Fusion of PAX3 to a Member of the Forkhead Family of Transcription Factors in Human Alveolar Rhabdomyosarcoma1

[CANCER RESEARCH 53, 5108-5112. November 1. 1993]

Advances in Brief

David N. Shapiro,2 Jack E. Sublett, Baitao Li, James R. Downing, and Clayton W. Naeve

Departments of Experimental Oncology /I). N. S., J. E. S., B. L.Â¡.Hcmatology/Oncology Â¡D.N. S./, Pathology [J. R. D.Â¡, Tumor Cell Biology /J. R. D./, anil Virology and Molecular Biology fC. W. N.Â¡,St. Jude Children's Research Hospital. Memphis. Tennessee 38105, and Departments of Pediatrics [D. N. S.Â¡and Pathology /./. R. D.. C. W. N.J, University of Tennessee College of Medicine. Memphis. Tennessee 38163

Abstract alveolar rhabdomyosarcoma and show that this rearrangement results in the creation of a chimeric fusion gene composed of 5' PAX3 Alveolar rhabdomyosarcoma, a malignant tumor of skeletal muscle, is sequences juxtaposed to 3' sequences derived from a previously uncharacterized by a chromosomal translocation, t(2;13)(q35;ql4). This described member of the forkhead family of transcription factors, translocation Is associated with a structural rearrangement of the gene provisionally designated ALV (7). In PAX3-ALV, the putative 3' tran encoding /' 1 \ Â¡.a presumed transcriptional regulator expressed exclu sively during embryogenesis. The breakpoint results in a fusion between scriptional activation domain of PAX3 is replaced by the bisected PAX3 and a gene provisionally named ALV, a novel member of the fork- forkhead binding domain of ALV, while retaining the structural integ head family of transcription factors. In PAX3-ALV, the structural integrity rity of the PAX3 paired box and homeodomain. Thus the chimeric of both /' l \ i DNA-binding regions, the paired box and homeodomain, are protein product of this translocation has the potential to promote retained while the putative transcriptional activation domain of PAXÃŒis tumorigenesis by acting as an aberrant transcription factor, consistent replaced by the bisected forkhead DNA-binding domain of ALV. Forma with the molecular abnormalities in other solid tumor and several tion of chimeric transcription factors has now been implicated in diverse leukemia-associated rearrangements. human tumors of myogenic, hematopoietic, neuroectodermal, and adipo- cytic origin, suggesting that transcriptional deregulation is a common Materials and Methods mechanism of tumorigenesis. Cell Lines. Alveolar rhabdomyosarcoma cell lines containing the (2;13) Introduction translocation are RH3, RH4, RH5, RH18, RH28, and RH30. Some have Malignant transformation occurs because of the accumulation of previously been reported as case 5 (RH3), case 11 (RH4), case 3 (RH18), case 4 (RH28), and case 13 (RH30) (8). Control cell lines without this tumor- somatic mutations, often made apparent cytogenetically by the acqui sition of tumor-specific chromosomal translocations. Two frequent specific translocation include the embryonal rhabdomyosarcoma cell RH1 [previously referred to as BG (9)] as well as the Ewing sarcoma cell line EWS consequences of these chromosomal events, which have been most 3. All cell lines were grown in RPMI 1640 supplemented with 10% fetal calf thoroughly studied in hematopoietic malignancies, are oncogene ac serum and 50 /xg/ml gentamicin. tivation or the creation of a novel oncogenic fusion protein. There is RNA Analysis. Total cellular RNA was isolated from the indicated cells less information available regarding the genes involved in specific and fractionated in a 1% agarose-formaldehyde gel. After electrophoresis, the translocations of solid tumors. This situation results in part from the RNA was transferred to Duralon-UV nylon filters (Stratagene, La Jolla, CA), technically