki et al., 2018). Pan- genome analysis revealed that remarkable genome reduction occurred in serotype Ib fish pathogenic strains compared to serotype Ia fish pathogenic strains and terrestrial isolates

(Kawasaki et al., 2018; Rosinski-Chupin et al., 2013). Also, Ib fish strains have lost most of virulence factors including many adhesins, genes associated with immune evasion, cellular invasion and toxin production (Kawasaki et al., 2018). However, some virulence factors are conserved across most of the isolates, and these include CPS and a limited repertoire of putative adhesins which I named the ST-261 adhesins as they are the only surface associated virulence factors preserved in the aquatic-adapted 261 GBS sequence type (ST)

(Kawasaki et al., 2018). Although some ST-261 adhesins are only present in serotype Ib fish strains or specific to ST-261 isolates, three ST-261 adhesins, 0337, 0626, and 1196 are conserved in most of the strains (Kawasaki et al., 2018).

Adhesins are important virulence factors that mediate bacterial attachment to the host surface and colonisation (Kouki et al., 2011; Nobbs et al., 2009; Raynes et al., 2018). Due to their role, adhesins are usually located on the cell surface, which can be easily targeted by the host immune system (Raynes et al., 2018). In this study, the efficacies of three ST-

261 adhesins, which are conserved in most of the strains, as vaccines against GBS were evaluated in a tilapia disease challenge model. However, although two recombinant ST-261 adhesins, 0337 and 0626, and mixture of three recombinant ST-261 adhesins were capable 146 of inducing antibody production, they were not protective for tilapia against GBS serotype Ib challenge (Chapter 3 and 4). Adhesins are considered as good vaccine candidates not only because they are located on bacterial surface where antibody can access, but also their degree of conservation across different isolates (Kouki et al., 2011; Krachler and Orth, 2013).

This means adhesins should be under the strong immunological pressure. However, although some sequence variations in the adhesins can occur, their biological functions must still be conserved (Kouki et al., 2011; Moschioni et al., 2010). For instance, RrgA, which is a subunit of pilus 1 in S. pneumoniae and responsible for bacterial adhesion by pilus 1, has two major variants (clades I and II) but the two variants were both capable of binding to epithelial cells at a similar level (Barocchi et al., 2006; Moschioni et al., 2010;

Nelson et al., 2007). In addition, the two RrgA variants were antigenically cross-reactive in vitro and also cross-protective in a murine model passive immunisation experiment with

RrgA clade I rabbit antiserum (Moschioni et al., 2010). Different levels of diversification observed across antibody binding targets in bacteria can be elucidated from the functional constraints on variations of the bacterial proteins (Croucher et al., 2017). Bacterial adherence to the host cell surface requires specific ligand-receptor interactions (Berne et al., 2015). When pathogens encounter the host cells, they initially attach to the surfaces via non-specific interactions involved the bacterial and host surfaces physiochemical properties

(Krachler and Orth, 2013; Tuson and Weibel, 2013). These interactions are weak and reversible so pathogens are still allowed to move and examine the host cell surfaces (Berne et al., 2015; Krachler and Orth, 2013; Tuson and Weibel, 2013). Once pathogens are on the host surface, they trigger strong and irreversible adherence mediated by specific ligand- receptor interactions, such as bacterial adhesin-host cell surface receptor pairing (Berne et al., 2015; Krachler and Orth, 2013; Tuson and Weibel, 2013). Due to this specific interaction, 147 any changes in adhesins can significantly affect the ability of bacteria to adhere to the host cells, which can negatively impact on bacterial fitness in the host (Krachler and Orth, 2013).

Therefore, ST-261 adhesins may similarly be subjected to a strong functional constraint that explains their high level of conservation.

It has been proposed that the vaccines targeting adhesins are less likely to lead to bacterial resistance (Krachler and Orth, 2013; Ofek et al., 2003). When anti-adhesin antibodies bind to the bacterial surface epitopes, they can also block the critical step of bacterial infection, attachment to the host surface and colonisation, by interrupting specific ligand-receptor interactions so that bacterial infection may be prevented (Klemm et al., 2010; Krachler and

Orth, 2013; Ofek et al., 2003; Wizemann et al., 1999). However, inhibiting bacterial adherence does not affect on bacterial viability and growth, like antibiotics, so it would not exert selective pressure on pathogens (Cozens and Read, 2012; Krachler and Orth, 2013).

A counter argument to this, of course is that blocking adhesion may render bacteria less fit within the host and consequently reduce the transmission and success, thereby conferring advantage to variants that are not impeded.

Sequence type 261 adhesins were not protective for tilapia against GBS challenge, perhaps implicating that these adhesins may not be under strong immunologic pressure during infection consistent with their high conservation across the all GBS isolates. Many bacterial species are capable of expression of various adhesins during the different stages of infection and in different environments (Klemm et al., 2010; Ofek et al., 2003). Although GBS serotype

Ib fish isolates only possess ST-261 adhesins, GBS serotype Ia isolates from both fish and terrestrial animals conserve additional adhesins (Kawasaki et al., 2018). This may implicate 148 these alternative adhesins in the colonisation of mammals, but it may also be possible that these isolates may express these additional adhesins rather than ST-261 adhesins during the infection of tilapia. In my research, I did not examine if the three conserved ST-261 adhesins were expressed during infection in tilapia. The tilapias were challenged by intraperitoneal injection (IP) which is likely different from natural routes of infection, in which

GBS enter tilapia via gastrointestinal epithelium from the oral route and attach to the epithelium cell surface and colonise (Iregui et al., 2016). Consequently, the route of infection employed may bypass the adhesion stage during which adhesins might be critical to invasion of the gut epithelium. Instead, GBS might express different factors when they are injected to tilapia abdominal cavity. This may explain why the adhesins were not protective against GBS in the present model. However, I cannot elucidate if adhesins are conserved well because of low immunologic pressure to adapt or because of functional constraint, since

I did not determine if the ST-261 adhesins are expressed on the bacterial surface during infection under natural conditions. Therefore, further works are needed to elucidate the role of ST-261 adhesins during the infection and if the adhesins are important for GBS pathogenesis in fish. In order to clarify the question, the future study may employ ST-261 adhesin-knockout mutants and test their pathogenesis in tilapia challenge model. Also, the levels of the adhesin expression during the infection should be investigated. Moreover, although the genes of the antigens are conserved and expressed by all isolates, accessibility of antigen can be vary between the isolates (Maione et al., 2005). For example, Sip protein is conserved in core genome of GBS and even though it is expressed on the bacterial surface, with the accessibility dependent on the presence of CPS (Maione et al., 2005). If the ST-261 adhesins were expressed on the surface but were not accessible, this might explain why the antigens were not protective which cause less immunological pressure. 149 Indeed, CPS and ST261-adhesins seem to be inversely co-regulated under different growth conditions (Chapter 3) suggesting some form of interdependent phase control during the infection lifecycle of these strains. Better understanding of antigen expression and accessibility is needed for efficient vaccine development because although the presence of gene for the antigen is a critical factor for antigen selection, the antigen expression in vivo and their accessibility are equally critical to elicit effective protection.

Currently, commercial aquaculture vaccines are available for farmed fish including salmonid fish, European seabass, seabream, Japanese flounder, yellow tail, Atlantic cod, grouper, catfish, carps and tilapia (Assefa and Abunna, 2018; Brudeseth et al., 2013; Muktar et al.,

2016; Sommerset et al., 2014). Vaccination has played critical role in the success of salmonid farming industries in terms of production growth and antibiotic reduction, particularly in Norway (Brudeseth et al., 2013; Sommerset et al., 2014). Today, commercial vaccines are licensed and available for more than 40 countries (Brudeseth et al., 2013).

However, although vaccines are widely used to protect farmed salmonid fish and marine fish in Europe, North America, Middle East, Chile, Japan and Korea, it is not the case for freshwater fish aquaculture in some countries (Brudeseth et al., 2013). Tropical and warm- temperate freshwater fish, such as carp, catfish and tilapia, are mainly farmed in China,

Southeast Asia, Africa and South America and growth in production is very high but use of vaccines is very limited (Brudeseth et al., 2013; Opiyo et al., 2018; Wamala et al., 2018).

For example, commercial injectable vaccines against GBS are available for tilapia farmers in Brazil, Costa Rica and Indonesia but many farmers in tilapia aquaculture still relying on husbandry techniques to prevent disease rather than vaccination (Aftabuddin et al., 2016;

Brudeseth et al., 2013; Chitmanat et al., 2016; Yanong, 2011). When disease outbreaks 150 occur, antibiotics are mainly used to treat fish (Aftabuddin et al., 2016; Chitmanat et al.,

2016; Yanong, 2011). Manual vaccination is labor intensive and requires good fish handling skills which can cause high stress (Brudeseth et al., 2013). Since most warm freshwater fish like tilapia are low value species injection vaccines, or even immersion vaccines, may seem too expensive, especially for small farms (Brudeseth et al., 2013; Sommerset et al., 2014).

In addition, pathogens like GBS may be hard to control by generic vaccines as a result of the immunodominance of the CPS on the infecting strains in fish. Furthermore, vaccines that target CPS exert selective pressure leading to capsular serotype switching and consequent vaccine failure and/or emergence of novel serotypes not covered by the vaccines in use (Bachrach et al., 2001; Bellais et al., 2012). In Brazil, GBS serotype Ib is the major causative agent of disease outbreaks in tilapia industries so commercial vaccine,

AQUAVAC® Strep Sa (MDS Animal Health), are used to protect fish in some farms

(Chideroli et al., 2017). However, in 2016, outbreak caused by GBS serotype III occurred in the farms, some of whom had vaccinated fish (Chideroli et al., 2017). Although AQUAVAC®

Strep Sa (MDS Animal Health) is reported to provide excellent protection for tilapia against

GBS biotype II (serotype Ib), the vaccine efficacy is evidently reduced by the emergence of new serotypes. The ideal vaccine for aquaculture has to meet strict standards including safety of use, provision of long-term immunity preventing mortality for the life of the fish, must also be cheap to produce, license and register (Grisez and Tan, 2005; Muktar et al.,

2016; Sommerset et al., 2014). Development of generic vaccines that meet these standards for tropical and subtropical freshwater aquacultures might be very difficult, particularly given the existing serotypic diversity and extensive pan-genome that still remains open indicating potential for discovery of further diversity over time.

151 To develop effective vaccines against the pathogens with broad diversities, autogenous vaccines, which are custom vaccines prepared from the pathogens isolated directly from the farm and applied only on the farm, could be one of the solutions to control diseases in warm water fish aquacultures (Hoelzer et al., 2018; Millard et al., 2012; Toranzo et al., 2009).

Autogenous vaccines are usually deployed at small or medium scale and under restricted permit that reduces registration costs (Arsenakis et al., 2018; Brudeseth et al., 2013).

Autogenous vaccines have been used in terrestrial agriculture including cattle, swine and poultry where they have successfully reduced antibiotic use (Arsenakis et al., 2018; Baums et al., 2010; Li et al., 2017; Reeves et al., 2013). For instance, exudative epidermitis caused by Staphylococcus hyicus is a common skin disease in pigs and autogenous vaccine against

S. hyicus reduce morbidity and mortality rate while the amount of metaphylactic antimicrobial treatment has been reduced (Arsenakis et al., 2018). In aquaculture, autogenous vaccines have been used widely in both cold and warm water fish (Gudmundsdóttir et al., 1997;

Millard et al., 2012) and have been effective against Aeromonous salmonicida spp. achromogenes and Yersinia ruckeri in salmonid fish (Barnes et al., 2016; Gudmundsdóttir et al., 1997; Ormsby et al., 2016) and against Streptococcus iniae in barramundi and GBS in stingrays (Bowater et al., 2018; Millard et al., 2012). Autogenous vaccines are also known as emergency vaccine, which can be used under the circumstances where fully licensed vaccines are not available, not effective or the causative agent is not covered (Hoelzer et al., 2018). The process of developing autogenous vaccines is much shorter than developing generic vaccines so the vaccine could be very effective against pathogens like

Streptococcus that evolve rapidly because even emerging novel serotypes can be incorporated in a short period of time.

