DOCSLIB.ORG

Fusion of PAX3 to a Member of the Forkhead Family of Transcription Factors in Human Alveolar Rhabdomyosarcoma1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Fusion of PAX3 to a Member of the Forkhead Family of Transcription Factors in Human Alveolar Rhabdomyosarcoma1 [CANCER RESEARCH 53, 5108-5112. November 1. 1993] Advances in Brief Fusion of PAX3 to a Member of the Forkhead Family of Transcription Factors in Human Alveolar Rhabdomyosarcoma1 David N. Shapiro,2 Jack E. Sublett, Baitao Li, James R. Downing, and Clayton W. Naeve Departments of Experimental Oncology /I). N. S., J. E. S., B. L.¡.Hcmatology/Oncology ¡D.N. S./, Pathology [J. R. D.¡, Tumor Cell Biology /J. R. D./, anil Virology and Molecular Biology fC. W. N.¡,St. Jude Children's Research Hospital. Memphis. Tennessee 38105, and Departments of Pediatrics [D. N. S.¡and Pathology /./. R. D.. C. W. N.J, University of Tennessee College of Medicine. Memphis. Tennessee 38163 Abstract alveolar rhabdomyosarcoma and show that this rearrangement results in the creation of a chimeric fusion gene composed of 5' PAX3 Alveolar rhabdomyosarcoma, a malignant tumor of skeletal muscle, is sequences juxtaposed to 3' sequences derived from a previously un- characterized by a chromosomal translocation, t(2;13)(q35;ql4). This described member of the forkhead family of transcription factors, translocation Is associated with a structural rearrangement of the gene provisionally designated ALV (7). In PAX3-ALV, the putative 3' tran encoding /' 1 \ ¡.a presumed transcriptional regulator expressed exclu sively during embryogenesis. The breakpoint results in a fusion between scriptional activation domain of PAX3 is replaced by the bisected PAX3 and a gene provisionally named ALV, a novel member of the fork- forkhead binding domain of ALV, while retaining the structural integ head family of transcription factors. In PAX3-ALV, the structural integrity rity of the PAX3 paired box and homeodomain. Thus the chimeric of both /' l \ i DNA-binding regions, the paired box and homeodomain, are protein product of this translocation has the potential to promote retained while the putative transcriptional activation domain of PAXÃŒis tumorigenesis by acting as an aberrant transcription factor, consistent replaced by the bisected forkhead DNA-binding domain of ALV. Forma with the molecular abnormalities in other solid tumor and several tion of chimeric transcription factors has now been implicated in diverse leukemia-associated rearrangements. human tumors of myogenic, hematopoietic, neuroectodermal, and adipo- cytic origin, suggesting that transcriptional deregulation is a common Materials and Methods mechanism of tumorigenesis. Cell Lines. Alveolar rhabdomyosarcoma cell lines containing the (2;13) Introduction translocation are RH3, RH4, RH5, RH18, RH28, and RH30. Some have Malignant transformation occurs because of the accumulation of previously been reported as case 5 (RH3), case 11 (RH4), case 3 (RH18), case 4 (RH28), and case 13 (RH30) (8). Control cell lines without this tumor- somatic mutations, often made apparent cytogenetically by the acqui sition of tumor-specific chromosomal translocations. Two frequent specific translocation include the embryonal rhabdomyosarcoma cell RH1 [previously referred to as BG (9)] as well as the Ewing sarcoma cell line EWS consequences of these chromosomal events, which have been most 3. All cell lines were grown in RPMI 1640 supplemented with 10% fetal calf thoroughly studied in hematopoietic malignancies, are oncogene ac serum and 50 /xg/ml gentamicin. tivation or the creation of a novel oncogenic fusion protein. There is RNA Analysis. Total cellular RNA was isolated from the indicated cells less information available regarding