more challenging task of obtaining conventional cytoge- UV-cross-linked, and sequentially hybridized to ^-P-labeled probes as de netic analyses from these neoplasms. Nevertheless, recurrent chromo scribed in Fig. 1. Autoradiography was for 96 h (Fig. \A) or 48 h (Fig. IÃŸ)at -70Â°C. The size of mRNA was estimated using a RNA ladder (GIBCO BRL, somal translocations have been observed in some solid tumors, par Gaithersburg. MD). ticularly sarcomas. Recently, the translocation breakpoints in both cDNA Cloning. Separate Agt22AcDNA1 libraries were prepared with 2 /ng Ewing sarcoma and myxoid liposarcoma have been molecularly de of polyadenylated mRNA from the RH18 and RH30 alveolar rhabdomyosar fined and chimeric fusion genes with the properties of transcriptional coma cell lines using oligodeoxythymidylale primers with a GIBCO BRL regulators have been identified in each case (1, 2). Superscript cDNA synthesis kit. Sized and adapted inserts were directionally The molecular basis of the t(2;13)(q35;ql4) in alveolar rhabdomyo- cloned in the Ã€vector with a Sail adapter. Libraries were screened with a sarcoma, a malignant tumor derived from skeletal muscle precursors, full-length murine Pax-3 cDNA probe under conditions of normal stringency. has been shown to consistently involve a rearrangement of the 5' Positive A clones were plaque purified and the inserts were cloned into Noti/ portion of the PAX3 gene on chromosome 2q35 (3). These studies .SV;/I-digcsted pBlucscripl SK+ (Stratagene). demonstrated that both regions of the PAX3 gene with DNA-binding Inserts from positive clones from both cell lines were subcloned into activity, the paired box and the paired-type homeodomain, are juxta M13mpl8 and cycle sequencing reactions performed using Prism chemistry posed to previously uncharacterized sequences on chromosome 13ql4 (Applied Biosystems. Inc., Foster City, CA) and protocols recommended by the manufacturer. Samples were electrophoresed, detected, and analyzed on an (4). The involvement of PAX3 in the t(2;13) is of interest not only AB1 373 DNA sequencer. Analysis of the completed consensus nucleic acid because of its role as a presumed transcriptional regulator during early and peptide sequences was performed using the Intelligenetics and GCG soft neuromuscular differentiation but also in the context of the recently ware packages as well as BLAST algorithms. ALV cDNA clones were also demonstrated oncogenic potential of several murine Pax genes, in isolated from a cell line without the t(2;13) by screening the UOCB-1 pre-B cluding Pax-3 (5, 6). We now describe an analysis of the t(2;13) in cell ALL cDNA library in AZAP. Rescued phagemid DNA containing ALV inserts was subcloned into M13 prior to sequencing. Received 9/29/93; accepted 10/1/93. PCR Analysis. To verify the PAX3-ALV fusion mRNA, amplification was The cosls of publication of this article were defrayed in part by the payment of page carried out with primers corresponding to positions 1137 to 1158 (forward charges. This article must therefore be hereby marked advertisement in accordance with primer) in PAX3 and positions 1474 to 1495 (reverse primer) in ALV in 18 U.S.C. Section 1734 solely to indicate this fact. 1Supported in part by Grant CA-23099 and Cancer Center CORE Grant CA-21765 reactions containing approximately 10 ng of target cDNA. The amplification from the NIH and by the American Lebanese Syrian Associated Charities (ALSAC). 2 To whom requests for reprints should he addressed, at the Department of Experi mental Oncology. St. Jude Children's Research Hospital. 332 North Lauderdale. Mem 1The abbreviations used are: cDNA, complementary DNA; ALL, acute lymphohlas- phis, TN 38105. toid leukemia: PCR. polymerase chain reaction. 51 OS