152 Although there are considerable advantages of autogenous vaccines in rapidly developing, margin industries such as warm water aquaculture, there are some disadvantages. One of the problems is that autogenous vaccine needs to be regularly updated with different strains from the vaccine population or vaccine escape strains that may be circulating in the environment (Arsenakis et al., 2018). In order to solve this problem, careful surveillance and frequent diagnosis to determine the emergence of infectious disease in real-time is the key for effective autogenous vaccine development. These services are often not widely available in developing economies and lack of diagnostics has been attributed as one contributing factor in misdiagnosis and misuse of antibiotics in tilapia aquaculture in Vietnam and aquaculture in general (Boerlage et al., 2017; Henriksson et al., 2017). Whilst tools such as next generation sequencing technologies and bioinformatics can provide rapid and low cost genomic and metagenomic data that allow more accurate surveillance and detection of causative agents of disease (Barnes et al., 2016; Brynildsrud et al., 2014; Gardy and Loman,

2018; Gulla et al., 2018; Kawasaki et al., 2018), the establishment of readily available basic diagnostic and strain collection capability locally in aquaculture growth areas is a first priority.

Once established, pathogenomics can increase understanding of the evolution of pathogen strains and the mechanism of shifting from microbiome to pathobiome which can be used to predict occurrence of disease outbreaks (Vayssier-Taussat et al., 2014). Moreover, a highly portable pocket-sized sequencer, MinIONTM from Oxford Nanopore has potential to enable sequencing to be performed almost anywhere without establishment of expensive sequencing facilities (Bayliss et al., 2017; Gardy and Loman, 2018; Jain et al., 2016).

MinION has been used in field situations for sequencing Ebola and Zika virus epidemic

(Gardy and Loman, 2018). By applying MinIONTM, it is possible to sequence pathogens causing disease outbreaks on the farms where a sequencing facility is not accessible 153 (Bayliss et al., 2017). Therefore, rapid surveillance and diagnosis supported by pathogenomics are likely to enable accurate and timely formulation of autogenous vaccines in response to changes in the pathobiome and emergence of novel strains once basic routine pathological sampling is established locally.

Pathogenomics provides not only useful information for surveillance but also the evidence to justify expansion of the epidemiological unit that defines and limits autogenous vaccine use. Autogenous vaccines can only be used on the farm where the vaccine strain is isolated

(Hoelzer et al., 2018; Millard et al., 2012). The same vaccine formulation cannot be used for animals that are not within the same epidemiological unit although the same isolate may be causing disease in different farms (Pesticides and Authority, 2014). Generally, each farm, flock or herd is considered as a separate epidemiological unit but the definition can vary

(Hoelzer et al., 2018; Landman et al., 2014; Pesticides and Authority, 2014). Developing and manufacturing costs are diluted over a number of vaccine doses so producing smaller amount of vaccine can lead to higher per-unit production cost (Plotkin et al., 2017). As a consequence, an autogenous vaccine produced for a single small farm may not be affordable even though registration costs are low. However, when disease is caused by the same pathogenic strain over several farms, they should be defined as the same epidemiological unit so that the same vaccine formulation can be used in all of those farms decreasing the cost per dose. The expansion of the epidemiological unit for autogenous vaccine use provides economy of scale towards affordable solutions for smaller farmers.

Evidence provided by timely pathogenomics will facilitate this process. In conclusion, affordable autogenous vaccines would bestow benefit onto the famers in lower income countries where the aquaculture growth is rapid and antibiotics are still the main measure to 154 treat infectious disease (Brudeseth et al., 2013; Sommerset et al., 2014). The work in this thesis reveals some of the challenges and potential solutions for such vaccines. With global antimicrobial use in animal production far exceeding use in human medicine (Van Boeckel et al., 2017), and considering the “one health” philosophy linking human health with production animal and environmental health (Kaplan and Echols, 2009) that is driving towards reduction of antimicrobial use in agriculture (Robinson et al., 2016), it is critical that affordable disease prevention methods such as guided autogenous vaccination are promoted in the world’s fastest growing food production sector.

155 References

Abuseliana, A., Daud, H., Aziz, S.A., Bejo, S.K., Alsaid, M., 2010. Streptococcus agalactiae the etiological agent of mass mortality in farmed red tilapia (Oreochromis sp.). J Anim Vet Adv 9, 2640-2646. Adam, K., Gunn, G., 2017. Social and economic aspects of aquatic animal health. Revue scientifique et technique (International Office of Epizootics) 36, 323-329. Adu-Bobie, J., Capecchi, B., Serruto, D., Rappuoli, R., Pizza, M., 2003. Two years into reverse vaccinology. Vaccine 21, 605-610. Aftabuddin, S., Islam, M.N., Bhuyain, M.A.B., Mannan, M.A., Alam, M.M., 2016. Fish diseases and strategies taken by the farmers in freshwater aquaculture at southwestern Bangladesh. Bangladesh Journal of Zoology 44, 111-122. Agnew, W., Barnes, A.C., 2007. Streptococcus iniae: An aquatic pathogen of global veterinary significance and a challenging candidate for reliable vaccination. Veterinary microbiology 122, 1-15. Aisyhah, M.A.S., Amal, M.N.A., Zamri-Saad, M., Siti-Zahrah, A., Shaqinah, N.N., 2015. Streptococcus agalactiae isolates from cultured fishes in Malaysia manifesting low resistance pattern towards selected antibiotics. Journal of Fish Diseases. Aji, L.P., 2012. The operation and production of the barramundi, Lates calcarifer, at the Good Fortune Bay (GFB) Barramundi Farm Australia. Journal of Tropical Life Science 2, 25-28. Alikhan, N.-F., Petty, N.K., Ben Zakour, N.L., Beatson, S.A., 2011. BLAST Ring Image Generator (BRIG): simple prokaryote genome comparisons. BMC Genomics 12, 402. Almeida, A., Alves-Barroco, C., Sauvage, E., Bexiga, R., Albuquerque, P., Tavares, F., Santos-Sanches, I., Glaser, P., 2016. Persistence of a dominant bovine lineage of group B Streptococcus reveals genomic signatures of host adaptation. Environmental microbiology 18, 4216-4229. Amal, M.N.A., Zamri-Saad, M., 2011. Streptococcosis in tilapia (Oreochromis niloticus): a review. Pertanika Journal of Tropical Agricultural Science 34, 195-206. Amann, R.I., Ludwig, W., Schleifer, K.H., 1995. Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiological reviews 59, 143-169. Amend, D.F., 1981. Potency testing of fish vaccines. Developments in Biological Standardization 49, 447-454. Amundson, N.R., Flores, A.E., Hillier, S.L., Baker, C.J., Ferrieri, P., 2005. DNA macrorestriction analysis of nontypeable group B streptococcal isolates: clonal

156 evolution of nontypeable and type V isolates. Journal of clinical microbiology 43, 572- 576. Andrews, S. 2010. FastQC: a quality control tool for high throughput sequence data. Arsenakis, I., Boyen, F., Haesebrouck, F., Maes, D.G., 2018. Autogenous vaccination reduces antimicrobial usage and mortality rates in a herd facing severe exudative epidermitis outbreaks in weaned pigs. Veterinary Record, vetrec-2017-104720. Assefa, A., Abunna, F., 2018. Maintenance of Fish Health in Aquaculture: Review of Epidemiological Approaches for Prevention and Control of Infectious Disease of Fish. Veterinary medicine international 2018. Aviles, F., Zhang, M.M., Chan, J., Delamare-Deboutteville, J., Green, T.J., Dang, C., Barnes, A.C., 2013. The conserved surface M-protein SiMA of Streptococcus iniae is not effective as a cross-protective vaccine against differing capsular serotypes in farmed fish. Veterinary microbiology 162, 151-159. Bachrach, G., Zlotkin, A., Hurvitz, A., Evans, D.L., Eldar, A., 2001. Recovery of Streptococcus iniae from Diseased Fish Previously Vaccinated with a Streptococcus Vaccine. Applied and environmental microbiology 67, 3756-3758. Baiano, J.C., Barnes, A.C., 2009. Towards control of Streptococcus iniae. Emerg Infect Dis 15, 1891. Bankevich, A., Nurk, S., Antipov, D., Gurevich, A.A., Dvorkin, M., Kulikov, A.S., Lesin, V.M., Nikolenko, S.I., Pham, S., Prjibelski, A.D., 2012. SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing. Journal of computational biology 19, 455-477. Barlow, M. 2009. What antimicrobial resistance has taught us about horizontal gene transfer, In: Horizontal Gene Transfer. Springer, 397-411. Barnes, A.C., Delamare-Deboutteville, J., Gudkovs, N., Brosnahan, C., Morrison, R., Carson, J., 2016. Whole genome analysis of Yersinia ruckeri isolated over 27 years in Australia and New Zealand reveals geographical endemism over multiple lineages and recent evolution under host selection. Microbial genomics 2. Barnes, A.C., Ellis, A.E., 2004. Role of capsule in serotypic differences and complement fixation by Lactococcus garvieae. Fish & shellfish immunology 16, 207-214. Barnes, A.C., Guyot, C., Hansen, B.G., Horne, M.T., Ellis, A.E., 2002. Antibody increases phagocytosis and killing of Lactococcus garvieae by rainbow trout (Oncorhynchus mykiss, L.) macrophages. Fish & shellfish immunology 12, 181-186. Barnes, A.C., Young, F.M., Horne, M.T., Ellis, A.E., 2003. Streptococcus iniae: serological differences, presence of capsule and resistance to immune serum killing. Diseases of aquatic organisms 53, 241-247. 157 Barocchi, M., Ries, J., Zogaj, X., Hemsley, C., Albiger, B., Kanth, A., Dahlberg, S., Fernebro, J., Moschioni, M., Masignani, V., 2006. A pneumococcal pilus influences virulence and host inflammatory responses. Proceedings of the National Academy of Sciences 103, 2857-2862. Baums, C.G., Brüggemann, C., Kock, C., Beineke, A., Waldmann, K.-H., Valentin-Weigand, P., 2010. Immunogenicity of an autogenous Streptococcus suis bacterin in preparturient sows and their piglets in relation to protection after weaning. Clinical and vaccine immunology 17, 1589-1597. Baya, A.M., Lupiani, B., Hetrick, F.M., Roberson, B.S., Lukacovic, R., May, E., Poukish, C., 1990. Association of Streptococcus sp. with fish mortalities in the Chesapeake Bay and its tributaries. Journal of Fish Diseases 13, 251-253. Bayliss, S.C., Verner-Jeffreys, D.W., Bartie, K.L., Aanensen, D.M., Sheppard, S.K., Adams, A., Feil, E.J., 2017. The promise of whole genome pathogen sequencing for the molecular epidemiology of emerging aquaculture pathogens. Frontiers in microbiology 8, 121. Bellais, S., Six, A., Fouet, A., Longo, M., Dmytruk, N., Glaser, P., Trieu-Cuot, P., Poyart, C., 2012. Capsular switching in group B Streptococcus CC17 hypervirulent clone: a future challenge for polysaccharide vaccine development. The Journal of infectious diseases 206, 1745-1752. Berne, C., Ducret, A., Hardy, G.G., Brun, Y.V., 2015. Adhesins involved in attachment to abiotic surfaces by Gram-negative bacteria. Microbiology spectrum 3. Bishop, E.J., Shilton, C., Benedict, S., Kong, F., Gilbert, G., Gal, D., Godoy, D., Spratt, B., Currie, B.J., 2007. Necrotizing fasciitis in captive juvenile Crocodylus porosus caused by Streptococcus agalactiae: an outbreak and review of the animal and human literature. Epidemiology & Infection 135, 1248-1255. Blanchard, J.L., Watson, R.A., Fulton, E.A., Cottrell, R.S., Nash, K.L., Bryndum-Buchholz, A., Büchner, M., Carozza, D.A., Cheung, W.W., Elliott, J., 2017. Linked sustainability challenges and trade-offs among fisheries, aquaculture and agriculture. Nature Ecology & Evolution 1, 1240. Boerlage, A.S., Dung, T.T., Hoa, T.T.T., Davidson, J., Stryhn, H., Hammell, K.L., 2017. Production of red tilapia (Oreochromis spp.) in floating cages in the Mekong Delta, Vietnam: mortality and health management. Diseases of aquatic organisms 124, 131- 144. Boesen, H.T., Pedersen, K., Larsen, J.L., Koch, C., Ellis, A.E., 1999. Vibrio anguillarum resistance to rainbow trout (Oncorhynchus mykiss) serum: role of O-antigen structure of lipopolysaccharide. Infection and Immunity 67, 294-301. 158 Bondad-Reantaso, M.G., Subasinghe, R.P., Arthur, J.R., Ogawa, K., Chinabut, S., Adlard, R., Tan, Z., Shariff, M., 2005. Disease and health management in Asian aquaculture. Veterinary parasitology 132, 249-272. Bostock, J., McAndrew, B., Richards, R., Jauncey, K., Telfer, T., Lorenzen, K., Little, D., Ross, L., Handisyde, N., Gatward, I., 2010. Aquaculture: global status and trends. Philosophical Transactions of the Royal Society B: Biological Sciences 365, 2897- 2912. Bowater, R., Dennis, M., Blyde, D., Stone, B., Barnes, A., Delamare-Deboutteville, J., Horton, M., White, M., Condon, K., Jones, R., 2018. Epizootics of Streptococcus agalactiae infection in captive rays from Queensland, Australia. Journal of fish diseases 41, 223-232. Bowater, R.O., Forbes-Faulkner, J., Anderson, I.G., Condon, K., Robinson, B., Kong, F., Gilbert, G.L., Reynolds, A., Hyland, S., McPherson, G., 2012. Natural outbreak of Streptococcus agalactiae (GBS) infection in wild giant Queensland grouper, Epinephelus lanceolatus (Bloch), and other wild fish in northern Queensland, Australia. Journal of fish diseases 35, 173-186. Bowyer, J.N., Qin, J.G., Stone, D.A., 2013. Protein, lipid and energy requirements of cultured marine fish in cold, temperate and warm water. Reviews in Aquaculture 5, 10-32. Brochet, M., Couvé, E., Zouine, M., Vallaeys, T., Rusniok, C., Lamy, M.-C., Buchrieser, C., Trieu-Cuot, P., Kunst, F., Poyart, C., 2006. Genomic diversity and evolution within the species Streptococcus agalactiae. Microbes and Infection 8, 1227-1243. Brodeur, B.R., Boyer, M., Charlebois, I., Hamel, J., Couture, F., Rioux, C.R., Martin, D., 2000. Identification of group B streptococcal Sip protein, which elicits cross-protective immunity. Infection and immunity 68, 5610-5618. Bromage, E.S., Thomas, A., Owens, L., 1999. Streptococcus iniae, a bacterial infection in barramundi Lates calcarifer. Diseases of Aquatic Organisms, 177-181. Brown, L.R., Gunnell, S.M., Cassella, A.N., Keller, L.E., Scherkenbach, L.A., Mann, B., Brown, M.W., Hill, R., Fitzkee, N.C., Rosch, J.W., 2016. AdcAII of Streptococcus pneumoniae Affects Pneumococcal Invasiveness. PloS one 11. Brudeseth, B.E., Wiulsrød, R., Fredriksen, B.N., Lindmo, K., Løkling, K.-E., Bordevik, M., Steine, N., Klevan, A., Gravningen, K., 2013. Status and future perspectives of vaccines for industrialised fin-fish farming. Fish & Shellfish Immunology 35, 1759- 1768. Brum, A., Pereira, S.A., Owatari, M.S., Chagas, E.C., Chaves, F.C.M., Mouriño, J.L.P., Martins, M.L., 2017. Effect of dietary essential oils of clove basil and ginger on Nile