the genes involved in specific and fractionated in a 1% agarose-formaldehyde gel. After electrophoresis, the translocations of solid tumors. This situation results in part from the RNA was transferred to Duralon-UV nylon filters (Stratagene, La Jolla, CA), technically more challenging task of obtaining conventional cytoge- UV-cross-linked, and sequentially hybridized to ^-P-labeled probes as de netic analyses from these neoplasms. Nevertheless, recurrent chromo scribed in Fig. 1. Autoradiography was for 96 h (Fig. \A) or 48 h (Fig. Iß)at -70°C. The size of mRNA was estimated using a RNA ladder (GIBCO BRL, somal translocations have been observed in some solid tumors, par Gaithersburg. MD). ticularly sarcomas. Recently, the translocation breakpoints in both cDNA Cloning. Separate Agt22AcDNA1 libraries were prepared with 2 /ng Ewing sarcoma and myxoid liposarcoma have been molecularly de of polyadenylated mRNA from the RH18 and RH30 alveolar rhabdomyosar fined and chimeric fusion genes with the properties of transcriptional coma cell lines using oligodeoxythymidylale primers with a GIBCO BRL regulators have been identified in each case (1, 2). Superscript cDNA synthesis kit. Sized and adapted inserts were directionally The molecular basis of the t(2;13)(q35;ql4) in alveolar rhabdomyo- cloned in the Àvector with a Sail adapter. Libraries were screened with a sarcoma, a malignant tumor derived from skeletal muscle precursors, full-length murine Pax-3 cDNA probe under conditions of normal stringency. has been shown to consistently involve a rearrangement of the 5' Positive A clones were plaque purified and the inserts were cloned into Noti/ portion of the PAX3 gene on chromosome 2q35 (3). These studies .SV;/I-digcsted pBlucscripl SK+ (Stratagene). demonstrated that both regions of the PAX3 gene with DNA-binding Inserts from positive clones from both cell lines were subcloned into activity, the paired box and the paired-type homeodomain, are juxta M13mpl8 and cycle sequencing reactions performed using Prism chemistry posed to previously uncharacterized sequences on chromosome 13ql4 (Applied Biosystems. Inc., Foster City, CA) and protocols recommended by the manufacturer. Samples were electrophoresed, detected, and analyzed on an (4). The involvement of PAX3 in the t(2;13) is of interest not only AB1 373 DNA sequencer. Analysis of the completed consensus nucleic acid because of its role as a presumed transcriptional regulator during early and peptide sequences was performed using the Intelligenetics and GCG soft neuromuscular differentiation but also in the context of the recently ware packages as well as BLAST algorithms. ALV cDNA clones were also demonstrated oncogenic potential of several murine Pax genes, in isolated from a cell line without the t(2;13) by screening the UOCB-1 pre-B cluding Pax-3 (5, 6). We now describe an analysis of the t(2;13) in cell ALL cDNA library in AZAP. Rescued phagemid DNA containing ALV inserts was subcloned into M13 prior to sequencing. Received 9/29/93; accepted 10/1/93. PCR Analysis. To verify the PAX3-ALV fusion mRNA, amplification was The cosls of publication of this article were defrayed in part by the payment of page carried out with primers corresponding to positions 1137 to 1158 (forward charges. This article must therefore be hereby marked advertisement in accordance with primer) in PAX3 and positions 1474 to 1495 (reverse primer) in ALV in 18 U.S.C. Section 1734 solely to indicate this fact. 1Supported in part by Grant CA-23099 and Cancer Center CORE Grant CA-21765 reactions containing approximately 10 ng of target cDNA. The amplification from the NIH and by the American Lebanese Syrian Associated Charities (ALSAC). 