MLL-AF4 Binds Directly to a BCL-2 Specific Enhancer
Total Page：16
File Type：pdf, Size：1020Kb
Experimental Hematology 2016;-:-–- MLL-AF4 binds directly to a BCL-2 specific enhancer and modulates H3K27 acetylation Laura Godfreya, Jon Kerrya, Ross Thornea, Emmanouela Repapib, James O.J. Daviesa, Marta Tapiaa, Erica Ballabioa, Jim R. Hughesa, Huimin Gengc, Marina Konoplevad, and Thomas A. Milnea aWeatherall Institute of Molecular Medicine, MRC Molecular Haematology Unit, University of Oxford, Headington, Oxford, UK; bWeatherall Institute of Molecular Medicine, Computational Biology Research Group, University of Oxford, Headington, Oxford, UK; cDepartment of Laboratory Medicine, University of California San Francisco, San Francisco, CA; dDepartment of Leukemia, University of Texas MD Anderson Cancer Center, Houston, TX (Received 27 July 2016; revised 21 October 2016; accepted 2 November 2016) Survival rates for children and adults carrying mutations in the Mixed Lineage Leukemia (MLL) gene continue to have a very poor prognosis. The most common MLL mutation in acute lympho- blastic leukemia is the t(4;11)(q21;q23) chromosome translocation that fuses MLL in-frame with the AF4 gene producing MLL-AF4 and AF4-MLL fusion proteins. Previously, we found that MLL-AF4 binds to the BCL-2 gene and directly activates it through DOT1L recruitment and increased H3K79me2/3 levels. In the study described here, we performed a detailed analysis of MLL-AF4 regulation of the entire BCL-2 family. By measuring nascent RNA production in MLL-AF4 knockdowns, we found that of all the BCL-2 family genes, MLL-AF4 directly con- trols the active transcription of both BCL-2 and MCL-1 and also represses BIM via binding of the polycomb group repressor 1 (PRC1) complex component CBX8. We further analyzed MLL- AF4 activation of the BCL-2 gene using Capture-C and identified a BCL-2-specific enhancer, consisting of two clusters of H3K27Ac at the 30 end of the gene. Loss of MLL-AF4 activity re- sults in a reduction of H3K79me3 levels in the gene body and H3K27Ac levels at the 30 BCL-2 enhancer, revealing a novel regulatory link between these two histone marks and MLL-AF4- mediated activation of BCL-2. Copyright Ó 2016 ISEH - International Society for Experi- mental Hematology. Published by Elsevier Inc. This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/). Survival rates for children diagnosed with acute lympho- The most common MLL rearrangement (MLLr) in ALL is blastic leukemia (ALL) have drastically improved and, in the t(4;11)(q21;q23) chromosome translocation that fuses some cases, are now approaching 90% [1,2]. However, MLL in-frame with the AF4 gene, producing MLL-AF4 even with this progress, adults with ALL still have a and AF4-MLL fusion proteins [8]. The role of AF4-MLL very poor prognosis [3], and childhood ALL cases that in leukemogenesis is controversial, as AF4-MLL has trans- relapse often exhibit drug resistance and remain difficult formation capabilities [9], but is expressed in only 50% to to treat [4]. In addition, specific subgroups of ALL pa- 80% of patients [10,11] and thus may not be necessary for tients, especially those carrying rearrangements of the leukemic maintenance. MLL-AF4, however, is essential for mixed lineage leukemia (MLL)gene[5,6], still have leukemic maintenance [12] and this, combined with the very poor survival outcomes [5]. Even with the advent fact that t(4;11) leukemias have very few cooperating muta- of novel therapeutic approaches such as CAR T-cell ther- tions [10], suggests that a detailed understanding of the func- apy, MLL ALLs often rapidly relapse as acute myeloid tion of MLL-AF4 may aid in the design of targeted therapies. leukemia (AML) [7], and thus, treatment of MLL ALL pa- The MLL-AF4 fusion protein binds to gene targets and tients remains an unmet need. is proposed to cause inappropriate gene activation through multiple transcription elongation and epigenetic mecha- nisms [13–16]. We recently reported that MLL-AF4 acti- Offprint requests to: Thomas A. Milne, MRC Molecular Haematology Unit, Weatherall Institute of Molecular Medicine, John Radcliffe Hospital, vates important gene targets such as RUNX1, HOXA9, University of Oxford, Oxford OX3 9DS, UK; E-mail: thomas.milne@imm. and BCL-2 [17,18], mainly through recruitment of the dis- ox.ac.uk ruptor of telomeric silencing 1-like (DOT1L) protein (the 0301-472X/Copyright Ó 2016 ISEH - International Society for Experimental Hematology. Published by Elsevier Inc. This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/). http://dx.doi.org/10.1016/j.exphem.2016.11.003 2 L. Godfrey et al./ Experimental Hematology 2016;-:-–- only known histone 3 lysine 79 methylation methyltransfer- repressor 1 (PRC1) component CBX8, although this has lit- ase [19]) and increased H3K79me2/3 levels [18]. Past work tle overall effect on BIM protein levels. We further analyze has suggested that MLL-AF4 leukemias