159 tilapia (Oreochromis niloticus) following challenge with Streptococcus agalactiae. Aquaculture 468, 235-243. Brynildsrud, O., Feil, E.J., Bohlin, J., Castillo-Ramirez, S., Colquhoun, D., McCarthy, U., Matejusova, I.M., Rhodes, L.D., Wiens, G.D., Verner-Jeffreys, D.W., 2014. Microevolution of Renibacterium salmoninarum: evidence for intercontinental dissemination associated with fish movements. The ISME journal 8, 746. Bumbaca, D., LittleJohn, J.E., Nayakanti, H., Rigden, D.J., Galperin, M.Y., Jedrzejas, M.J., 2004. Sequence analysis and characterization of a novel fibronectin-binding repeat domain from the surface of Streptococcus pneumoniae. Omics: a journal of integrative biology 8, 341-356. Burnaugh, A.M., Frantz, L.J., King, S.J., 2008. Growth of Streptococcus pneumoniae on human glycoconjugates is dependent upon the sequential activity of bacterial exoglycosidases. Journal of bacteriology 190, 221-230. Cabello, F.C., 2006. Heavy use of prophylactic antibiotics in aquaculture: a growing problem for human and animal health and for the environment. Environmental microbiology 8, 1137-1144. Cabello, F.C., Godfrey, H.P., Tomova, A., Ivanova, L., Dölz, H., Millanao, A., Buschmann, A.H., 2013. Antimicrobial use in aquaculture re-examined: its relevance to antimicrobial resistance and to animal and human health. Environmental microbiology 15, 1917-1942. Cao, L., Naylor, R., Henriksson, P., Leadbitter, D., Metian, M., Troell, M., Zhang, W., 2015. China’s aquaculture and the world’s wild fisheries. Science 347, 133-135. Carvalho-Castro, G.A., Silva, J.R., Paiva, L.V., Custódio, D.A.C., Moreira, R.O., Mian, G.F., Prado, I.A., Chalfun-Junior, A., Costa, G.M., 2017. Molecular epidemiology of Streptococcus agalactiae isolated from mastitis in Brazilian dairy herds. Brazilian Journal of Microbiology 48, 551-559. Chaffin, D.O., Beres, S.B., Yim, H.H., Rubens, C.E., 2000. The serotype of type Ia and III group B streptococci is determined by the polymerase gene within the polycistronic capsule operon. J Bacteriol 182, 4466-4477. Chaffin, D.O., McKinnon, K., Rubens, C.E., 2002. CpsK of Streptococcus agalactiae exhibits alpha2,3-sialyltransferase activity in Haemophilus ducreyi. Mol Microbiol 45, 109- 122. Chen, L., Yang, J., Yu, J., Yao, Z., Sun, L., Shen, Y., Jin, Q., 2005. VFDB: a reference database for bacterial virulence factors. Nucleic Acids Res 33, D325-328.

160 Chen, M., Li, L.-P., Wang, R., Liang, W.-W., Huang, Y., Li, J., Lei, A.-Y., Huang, W.-Y., Gan, X., 2012. PCR detection and PFGE genotype analyses of streptococcal clinical isolates from tilapia in China. Veterinary microbiology 159, 526-530. Cheng, S., Hu, Y.-h., Jiao, X.-d., Sun, L., 2010. Identification and immunoprotective analysis of a Streptococcus iniae subunit vaccine candidate. Vaccine 28, 2636-2641. Cheryl-lynn, Y.O., Walker, M.J., McEwan, A.G., 2015. Zinc disrupts central carbon metabolism and capsule biosynthesis in Streptococcus pyogenes. Scientific reports 5. Chideroli, R.T., Amoroso, N., Mainardi, R.M., Suphoronski, S.A., de Padua, S.B., Alfieri, A.F., Alfieri, A.A., Mosela, M., Moralez, A.T.P., de Oliveira, A.G., Zanolo, R., Di Santis, G.W., Pereira, U.P., 2017. Emergence of a new multidrug-resistant and highly virulent serotype of Streptococcus agalactiae in fish farms from Brazil. Aquaculture 479, 45-51. Chitmanat, C., Lebel, P., Whangchai, N., Promya, J., Lebel, L., 2016. Tilapia diseases and management in river-based cage aquaculture in northern Thailand. Journal of Applied Aquaculture 28, 9-16. Chong, S., Wong, W., Lee, W., Tan, Z., Tay, Y., Teo, X., Chee, L., Fernandez, C., 2017. Streptococcus agalactiae outbreaks in cultured golden pomfret, Trachinotus blochii (Lacépède), in Singapore. Journal of fish diseases 40, 971-974. Cieslewicz, M.J., Chaffin, D., Glusman, G., Kasper, D., Madan, A., Rodrigues, S., Fahey, J., Wessels, M.R., Rubens, C.E., 2005. Structural and genetic diversity of group B Streptococcus capsular polysaccharides. Infect Immun 73, 3096-3103. Cingolani, P., Platts, A., Wang, L.L., Coon, M., Nguyen, T., Wang, L., Land, S.J., Lu, X., Ruden, D.M., 2012. A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3. Fly 6, 80-92. Claverys, J.P., Prudhomme, M., Mortier-Barrière, I., Martin, B., 2000. Adaptation to the environment: Streptococcus pneumoniae, a paradigm for recombination-mediated genetic plasticity? Molecular microbiology 35, 251-259. Colorn, A., Diamant, A., Eldar, A., Kvitt, H., Zlotkin, A., 2002. Streptococcus iniae infections in Red Sea cage-cultured and wild fishes. Diseases of aquatic organisms 49, 165- 170. Colquhoun, D.J., Alvheim, K., Dommarsnes, K., Syvertsen, C., Sørum, H., 2002. Relevance of incubation temperature for Vibrio salmonicida vaccine production. Journal of applied microbiology 92, 1087-1096.