MTTLAOAVPHMMRPGP 10 CACCTQQATATAATTTCCQAQCQAAQTQCCCCCAQQATQACCACOCTQOCCQQCQCTOTOCCCAOOATQATQCQOCCOQQCCCQ 84

QQNYPRSQFPLEVSTPLQOQRVNQLQQV 44 QQQCAQAACTACCCQCOTAQCQQQTTCCCQCTQQAAQTQTCCACTCCCCTCQOCCAQQQCCQCQTCAACCAQCTCQQCOQCQTT 168

F VEMA G PCV T TTAINQRPLPNHIRHKTCAACQQCAQQCCOCTQCCCAACCACATCCQCCACAAQAI TCQTQQAQATQQCCCH ACCH ACQQC AITCRCOQCCCTQCOTCA1 TC72252 S l R P O A 100 ;ATACOTCCTQOTOCC 336

IGGSKPKOVTTPDVEKKIEEYKRENPGM 128 ATCQQCQQCAQCAAQCCCAAaCAQGTGACAACQCCTQACQTOGAGAAQAAAATTaAGQAATACAAAAGAGAOAACCCGGGCATQ 420

F S W E IRDKLLKDAVCDRNTVPSVSS I SR IM TTCAGCTGGQAAATCCOAQACAAATTACTCAAQQACQCGGTCTGTGATCGAAACACCGTGCCGTCAGTQAGTTCCATCAGCCGC 504

I LRSKFQKGEEEEAOLERKEAEESEKKA 164 ATCCTQAGAAaTAAATTCGGGAAAGGTGAAGAQGAQGAGGCCGACTTGGAQAGQAAGGAGGCAGAGGAAAGCGAGAAGAAQGCC see

DSEPD 212 lACTCTGAACCAGAT 672 LPLKRKORRSRTTFTAEOLEELEHAFER 240 TTACCACTAAAGAQQAAACAQCQCAGAAGCCQAACCACCTTCACAGCAGAACAGCTGGAGGAACTQQAGCGTGCTTTTGAGAGA 766 266 640 296 AACCOCCQTaCAAQATOQAQQAAQCAAGCTQGGGCCAATCAACTGATGGCTTTCAACCATCTCATTCCCGGGGGGTTCCCTCCC 924

TAMPTLPTYQLSETSYQPTSIPQAVSDP 324 ACTOCCATOCCOACCTTQCCAACGTACCAGCTOTCGGAOACCTCTTACCAOCCCACATCTATTCCACAAGCTGTGTCAGATCCC 1008

SSTVHRPOPLPPSTVHOST I PSNPDSSS 362 AQCAQCACCGTTCACAQACCTCAACCQCTTCCTCCAAaCACTGTACACCAAAQCACGATTCCTTCCAACCCAGACAQCAGCTCT 1092

360 1176

NPT l G N G L S P Q SI l HVQ 406 AACCCCACCATTOGCAATOaCCTCTCACCTCAOÂ»NCTACACAQCAAGTTCATTCGTOTGCAQNEGTGK83WWMLNPEQGK3GKSPRRRAA AATTCAATTR COTH CATN AA TLCTOS TCCLHSKF 1260 436 AATÃ¢AAaaAACTGOAAAAAQTTCTTQaTQQATQCTCAATCCAQAaQQTaaCAAaAGCQQGAAATCTCCTAGGAaAAGAGCTGCA 1344

SMONNSKF TCCATQQACAACAACAOTAAATT' 464 1428 AQOSPQSOFSKWPASPQSHSNDDFONWS 492 GCTQGQGACAOCCCTGOATCACAOTTTTCCAAATOOCCTOCAAQCCCTGGCTCTCACAGCAATGATGACTTTQATAACTGOAGT 1512

TFRPRT3SNASTISORLSPIMTEQDDLG 520 ACATTTCaCCCTCGAACTAOCTCAAATQCTAGTACTATTAQTGGGAGACTCTCACCCATTATGACCGAACAOGATGATCTTGGA 1596

EOOVHSMVYPPSAAKMASTLPSLSE l SN 546 GAAQQOOATGTGCATTCTATOGTGTACCCQCCATCTGCCOCAAAGATGQCCTCTACTTTACCCAGTCTGTCTGAGATAAQCAAT 1680

PENMENLLDN SLTVSTOSSP CCCQAAAACATQQAAAATCTTTTQQATAA- 576 Â¡ATTAACTGTTTCGACCCAGTCCTCACCT 1764

QTMMOOTPCYSFAPPNTSLNSPSPNYOK 604 QQCACCATQATQCAQCAGACGCCOTQCTACTCGTTTQCGCCACCAAACACCAGTTTGAATTCACCCAGCCCAAACTACCAAAAA 1646

YTYOOSSMSPLPOMPIOTLODNKSSYGG 632 TATACATATOOCCAATCCAOCATQAGCCCTTTGCCCCAGATGCCTATACAAACACTTCAOOACAATAAOTCOAGTTATQOAGGT 1932

MSOYNCAPOLLKELLTSDSPPHNDIMTP 660 ATGAGTCAaTATAACTOTGCQCCTOQACTCTTGAAGGAQTTGCTGACTTCTGACTCTCCTCCCCATAATGACATTATGACACCA 2016