2 To whom requests for reprints should he addressed, at the Department of Experi mental Oncology. St. Jude Children's Research Hospital. 332 North Lauderdale. Mem 1The abbreviations used are: cDNA, complementary DNA; ALL, acute lymphohlas- phis, TN 38105. toid leukemia: PCR. polymerase chain reaction. 51 OS Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 1993 American Association for Cancer Research. mX3 AND FORKHEAD IN ALVEOLAR RHABDOMYOSARCOMA MTTLAOAVPHMMRPGP 10 CACCTQQATATAATTTCCQAQCQAAQTQCCCCCAQQATQACCACOCTQOCCQQCQCTOTOCCCAOOATQATQCQOCCOQQCCCQ 84 QQNYPRSQFPLEVSTPLQOQRVNQLQQV 44 QQQCAQAACTACCCQCOTAQCQQQTTCCCQCTQQAAQTQTCCACTCCCCTCQOCCAQQQCCQCQTCAACCAQCTCQQCOQCQTT 168 F VEMA G PCV T TTAINQRPLPNHIRHKTCAACQQCAQQCCOCTQCCCAACCACATCCQCCACAAQAI TCQTQQAQATQQCCCH ACCH ACQQC AITCRCOQCCCTQCOTCA1 TC72252 S l R P O A 100 ;ATACOTCCTQOTOCC 336 IGGSKPKOVTTPDVEKKIEEYKRENPGM 128 ATCQQCQQCAQCAAQCCCAAaCAQGTGACAACQCCTQACQTOGAGAAQAAAATTaAGQAATACAAAAGAGAOAACCCGGGCATQ 420 F S W E IRDKLLKDAVCDRNTVPSVSS I SR IM TTCAGCTGGQAAATCCOAQACAAATTACTCAAQQACQCGGTCTGTGATCGAAACACCGTGCCGTCAGTQAGTTCCATCAGCCGC 504 I LRSKFQKGEEEEAOLERKEAEESEKKA 164 ATCCTQAGAAaTAAATTCGGGAAAGGTGAAGAQGAQGAGGCCGACTTGGAQAGQAAGGAGGCAGAGGAAAGCGAGAAGAAQGCC see DSEPD 212 lACTCTGAACCAGAT 672 LPLKRKORRSRTTFTAEOLEELEHAFER 240 TTACCACTAAAGAQQAAACAQCQCAGAAGCCQAACCACCTTCACAGCAGAACAGCTGGAGGAACTQQAGCGTGCTTTTGAGAGA 766 266 640 296 AACCOCCQTaCAAQATOQAQQAAQCAAGCTQGGGCCAATCAACTGATGGCTTTCAACCATCTCATTCCCGGGGGGTTCCCTCCC 924 TAMPTLPTYQLSETSYQPTSIPQAVSDP 324 ACTOCCATOCCOACCTTQCCAACGTACCAGCTOTCGGAOACCTCTTACCAOCCCACATCTATTCCACAAGCTGTGTCAGATCCC 1008 SSTVHRPOPLPPSTVHOST I PSNPDSSS 362 AQCAQCACCGTTCACAQACCTCAACCQCTTCCTCCAAaCACTGTACACCAAAQCACGATTCCTTCCAACCCAGACAQCAGCTCT 1092 360 1176 NPT l G N G L S P Q SI l HVQ 406 AACCCCACCATTOGCAATOaCCTCTCACCTCAO»NCTACACAQCAAGTTCATTCGTOTGCAQNEGTGK83WWMLNPEQGK3GKSPRRRAA AATTCAATTR COTH CATN AA TLCTOS TCCLHSKF 1260 436 AATâAAaaAACTGOAAAAAQTTCTTQaTQQATQCTCAATCCAQAaQQTaaCAAaAGCQQGAAATCTCCTAGGAaAAGAGCTGCA 1344 SMONNSKF TCCATQQACAACAACAOTAAATT' 464 1428 AQOSPQSOFSKWPASPQSHSNDDFONWS 492 GCTQGQGACAOCCCTGOATCACAOTTTTCCAAATOOCCTOCAAQCCCTGGCTCTCACAGCAATGATGACTTTQATAACTGOAGT 1512 TFRPRT3SNASTISORLSPIMTEQDDLG 520 ACATTTCaCCCTCGAACTAOCTCAAATQCTAGTACTATTAQTGGGAGACTCTCACCCATTATGACCGAACAOGATGATCTTGGA 1596 EOOVHSMVYPPSAAKMASTLPSLSE l SN 546 GAAQQOOATGTGCATTCTATOGTGTACCCQCCATCTGCCOCAAAGATGQCCTCTACTTTACCCAGTCTGTCTGAGATAAQCAAT
Load more

Recommended publications
  • Perspectives
    Copyright 0 1994 by the Genetics Society of America Perspectives Anecdotal, Historical and Critical Commentaries on Genetics Edited by James F. Crow and William F. Dove A Century of Homeosis, A Decade of Homeoboxes William McGinnis Department of Molecular Biophysics and Biochemistry, Yale University, New Haven, Connecticut 06520-8114 NE hundred years ago, while the science of genet- ing mammals, and were proposed to encode DNA- 0 ics still existed only in the yellowing reprints of a binding homeodomainsbecause of a faint resemblance recently deceased Moravian abbot, WILLIAMBATESON to mating-type transcriptional regulatory proteins of (1894) coined the term homeosis to define a class of budding yeast and an even fainter resemblance to bac- biological variations in whichone elementof a segmen- terial helix-turn-helix transcriptional regulators. tally repeated array of organismal structures is trans- The initial stream of papers was a prelude to a flood formed toward the identity of another. After the redis- concerning homeobox genes and homeodomain pro- coveryof MENDEL’Sgenetic principles, BATESONand teins, a flood that has channeled into a steady river of others (reviewed in BATESON1909) realized that some homeo-publications, fed by many tributaries. A major examples of homeosis in floral organs and animal skel- reason for the continuing flow of studies is that many etons could be attributed to variation in genes. Soon groups, working on disparate lines of research, have thereafter, as the discipline of Drosophila genetics was found themselves swept up in the currents when they born and was evolving into a formidable intellectual found that their favorite protein contained one of the force enriching many biologicalsubjects, it gradually be- many subtypes of homeodomain.