161 Cozens, D., Read, R.C., 2012. Anti-adhesion methods as novel therapeutics for bacterial infections. Expert review of anti-infective therapy 10, 1457-1468. Creeper, J.H., Buller, N.B., 2006. An outbreak of Streptococcus iniae in barramundi (Lates calcarifera) in freshwater cage culture. Australian veterinary journal 84, 408-411. Croucher, N.J., Campo, J.J., Le, T.Q., Liang, X., Bentley, S.D., Hanage, W.P., Lipsitch, M., 2017. Diverse evolutionary patterns of pneumococcal antigens identified by pangenome-wide immunological screening. Proceedings of the National Academy of Sciences 114, E357-E366. Croucher, N.J., Page, A.J., Connor, T.R., Delaney, A.J., Keane, J.A., Bentley, S.D., Parkhill, J., Harris, S.R., 2015. Rapid phylogenetic analysis of large samples of recombinant bacterial whole genome sequences using Gubbins. Nucleic Acids Res 43, e15. Dadar, M., Dhama, K., Vakharia, V.N., Hoseinifar, S.H., Karthik, K., Tiwari, R., Khandia, R., Munjal, A., Salgado-Miranda, C., Joshi, S.K., 2017. Advances in aquaculture vaccines against fish pathogens: global status and current trends. Reviews in Fisheries Science & Aquaculture 25, 184-217. Dangor, Z., Kwatra, G., Izu, A., Lala, S.G., Madhi, S.A., 2014. Review on the association of Group B Streptococcus capsular antibody and protection against invasive disease in infants. Expert Review of Vaccines 14, 135-149. De Santis, C., Smith-Keune, C., Jerry, D.R., 2011. Normalizing RT-qPCR data: are we getting the right answers? An appraisal of normalization approaches and internal reference genes from a case study in the finfish Lates calcarifer. Marine biotechnology 13, 170-180. Defoirdt, T., Sorgeloos, P., Bossier, P., 2011. Alternatives to antibiotics for the control of bacterial disease in aquaculture. Current opinion in microbiology 14, 251-258. Delamare Deboutteville, J., 2014. On the origin of Group B Streptococcus from disease outbreaks in wild marine fish in Australia. Delamare-Deboutteville, J., Wood, D., Barnes, A.C., 2006. Response and function of cutaneous mucosal and serum antibodies in barramundi (Lates calcarifer) acclimated in seawater and freshwater. Fish & shellfish immunology 21, 92-101. Delamare-Deboutteville, J., Bowater, R., Condon, K., Reynolds, A., Fisk, A., Aviles, F., Barnes, A., 2015. Infection and pathology in Queensland grouper, Epinephelus lanceolatus,(Bloch), caused by exposure to Streptococcus agalactiae via different routes. Journal of fish diseases 38, 1021-1035. Delannoy, C.M.J., Crumlish, M., Fontaine, M.C., Pollock, J., Foster, G., Dagleish, M.P., Turnbull, J.F., Zadoks, R.N., 2013. Human Streptococcus agalactiae strains in aquatic mammals and fish. BMC microbiology 13, 41. 162 Delannoy, C.M.J., Zadoks, R.N., Crumlish, M., Rodgers, D., Lainson, F.A., Ferguson, H.W., Turnbull, J., Fontaine, M.C., 2016. Genomic comparison of virulent and non-virulent Streptococcus agalactiae in fish. Journal of fish diseases 39, 13-29. Delany, I., Rappuoli, R., Seib, K.L., 2013. Vaccines, reverse vaccinology, and bacterial pathogenesis. Cold Spring Harbor Perspectives in Medicine 3, a012476. Di Palo, B., Rippa, V., Santi, I., Brettoni, C., Muzzi, A., Metruccio, M., Grifantini, R., Telford, J.L., Paccani, S.R., Soriani, M., 2013. Adaptive response of group B Streptococcus to high glucose conditions: new insights on the CovRS regulation Network. PloS one 8, e61294. Diana, J.S., Egna, H.S., Chopin, T., Peterson, M.S., Cao, L., Pomeroy, R., Verdegem, M., Slack, W.T., Bondad-Reantaso, M.G., Cabello, F., 2013. Responsible aquaculture in 2050: valuing local conditions and human innovations will be key to success. BioScience 63, 255-262. Diggles, B.K., Cooke, S.J., Rose, J.D., Sawynok, W., 2011. Ecology and welfare of aquatic animals in wild capture fisheries. Reviews in Fish Biology and Fisheries 21, 739-765. Dos Santos, N.M., Taverne-Thiele, J., Barnes, A.C., Ellis, A.E., Rombout, J.H., 2001. Kinetics of juvenile sea bass (Dicentrarchus labrax, L.) systemic and mucosal antibody secreting cell response to different antigens (Photobacterium damselae spp. piscicida, Vibrio anguillarum and DNP). Fish & shellfish immunology 11, 317-331. Doumith, M., Mushtaq, S., Martin, V., Chaudhry, A., Adkin, R., Coelho, J., Chalker, V., MacGowan, A., Woodford, N., Livermore, D.M., 2017. Genomic sequences of Streptococcus agalactiae with high-level gentamicin resistance, collected in the BSAC bacteraemia surveillance. Journal of Antimicrobial Chemotherapy 72, 2704- 2707. Dumetz, F., Duchaud, E., LaPatra, S.E., Le Marrec, C., Claverol, S., Urdaci, M.-C., Le Hénaff, M., 2006. A protective immune response is generated in rainbow trout by an OmpH-like surface antigen (P18) of Flavobacterium psychrophilum. Applied and environmental microbiology 72, 4845-4852. Edwards, M.S., Gonik, B., 2013. Preventing the broad spectrum of perinatal morbidity and mortality through group B streptococcal vaccination. Vaccine 31, D66-D71. Eijkelkamp, B.A., McDevitt, C.A., Kitten, T., 2015. Manganese uptake and streptococcal virulence. BioMetals 28, 491-508. Eldar, A., Bejerano, Y., Bercovier, H., 1994. Streptococcus shiloi and Streptococcus difficile: Two new streptococcal species causing a meningoencephalitis in fish. Current Microbiology 28, 139-143.

163 Eldar, A., Bejerano, Y., Livoff, A., Horovitcz, A., Bercovier, H., 1995a. Experimental streptococcal meningo-encephalitis in cultured fish. Veterinary microbiology 43, 33- 40. Eldar, A., Horovitcz, A., Bercovier, H., 1997. Development and efficacy of a vaccine against Streptococcus iniae infection in farmed rainbow trout. Veterinary Immunology and Immunopathology 56, 175-183. Eldar, A., Shapiro, O., Bejerano, Y., Bercovier, H., 1995b. Vaccination with whole-cell vaccine and bacterial protein extract protects tilapia against Streptococcus difficile meningoencephalitis. Vaccine 13, 867-870. Elliott, J.A., Facklam, R.R., Richter, C.B., 1990. Whole-cell protein patterns of nonhemolytic group B, type Ib, streptococci isolated from humans, mice, cattle, frogs, and fish. Journal of Clinical Microbiology 28, 628-630. Evans, J.J., Bohnsack, J.F., Klesius, P.H., Whiting, A.A., Garcia, J.C., Shoemaker, C.A., Takahashi, S., 2008. Phylogenetic relationships among Streptococcus agalactiae isolated from piscine, dolphin, bovine and human sources: a dolphin and piscine lineage associated with a fish epidemic in Kuwait is also associated with human neonatal infections in Japan. Journal of medical microbiology 57, 1369-1376. Evans, J.J., Klesius, P.H., Gilbert, P.M., Shoemaker, C.A., Al Sarawi, M.A., Landsberg, J., Duremdez, R., Al Marzouk, A., Al Zenki, S., 2002. Characterization of β-haemolytic Group B Streptococcus agalactiae in cultured seabream, Sparus auratus L., and wild mullet, Liza klunzingeri (Day), in Kuwait. Journal of Fish Diseases 25, 505-513. Evans, J.J., Klesius, P.H., Pasnik, D.J., Bohnsack, J.F., 2009. Human Streptococcus agalactiae isolate in Nile tilapia (Oreochromis niloticus). Emerging infectious diseases 15, 774. Evans, J.J., Klesius, P.H., Shoemaker, C.A., 2004. Efficacy of Streptococcus agalactiae (group B) vaccine in tilapia (Oreochromis niloticus) by intraperitoneal and bath immersion administration. Vaccine 22, 3769-3773. Eyngor, M., Tekoah, Y., Shapira, R., Hurvitz, A., Zlotkin, A., Lublin, A., Eldar, A., 2008. Emergence of novel Streptococcus iniae exopolysaccharide-producing strains following vaccination with nonproducing strains. Applied and environmental microbiology 74, 6892-6897. Facklam, R., Elliott, J., Shewmaker, L., Reingold, A., 2005. Identification and characterization of sporadic isolates of Streptococcus iniae isolated from humans. Journal of clinical microbiology 43, 933-937. FAO, 2012. The State of World Fisheries and Aquaculture 2012. The State of World Fisheries and Aquaculture, I. 164 FAO, 2013. FAO Statistical Yearbook 2013. Food & Agriculture Organi. FAO, 2014. The State of World Fisheries and Aquaculture 2014. Opportunities and challenges. The State of World Fisheries and Aquaculture, I. FAO 2016. The State of World Fisheries and Aquaculture 2016. Contributing to Food Security and Nutrition for All (FAO Rome). FAO, 2018. The State of World Fisheries and Aquaculture 2018. Meeting the sustainable development goals. FAO Rome. Ferguson, H.W., St John, V.S., Roach, C.J., Willoughby, S., Parker, C., Ryan, R., 2000. Caribbean reef fish mortality associated with Streptococcus iniae. Veterinary Record 147, 662-664. Figueiredo, H.C.P., Nobrega Netto, L., Leal, C.A.G., Pereira, U.P., Mian, G.F., 2012. Streptococcus iniae outbreaks in Brazilian Nile tilapia (Oreochromis niloticus L:) farms. Brazilian Journal of Microbiology 43, 576-580. Finn, R.D., Clements, J., Eddy, S.R., 2011. HMMER web server: interactive sequence similarity searching. Nucleic acids research, gkr367. Fischer, A., Liljander, A., Kaspar, H., Muriuki, C., Fuxelius, H.-H., Bongcam-Rudloff, E., de Villiers, E.P., Huber, C.A., Frey, J., Daubenberger, C., 2013. Camel Streptococcus agalactiae populations are associated with specific disease complexes and acquired the tetracycline resistance gene tetM via a Tn 916-like element. Veterinary research 44, 86. Flores, A.R., Galloway-Peña, J., Sahasrabhojane, P., Saldaña, M., Yao, H., Su, X., Ajami, N.J., Holder, M.E., Petrosino, J.F., Thompson, E., 2015. Sequence type 1 group B Streptococcus, an emerging cause of invasive disease in adults, evolves by small genetic changes. Proceedings of the National Academy of Sciences, 201504725. Francis, A.R., Tanaka, M.M., 2012. Evolution of variation in presence and absence of genes in bacterial pathways. BMC evolutionary biology 12, 55. Gardy, J.L., Loman, N.J., 2018. Towards a genomics-informed, real-time, global pathogen surveillance system. Nature Reviews Genetics 19, 9. Gaughan, D.J., 2001. Disease-translocation across geographic boundaries must be recognized as a risk even in the absence of disease identification: the case with Australian Sardinops. Reviews in Fish Biology and Fisheries 11, 113-123. Geng, Y., Wang, K.Y., Huang, X.L., Chen, D.F., Li, C.W., Ren, S.Y., Liao, Y.T., Zhou, Z.Y., Liu, Q.F., Du, Z.J., 2012. Streptococcus agalactiae, an Emerging Pathogen for Cultured Ya-Fish, Schizothorax prenanti, in China. Transboundary and emerging diseases 59, 369-375.