VDPOVAOPNSRVLGQNVMMGPNSVMSTY 688 OTTQATCCTOaQGTAQCCCAQCCCAACAQCCOGGTTCTQGGCCAGAACQTCATGATGGOCCCTAATTCGGTCATGTCAACCTAT 2100

VN 716 l T T A AC 2184

TPVQ 744 IACACCTGTACAA 2268

VPLPHPMQMSALQOYSSVSSCNGYGHMQ 772 QTOCCTCTQCCCCACCCCATOCAGATGAGTGCCCTGGGOQOCTACTCCTCCQTGAGCAGCTGCAATGGCTATGGCAGAATGGGC 2352

LLHOEKLP3DLDGMFIERLDCOMESI IR 600 CTTCTCCACCAQOAGAAQCTCCCAAGTOACTTGGATQGCATGTTCATTQAGCGCTTAGACTGTQACATGGAATCCATCATTCOQ 2436

NDLMDODTLDFNFONVLPNOSFPHSVKT 828 AATOACCTCATOQATGQAGATACATTGOATTTTAACTTTQACAATGTGTTGCCCAACCAAAGCTTCCCACACAGTGTCAAGACA 2520

TTHSwvso* eso ACQACACATAaCTaQQTQTCAQOCTGAQGGTTAQTGAGCAQQTTACACTTAAAAGTACTTCAGATTGTCTGACAGCAGGAACTG 2604 AQAaAAaCAaTCCAAAaATaTCTTTCACCAACTCCCTTTTAaTTTTCTTGQTTAAAAAAAAAAAACAAAAAAAAAAACCCTCCT 2688 TTTTTCCTTTCaTCAaACTTOQCAGCAAAaACATTTTTCCTOTACAOGATGTTTOCCCAATOTQTOCAGOTTATGTGCTGCTGT 2772 AaATAAaOACTaTOCCATTOaAAATTTCATTACAATOAAOTOCCAAACTCACTACACCATATAATTGCAOAAAAGATTTTCAGA 2856 TCCTOOTOTQCTTTCAAaTTTTOTATATAAOCAGTAQATACAaATTGTATTTOTOTOTGTTTTTGGTTTTTCTAAATATCCAAT 2940 TaQTCCAA88AAAaTTTATACTCTTTTTQTAATACTOTaATGOOCCTCATaTCTTGATAAQTTAAACTTTTOTTTGTACTACCT 3024 OTTTTCTaCaQAACTOACOOATCACAAAOAACTOAATCTCCATTCTOCATCTCCATTOAACAOCCTTOOACCTOTTCACOTTQC 3108 CACAaAATTCACATQAaAACCAAQTAOCCTOTTATCAATCTOCTAAATTAATOOACTTGTTAAACTTTTGGAAAAAAAAO 3192 Fig. 1. Nucleotide sequence and derived prolein sequence of the PAX3-ALV fusion cDNA pALV6.1 cDNA clone pALV6.1 was isolated from the Agt22A cDNA library made from RNA of the RH30 alveolar rhabdomyosarcoma cell line using a full-length murine Pajt-3 cDNA probe. The nucleotide and derived protein sequence (single letter code) are given. Arrows, position of Ihe fusion between PAX3 and ALV. For simplicity, only the core regions of the paired box domain (codon 68 to codon 84) and homeodomain (codon 252 to codon 274) are boxed and are in agreement with previously published partial human PAX3 sequence (10). The conserved signature /MA'octapeptide (HS1DGILS) is located at codon 186-193. The forkhead homology in ALV is boxed and extends from codon 392 to codon 440. The nucleotide sequence of the PAX3-ALV fusion cDNA has been deposited in the GcnBank database (accession no. U02368).