    [Show full text]
  • REVIEW Cell and Molecular Biology of Notch
    459 REVIEW Cell and molecular biology of Notch Ulla-Maj Fiu´za and Alfonso Martinez Arias Department of Genetics, University of Cambridge, Cambridge CB2 3EH, UK (Correspondence should be addressed to U-M Fiu´za; Email: [email protected]) Abstract Notch signalling is a cell–cell communication process, which complexity which could account for the multitude of roles it has allows the establishment of patterns of gene expression and during development and in adult organisms. In this review, we differentiation, regulates binary cell fate choice and the will describe the multiple roles of Notch and how various factors maintenance of stem cell populations. So far, the data published can regulate Notch signalling. has elucidated the main players in the Notch signalling pathway. Journal of Endocrinology (2007) 194, 459–474 However, its regulatory mechanisms are exhibiting an increasing The structure of Notch and the Notch signalling which allowed the discovery of a core set of molecules involved pathway in Notch signalling and lead to the understanding of how they organize into a signalling pathway. The Notch genes encode members of a family of receptors that In mammals, there are four Notch genes and five genes mediate short-range signalling events. A prototypical Notch encoding ligands, three Delta-like and two Jagged (Fig. 1). In gene encodes a single transmembrane receptor composed in Drosophila, there is only one Notch-encoding gene, one Delta its extracellular region of a conserved array of up to 36 and one Jagged homologue (Serrate; Maine et al. 1995, epidermal growth factor (EGF)-like repeats, involved in Lissemore & Starmer 1999).
    [Show full text]
  • Epigenetics of Floral Homeotic Genes in Relation to Sexual Dimorphism in the 2 Dioecious Plant Mercurialis Annua
    bioRxiv preprint doi: https://doi.org/10.1101/481481; this version posted November 29, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Epigenetics of floral homeotic genes in relation to sexual dimorphism in the 2 dioecious plant Mercurialis annua 3 4 Janardan Khadka1, Narendra Singh Yadav1†, Micha Guy1, Gideon Grafi1* and Avi Golan- 5 Goldhirsh1* 6 1French Associates Institute for Agriculture and Biotechnology of Drylands, Jacob Blaustein 7 Institutes for Desert Research, Ben-Gurion University of the Negev, Midreshet Ben Gurion 8 84990, Israel. 9 †Present address: Department of Biological Sciences, University of Lethbridge, AB T1K 10 3M4, Canada. 11 * To whom correspondence should be addressed 12 13 14 Highlights 15 Sex determination in Mercurialis annua is not related to epigenetics of floral homeotic genes 16 but appears to be modulated by an unknown gender-specific regulator(s) that affects hormonal 17 homeostasis. 18 1 bioRxiv preprint doi: https://doi.org/10.1101/481481; this version posted November 29, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 19 Abstract 20 In plants, dioecy characterizes species carrying male and female flowers on separate plants 21 and occurs in about 6% of angiosperms. To date, the molecular mechanism(s) underlying 22 sexual dimorphism is essentially unknown. The ability of gender-reversal by hormone 23 application suggests that epigenetics might play an important role in sexual dimorphism.