165 Ghittino, C., Latini, M., Agnetti, F., Panzieri, C., Lauro, L., Ciappelloni, R., Petracca, G., 2003. Emerging pathologies in aquaculture: effects on production and food safety. Veterinary research communications 27, 471-479. Gianfaldoni, C., Censini, S., Hilleringmann, M., Moschioni, M., Facciotti, C., Pansegrau, W., Masignani, V., Covacci, A., Rappuoli, R., Barocchi, M.A., 2007. Streptococcus pneumoniae pilus subunits protect mice against lethal challenge. Infection and immunity 75, 1059-1062. Giuliani, M.M., Adu-Bobie, J., Comanducci, M., Aricò, B., Savino, S., Santini, L., Brunelli, B., Bambini, S., Biolchi, A., Capecchi, B., 2006. A universal vaccine for serogroup B meningococcus. Proceedings of the National Academy of Sciences 103, 10834- 10839. Godoy, D., Carvalho-Castro, G., Leal, C., Pereira, U., Leite, R., Figueiredo, H., 2013a. Genetic diversity and new genotyping scheme for fish pathogenic Streptococcus agalactiae. Letters in applied microbiology 57, 476-483. Godoy, D.T., Carvalho-Castro, G.A., Leal, C.A.G., Pereira, U.P., Leite, R.C., Figueiredo, H.C.P., 2013b. Genetic diversity and new genotyping scheme for fish pathogenic Streptococcus agalactiae. Letters in applied microbiology 57, 476-483. Grandi, G., 2010. Bacterial surface proteins and vaccines. F1000 biology reports 2. Grisez, L., Tan, Z. 2005. Vaccine development for Asian aquaculture. In: Diseases in Asian Aquaculture V Fish health section, Proceedings of the Fifth Symposium in Asian Aquaculture Edited by: Walker P, Lester R, Bondad-Reantaso MG. Goldcoast, Australia: Asian Fisheries Society, 483-494. Gudding, R., 2014. Vaccination as a preventive measure. Fish Vaccination, 12-21. Gudding, R., Van Muiswinkel, W.B., 2013. A history of fish vaccination: science-based disease prevention in aquaculture. Fish & shellfish immunology 35, 1683-1688. Gudmundsdóttir, B., Jónsdóttir, H., Steinthórsdóttir, V., Magnadóttir, B., Gudmundsdóttir, S., 1997. Survival and humoral antibody response of Atlantic salmon, Salmo salar L., vaccinated against Aeromonas salmonicida ssp. achromogenes. Journal of Fish Diseases 20, 351-360. Gulla, S., Barnes, A.C., Welch, T.J., Romalde, J.L., Ryder, D., Ormsby, M.J., Carson, J., Lagesen, K., Verner-Jeffreys, D.W., Davies, R.L., 2018. Multi-Locus Variable number of tandem repeat Analysis (MLVA) of Yersinia ruckeri confirms the existence of host- specificity, geographic endemism and anthropogenic dissemination of virulent clones. Applied and environmental microbiology, AEM. 00730-00718. Hamburger, Z.A., Brown, M.S., Isberg, R.R., Bjorkman, P.J., 1999. Crystal structure of invasin: a bacterial integrin-binding protein. Science 286, 291-295. 166 Håstein, T., Gudding, R., Evensen, Ø. 2005. Bacterial vaccines for fish - An update of the current situation worldwide. In Developments in Biologicals, 55-74. He, E.-M., Chen, C.-W., Guo, Y., Hsu, M.-H., Zhang, L., Chen, H.-L., Zhao, G.-P., Chiu, C.- H., Zhou, Y., 2017. The genome of serotype VI Streptococcus agalactiae serotype VI and comparative analysis. Gene 597, 59-65. He, Z., Zhang, H., Gao, S., Lercher, M.J., Chen, W.-H., Hu, S., 2016. Evolview v2: an online visualization and management tool for customized and annotated phylogenetic trees. Nucleic acids research 44, W236-W241. Hedrick, R.P., 1996. Movement of pathogens with the international trade of live fish: problems and solutions. Revue scientifique et technique (International Office of Epizootics) 15, 523-531. Henningham, A., Chiarot, E., Gillen, C.M., Cole, J.N., Rohde, M., Fulde, M., Ramachandran, V., Cork, A.J., Hartas, J., Magor, G., Djordjevic, S.P., Cordwell, S.J., Kobe, B., Sriprakash, K.S., Nizet, V., Chhatwal, G.S., Margarit, I.Y.R., Batzloff, M.R., Walker, M.J., 2012. Conserved anchorless surface proteins as group A streptococcal vaccine candidates. Journal of Molecular Medicine (Berlin, Germany) 90, 1197-1207. Henningham, A., Gillen, C.M., Walker, M.J. 2013. Group A streptococcal vaccine candidates: potential for the development of a human vaccine, In: Host-Pathogen Interactions in Streptococcal Diseases. Springer, 207-242. Henriksson, P.J., Rico, A., Troell, M., Klinger, D.H., Buschmann, A.H., Saksida, S., Chadag, M.V., Zhang, W., 2017. Unpacking factors influencing antimicrobial use in global aquaculture and their implication for management: a review from a systems perspective. Sustainability science, 1-16. Herbert, M.A., Beveridge, C.J., McCormick, D., Aten, E., Jones, N., Snyder, L.A., Saunders, N.J., 2005. Genetic islands of Streptococcus agalactiae strains NEM316 and 2603VR and their presence in other Group B Streptococcal strains. BMC microbiology 5, 31. Hoelzer, K., Bielke, L., Blake, D.P., Cox, E., Cutting, S.M., Devriendt, B., Erlacher-Vindel, E., Goossens, E., Karaca, K., Lemiere, S., 2018. Vaccines as alternatives to antibiotics for food producing animals. Part 2: new approaches and potential solutions. Veterinary research 49, 70. Hoshina, T., Sano, T., Morimoto, Y., 1958. A Streptococcus pathogenic for fish. Journal of the Tokyo University of Fisheries 44, 57-68. Iregui, C., Barato, P., Rey, A., Vasquez, G., Verjan, N., 2014. Epidemiology of Streptococcus agalactiae and Streptococcosis in Tilapia Fish.

167 Iregui, C., Comas, J., Vasquez, G., Verjan, N., 2016. Experimental early pathogenesis of S treptococcus agalactiae infection in red tilapia Oreochromis spp. Journal of fish diseases 39, 205-215. Jacobsen, F.E., Kazmierczak, K.M., Lisher, J.P., Winkler, M.E., Giedroc, D.P., 2011. Interplay between manganese and zinc homeostasis in the human pathogen Streptococcus pneumoniae. Metallomics 3, 38-41. Jafar, Q., Sameer, A.-Z., Salwa, A.-M., Samee, A.-A., Ahmed, A.-M., Al-Sharifi, F., 2008. Molecular investigation of Streptococcus agalactiae isolates from environmental samples and fish specimens during a massive fish kill in Kuwait Bay. Pakistan journal of biological sciences: PJBS 11, 2500-2504. Jain, M., Olsen, H.E., Paten, B., Akeson, M., 2016. The Oxford Nanopore MinION: delivery of nanopore sequencing to the genomics community. Genome biology 17, 239. Johri, A.K., Paoletti, L.C., Glaser, P., Dua, M., Sharma, P.K., Grandi, G., Rappuoli, R., 2006. Group B Streptococcus: global incidence and vaccine development. Nature Reviews Microbiology 4, 932-942. Jones, N., Bohnsack, J.F., Takahashi, S., Oliver, K.A., Chan, M.-S., Kunst, F., Glaser, P., Rusniok, C., Crook, D.W.M., Harding, R.M., 2003. Multilocus sequence typing system for group B Streptococcus. Journal of Clinical Microbiology 41, 2530-2536. Kadioglu, A., Weiser, J.N., Paton, J.C., Andrew, P.W., 2008. The role of Streptococcus pneumoniae virulence factors in host respiratory colonization and disease. Nature Reviews Microbiology 6, 288-301. Kallio, A., Sepponen, K., Hermand, P., Denoël, P., Godfroid, F., Melin, M., 2014. Role of Pht proteins in attachment of Streptococcus pneumoniae to respiratory epithelial cells. Infection and immunity 82, 1683-1691. Kannika, K., Pisuttharachai, D., Srisapoome, P., Wongtavatchai, J., Kondo, H., Hirono, I., Unajak, S., Areechon, N., 2017. Molecular serotyping, virulence gene profiling and pathogenicity of Streptococcus agalactiae isolated from tilapia farms in Thailand by multiplex PCR. Journal of Applied Microbiology 122, 1497-1507. Kapatai, G., Patel, D., Efstratiou, A., Chalker, V.J., 2017. Comparison of molecular serotyping approaches of Streptococcus agalactiae from genomic sequences. BMC genomics 18, 429. Kaplan, B., Echols, M., 2009. One Health-the Rosetta stone for 21st century health and health providers. Vet Ital 45, 377-382. Kawamura, Y., Itoh, Y., Mishima, N., Ohkusu, K., Kasai, H., Ezaki, T., 2005. High genetic similarity of Streptococcus agalactiae and Streptococcus difficilis: S. difficilis Eldar et al. 1995 is a later synonym of S. agalactiae Lehmann and Neumann 1896 (Approved 168 Lists 1980). International journal of systematic and evolutionary microbiology 55, 961- 965. Kawasaki, M., Delamare-Deboutteville, J., Bowater, R.O., Walker, M.J., Beatson, S., Zakour, N.L.B., Barnes, A.C., 2018. Microevolution of aquatic Streptococcus agalactiae ST-261 from Australia indicates dissemination via imported tilapia and ongoing adaptation to marine hosts or environment. Applied and environmental microbiology, AEM. 00859-00818. Kawata, K., Anzai, T., Senna, K., Kikuchi, N., Ezawa, A., Takahashi, T., 2004. Simple and rapid PCR method for identification of streptococcal species relevant to animal infections based on 23S rDNA sequence. FEMS microbiology letters 237, 57-64. Kayansamruaj, P., Pirarat, N., Katagiri, T., Hirono, I., Rodkhum, C., 2014. Molecular characterization and virulence gene profiling of pathogenic Streptococcus agalactiae populations from tilapia (Oreochromis sp.) farms in Thailand. Journal of Veterinary Diagnostic Investigation 26, 488-495. Kennedy, D.A., Kurath, G., Brito, I.L., Purcell, M.K., Read, A.F., Winton, J.R., Wargo, A.R., 2016. Potential drivers of virulence evolution in aquaculture. Evolutionary applications 9, 344-354. Khan, M.N., Pichichero, M.E., 2012. Vaccine candidates PhtD and PhtE of Streptococcus pneumoniae are adhesins that elicit functional antibodies in humans. Vaccine 30, 2900-2907. Kitao, T., Aoki, T., Sakoh, R., 1981. Epizootic caused by beta-haemolytic Streptococcus species in cultured freshwater fish. Fish Pathology 15, 301-307. Klemm, P., Vejborg, R.M., Hancock, V., 2010. Prevention of bacterial adhesion. Applied microbiology and biotechnology 88, 451-459. Klinger, D., Naylor, R., 2012. Searching for solutions in aquaculture: charting a sustainable course. Annual Review of Environment and Resources 37, 247-276. Kong, F., Gowan, S., Martin, D., James, G., Gilbert, G.L., 2002. Serotype Identification of Group B Streptococci by PCR and Sequencing. Journal of clinical microbiology 40, 216-226. Koressaar, T., Remm, M., 2007. Enhancements and modifications of primer design program Primer3. Bioinformatics 23, 1289-1291. Kouki, A., Haataja, S., Loimaranta, V., Pulliainen, A.T., Nilsson, U.J., Finne, J., 2011. Identification of a Novel Streptococcal Adhesin P (SadP) Protein Recognizing Galactosyl-α1–4-galactose-containing Glycoconjugates CONVERGENT EVOLUTION OF BACTERIAL PATHOGENS TO BINDING OF THE SAME HOST RECEPTOR. Journal of Biological Chemistry 286, 38854-38864. 169 Krachler, A.M., Orth, K., 2013. Targeting the bacteria–host interface: strategies in anti- adhesion therapy. Virulence 4, 284-294. Krogh, A., Larsson, B., Von Heijne, G., Sonnhammer, E.L.L., 2001. Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes. Journal of molecular biology 305, 567-580. Kümmerer, K., 2009. Antibiotics in the aquatic environment–a review–part I. Chemosphere 75, 417-434. Kuo, C.-H., Ochman, H., 2010. The extinction dynamics of bacterial pseudogenes. PLoS genetics 6, e1001050. Lachenauer, C.S., Kasper, D.L., Shimada, J., Ichiman, Y., Ohtsuka, H., Kaku, M., Paoletti, L.C., Ferrieri, P., Madoff, L.C., 1999. Serotypes VI and VIII predominate among group B streptococci isolated from pregnant Japanese women. Journal of Infectious Diseases 179, 1030-1033. Lafferty, K.D., Harvell, C.D., Conrad, J.M., Friedman, C.S., Kent, M.L., Kuris, A.M., Powell, E.N., Rondeau, D., Saksida, S.M., 2015. Infectious diseases affect marine fisheries and aquaculture economics. Annual review of marine science 7, 471-496. LaFrentz, B.R., LaPatra, S.E., Jones, G.R., Cain, K.D., 2004. Protective immunity in rainbow trout Oncorhynchus mykiss following immunization with distinct molecular mass fractions isolated from Flavobacterium psychrophilum. Diseases of Aquatic Organisms 59, 17-26. Lamy, M.C., Zouine, M., Fert, J., Vergassola, M., Couve, E., Pellegrini, E., Glaser, P., Kunst, F., Msadek, T., Trieu-Cuot, P., 2004. CovS/CovR of group B Streptococcus: a two- component global regulatory system involved in virulence. Molecular microbiology 54, 1250-1268. Lancefield, R.C., 1933. A serological differentiation of human and other groups of hemolytic streptococci. The Journal of experimental medicine 57, 571-595. Landman, W., Buter, G., Dijkman, R., Van Eck, J., 2014. Molecular typing of avian pathogenic Escherichia coli colonies originating from outbreaks of E. coli peritonitis syndrome in chicken flocks. Avian pathology 43, 345-356. Langermann, S., Palaszynski, S., Barnhart, M., Auguste, G., Pinkner, J.S., Burlein, J., Barren, P., Koenig, S., Leath, S., Jones, C.H., 1997. Prevention of mucosal Escherichia coli infection by FimH-adhesin-based systemic vaccination. Science 276, 607-611. Larsen, M.V., Cosentino, S., Rasmussen, S., Friis, C., Hasman, H., Marvig, R.L., Jelsbak, L., Sicheritz-Pontén, T., Ussery, D.W., Aarestrup, F.M., Lund, O., 2012. Multilocus