5109

R~fi]0 K R F K[D]E D SliÃ¤NM FEN

S SÃ¤NM FEN ft WO

OSYNMFEN

Q F l S N R F OSOEMFDN

L t V A S E S K L l E 4 fU T A P T u W 1C.Â«SJVJR H N t S L P 6JY KPNLIQA--LKKOP F|S|s A S Q 0 S N S S A|GWK Â» 30K - - - sBK s P|RRR|AA^ Fig. 2. Comparison of the amino acid sequence of the conserved DNA-binding domain of ALV with other human forkhead (FKH) domains and the prototypical Drosophila fkh domain. Any amino acid residue in common with ALV is shaded. Gaps (dashes) have been introduced to maximize homologies. The published forkhead family members are human T-cell leukemia virus enhancer factor (HTI.F), intcrleukin binding factor (ILF), 5-3, H-8, and H-3 (hematopoietic cell-derived forkhead clones), and the Drosophila fkh gene. conditions were 94Â°Cfor 1 min, 60Â°Cfor 2 min, and 72Â°Cfor 3 min repeated those reported for murine Pax-3 (10). (b) A previously undescribed for 40 cycles. The products were separated on agarose gels followed by sequence (ALV) is fused in frame to the 3' end of PAX3 after the codon staining with ethidium bromide and transfer to nylon filters. The specific fusion for Asp391, resulting in a putative fusion protein of 836 amino acids. product was confirmed by hybridization with a 32P-end labeled detection The sequence joined to PAX3 3' of the fusion junction in the chimeric oligonucleotide corresponding to positions 1294 to 1315 of the fusion sequence RNA was confirmed to arise from chromosome 13ql4 both by South (Fig. 1). ern analysis of DNA from a panel of previously characterized human Results X rodent somatic cell hybrids that segregate either the der(2) or der(13) chromosomes and by metaphase fluorescence in situ hybrid PAX3 Is Fused to ALV in t(2;13). The position of the PAX3 ization (9) (data not shown). rearrangement was previously shown to occur within a 20-kilobase A striking feature of ALV was that a portion of the sequence, intron, which results in the predicted retention on chromosome 2q35 beginning at the fusion junction and extending 49 residues toward the of 3' coding sequences containing the putative transcriptional activa carboxyl terminus, was highly related to the forkhead DNA-binding tion domain and fusing 5' coding sequences containing both PAX3 domain (Figs. 1 and 2). This domain was originally described in the DNA-binding motifs to a gene on chromosome 13ql4 (3). The con Drosophila protein forkhead, which developmentally regulates termi sequences of the rearrangement on the PAX3 gene were investigated nal segment morphogenesis (7). The forkhead region of homology has by analyzing a fusion cDNA clone, pALVo.l, isolated by screening a previously been shown to be required for DNA binding of other cDNA library prepared from the RH30 alveolar rhabdomyosarcoma cellular transcription factors including hepatic nuclear factor 3, inter- cell line with a full-length murine Pax-3 cDNA probe (Fig. 1). Several leukin-binding factor, and human T-cell leukemia virus enhanced fac important features of the sequence are apparent, (a) Virtually the tor (reviewed in Ref. 11). The (2; 13) translocation bisects the pre entire 5' half of the predicted protein coding region of PAX3 is dicted ALV DNA-binding domain, retaining the carboxyl-terminal retained in the fusion transcript, including the paired box, the paired- residues of the conserved forkhead domain and the unique ALV car type homeodomain, and signature octapeptide motifs. This nucleic boxyl-terminal region. To determine whether the ALV forkhead ho acid sequence is identical to that previously reported for human PAX3 mology includes the amino-terminal portion of the DNA-binding do and includes translation initiation consensus sequences similar to main, additional ALV clones were isolated from a pre-B ALL cDNA library. ALV was found to contain a complete forkhead consensus