are particularly MLL-AF4 activation of the BCL-2 gene using Capture-C sensitive to loss of BCL-2 activity [20], and we were able and identify a BCL-2 enhancer. Loss of MLL-AF4 results to extend this observation by illustrating that BCL-2 is a in a concurrent reduction of H3K27Ac at the enhancer as key therapeutic target in MLL-AF4 leukemias [18]. well as H3K79me3 in the gene body, revealing a novel BCL-2 is part of a family of proteins that controls interplay between these two histone marks in MLL-AF4- apoptosis, and perturbed expression of BCL-2 family mem- mediated activation of BCL-2. bers is associated with tumorigenesis and resistance to can- cer treatments [21–23]. The BCL-2 family is divided into antiapoptotic factors (e.g., BCL-2, MCL-1, BCL-XL, Methods BCL-w, BCL2-A1), pore-forming proapoptotic factors (BAX and BAK), and BH3-only proteins (e.g., BIM, Cell lines and cultures BID, and BAD). Recent work suggests that the primary SEM cells [36] were purchased from DSMZ (www.cell-lines.de) role of the BH3-only proteins is to sequester the antiapop- and cultured in Iscove’s modified Dulbecco’s medium (IMDM) supplemented with 10% fetal calf serum. For treatment studies, totic factors (e.g., BCL-2), allowing the initiation of mito- SEM cells were treated with the DOT1L inhibitor EPZ5676 (Epi- chondrial outer membrane permeabilization (MOMP), the zyme) for 7 days, with medium and inhibitor changes on days 0, 3, first irreversible step of apoptosis [24]. Therefore, maintain- and 6. SEM cells were seeded at a concentration of 0.3 Â 106 cell/ ing normal cellular homeostasis requires maintenance of a mL on days 0 and 3 and at a concentration of 0.7 Â 106 cell/mL on precise balance between antiapoptotic and BH3-only pro- day 6 prior to harvesting on day 7. tein levels for the control of cell survival. The MLL-AF4 protein disrupts this balance by directly binding to the RNAi assays BCL-2 gene [17,18,25,26], causing increased gene expres- MLL-AF4 siRNA was performed as described [18], and sequences sion and elevated BCL-2 protein levels [18]. were obtained from Thomas et al. [12]. ABT-199 (also known as venetoclax) is a highly spe- cific BH3 mimetic that can preferentially target BCL-2 ac- Reverse transcription polymerase chain reaction tivity [27]. In ALL, MLL-AF4 leukemias are distinctly Reverse transcription polymerase chain reaction (RT-PCR) SYBR sensitive to treatment with venetoclax alone [18,28]. How- green primers and Taqman primer/probe sets are as previously described [17,18] except for the following SYBR green primer ever, even among MLLr samples, a subset either is resis- sets used in this study: tant to venetoclax [28] or relapses after an early initial b2M forward: TGCTGTCTCCATGTTTGATGTATCT response [18]. Resistance to BH3 mimetic monotherapy b2M reverse: TCTCTGCTCCCCACCTCTAAGT usually occurs via upregulation of alternative antiapop- YWHAZ forward: ACTTTTGGTACATTGTGGCTTCAA totic factors such as MCL-1 and BCL-XL [29–33]. YWHAZ reverse: CCGCCAGGACAAACCAGTAT Notably, high-level MCL-1 gene expression is also known BCL-2 (no2) forward: GTGGATGACTGAGTACCTGAAC to be associated with resistance to treatment in MLLr sam- BCL-2 (no2) reverse: GAGACAGCCAGGAGAAATCAA ples [34]. We found that the venetoclax treatment strongly MCL1 (no2) forward: TGCTTCGGAAACTGGACATC synergized with standard chemotherapeutic agents, likely MCL1 (no2) reverse: GTTACGCCGTCGCTGAAA in part because of the treatment-induced reduction of MCL1 (no3) forward: AAACGGGACTGGCTAGTTAAA MCL-1 and BCL-XL protein levels [18].Moreinterest- MCL1 (no3) reverse: CATTCCTGATGCCACCTTCTA MCL1 (no4) forward: GCATCGAACCATTAGCAGAAAG ingly, we also found that venetoclax treatment synergized MCL1 (no4) reverse: CTCTACATGGAAGAACTCCACAA with DOT1L inhibitors (also confirmed in a more recent study [35]), although it is unclear if the mechanism of syn- ergy is through downregulation of other BCL-2 family Patient microarray gene expression data proteins. In our past work, other BCL-2 family genes We analyzed a microarray gene expression data set from a St. Jude 5 such as MCL-1, BIM, BAX,andBCL-XL did not appear ALL cohort [37] (n 154) that includes these patient subsets: 18 to be regulated by MLL-AF4 or DOT1L [18], but admit- BCR-ABL1, 8 E2A-PBX1, 15 MLLr, 24 TEL-AML1, 26 hyperdi- ploid, 11 CRLF2, 11 ERG, and 7 other. tedly this could have been due to the sensitivity of the as- says used for the analysis. Western blot analysis To more carefully analyze MLL-AF4- and DOT1L- Western blot analysis was performed as previously described [18]. mediated regulation of BCL-2 family genes, here we use nascent RNA sequencing (RNA-seq) coupled with MLL- Chromatin immunoprecipitation assays and -seq AF4 siRNA knockdowns and DOT1L inhibitor treatments Chromatin immunoprecipitation (ChIP) and ChIP-seq experi- to illustrate that MLL-AF4 directly activates both BCL-2 ments were performed as previously described [17,18,38],and and MCL-1.