170 Sequence Typing of Total-Genome-Sequenced Bacteria. Journal of Clinical Microbiology 50, 1355-1361. Lauer, P., Rinaudo, C.D., Soriani, M., Margarit, I., Maione, D., Rosini, R., Taddei, A.R., Mora, M., Rappuoli, R., Grandi, G., 2005. Genome analysis reveals pili in Group B Streptococcus. Science 309, 105-105. Lembo, A., Gurney, M.A., Burnside, K., Banerjee, A., De Los Reyes, M., Connelly, J.E., Lin, W.J., Jewell, K.A., Vo, A., Renken, C.W., 2010. Regulation of CovR expression in Group B Streptococcus impacts blood–brain barrier penetration. Molecular microbiology 77, 431-443. Lerat, E., Ochman, H., 2004. Ψ-Φ: Exploring the outer limits of bacterial pseudogenes. Genome research 14, 2273-2278. Lerat, E., Ochman, H., 2005. Recognizing the pseudogenes in bacterial genomes. Nucleic acids research 33, 3125-3132. Letunic, I., Doerks, T., Bork, P., 2015. SMART: recent updates, new developments and status in 2015. Nucleic acids research 43, D257-D260. Lewis, T.E., Sillitoe, I., Andreeva, A., Blundell, T.L., Buchan, D.W.A., Chothia, C., Cuff, A., Dana, J.M., Filippis, I., Gough, J., 2013. Genome3D: a UK collaborative project to annotate genomic sequences with predicted 3D structures based on SCOP and CATH domains. Nucleic acids research 41, D499-D507. Li, K., Liu, L., Clausen, J.H., Lu, M., Dalsgaard, A., 2016. Management measures to control diseases reported by tilapia (Oreochromis spp.) and whiteleg shrimp (Litopenaeus vannamei) farmers in Guangdong, China. Aquaculture 457, 91-99. Li, L., Thøfner, I., Christensen, J.P., Ronco, T., Pedersen, K., Olsen, R.H., 2017. Evaluation of the efficacy of an autogenous Escherichia coli vaccine in broiler breeders. Avian Pathology 46, 300-308. Li, L., Wang, R., Liang, W., Gan, X., Huang, T., Huang, Y., Li, J., Shi, Y., Chen, M., Luo, H., 2013. Rare serotype occurrence and PFGE genotypic diversity of Streptococcus agalactiae isolated from tilapia in China. Veterinary microbiology 167, 719-724. Lindahl, G., Stålhammar-Carlemalm, M., Areschoug, T., 2005. Surface proteins of Streptococcus agalactiae and related proteins in other bacterial pathogens. Clinical Microbiology Reviews 18, 102-127. Liu, G., Zhang, W., Lu, C., 2013. Comparative genomics analysis of Streptococcus agalactiae reveals that isolates from cultured tilapia in China are closely related to the human strain A909. BMC genomics 14, 775.

171 Liu, G., Zhu, J., Chen, K., Gao, T., Yao, H., Liu, Y., Zhang, W., Lu, C., 2016. Development of Streptococcus agalactiae vaccines for tilapia. Diseases of aquatic organisms 122, 163-170. Locke, J.B., Aziz, R.K., Vicknair, M.R., Nizet, V., Buchanan, J.T., 2008. Streptococcus iniae M-like protein contributes to virulence in fish and is a target for live attenuated vaccine development. PLoS One 3, e2824. Locke, J.B., Colvin, K.M., Datta, A.K., Patel, S.K., Naidu, N.N., Neely, M.N., Nizet, V., Buchanan, J.T., 2007. Streptococcus iniae capsule impairs phagocytic clearance and contributes to virulence in fish. Journal of bacteriology 189, 1279-1287. Locke, J.B., Vicknair, M.R., Ostland, V.E., Nizet, V., Buchanan, J.T., 2010. Evaluation of Streptococcus iniae killed bacterin and live attenuated vaccines in hybrid striped bass through injection and bath immersion. Diseases of aquatic organisms 89, 117. Lowe, B.A., Miller, J.D., Neely, M.N., 2007. Analysis of the polysaccharide capsule of the systemic pathogen Streptococcus iniae and its implications in virulence. Infection and immunity 75, 1255-1264. Luo, Y., Frey, E.A., Pfuetzner, R.A., Creagh, A.L., Knoechel, D.G., Haynes, C.A., Finlay, B.B., Strynadka, N.C.J., 2000. Crystal structure of enteropathogenic Escherichia coli intimin–receptor complex. Nature 405, 1073-1077. Lusiastuti, A.M., Textor, M., Seeger, H., Akineden, Ö., Zschöck, M., 2014. The occurrence of Streptococcus agalactiae sequence type 261 from fish disease outbreaks of tilapia Oreochromis niloticus in Indonesia. Aquaculture Research 45, 1260-1263. Maione, D., Margarit, I., Rinaudo, C.D., Masignani, V., Mora, M., Scarselli, M., Tettelin, H., Brettoni, C., Iacobini, E.T., Rosini, R., 2005. Identification of a universal Group B Streptococcus vaccine by multiple genome screen. Science 309, 148-150. Margarit, I., Rinaudo, C.D., Galeotti, C.L., Maione, D., Ghezzo, C., Buttazzoni, E., Rosini, R., Runci, Y., Mora, M., Buccato, S., 2009. Preventing bacterial infections with pilus- based vaccines: the group B Streptococcus paradigm. Journal of Infectious Diseases 199, 108-115. Martins, E.R., Melo-Cristino, J., Ramirez, M., 2007. Reevaluating the serotype II capsular locus of Streptococcus agalactiae. J Clin Microbiol 45, 3384-3386. Mather, P., Arthington, A., 1991. An assessment of genetic differentiation among feral Australian tilapia populations. Marine and Freshwater Research 42, 721-728. McDevitt, C.A., Ogunniyi, A.D., Valkov, E., Lawrence, M.C., Kobe, B., McEwan, A.G., Paton, J.C., 2011. A molecular mechanism for bacterial susceptibility to zinc. PLoS Pathog 7, e1002357.

172 McIver, K.S., Heath, A.S., Scott, J.R., 1995. Regulation of virulence by environmental signals in group A streptococci: influence of osmolarity, temperature, gas exchange, and iron limitation on emm transcription. Infection and immunity 63, 4540-4542. Medini, D., Donati, C., Tettelin, H., Masignani, V., Rappuoli, R., 2005. The microbial pan- genome. Current opinion in genetics & development 15, 589-594. Melin, M., Di Paolo, E., Tikkanen, L., Jarva, H., Neyt, C., Käyhty, H., Meri, S., Poolman, J., Väkeväinen, M., 2010. Interaction of pneumococcal histidine triad proteins with human complement. Infection and immunity 78, 2089-2098. Merino, G., Barange, M., Blanchard, J.L., Harle, J., Holmes, R., Allen, I., Allison, E.H., Badjeck, M.C., Dulvy, N.K., Holt, J., 2012. Can marine fisheries and aquaculture meet fish demand from a growing human population in a changing climate? Global Environmental Change 22, 795-806. Mian, G., Godoy, D., Leal, C., Yuhara, T., Costa, G., Figueiredo, H., 2009. Aspects of the natural history and virulence of S. agalactiae infection in Nile tilapia. Veterinary microbiology 136, 180-183. Midtlyng, P.J., Grave, K., Horsberg, T.E., 2011. What has been done to minimize the use of antibacterial and antiparasitic drugs in Norwegian aquaculture? Aquaculture Research 42, 28-34. Millard, C.M., Baiano, J.C.F., Chan, C., Yuen, B., Aviles, F., Landos, M., Chong, R.S.M., Benedict, S., Barnes, A.C., 2012. Evolution of the Capsular Operon of Streptococcus iniae in Response to Vaccination. Applied and environmental microbiology 78, 8219- 8226. Mmanda, F.P., Zhou, S., Zhang, J., Zheng, X., An, S., Wang, G., 2014. Massive mortality associated with Streptococcus iniae infection in cage-cultured red drum (Sciaenops ocellatus) in Eastern China. African Journal of Microbiology Research 8, 1722-1729. Morona, J.K., Morona, R., Miller, D.C., Paton, J.C., 2002. Streptococcus pneumoniae capsule biosynthesis protein CpsB is a novel manganese-dependent phosphotyrosine-protein phosphatase. Journal of bacteriology 184, 577-583. Moschioni, M., Emolo, C., Biagini, M., Maccari, S., Pansegrau, W., Donati, C., Hilleringmann, M., Ferlenghi, I., Ruggiero, P., Sinisi, A., 2010. The two variants of the Streptococcus pneumoniae pilus 1 RrgA adhesin retain the same function and elicit cross-protection in vivo. Infection and immunity 78, 5033-5042. Muktar, Y., Tesfaye, S., Tesfaye, B., 2016. Present status and future prospects of fish vaccination: a review. J Veterinar Sci Technol 2, 299. Munang’andu, H.M., 2018. Intracellular Bacterial Infections: A Challenge for Developing Cellular Mediated Immunity Vaccines for Farmed Fish. Microorganisms 6, 33. 173 Murray, A.G., Peeler, E.J., 2005. A framework for understanding the potential for emerging diseases in aquaculture. Preventive veterinary medicine 67, 223-235. Muzzi, A., Masignani, V., Rappuoli, R., 2007. The pan-genome: towards a knowledge-based discovery of novel targets for vaccines and antibacterials. Drug discovery today 12, 429-439. Nagano, N., Nagano, Y., Taguchi, F., 2002. High expression of a C protein β antigen gene among invasive strains from certain clonally related groups of type Ia and Ib group B streptococci. Infection and immunity 70, 4643-4649. Najiah, M., Aqilah, N.I., Lee, K.L., Khairulbariyyah, Z., Mithun, S., Chowdhury, A.J.K., Shaharom-Harrison, F., Nadirah, M., 2012. Massive mortality associated with Streptococcus agalactiae infection in cage-cultured red hybrid tilapia Oreochromis niloticus in Como River, Kenyir Lake, Malaysia. Journal of Biological Sciences 12, 438-442. Nakatsugawa, T., 1983. A streptococcal disease of cultured flounder. Fish pathology 17, 281-285. Nawawi, R.A., Baiano, J., Barnes, A.C., 2008. Genetic variability amongst Streptococcus iniae isolates from Australia. Journal of fish diseases 31, 305-309. Nawawi, R.A., Baiano, J.C.F., Kvennefors, E.C.E., Barnes, A.C., 2009. Host-directed evolution of a novel lactate oxidase in Streptococcus iniae isolates from Barramundi (Lates calcarifer). Applied and environmental microbiology 75, 2908-2919. Naylor, R., Burke, M., 2005. Aquaculture and ocean resources: raising tigers of the sea. Nelson, A., Ries, J., Bagnoli, F., Dahlberg, S., Fälker, S., Rounioja, S., Tschöp, J., Morfeldt, E., Ferlenghi, I., Hilleringmann, M., 2007. RrgA is a pilus-associated adhesin in Streptococcus pneumoniae. Molecular microbiology 66, 329-340. Nobbs, A.H., Jenkinson, H.F., Everett, D.B., 2015. Generic determinants of Streptococcus colonization and infection. Infection, Genetics and Evolution 33, 361-370. Nobbs, A.H., Lamont, R.J., Jenkinson, H.F., 2009. Streptococcus adherence and colonization. Microbiology and Molecular Biology Reviews 73, 407-450. Novick, R.P., 2000. Sortase: the surface protein anchoring transpeptidase and the LPXTG motif. Trends in microbiology 8, 148-151. Nuccitelli, A., Rinaudo, C.D., Maione, D., 2015. Group B Streptococcus vaccine: state of the art. Therapeutic advances in vaccines, 2051013615579869. Nur-Nazifah, M., Sabri, M., Siti-Zahrah, A., 2014. Development and efficacy of feed-based recombinant vaccine encoding the cell wall surface anchor family protein of Streptococcus agalactiae against streptococcosis in Oreochromis sp. Fish & shellfish immunology 37, 193-200. 174 Ofek, I., Hasty, D.L., Sharon, N., 2003. Anti-adhesion therapy of bacterial diseases: prospects and problems. FEMS Immunology & Medical Microbiology 38, 181-191. Opiyo, M.A., Marijani, E., Muendo, P., Odede, R., Leschen, W., Charo-Karisa, H., 2018. A review of aquaculture production and health management practices of farmed fish in Kenya. International Journal of Veterinary Science and Medicine. Ormsby, M.J., Caws, T., Burchmore, R., Wallis, T., Verner-Jeffreys, D.W., Davies, R.L., 2016. Yersinia ruckeri isolates recovered from diseased Atlantic salmon (Salmo salar) in Scotland are more diverse than those from rainbow trout (Oncorhynchus mykiss) and represent distinct sub-populations. Applied and environmental microbiology, AEM. 01173-01116. Page, A.J., Cummins, C.A., Hunt, M., Wong, V.K., Reuter, S., Holden, M.T., Fookes, M., Falush, D., Keane, J.A., Parkhill, J., 2015. Roary: rapid large-scale prokaryote pan genome analysis. Bioinformatics 31, 3691-3693. Paixão, L., Caldas, J., Kloosterman, T.G., Kuipers, O.P., Vinga, S., Neves, A.R., 2015. Transcriptional and metabolic effects of glucose on Streptococcus pneumoniae sugar metabolism. Frontiers in microbiology 6. Paoletti, L.C., Madoff, L.C. 2002. Vaccines to prevent neonatal GBS infection. In: Seminars in Fetal and Neonatal Medicine, 315-323. Pasnik, D., Evans, J., Panangala, V., Klesius, P., Shelby, R., Shoemaker, C., 2005. Antigenicity of Streptococcus agalactiae extracellular products and vaccine efficacy. Journal of fish diseases 28, 205-212. Perera, R.P., Johnson, S.K., Collins, M.D., Lewis, D.H., 1994. Streptococcus iniae associated with mortality of Tilapia nilotica× T. aurea hybrids. Journal of Aquatic Animal Health 6, 335-340. Pesticides, A., Authority, V.M., 2014. APVMA guideline for autogenous vaccine permit. Petersen, T.N., Brunak, S., von Heijne, G., Nielsen, H., 2011. SignalP 4.0: discriminating signal peptides from transmembrane regions. Nature methods 8, 785-786. Petkau, A., Stuart-Edwards, M., Stothard, P., Van Domselaar, G., 2010. Interactive microbial genome visualization with GView. Bioinformatics 26, 3125-3126. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RT– PCR. Nucleic acids research 29, e45-e45. Pfaffl, M.W., Horgan, G.W., Dempfle, L., 2002. Relative expression software tool (REST©) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic acids research 30, e36-e36.