    [Show full text]
  • Homeotic Gene Action in Embryonic Brain Development of Drosophila
    Development 125, 1579-1589 (1998) 1579 Printed in Great Britain © The Company of Biologists Limited 1998 DEV1254 Homeotic gene action in embryonic brain development of Drosophila Frank Hirth, Beate Hartmann and Heinrich Reichert* Institute of Zoology, University of Basel, Rheinsprung 9, CH-4051 Basel, Switzerland *Author for correspondence (e-mail: [email protected]) Accepted 18 February; published on WWW 1 April 1998 SUMMARY Studies in vertebrates show that homeotic genes are absence of labial, mutant cells are generated and positioned involved in axial patterning and in specifying segmental correctly in the brain, but these cells do not extend axons. identity of the embryonic hindbrain and spinal cord. To Additionally, extending axons of neighboring wild-type gain further insights into homeotic gene action during CNS neurons stop at the mutant domains or project ectopically, development, we here characterize the role of the homeotic and defective commissural and longitudinal pathways genes in embryonic brain development of Drosophila. We result. Immunocytochemical analysis demonstrates that first use neuroanatomical techniques to map the entire cells in the mutant domains do not express neuronal anteroposterior order of homeotic gene expression in the markers, indicating a complete lack of neuronal identity. Drosophila CNS, and demonstrate that this order is An alternative glial identity is not adopted by these mutant virtually identical in the CNS of Drosophila and mammals. cells. Comparable effects are seen in Deformed mutants but We then carry out a genetic analysis of the labial gene in not in other homeotic gene mutants. Our findings embryonic brain development. Our analysis shows that demonstrate that the action of the homeotic genes labial loss-of-function mutation and ubiquitous overexpression of and Deformed are required for neuronal differentiation in labial results in ectopic expression of neighboring the developing brain of Drosophila.
    [Show full text]
  • Homeotic Transformations and Limb Defects in Hox All Mutant Mice
    Downloaded from genesdev.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press Homeotic transformations and limb defects in Hox All mutant mice Kersten M. Small and S. Steven Potter ~ Division of Basic Science Research, Children's Hospital Research Foundation, Cincinnati, Ohio 45229 USA Hox All is one of the expanded set of vertebrate homeo box (Hox) genes with similarities to the Drosophila homeotic gene, Abdominal-B (Abd-B). These Abd-B-type Hox genes have been shown to be expressed in the most caudal regions of the developing vertebrate embryo and in overlapping domains within the developing limbs, suggesting that these genes play important roles in pattern formation in both appendicular and axial regions of the body. In this report whole-mount in situ hybridization in mouse embryos gave a precise description of Hox All gene expression in the developing limbs and in the axial domain of the developing body. In addition, we generated a targeted mutation in Hox All and characterized the resulting phenotype to begin to dissect developmental functions of the Abd-B subfamily of Hox genes. Hox All mutant mice exhibited double homeotic transformations, with the thirteenth thoracic segment posteriorized to form an additional first lumbar vertebra and with the sacral region anteriorized, generating yet another lumbar segment. Furthermore, skeletal malformations were observed in both forelimbs and hindlimbs. In mutant forelimbs, the ulna and radius were misshapen, the pisiform and triangular carpal bones were fused, and abnormal sesamoid bone development occurred. In mutant hindlimbs the tibia and fibula were joined incorrectly and malformed at their distal ends.