? O on 00 domain similar to those of the other human forkhead proteins (12) ^^-TTCOiFCXJCOin 5 xxxxiii (Fig. 2). Based upon amino acid identity and sequence alignment ujcccccccccccra: within the DNA binding domain, ALV is most closely related to a forkhead homology group containing the Drosophila fkh, slp-1, and slp-2 genes and the rat BF-1 gene (7, 13, 14). PAX3-ALV Fusion in Alveolar Rhabdomyosarcoma. The se quence of the pALVo.l cDNA suggests that the PAX3-ALV chimeric protein is transcribed from the chromosome 2 PAX3 gene and fused to ALV coding sequences on chromosome 13. In order to confirm the specificity of the fusion, reverse transcription-PCR was performed with cDNA from several alveolar rhabdomyosarcoma cell lines con taining the t(2;13), as well as from an embryonal rhabdomyosarcoma and Ewing sarcoma cell lines known to lack this translocation (Fig. 3). Primers were selected based on sequences within the ALV exon 3' of B the junction point and a region of PAX3 exon 5 which is 5' to the breakpoint. Amplification using these primers is predicted to yield a 358-base pair product from the fusion transcript. Utilizing this assay cDNA products of the predicted size were detected in each cell line containing the t(2;13) but not from the RNA of cell lines lacking this translocation. The identical sizes of the PCR products from each of the six alveolar cell lines indicate that similar translocation breakpoints occurred within the same introns of the two genes. This was confirmed Fig. 3. Reverse transcription-PCR to establish the specificity of the PAX3-ALV fusion by cloning and sequencing of the PCR products from RH18 and RH28 junction. A, cDNA prepared from Ewing sarcoma (EWS-3) and embryonal rhabdomyo cDNAs, which were identical at the PAX3-ALVjunction to that of the sarcoma (RH-1) cell lines without t(2;13) as well as six alveolar rhabdomyosarcoma cell lines wilh the translocation (RH-4, RH-3Ãœ,RH-18, RH-28, RH-3, and RH-5). cDNA RH30 pALVo.l cDNA sequence (data not shown). The PCR data thus templates were amplified with two oligomers spanning the breakpoint (see "Materials and suggest that the breakpoints in alveolar rhabdomyosarcoma result Methods"). Waelll-digestcd <)>XI74DNA is included in the last lane as a size marker. In from the consequences of similar RNA splicing events in the fusion ÃŸ,the specificity of the amplified fragment for the translocation junction was confirmed by detection with an oligomer spanning the breakpoint in the fusion transcripts. gene. 5110