175 Pier, G.B., Madin, S.H., 1976. Streptococcus iniae sp. nov., a beta-hemolytic streptococcus isolated from an Amazon freshwater dolphin, Inia geoffrensis. International Journal of Systematic Bacteriology 26, 545-553. Pizza, M., Scarlato, V., Masignani, V., Giuliani, M.M., Arico, B., Comanducci, M., Jennings, G.T., Baldi, L., Bartolini, E., Capecchi, B., 2000. Identification of vaccine candidates against serogroup B meningococcus by whole-genome sequencing. Science 287, 1816-1820. Plotkin, S., Robinson, J.M., Cunningham, G., Iqbal, R., Larsen, S., 2017. The complexity and cost of vaccine manufacturing–an overview. Vaccine 35, 4064-4071. Ponte, S., Kelling, I., Jespersen, K.S., Kruijssen, F., 2014. The blue revolution in Asia: upgrading and governance in aquaculture value chains. World Development 64, 52- 64. Press, C.M., Lillehaug, A., 1995. Vaccination in European salmonid aquaculture: a review of practices and prospects. British Veterinary Journal 151, 45-69. Pretto-Giordano, L.G., Müller, E.E., Freitas, J.C.d., Silva, V.G.d., 2010. Evaluation on the Pathogenesis of Streptococcus agalactiae in Nile Tilapia (Oreochromis niloticus). Brazilian Archives of Biology and Technology 53, 87-92. Pridgeon, J.W., Klesius, P.H., 2013. Major bacterial diseases in aquaculture and their vaccine development. Animal Science Reviews 2012 141. Pridgeon, J.W., Zhang, D., 2014. Complete genome sequence of a virulent Streptococcus agalactiae strain, 138P, isolated from diseased Nile Tilapia. Genome announcements 2, e00295-00214. Puymège, A., Bertin, S., Guédon, G., Payot, S., 2015. Analysis of Streptococcus agalactiae pan-genome for prevalence, diversity and functionality of integrative and conjugative or mobilizable elements integrated in the tRNALys CTT gene. Molecular genetics and genomics 290, 1727-1740. Qi, W., 2002. Social and economic impacts of aquatic animal health problems in aquaculture in China. population 250, 750. Rajagopal, L., 2009. Understanding the regulation of Group B Streptococcal virulence factors. Rappuoli, R., 2001. Reverse vaccinology, a genome-based approach to vaccine development. Vaccine 19, 2688-2691. Raynes, J., Young, P., Proft, T., Williamson, D., Baker, E., Moreland, N., 2018. Protein adhesins as vaccine antigens for Group A Streptococcus. Pathogens and disease 76, fty016.

176 Reeves, H., Lotz, S., Kennedy, E., Randall, L., Coldham, N., La Ragione, R., 2013. Evaluation of an autogenous vaccine in cattle against Escherichia coli bearing the CTX-M-14 plasmid. Research in veterinary science 94, 419-424. Richards, V.P., Palmer, S.R., Pavinski Bitar, P.D., Qin, X., Weinstock, G.M., Highlander, S.K., Town, C.D., Burne, R.A., Stanhope, M.J., 2014. Phylogenomics and the dynamic genome evolution of the genus Streptococcus. Genome biology and evolution 6, 741-753. Rissman, A.I., Mau, B., Biehl, B.S., Darling, A.E., Glasner, J.D., Perna, N.T., 2009. Reordering contigs of draft genomes using the Mauve aligner. Bioinformatics 25, 2071-2073. Roberts, R.J., 2012. Fish pathology. John Wiley & Sons. Robinson, J.A., Meyer, F.P., 1966. Streptococcal fish pathogen. Journal of Bacteriology 92, 512. Robinson, T., Bu, D., Carrique-Mas, J., Fèvre, E., Gilbert, M., Grace, D., Hay, S., Jiwakanon, J., Kakkar, M., Kariuki, S., 2016. Antibiotic resistance is the quintessential One Health issue. Transactions of the Royal Society of Tropical Medicine and Hygiene 110, 377- 380. Rodkhum, C., Kayansamruaj, P., Pirarat, N., 2011. Effect of water temperature on susceptibility to Streptococcus agalactiae serotype Ia infection in Nile tilapia (Oreochromis niloticus). Thai J Vet Med 41, 309-314. Rosinski-Chupin, I., Sauvage, E., Mairey, B., Mangenot, S., Ma, L., Da Cunha, V., Rusniok, C., Bouchier, C., Barbe, V., Glaser, P., 2013. Reductive evolution in Streptococcus agalactiae and the emergence of a host adapted lineage. BMC genomics 14, 252. Sabat, A.J., Budimir, A., Nashev, D., Sá-Leão, R., Van Dijl, J.M., Laurent, F., Grundmann, H., Friedrich, A.W., Markers, E.S.G.o.E., 2013. Overview of molecular typing methods for outbreak detection and epidemiological surveillance. Euro Surveill 18, 20380. Salipante, S.J., Hall, B.G., 2011. The inadequacies of minimum spanning trees in molecular epidemiology. Journal of clinical microbiology, JCM. 00919-00911. Salvador, R., Muller, E.E., Freitas, J.C.d., Leonhadt, J.H., Pretto-Giordano, L.G., Dias, J.A., 2005. Isolation and characterization of Streptococcus spp. group B in Nile tilapias (Oreochromis niloticus) reared in hapas nets and earth nurseries in the northern region of Parana State, Brazil. Ciência Rural 35, 1374-1378. Sandin, C., Carlsson, F., Lindahl, G., 2006. Binding of human plasma proteins to Streptococcus pyogenes M protein determines the location of opsonic and non- opsonic epitopes. Molecular microbiology 59, 20-30. 177 Schneewind, O., Missiakas, D.M., 2012. Protein secretion and surface display in Gram- positive bacteria. Philosophical Transactions of the Royal Society of London B: Biological Sciences 367, 1123-1139. Seemann, T., 2014. Prokka: rapid prokaryotic genome annotation. Bioinformatics 30, 2068- 2069. Seib, K.L., Zhao, X., Rappuoli, R., 2012. Developing vaccines in the era of genomics: a decade of reverse vaccinology. Clinical Microbiology and Infection 18, 109-116. Shafeeq, S., Kloosterman, T.G., Kuipers, O.P., 2011. Transcriptional response of Streptococcus pneumoniae to Zn2+ limitation and the repressor/activator function of AdcR. Metallomics 3, 609-618. Sharma, A., Arya, D.K., Sagar, V., Bergmann, R., Chhatwal, G.S., Johri, A.K., 2012. Identification of potential universal vaccine candidates against group A Streptococcus by using high throughput in silico and proteomics approach. Journal of proteome research 12, 336-346. Shelburne, S.A., Davenport, M.T., Keith, D.B., Musser, J.M., 2008. The role of complex carbohydrate catabolism in the pathogenesis of invasive streptococci. Trends in microbiology 16, 318-325. Sheppard, A.E., Vaughan, A., Jones, N., Turner, P., Turner, C., Efstratiou, A., Patel, D., Walker, A.S., Berkley, J.A., Crook, D.W., 2016. Capsular typing method for Streptococcus agalactiae using whole-genome sequence data. Journal of clinical microbiology 54, 1388-1390. Shoemaker, C.A., Klesius, P.H., Evans, J.J., 2001. Prevalence of Streptococcus iniae in tilapia, hybrid striped bass, and channel catfish on commercial fish farms in the United States. American journal of veterinary research 62, 174-177. Siegel, S.D., Reardon, M.E., Ton-That, H. 2017. Anchoring of LPXTG-Like Proteins to the Gram-Positive Cell Wall Envelope, In: Bagnoli, F., Rappuoli, R. (Eds.) Protein and Sugar Export and Assembly in Gram-positive Bacteria. Springer International Publishing, Cham, 159-175. Six, A., Bellais, S., Bouaboud, A., Fouet, A., Gabriel, C., Tazi, A., Dramsi, S., Trieu-Cuot, P., Poyart, C., 2015. Srr2, a multifaceted adhesin expressed by ST-17 hypervirulent Group B Streptococcus involved in binding to both fibrinogen and plasminogen. Molecular microbiology 97, 1209-1222. Slotved, H.-C., Kong, F., Lambertsen, L., Sauer, S., Gilbert, G.L., 2007. Serotype IX, a proposed new Streptococcus agalactiae serotype. Journal of clinical microbiology 45, 2929-2936.