    [Show full text]
  • Evolutionary Developmental Biology Gene Regulation in Fruit Flies
    Evolutionary Developmental Gene regulation in fruit flies Biology • Maternal effect genes, which are genes in the mother’s genome for RNAs that are pumped into each egg cell, regulate. • gap genes, which determine large areas of the embryo, and which regulate. • pair-rule genes, which are expressed in alternating bands and specify the future segments of the embryo, and which regulate. • homeotic genes, which determine segment identity, and EVO DEVO which regulate. • realisator genes, which cause segment differentiation a.k.a. “EVO-DEVO” Drosophila egg, showing the location of the maternal Maternal genes mRNA bicoid (top) and the localization of the bicoid regulate gap genes; for protein, forming a gradient from the future head end example, bicoid (top) to the tail end regulates hunchback (middle, shown in orange) and Krüppel (middle, shown in green). Gap genes regulate pair-rule genes such as fushi tarazu (bottom). Both gap and pair-rule genes regulate homeotic genes. 1 Early-stage Drosophila embryo, stained to show the expression patterns of the pair-rule genes even- skipped (dark blue) and fushi tarazu (brown). Pair- rule genes regulate segment-polarity genes (which I Just a part of the ain’t getting’ into here) and homeotic genes. gene regulatory cascade, and we haven’t even got to the homeotic genes yet. Homeotic Genes Computer model of • Homeotic genes contain a 180-bp sequence the Ubx protein called a homeobox that codes for the DNA- (shown in gray) binding part of the protein (the homeodomain). binding to DNA (shown in orange). • Homeotic genes lay down segment identity This helix-turn-helix – As such, homeotic genes determine the placement protein interacts with of major structures RNA polymerase II to – For example: the homeotic gene Ultrabithorax, or control the expression Ubx, regulates a set of a dozen genes that of other genes.
    [Show full text]
  • Ultrabithorax Is Essential for Bacteriocyte Development
    Ultrabithorax is essential for bacteriocyte development Yu Matsuuraa,b,c, Yoshitomo Kikuchid, Toru Miurab, and Takema Fukatsua,c,1 aBioproduction Research Institute, National Institute of Advanced Industrial Science and Technology, Tsukuba 305-8566, Japan; bGraduate School of Environmental Science, Hokkaido University, Sapporo 060-0810, Japan; cGraduate School of Life and Environmental Sciences, University of Tsukuba, Tsukuba 305-8572, Japan; and dBioproduction Research Institute, National Institute of Advanced Industrial Science and Technology, Hokkaido Center, Sapporo 062-8517, Japan Edited by Nancy A. Moran, University of Texas at Austin, Austin, TX, and approved June 19, 2015 (received for review February 18, 2015) Symbiosis often entails the emergence of novel adaptive traits in transcription factors, in particular Ultrabithorax (Ubx), are involved organisms. Microbial symbionts are indispensable for diverse insects in the development of the host cells and organs specialized for via provisioning of essential nutrients, wherein novel host cells and harboring the symbiotic bacteria. organs for harboring the microbes, called bacteriocytes and bacter- iomes, have evolved repeatedly. Molecular and developmental mech- Results and Discussion anisms underpinning the emergence of novel symbiotic cells and Bacteriocyte Development During Embryogenesis of N. plebeius. We organs comprise an unsolved question in evolutionary developmental performed a detailed description of the embryogenesis of N. ple- biology. Here, we report that a conserved
    [Show full text]
  • Homeobox Genes and Their Functional Significance in Ovarian Tumorigenesis
    10 Homeobox Genes and Their Functional Significance in Ovarian Tumorigenesis Bon Quy Trinh and Honami Naora University of Texas MD Anderson Cancer Center USA 1. Introduction It is widely recognized that many pathways that control normal embryonic patterning are deregulated in human cancers. Mutations or aberrant expression of components of the Wnt, Hedgehog and Notch signaling pathways have been demonstrated to play pivotal roles in tumorigenesis. Homeobox genes constitute an evolutionarily conserved gene super-family that represents another important class of patterning regulators. These genes encode transcription factors that are essential for controlling cell differentiation and specification of the body plan during embryonic development. Although many homeobox genes have been reported to be aberrantly expressed in ovarian cancer, the functional significance of these genes in ovarian tumorigenesis has only emerged in recent years. This chapter discusses recent research studies that demonstrate that homeobox genes have diverse functions in the biology of ovarian cancer. These functions include specifying patterns of histologic differentiation of ovarian cancers, controlling growth and survival of tumor cells, and promoting tumor angiogenesis, cell-cell interactions and tumor cell invasiveness. This chapter discusses how studies of homeobox genes provide insights into our understanding of the cell-of-origin of ovarian cancers, the striking morphologic heterogeneity of these tumors, and the unique clinical behavior of ovarian cancer. 2. Overview of homeobox genes Homeobox genes were first discovered in Drosophila by their mutations that caused homeotic transformation, a phenomenon in which body segments form in inappropriate locations (Gehring & Hiromi, 1986; McGinnis & Krumlauf, 1992). A classic example of a homeotic transformation in Drosophila is the formation of legs rather than antennae caused by ectopic expression of the Antennapedia gene (Schneuwly et al., 1987).