PAX3 and ALVmRNA Expression. The dcr(13) alÃeleexpressing Discussion PAX3-ALV is most likely critical in the etiology of alveolar rhabdomyosarcoma because the reciprocal der(2) gene product would lack The characteristic chromosomal abnormality in alveolar rhabdo both the PAX3 paired box, shown previously to be critical for onco- myosarcoma, a malignant tumor of skeletal muscle, is the t(2;13) genesis, as well as the paired-type homeodomain (6). Together the (q35;ql4) (8). PAX3 has been previously shown to be rearranged in paired box and the homeodomain have been implicated in novel this tumor (3). In this study we show that this rearrangement involves coordinate DNA-binding specificity, which is different from that dis the fusion of PAX3 on chromosome 2q35 to a novel member of the played by either domain alone (15). This conclusion is supported by forkhead family of transcription factors on chromosome 13ql4. The analysis of mRN A expressed by alveolar rhabdomyosarcoma cell lines finding of a potential fusion protein created by this translocation with with the t(2:13) (Fig. 4). RH1, an embryonal rhabdomyosarcoma cell properties of a chimeric transcription factor is similar to that observed line lacking the t(2;13), and each of six alveolar rhabdomyosarcoma in other solid tumor rearrangements including Ewing sarcoma and cell lines containing the translocation, expressed the normal 6.6-kilo- myxoid liposarcoma (1, 2). base ALV mRNA transcript, which was detected with a 3' ALV probe The predicted PAX3-ALV protein has an unusual structure. PAX3 containing sequences distal of the breakpoint (Fig. 4A ). In the t(2;13) belongs to the paired box gene family of transcription factors and contains two discrete DNA-binding domains; the paired box and the cell lines this probe also identified a larger message of approximately 7.2 kilobases which is absent in RH1. The 7.2-kilobase message was paired-type homeodomain which display unique coordinate DNA- shown to represent the t(2;13)-derived fusion transcript, because it binding specificity (Fig 1) (4). The importance of the paired box for cohybridized to a probe containing PAX3 sequences 5' to the break the function of PAX proteins is illustrated by several mouse and point only in cell lines with the t(2;13). Consistent with previous human developmental mutations involving deletions or point muta studies there was no detectable expression of the normal 3.3â€”3.6- tions in the paired box (reviewed in Ref. 5). Furthermore, the HI vitro kilobasc PAX3 mRNA in these tumors (3, 4) (Fig. 4B). Moreover, and HI vivo transforming potential of murine Pax genes is dependent there was no evidence of RNA transcripts of the size expected for the on the structural integrity of the paired domain and retention of its reciprocal ALV-PAX3 fusion expressed from the der(2) alÃelewhen DNA-binding capacity (6). Deregulated expression of PAX3-ALV these filters were reprobed with either a 3' murine Pax-3 cDNA probe mRNA by removal of potential PAX3 negative regulatory elements by or a probe derived from ALV sequences 5' of the translocation break the translocation together with retention of the paired box thus sug point (data not shown). The pattern of ALV expression was examined gests a potential mechanism for transformation. in normal fetal and adult tissues, and with the exception of an Ewing The precise contribution of ALV la the PAX3-ALV fusion protein is sarcoma cell line (Fig. 3/4), ALV was present as a single 6.6-kilobase less certain. The recent identification of the avian retroviral qin on transcript in all tissues examined (data not shown). Thus, unlike PAX3 cogene as a forkhead family member suggests that the mammalian the expression of which is temporally and spatially restricted during forkhead genes may also, under certain circumstances, possess trans embryogenesis, ALV is widely expressed in virtually all fetal and adult forming capacity (16). However, based on functional and structural tissues. studies demonstrating the essential nature of the amino terminus of the forkhead domain for DNA binding, it is unlikely that the disrupted carboxyl ALV forkhead domain in the putative fusion protein contrib utes to sequence-specific DNA interactions (11, 17). Alternatively, B ALK could contribute to oncogenic transformation by donating a novel W *- f Ã¯=CMm00 Â°Â° transcriptional activation domain to PAX3, replacing its previously 5lXÂ±xxÂ±x localized carboxyl-terminal activation domain. In this regard, a similar ujcctrccrrirccrr ujrrrrircnrrcccc mechanism of oncogenic transformation has been proposed for the t(l;19) of pre-B-cell ALL, by conversion of PBXI into a strong transcriptional activator through acquisition of the E2A activation domain (18). Consistent with this hypothesis, the carboxyl terminus of ALK contains an acidic domain with a predicted amphipathic a-helical structure, similar to that found in other transcription factors such as 28S AP-1 and JUN (19). In addition, the ALV gene could also contribute an enhancer element or RNA stabilization sequences accounting for the expression of chimeric PAX3-ALV mRNA in cell lines lacking detectable expression of normal PAX3 transcripts from their unrear- ranged chromosome 2 alÃele(20). Regardless of the precise mechanism by which the PAX3-ALV fu sion results in transformation, these findings have important implica tions for the diagnosis and treatment of alveolar rhabdomyosarcoma. 28S The fusion mRNA affords an unique target for the specific and sen sitive detection of this tumor-specific translocation, thereby assisting in both the diagnostic and clinical management of patients with this tumor. Additionally the restricted expression of PAX3 and the unique ness of the fusion junction sequence afford the opportunity for anti- sense- or ribozyme-mediated treatment strategies. Fig. 4. Expression of ALV and PAX3-AI.V in rhabdomyosarcoma cell lines. RNA (20 Hg) was fractionated on agarose gels, blotted on nylon membranes, and sequentially hybridized after confirmation of probe removal with an Al.V probe derived from the 3' Acknowledgments portion of pALVn. 1 (A ) or a probe containing PAX3 sequences derived from the 5' portion of pALVo. 1 proximal to the breakpoint (ÃŸ).Bold arrow, position of the ft.h-kilobase ALV We would like to acknowledge the expert technical assistance of Margaret transcript; upper arrow, position of the 7.2-kilohasc PAX3-AL.V fusion transcript. C Cirtain, Karen Rakestraw, Vance Roe. Deanna Williams. Mary Hulshof, and cthidium-staincd gel demonstrating approximately equal sample loading. Sharon Nooncr as well as the computational support of Patricia Eddy and 5111