178 Sommerset, I., Krossøy, B., Biering, E., Frost, P., 2014. Vaccines for fish in aquaculture. Expert review of vaccines. Spellerberg, B., Martin, S., Brandt, C., Lütticken, R., 2000. The cyl genes of Streptococcus agalactiae are involved in the production of pigment. FEMS microbiology letters 188, 125-128. Stamatakis, A., 2014. RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 30, 1312-1313. Stanton-Cook, M., Ben Zakour, N., Alikhan, N., Beatson, S. 2013. SeqFindR. Stentiford, G.D., Sritunyalucksana, K., Flegel, T.W., Williams, B.A., Withyachumnarnkul, B., Itsathitphaisarn, O., Bass, D., 2017. New paradigms to help solve the global aquaculture disease crisis. PLoS pathogens 13, e1006160. Stoffregen, D.A., Backman, S.C., Perham, R.E., Bowser, P.R., Babish, J.G., 1996. Initial disease report of Streptococcus iniae infection in hybrid striped (sunshine) bass and successful therapeutic intervention with the fluoroquinolone antibacterial enrofloxacin. Journal of the World Aquaculture Society 27, 420-434. Suanyuk, N., Kong, F., Ko, D., Gilbert, G.L., Supamattaya, K., 2008. Occurrence of rare genotypes of Streptococcus agalactiae in cultured red tilapia Oreochromis sp. and Nile tilapia O. niloticus in Thailand—Relationship to human isolates? Aquaculture 284, 35-40. Suanyuk, N., Sukkasame, N., Tanmark, N., Yoshida, T., Itami, T., Thune, R.L., Tantikitti, C., Supamattaya, K., 2010. Streptococcus iniae infection in cultured Asian sea bass (Lates calcarifer) and red tilapia (Oreochromis sp.) in southern Thailand. Songklanakarin J Sci Technol 32, 341-348. Sudheesh, P.S., LaFrentz, B.R., Call, D.R., Siems, W.F., LaPatra, S.E., Wiens, G.D., Cain, K.D., 2007. Identification of potential vaccine target antigens by immunoproteomic analysis of a virulent and a non-virulent strain of the fish pathogen Flavobacterium psychrophilum. Diseases of aquatic organisms 74, 37-47. Sullivan, M.J., Petty, N.K., Beatson, S.A., 2011. Easyfig: a genome comparison visualizer. Bioinformatics 27, 1009-1010. Sun, J., Fang, W., Ke, B., He, D., Liang, Y., Ning, D., Tan, H., Peng, H., Wang, Y., Ma, Y., 2016. Inapparent Streptococcus agalactiae infection in adult/commercial tilapia. Scientific reports 6. Talukdar, S., Zutshi, S., Prashanth, K.S., Saikia, K.K., Kumar, P., 2014. Identification of potential vaccine candidates against Streptococcus pneumoniae by reverse vaccinology approach. Applied biochemistry and biotechnology 172, 3026-3041.

179 Tettelin, H., Masignani, V., Cieslewicz, M.J., Donati, C., Medini, D., Ward, N.L., Angiuoli, S.V., Crabtree, J., Jones, A.L., Durkin, A.S., 2005. Genome analysis of multiple pathogenic isolates of Streptococcus agalactiae: implications for the microbial “pan- genome”. Proceedings of the National Academy of Sciences of the United States of America 102, 13950-13955. Thorpe, H.A., Bayliss, S.C., Sheppard, S.K., Feil, E.J., 2017. Piggy: A Rapid, Large-Scale Pan-Genome Analysis Tool for Intergenic Regions in Bacteria. bioRxiv. Toranzo, A.E., Magariños, B., Romalde, J.L., 2005. A review of the main bacterial fish diseases in mariculture systems. Aquaculture 246, 37-61. Toranzo, A.E., Romalde, J.L., Magariños, B., Barja, J.L., 2009. Present and future of aquaculture vaccines against fish bacterial diseases. Treangen, T.J., Ondov, B.D., Koren, S., Phillippy, A.M., 2014. The Harvest suite for rapid core-genome alignment and visualization of thousands of intraspecific microbial genomes. Genome Biol 15, 524. Troell, M., Naylor, R.L., Metian, M., Beveridge, M., Tyedmers, P.H., Folke, C., Arrow, K.J., Barrett, S., Crépin, A.-S., Ehrlich, P.R., 2014. Does aquaculture add resilience to the global food system? Proceedings of the National Academy of Sciences 111, 13257- 13263. Tuson, H.H., Weibel, D.B., 2013. Bacteria–surface interactions. Soft matter 9, 4368-4380. Ulmer, J.B., Valley, U., Rappuoli, R., 2006. Vaccine manufacturing: challenges and solutions. Nature biotechnology 24, 1377-1383. Untergasser, A., Cutcutache, I., Koressaar, T., Ye, J., Faircloth, B.C., Remm, M., Rozen, S.G., 2012. Primer3—new capabilities and interfaces. Nucleic acids research 40, e115-e115. Van Boeckel, T.P., Glennon, E.E., Chen, D., Gilbert, M., Robinson, T.P., Grenfell, B.T., Levin, S.A., Bonhoeffer, S., Laxminarayan, R., 2017. Reducing antimicrobial use in food animals. Science 357, 1350-1352. Vandamme, P., Devriese, L., Pot, B., Kersters, K., Melin, P., 1997. Streptococcus difficile is a nonhemolytic group B, type Ib Streptococcus. International Journal of Systematic and Evolutionary Microbiology 47, 81-85. Vayssier-Taussat, M., Albina, E., Citti, C., Cosson, J.F., Jacques, M.-A., Lebrun, M.-H., Le Loir, Y., Ogliastro, M., Petit, M.-A., Roumagnac, P., 2014. Shifting the paradigm from pathogens to pathobiome: new concepts in the light of meta-omics. Frontiers in cellular and infection microbiology 4, 29.

180 Vendrell, D., Balcázar, J.L., Ruiz-Zarzuela, I., De Blas, I., Gironés, O., Múzquiz, J.L., 2006. Lactococcus garvieae in fish: a review. Comparative immunology, microbiology and infectious diseases 29, 177-198. Verner-Jeffreys, D., Wallis, T., Cano Cejas, I., Ryder, D., Haydon, D., Domazoro, J.F., Dontwi, J., Field, T., Adjei-Boteng, D., Wood, G., 2017. Streptococcus agalactiae Multilocus sequence type 261 is associated with mortalities in the emerging Ghanaian tilapia industry. Journal of Fish Diseases. Verschuere, L., Rombaut, G., Sorgeloos, P., Verstraete, W., 2000. Probiotic bacteria as biological control agents in aquaculture. Microbiology and molecular biology reviews 64, 655-671. Vogel, C., Marcotte, E.M., 2012. Insights into the regulation of protein abundance from proteomic and transcriptomic analyses. Nature Reviews Genetics 13, 227. Walker, M.J., Barnett, T.C., McArthur, J.D., Cole, J.N., Gillen, C.M., Henningham, A., Sriprakash, K.S., Sanderson-Smith, M.L., Nizet, V., 2014. Disease manifestations and pathogenic mechanisms of group A Streptococcus. Clinical microbiology reviews 27, 264-301. Wamala, S., Mugimba, K., Mutoloki, S., Evensen, Ø., Mdegela, R., Byarugaba, D., Sørum, H., 2018. Occurrence and antibiotic susceptibility of fish bacteria isolated from Oreochromis niloticus (Nile tilapia) and Clarias gariepinus (African catfish) in Uganda. Fisheries and Aquatic Sciences 21, 6. Watanabe, M., Miyake, K., Yanae, K., Kataoka, Y., Koizumi, S., Endo, T., Ozaki, A., Iijima, S., 2002. Molecular characterization of a novel beta1,3-galactosyltransferase for capsular polysaccharide synthesis by Streptococcus agalactiae type Ib. Journal of biochemistry 131, 183-191. Welch, T.J., LaPatra, S., 2016. Yersinia ruckeri lipopolysaccharide is necessary and sufficient for eliciting a protective immune response in rainbow trout (Oncorhynchus mykiss, Walbaum). Fish & shellfish immunology 49, 420-426. Wizemann, T.M., Adamou, J.E., Langermann, S., 1999. Adhesins as targets for vaccine development. Emerging infectious diseases 5, 395. Woo, P.T., Gregory, D.W.B., 2014. Diseases and disorders of finfish in cage culture. CABI. Wyres, K.L., Wick, R.R., Gorrie, C., Jenney, A., Follador, R., Thomson, N.R., Holt, K.E., 2016. Identification of Klebsiella capsule synthesis loci from whole genome data. Microbial genomics 2, e000102. Yamamoto, S., Miyake, K., Koike, Y., Watanabe, M., Machida, Y., Ohta, M., Iijima, S., 1999. Molecular characterization of type-specific capsular polysaccharide biosynthesis genes of Streptococcus agalactiae type Ia. J Bacteriol 181, 5176-5184. 181 Yang, Q., Zhang, M., Harrington, D.J., Black, G.W., Sutcliffe, I.C., 2010. A proteomic investigation of Streptococcus agalactiae grown under conditions associated with neonatal exposure reveals the upregulation of the putative virulence factor C protein β antigen. International Journal of Medical Microbiology 300, 331-337. Yang, Q., Zhang, M., Harrington, D.J., Black, G.W., Sutcliffe, I.C., 2011. A proteomic investigation of Streptococcus agalactiae reveals that human serum induces the C protein β antigen and arginine deiminase. Microbes and infection 13, 757-760. Yanong, R.P., 2011. Use of vaccines in finfish aquaculture. US Department of Agriculture, Cooperative Extension Service, University of Florida, IFAS, Florida A. & M. University Cooperative Extension Program, and Boards of County Commissioner, Report FA156. Available: http://edis. ifas. ufl. edu/fa156. Yanong, R.P.E., Francis-Floyd, R., 2010. Streptococcal infections of fish. Yao, K., Poulsen, K., Maione, D., Rinaudo, C.D., Baldassarri, L., Telford, J.L., Sørensen, U.B.S., Kilian, M., Group, D.S., 2013. Capsular gene typing of Streptococcus agalactiae compared to serotyping by latex agglutination. Journal of clinical microbiology 51, 503-507. Ye, X., Li, J., Lu, M., Deng, G., Jiang, X., Tian, Y., Quan, Y., Jian, Q., 2011. Identification and molecular typing of Streptococcus agalactiae isolated from pond-cultured tilapia in China. Fisheries Science 77, 623-632. Yi, T., Li, Y.-W., Liu, L., Xiao, X.-X., Li, A.-X., 2014. Protection of Nile tilapia (Oreochromis niloticus L.) against Streptococcus agalactiae following immunization with recombinant FbsA and α-enolase. Aquaculture 428–429, 35-40. Yuasa, K., Kitancharoen, N., Kataoka, Y., Al-Murbaty, F.A., 1999. Streptococcus iniae, the causative agent of mass mortality in rabbitfish Siganus canaliculatus in Bahrain. Journal of Aquatic Animal Health 11, 87-93. Zamri-Saad, M., Amal, M.N.A., Siti-Zahrah, A., Zulkafli, A.R., 2014. Control and prevention of streptococcosis in cultured tilapia in Malaysia: A review. Pertanika Journal of Tropical Agricultural Science 37, 389-410. Zhang, B.-c., Zhang, J., Sun, L., 2014. Streptococcus iniae SF1: complete genome sequence, proteomic profile, and immunoprotective antigens. PloS one 9, e91324. Zhang, D., Li, A., Guo, Y., Zhang, Q., Chen, X., Gong, X., 2013. Molecular characterization of Streptococcus agalactiae in diseased farmed tilapia in China. Aquaculture 412, 64- 69.

182