    [Show full text]
  • “Indeed, the Homeobox Has Been Called the 'Rosetta Stone' Of
    “Indeed, the Homeobox has been called the ‘Rosetta Stone’ of Developmental Biology” “Indeed, the Homeobox has been called the ‘Rosetta Stone’ of Developmental Biology” The Rosetta Stone - discovered in 1799 by the French under Napoleon, surrendered to the British. Now resides in London in the British Museum. Contains a proclamation in Greek and Egyptian (hiero- glyphics and demotic) from the Ptolemeic era (196 BC). Figure 9.28 Homeotic Gene Expression in Drosophila 1 Gene Duplication as an evolutionary mechanism Hox1 Duplication Event Hox1 Hox1 Duplicate evolves new function Hox1 Hox2 Repeated duplication, divergence Hox1.1 Hox1.2 Hox2.1 Hox2.2 Hox3 Hox4 A homeotic gene complex (HOM-C ) was present in the ancestor of all animals, patterning the anterior-posterior axis. Gene Duplication as an evolutionary mechanism species 1 Hox Gene duplication, divergence species 1 Paralogs Hoxα Hoxβ Speciation event species 2 species 3 Hoxα Hoxβ Hoxα Hoxβ Orthologs Gene evolutionary relationships Paralogs Homologs - share a common ancestor Paralogs - arise by gene duplication event Orthologs - arise by speciation event HOM-C Complex Duplication occurred in vertebrate evolution Single HOM-C in Hox1 Hox2 Hox3 Hox4 Hox5 Hox6 pre-vertebrate chordate Whole chromosome or whole genome duplication (WGD) event Hox1 Hox2 Hox3 Hox4 Hox5 Hox6 Hox1 Hox2 Hox3 Hox4 Hox5 Hox6 Divergence of HOM-C’s: gene loss, duplication, etc. HoxA HoxA1 HoxA2 HoxA3 HoxA4 HoxA6 HoxB HoxB1 HoxB3 HoxB4 HoxB5 HoxB6 HoxB6 HoxB6 Most vertebrates have four HOM-C’s; teleost fish have up to
    [Show full text]
  • A Homeotic Gene of the Antennapedia Complex
    Development 113, 257-271 (1991) 257 Printed in Great Britain © The Company of Biologists Limited 1991 Rescue and regulation of proboscipedia: a homeotic gene of the Antennapedia Complex FILIPPO M. RANDAZZO, DAVID L. CRIBBS* and THOMAS C. KAUFMAN Howard Hughes Medical Institute, Institute for Cellular and Molecular Biology, and Programs in Genetics and Cellular, Molecular, and Developmental Biology, Department of Biology, Indiana University, Bloomington, Indiana, U.S.A. * Present address: Centre de Recherche de Biochimie et Genetique Cellulaires, 118, route de Narbonne 31062 Toulouse Cedex, France Summary The extraordinary positional conservation of the hom- minigene expresses pb protein in only a subset of pb's eotic genes within the Antennapedia and the Bithorax normal domains of expression. Therefore, the biological Complexes (ANT-C and BX-C) in Drosophila melanogas- significance of the excluded expression pattern elements ter and the murine Hox and human HOX clusters of remains unclear except to note they appear unnecessary genes can be interpreted as a reflection of functional for specifying normal labial identity. Additionally, by necessity. The homeotic gene proboscipedia (pb) resides using reporter gene constructs inserted into the Dros- within the ANT-C, and its sequence is related to that of ophila genome and by comparing /^-associated genomic Hox-1.5. We show that two independent pb minigene sequences from two divergent species, we have located P-element insertion lines completely rescue the labial m-acting regulatory elements required for pb expression palp-to-first leg homeotic transformation caused by pb in embryos and larvae. null mutations; thus, a homeotic gene of the ANT-C can properly carry out its homeotic function outside of the Key words: proboscipedia, homeotic gene, Antennapedia complex.