Krishna Sankhavaram and secretarial assistance of Nancy Dean. We thank Drs. 10. Hoth, C. F., Milunsky, A., Lipsky, N., Sheffer, R., darren, S. K., and Baldwin, C. T. Thomas Look and Linda Shapiro for critical review of the manuscript and Peter Mutation in the paired domain of the human PAX3 gene cause Klein-Waardenburg Gruss for the kind gift of the murine Pax-3 cDNA clone. syndrome (WS-III) as well as Waardenburg syndrome type I (WS-I). Am. J. Hum. Genet., 52: 455-462, 1993. 11. Brennan, R. G. The winged-helix DNA-binding motif: another helix-turn-helix take References off. Cell, 74: 773-776, 1993. 12. Hromas, R.. Moore, J., Johnston, T., Socha, C., and Klemsz, M. Drosophila forkhead 1. Delattre, O., Zucman, J., Plougastel, B.. Desmaze, C, Melot, T., Peter, M, Kovar, H., homologues are expressed in a lineage-restricted manner in human hematopoietic Joubert. I., de Jong. P., Rouleau, G., et al. Gene fusion with an ETS DNA-binding cells. Blood, 81: 2854-2859, 1993. domain caused by chromosome translocation in human tumours. Nature (Lond.), 359: 13. Grossniklaus, U., Pearson, R. K., and Gehring, W. J. The Drosophila sloppy paired 162-165, 1992. locus encodes two proteins involved in segmentation that show homology to mam 2. Crozat, A.. Aman, P.. Mandahl, N., and Ron. D. Fusion of CHOP to a novel RNA- malian transcription factors. Genes Dev., 6: 1030-1051, 1992. binding protein in human myxoid liposarcoma. Nature (Lond.), 56.?: 640-644, 1993. 14. Tao, W., and Lai, E. Telencephalon-restricted expression of BF-1, a new member of 3. Barr. F. G.. Calili. N.. Holick, J., Biegel, J. A., Rovera, G., and Emanuel, B. S. the HNF-3/fork head gene family, in the developing rat brain. Neuron, 8: 957-966, Rearrangement of the PAX3 paired box gene in the paediatric solid tumour alveolar 1992. rhabdomyosarcoma. Nat. Genet., 3: 113-117, 1993. 15. Treisman, J., Harris, E., and Desplan, C. The paired box encodes a second DNA- 4. Goulding. M. D., Chalepakis, G., Deutsch, U., Erselius, J., and Gruss, P. Pax-3, a binding domain in the paired horneo domain protein. Genes Dev., 5: 594-604, 1991. novel murine DNA binding protein expressed during early neurogenesis. EMBO J.. 16. Li, J., and Vogt, P. K. The retroviral oncogene qin belongs to the transcription factor 10: 1135-1147, 1991. 5. Gruss, P., and Walther, C. Pax in development. Cell, 69: 719-722, 1992. family that includes the homeotic gene fork head. Proc. Nati. Acad. Sci. USA, 90: 4490-4494, 1993. 6. Maulbecker, C. C., and Gruss, P.The oncogenic potential of Pax genes. EMBO J., 12: 17. Clark, K. L., Halay, E. D., Lai, E., and Burley, S. K. Co-crystal structure of the 2361-2367, 1993. HNF-3/fork head DNA-recognition motif resembles histone H5. Nature (Lond.), 364: 7. Weigel, D., JÃ¼rgens,G., Kuttner, F., Seifen, E., and Jackie, H. The homeotic gene fork 412-420, 1993. head encodes a nuclear protein and is expressed in the terminal regions of the Drosophita embryo. Cell. 57: 645-658, 1989. 18. Van Dijk, M. A., Voorhoeve, P. M., and Murre, C. Pbxl is converted into a transcriptional activator upon acquiring the N-terminal region of E2A in pre-B-cell acute 8. Douglass, E. C., Valentine. M., Etcubanas, E., Parham, D., Webber, B. L., Houghton, P. J., Houghton, J. A., and Green, A. A. A specific chromosomal abnormality in lymphoblastoid leukemia. Proc. Nati. Acad. Sci. USA, 90: 6061-6065, 1993. rhabdomyosarcoma. Cytogenet. Cell Genet., 45: 148-155. 1987. 19. Mitchell, P. J., and Tjian, R. Transcriptional regulation in mammalian cells by se 9. Shapiro, D. N., Valentine, M. B., Sublet!, J. E., Sinclair, A. E., Tereba, A. M., Scheffer, quence-specific DNA binding proteins. Science (Washington DC), 245: 371-378, H., Buys, C. H., and Look, A. T Chromosomal sublocalization of the 2:13 translo 1989. 20. Jackson, R. J. Cytoplasmic regulation of mRNA function: the importance of the 3' cation breakpoint in alveolar rhabdomyosarcoma. Genes Chromosomes Cancer. 4: 241-249. 1992. untranslated region. Cell. 74: 9-14, 1993.

5112

Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 1993 American Association for Cancer Research. Fusion of PAX3 to a Member of the Forkhead Family of Transcription Factors in Human Alveolar Rhabdomyosarcoma

David N. Shapiro, Jack E. Sublett, Baitao Li, et al.

Cancer Res 1993;53:5108-5112.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/53/21/5108

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/53/21/5108. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.