    [Show full text]
  • Homeobox Genes in Mammary Gland Development and Neoplasia Michael T Lewis University of Colorado Health Sciences Center, Denver, Colorado, USA
    http://breast-cancer-research.com/content/2/3/158 Review Homeobox genes in mammary gland development and neoplasia Michael T Lewis University of Colorado Health Sciences Center, Denver, Colorado, USA Received: 2 December 1999 Breast Cancer Res 2000, 2:158–169 Revisions requested: 12 January 2000 The electronic version of this article can be found online at Revisions received: 25 January 2000 http://breast-cancer-research.com/content/2/3/158 Accepted: 4 February 2000 Published: 25 February 2000 © Current Science Ltd Abstract Both normal development and neoplastic progression involve cellular transitions from one physiological state to another. Whereas much is being discovered about signal transduction networks involved in regulating these transitions, little progress has been made in identifying the higher order genetic determinants that establish and maintain mammary cell identity and dictate cell type-specific responses to mammotropic signals. Homeobox genes are a large superfamily of genes whose members function in establishing and maintaining cell fate and cell identity throughout embryonic development. Recent genetic and expression analyses strongly suggest that homeobox genes may perform similar functions at specific developmental transition points in the mammary gland. These analyses also suggest that homeobox genes may play a contributory or causal role in breast cancer. Keywords: breast cancer, embryogenesis, homeodomain, HOX genes, organogenesis Introduction higher order genetic determinants of cell identity that The mammary gland is a remarkable organ with respect to dictate cell type specific responses are largely unknown. its development and functional differentiation. It is also remarkable with respect to the consequences on mam- Among other candidates, one superfamily of genes pre- malian life should development become abnormal, leading sents itself as capable of regulating developmental deci- either to lactational failure or, most importantly, mammary sions during these transitions: the homeobox genes.
    [Show full text]
  • 05 Biological 43-3 Frias
    Biol Res 43: 299-306, 2010 FRÍAS Biol Res 43, 2010, 299-306 B299R Omissions in the synthetic theory of evolution Daniel Frías L. Instituto de Entomología, Universidad Metropolitana de Ciencias de la Educación, Código Postal 7760197, Santiago. Chile, E-mail: [email protected] ABSTRACT The Synthetic Theory of Evolution is the most unifying theory of life science. This theory has dominated scientific thought in explaining the mechanisms involved in speciation. However, there are some omissions that have delayed the understanding of some aspects of the mechanisms of organic evolution, principally: 1) the bridge between somatic and germinal cells, especially in some phylum of invertebrates and vertebrates; 2) horizontal genetic transferences and the importance of viruses in host adaptation and evolution; 3) the role of non-coding DNA and non-transcriptional genes; 4) homeotic evolution and the limitations of gradual evolution; and 5) excessive emphasis on extrinsic barriers to animal speciation. This paper reviews each of these topics in an effort to contribute to a better comprehension of organic evolution. Molecular findings suggest the need for a new evolutionary synthesis. Key terms: Evolution, non-transcriptional genes, viruses, homeosis, epigenesis, imprinting, neo-Lamarckism, sympatric speciation. INTRODUCTION The goal of this article is to discuss these topics to contribute to a better understanding of the mechanisms The synthetic theory of evolution is considered the most involved in organic evolution. unifying theory of life science. This theory is mainly based on neo-Darwinism, particularly on Mendelism, population The absence of a bridge between somatic and germinal cells in some genetics, mutations, natural selection, gradualism, and the phylum of invertebrates and the heredity of somatoclonal variation central dogma of molecular biology.
    [Show full text]